>Feature sequence001 214 1131 gene locus_tag LOCUS_00010 214 1131 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_00010 1188 2606 gene locus_tag LOCUS_00020 gene amrB 1188 2606 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_00020 2670 3218 gene locus_tag LOCUS_00030 2670 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3312 4196 gene locus_tag LOCUS_00040 3312 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6093 4138 gene locus_tag LOCUS_00050 6093 4138 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_00050 6983 6120 gene locus_tag LOCUS_00060 6983 6120 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_00060 7428 9122 gene locus_tag LOCUS_00070 gene gspE 7428 9122 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666356.1 protein_id gnl|my_center|LOCUS_00070 9145 10332 gene locus_tag LOCUS_00080 9145 10332 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_00080 10316 10786 gene locus_tag LOCUS_00090 10316 10786 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533579.1 protein_id gnl|my_center|LOCUS_00090 10921 11268 gene locus_tag LOCUS_00100 10921 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11265 11984 gene locus_tag LOCUS_00110 11265 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11981 12895 gene locus_tag LOCUS_00120 11981 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12912 14471 gene locus_tag LOCUS_00130 12912 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14468 15049 gene locus_tag LOCUS_00140 14468 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15416 17818 gene locus_tag LOCUS_00150 gene gspD 15416 17818 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551118.1 protein_id gnl|my_center|LOCUS_00150 18033 19151 gene locus_tag LOCUS_00160 18033 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20713 19193 gene locus_tag LOCUS_00170 20713 19193 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937722.1 protein_id gnl|my_center|LOCUS_00170 21634 20798 gene locus_tag LOCUS_00180 21634 20798 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870318.1 protein_id gnl|my_center|LOCUS_00180 21867 22952 gene locus_tag LOCUS_00190 gene serC 21867 22952 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_00190 23150 24082 gene locus_tag LOCUS_00200 23150 24082 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_00200 24597 24325 gene locus_tag LOCUS_00210 24597 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25496 24594 gene locus_tag LOCUS_00220 25496 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25882 26025 gene locus_tag LOCUS_00230 25882 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26041 26499 gene locus_tag LOCUS_00240 26041 26499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26713 26946 gene locus_tag LOCUS_00250 26713 26946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27704 26970 gene locus_tag LOCUS_00260 27704 26970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_00260 28540 27701 gene locus_tag LOCUS_00270 28540 27701 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_00270 28947 30077 gene locus_tag LOCUS_00280 gene proB 28947 30077 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633899.1 protein_id gnl|my_center|LOCUS_00280 30163 31413 gene locus_tag LOCUS_00290 30163 31413 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_00290 31431 32096 gene locus_tag LOCUS_00300 gene nadD 31431 32096 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_00300 32106 32528 gene locus_tag LOCUS_00310 gene rsfS 32106 32528 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_00310 32541 33980 gene locus_tag LOCUS_00320 32541 33980 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_00320 34146 35573 gene locus_tag LOCUS_00330 34146 35573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36513 35656 gene locus_tag LOCUS_00340 36513 35656 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_00340 36731 40591 gene locus_tag LOCUS_00350 gene hrpA 36731 40591 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214608.1 protein_id gnl|my_center|LOCUS_00350 40588 41469 gene locus_tag LOCUS_00360 40588 41469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41556 41924 gene locus_tag LOCUS_00370 41556 41924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42609 42028 gene locus_tag LOCUS_00380 42609 42028 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_00380 42790 43314 gene locus_tag LOCUS_00390 gene ilvN 42790 43314 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_00390 43368 45041 gene locus_tag LOCUS_00400 43368 45041 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_00400 45183 46625 gene locus_tag LOCUS_00410 gene hpnJ 45183 46625 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_00410 46751 47611 gene locus_tag LOCUS_00420 gene hpnK 46751 47611 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_00420 47611 48057 gene locus_tag LOCUS_00430 47611 48057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48051 48419 gene locus_tag LOCUS_00440 48051 48419 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_00440 48433 49590 gene locus_tag LOCUS_00450 gene hpnI 48433 49590 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_00450 49610 50014 gene locus_tag LOCUS_00460 49610 50014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51004 50099 gene locus_tag LOCUS_00470 51004 50099 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938626.1 protein_id gnl|my_center|LOCUS_00470 53019 51031 gene locus_tag LOCUS_00480 53019 51031 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_00480 53239 53943 gene locus_tag LOCUS_00490 53239 53943 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_00490 53963 55291 gene locus_tag LOCUS_00500 53963 55291 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_00500 55325 56599 gene locus_tag LOCUS_00510 gene vceA 55325 56599 CDS product multidrug efflux MFS transporter adaptor subunit VceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625982.1 protein_id gnl|my_center|LOCUS_00510 56596 58161 gene locus_tag LOCUS_00520 56596 58161 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_00520 58178 59371 gene locus_tag LOCUS_00530 58178 59371 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_00530 59457 59867 gene locus_tag LOCUS_00540 59457 59867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60989 59961 gene locus_tag LOCUS_00550 60989 59961 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_00550 61867 60989 gene locus_tag LOCUS_00560 gene hpnK 61867 60989 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_00560 62155 63561 gene locus_tag LOCUS_00570 62155 63561 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_00570 63578 66361 gene locus_tag LOCUS_00580 63578 66361 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_00580 66362 66985 gene locus_tag LOCUS_00590 66362 66985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 68008 67058 gene locus_tag LOCUS_00600 68008 67058 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_00600 69305 67998 gene locus_tag LOCUS_00610 gene fabF 69305 67998 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_00610 69828 69346 gene locus_tag LOCUS_00620 69828 69346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71084 69798 gene locus_tag LOCUS_00630 gene fabF 71084 69798 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_00630 71688 71122 gene locus_tag LOCUS_00640 71688 71122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 72496 71711 gene locus_tag LOCUS_00650 gene fabL 72496 71711 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_00650 73446 72598 gene locus_tag LOCUS_00660 gene rsmA 73446 72598 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269133.1 protein_id gnl|my_center|LOCUS_00660 74476 73457 gene locus_tag LOCUS_00670 gene tsaD 74476 73457 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_00670 74997 75314 gene locus_tag LOCUS_00680 74997 75314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 75384 77168 gene locus_tag LOCUS_00690 75384 77168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 77649 77945 gene locus_tag LOCUS_00700 77649 77945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77945 79102 gene locus_tag LOCUS_00710 77945 79102 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_00710 >Feature sequence002 <1 795 gene locus_tag LOCUS_00720 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942516.1:vitamin B12-dependent ribonucleotide reductase 1144 1836 gene locus_tag LOCUS_00730 1144 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 2045 2560 gene locus_tag LOCUS_00740 2045 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2557 4740 gene locus_tag LOCUS_00750 2557 4740 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_00750 4785 6161 gene locus_tag LOCUS_00760 4785 6161 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_00760 6755 6168 gene locus_tag LOCUS_00770 6755 6168 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_00770 9745 6755 gene locus_tag LOCUS_00780 9745 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 10107 10742 gene locus_tag LOCUS_00790 10107 10742 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_00790 11394 10825 gene locus_tag LOCUS_00800 gene mug 11394 10825 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_00800 11676 11852 gene locus_tag LOCUS_00810 11676 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11914 12081 gene locus_tag LOCUS_00820 11914 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 12143 12319 gene locus_tag LOCUS_00830 12143 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 13582 12515 gene locus_tag LOCUS_00840 13582 12515 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_00840 14493 13696 gene locus_tag LOCUS_00850 14493 13696 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_00850 14696 15490 gene locus_tag LOCUS_00860 14696 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 16872 15574 gene locus_tag LOCUS_00870 gene larA 16872 15574 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_00870 17951 17019 gene locus_tag LOCUS_00880 17951 17019 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_00880 18235 19761 gene locus_tag LOCUS_00890 18235 19761 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_00890 20042 21310 gene locus_tag LOCUS_00900 20042 21310 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_00900 21390 22247 gene locus_tag LOCUS_00910 21390 22247 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_00910 22250 23215 gene locus_tag LOCUS_00920 22250 23215 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_00920 23212 23949 gene locus_tag LOCUS_00930 23212 23949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_00930 23933 24637 gene locus_tag LOCUS_00940 23933 24637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_00940 24671 25447 gene locus_tag LOCUS_00950 24671 25447 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_00950 26075 25554 gene locus_tag LOCUS_00960 gene purE 26075 25554 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_00960 29282 26292 gene locus_tag LOCUS_00970 29282 26292 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_00970 30008 29460 gene locus_tag LOCUS_00980 30008 29460 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_00980 30473 30099 gene locus_tag LOCUS_00990 30473 30099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 32885 30483 gene locus_tag LOCUS_01000 gene pheT 32885 30483 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_01000 34179 33169 gene locus_tag LOCUS_01010 gene pheS 34179 33169 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_01010 34536 34183 gene locus_tag LOCUS_01020 gene rplT 34536 34183 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_01020 34774 34577 gene locus_tag LOCUS_01030 gene rpmI 34774 34577 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_01030 35501 35010 gene locus_tag LOCUS_01040 gene infC 35501 35010 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_01040 37492 35552 gene locus_tag LOCUS_01050 gene thrS 37492 35552 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_01050 37775 37701 gene locus_tag LOCUS_t00010 37775 37701 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38378 37830 gene locus_tag LOCUS_01060 38378 37830 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_01060 39539 38385 gene locus_tag LOCUS_01070 39539 38385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 39423 39668 gene locus_tag LOCUS_01080 39423 39668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 39874 40122 gene locus_tag LOCUS_01090 39874 40122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 40416 41147 gene locus_tag LOCUS_01100 40416 41147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 41222 42562 gene locus_tag LOCUS_01110 gene miaB 41222 42562 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_01110 42627 43121 gene locus_tag LOCUS_01120 42627 43121 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173741.1 protein_id gnl|my_center|LOCUS_01120 43376 45100 gene locus_tag LOCUS_01130 gene ade 43376 45100 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255393.1 protein_id gnl|my_center|LOCUS_01130 45167 45628 gene locus_tag LOCUS_01140 45167 45628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 47077 45728 gene locus_tag LOCUS_01150 47077 45728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 47271 47960 gene locus_tag LOCUS_01160 47271 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 48579 47974 gene locus_tag LOCUS_01170 48579 47974 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022370.1 protein_id gnl|my_center|LOCUS_01170 49326 48844 gene locus_tag LOCUS_01180 49326 48844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 51240 50506 gene locus_tag LOCUS_01190 51240 50506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 51576 51307 gene locus_tag LOCUS_01200 51576 51307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 52871 51765 gene locus_tag LOCUS_01210 52871 51765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 54246 52921 gene locus_tag LOCUS_01220 54246 52921 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_01220 55436 54555 gene locus_tag LOCUS_01230 55436 54555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 55942 55448 gene locus_tag LOCUS_01240 55942 55448 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_01240 58065 56356 gene locus_tag LOCUS_01250 58065 56356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 59126 58191 gene locus_tag LOCUS_01260 59126 58191 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_01260 61972 59183 gene locus_tag LOCUS_01270 gene ppdK 61972 59183 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_01270 62513 63391 gene locus_tag LOCUS_01280 62513 63391 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_01280 65882 63603 gene locus_tag LOCUS_01290 65882 63603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 66085 67263 gene locus_tag LOCUS_01300 66085 67263 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_01300 67272 68423 gene locus_tag LOCUS_01310 gene nspC 67272 68423 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_01310 69030 68749 gene locus_tag LOCUS_01320 69030 68749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 69605 69189 gene locus_tag LOCUS_01330 69605 69189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 69901 70557 gene locus_tag LOCUS_01340 69901 70557 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_01340 70675 71607 gene locus_tag LOCUS_01350 70675 71607 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence003 1656 3881 gene locus_tag LOCUS_01360 1656 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4062 5192 gene locus_tag LOCUS_01370 gene ald 4062 5192 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_01370 5310 5705 gene locus_tag LOCUS_01380 5310 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5864 6694 gene locus_tag LOCUS_01390 5864 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6714 7379 gene locus_tag LOCUS_01400 6714 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7518 8129 gene locus_tag LOCUS_01410 7518 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8264 9442 gene locus_tag LOCUS_01420 8264 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 11803 9566 gene locus_tag LOCUS_01430 11803 9566 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_01430 12208 13635 gene locus_tag LOCUS_01440 12208 13635 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_01440 13975 13661 gene locus_tag LOCUS_01450 13975 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 14505 14702 gene locus_tag LOCUS_01460 14505 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 14987 17314 gene locus_tag LOCUS_01470 14987 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 17311 18555 gene locus_tag LOCUS_01480 17311 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 18645 20009 gene locus_tag LOCUS_01490 18645 20009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 20166 21245 gene locus_tag LOCUS_01500 20166 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 21360 22232 gene locus_tag LOCUS_01510 21360 22232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 22236 23432 gene locus_tag LOCUS_01520 22236 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 23429 24958 gene locus_tag LOCUS_01530 23429 24958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 24978 26099 gene locus_tag LOCUS_01540 24978 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 26096 27109 gene locus_tag LOCUS_01550 26096 27109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 27124 28263 gene locus_tag LOCUS_01560 27124 28263 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_01560 28260 29384 gene locus_tag LOCUS_01570 28260 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 29384 31249 gene locus_tag LOCUS_01580 gene asnB 29384 31249 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089038.1 protein_id gnl|my_center|LOCUS_01580 31236 33323 gene locus_tag LOCUS_01590 31236 33323 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484340.1 protein_id gnl|my_center|LOCUS_01590 33320 34636 gene locus_tag LOCUS_01600 gene algD 33320 34636 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_01600 34668 35825 gene locus_tag LOCUS_01610 34668 35825 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_01610 35940 37478 gene locus_tag LOCUS_01620 35940 37478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37501 38895 gene locus_tag LOCUS_01630 37501 38895 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_01630 39194 39793 gene locus_tag LOCUS_01640 39194 39793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 42403 40022 gene locus_tag LOCUS_01650 42403 40022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 43571 42396 gene locus_tag LOCUS_01660 43571 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 45308 43647 gene locus_tag LOCUS_01670 45308 43647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 47087 45342 gene locus_tag LOCUS_01680 47087 45342 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859463.1 protein_id gnl|my_center|LOCUS_01680 48753 47455 gene locus_tag LOCUS_01690 48753 47455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 49657 49016 gene locus_tag LOCUS_01700 49657 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 49986 50960 gene locus_tag LOCUS_01710 49986 50960 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_01710 51867 51112 gene locus_tag LOCUS_01720 51867 51112 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940521.1 protein_id gnl|my_center|LOCUS_01720 53747 51888 gene locus_tag LOCUS_01730 53747 51888 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_01730 54265 53759 gene locus_tag LOCUS_01740 54265 53759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 55526 56218 gene locus_tag LOCUS_01750 55526 56218 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_01750 56731 56339 gene locus_tag LOCUS_01760 56731 56339 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_01760 57361 56864 gene locus_tag LOCUS_01770 57361 56864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 58577 57354 gene locus_tag LOCUS_01780 58577 57354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 60850 58577 gene locus_tag LOCUS_01790 60850 58577 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937579.1 protein_id gnl|my_center|LOCUS_01790 64573 61163 gene locus_tag LOCUS_01800 64573 61163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 65730 64588 gene locus_tag LOCUS_01810 65730 64588 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_01810 66184 65762 gene locus_tag LOCUS_01820 66184 65762 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_01820 69094 66209 gene locus_tag LOCUS_01830 69094 66209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 69329 69135 gene locus_tag LOCUS_01840 69329 69135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 >Feature sequence004 1344 364 gene locus_tag LOCUS_01850 1344 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4457 2040 gene locus_tag LOCUS_01860 4457 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5232 5489 gene locus_tag LOCUS_01870 5232 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 5845 6207 gene locus_tag LOCUS_01880 5845 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6272 7456 gene locus_tag LOCUS_01890 6272 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7449 8960 gene locus_tag LOCUS_01900 7449 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9140 10207 gene locus_tag LOCUS_01910 9140 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10330 10253 gene locus_tag LOCUS_t00020 10330 10253 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11212 10451 gene locus_tag LOCUS_01920 11212 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 12007 11213 gene locus_tag LOCUS_01930 gene rsmE 12007 11213 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261219.1 protein_id gnl|my_center|LOCUS_01930 12808 12014 gene locus_tag LOCUS_01940 12808 12014 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_01940 15152 12810 gene locus_tag LOCUS_01950 gene topA 15152 12810 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_01950 16158 15160 gene locus_tag LOCUS_01960 gene dprA 16158 15160 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 16480 17760 gene locus_tag LOCUS_01970 16480 17760 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_01970 17830 18522 gene locus_tag LOCUS_01980 17830 18522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 18742 19602 gene locus_tag LOCUS_01990 gene prmC 18742 19602 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_01990 19605 20855 gene locus_tag LOCUS_02000 gene murA 19605 20855 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_02000 20852 21043 gene locus_tag LOCUS_02010 20852 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 21040 21417 gene locus_tag LOCUS_02020 21040 21417 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_02020 21468 21704 gene locus_tag LOCUS_02030 21468 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 21722 22675 gene locus_tag LOCUS_02040 gene hemC 21722 22675 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_02040 22764 24293 gene locus_tag LOCUS_02050 gene cobA 22764 24293 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_02050 24633 24397 gene locus_tag LOCUS_02060 24633 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 25893 24793 gene locus_tag LOCUS_02070 25893 24793 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251116.1 protein_id gnl|my_center|LOCUS_02070 26442 25897 gene locus_tag LOCUS_02080 26442 25897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 26608 26450 gene locus_tag LOCUS_02090 26608 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 26733 27473 gene locus_tag LOCUS_02100 26733 27473 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_02100 27479 28282 gene locus_tag LOCUS_02110 27479 28282 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942570.1 protein_id gnl|my_center|LOCUS_02110 28895 28299 gene locus_tag LOCUS_02120 gene udg 28895 28299 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_02120 29477 28914 gene locus_tag LOCUS_02130 gene cobO 29477 28914 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192682.1 protein_id gnl|my_center|LOCUS_02130 29808 29530 gene locus_tag LOCUS_02140 29808 29530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 31834 29912 gene locus_tag LOCUS_02150 31834 29912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 33902 31992 gene locus_tag LOCUS_02160 gene dnaK 33902 31992 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02160 34564 34013 gene locus_tag LOCUS_02170 gene grpE 34564 34013 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_02170 35712 34660 gene locus_tag LOCUS_02180 gene hrcA 35712 34660 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_02180 36870 35926 gene locus_tag LOCUS_02190 36870 35926 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_02190 38088 37057 gene locus_tag LOCUS_02200 38088 37057 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_02200 39066 38101 gene locus_tag LOCUS_02210 39066 38101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345583.1 protein_id gnl|my_center|LOCUS_02210 39451 42198 gene locus_tag LOCUS_02220 39451 42198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 42603 44258 gene locus_tag LOCUS_02230 42603 44258 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_02230 44355 45095 gene locus_tag LOCUS_02240 44355 45095 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_02240 45404 46747 gene locus_tag LOCUS_02250 45404 46747 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_02250 47035 47478 gene locus_tag LOCUS_02260 47035 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 47553 48344 gene locus_tag LOCUS_02270 47553 48344 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_02270 48359 49360 gene locus_tag LOCUS_02280 48359 49360 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_02280 49583 49993 gene locus_tag LOCUS_02290 49583 49993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 51784 50048 gene locus_tag LOCUS_02300 51784 50048 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_02300 52416 52679 gene locus_tag LOCUS_02310 52416 52679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence005 1379 111 gene locus_tag LOCUS_02320 1379 111 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_02320 1732 2793 gene locus_tag LOCUS_02330 1732 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2837 4423 gene locus_tag LOCUS_02340 2837 4423 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_02340 4559 5707 gene locus_tag LOCUS_02350 4559 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_02350 6100 5738 gene locus_tag LOCUS_02360 6100 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 7257 6097 gene locus_tag LOCUS_02370 7257 6097 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_02370 8257 7277 gene locus_tag LOCUS_02380 8257 7277 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_02380 8446 11844 gene locus_tag LOCUS_02390 8446 11844 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117884.1 protein_id gnl|my_center|LOCUS_02390 12194 12670 gene locus_tag LOCUS_02400 12194 12670 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530129.1 protein_id gnl|my_center|LOCUS_02400 14022 12790 gene locus_tag LOCUS_02410 14022 12790 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_02410 15287 14019 gene locus_tag LOCUS_02420 15287 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 16248 15280 gene locus_tag LOCUS_02430 16248 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 16664 16245 gene locus_tag LOCUS_02440 16664 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 19248 17065 gene locus_tag LOCUS_02450 19248 17065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 20735 19977 gene locus_tag LOCUS_02460 20735 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 22805 20835 gene locus_tag LOCUS_02470 22805 20835 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_02470 27586 22937 gene locus_tag LOCUS_02480 27586 22937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 29435 27696 gene locus_tag LOCUS_02490 29435 27696 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_02490 30858 30202 gene locus_tag LOCUS_02500 gene fsa 30858 30202 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_02500 31071 30883 gene locus_tag LOCUS_02510 31071 30883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 31070 32233 gene locus_tag LOCUS_02520 31070 32233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 33755 32349 gene locus_tag LOCUS_02530 gene lpdA 33755 32349 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_02530 33928 34371 gene locus_tag LOCUS_02540 33928 34371 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530560.1 protein_id gnl|my_center|LOCUS_02540 34502 34909 gene locus_tag LOCUS_02550 gene gcvH 34502 34909 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_02550 34906 36240 gene locus_tag LOCUS_02560 gene gcvPA 34906 36240 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_02560 36331 37788 gene locus_tag LOCUS_02570 gene gcvPB 36331 37788 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_02570 37896 38675 gene locus_tag LOCUS_02580 gene lipB 37896 38675 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_02580 40180 38762 gene locus_tag LOCUS_02590 40180 38762 CDS product HAD-IG family 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_02590 40371 42923 gene locus_tag LOCUS_02600 40371 42923 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_02600 43791 43006 gene locus_tag LOCUS_02610 43791 43006 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546447.1 protein_id gnl|my_center|LOCUS_02610 44730 47801 gene locus_tag LOCUS_02620 44730 47801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 47932 48135 gene locus_tag LOCUS_02630 47932 48135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02630 48214 48690 gene locus_tag LOCUS_02640 48214 48690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 48779 48970 gene locus_tag LOCUS_02650 48779 48970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02650 49151 51790 gene locus_tag LOCUS_02660 49151 51790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02660 52596 51940 gene locus_tag LOCUS_02670 52596 51940 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence006 1410 706 gene locus_tag LOCUS_02680 1410 706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_02680 3269 1497 gene locus_tag LOCUS_02690 3269 1497 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_02690 3842 3552 gene locus_tag LOCUS_02700 3842 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4288 5691 gene locus_tag LOCUS_02710 4288 5691 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_02710 5702 7240 gene locus_tag LOCUS_02720 5702 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 7244 8215 gene locus_tag LOCUS_02730 gene cbiB 7244 8215 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_02730 8299 9387 gene locus_tag LOCUS_02740 gene cobD 8299 9387 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_02740 9657 9397 gene locus_tag LOCUS_02750 9657 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 12236 10062 gene locus_tag LOCUS_02760 12236 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 12490 12948 gene locus_tag LOCUS_02770 12490 12948 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_02770 13188 13051 gene locus_tag LOCUS_02780 13188 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 13467 13249 gene locus_tag LOCUS_02790 13467 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 14200 13604 gene locus_tag LOCUS_02800 14200 13604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 protein_id gnl|my_center|LOCUS_02800 14942 14205 gene locus_tag LOCUS_02810 gene ubiE 14942 14205 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_02810 15237 15043 gene locus_tag LOCUS_02820 gene rpmB 15237 15043 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_02820 17337 15439 gene locus_tag LOCUS_02830 17337 15439 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942341.1 protein_id gnl|my_center|LOCUS_02830 18130 17324 gene locus_tag LOCUS_02840 18130 17324 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644821.1 protein_id gnl|my_center|LOCUS_02840 19164 18193 gene locus_tag LOCUS_02850 19164 18193 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545673.1 protein_id gnl|my_center|LOCUS_02850 20263 19217 gene locus_tag LOCUS_02860 gene purM 20263 19217 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_02860 20501 21718 gene locus_tag LOCUS_02870 gene mltG 20501 21718 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_02870 21818 22624 gene locus_tag LOCUS_02880 21818 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 22668 23471 gene locus_tag LOCUS_02890 22668 23471 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_02890 24221 23601 gene locus_tag LOCUS_02900 24221 23601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_02900 24753 25286 gene locus_tag LOCUS_02910 24753 25286 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_02910 25331 26362 gene locus_tag LOCUS_02920 gene dsrM 25331 26362 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_02920 26403 28022 gene locus_tag LOCUS_02930 26403 28022 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_02930 28009 28422 gene locus_tag LOCUS_02940 gene dsrJ 28009 28422 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_02940 28422 29201 gene locus_tag LOCUS_02950 28422 29201 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_02950 29212 30369 gene locus_tag LOCUS_02960 gene nrfD 29212 30369 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_02960 30610 31629 gene locus_tag LOCUS_02970 30610 31629 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_02970 31824 32537 gene locus_tag LOCUS_02980 31824 32537 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_02980 32516 33343 gene locus_tag LOCUS_02990 gene ccsB 32516 33343 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_02990 33343 34698 gene locus_tag LOCUS_03000 gene hemA 33343 34698 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_03000 34708 35109 gene locus_tag LOCUS_03010 34708 35109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 35132 35293 gene locus_tag LOCUS_03020 35132 35293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 36046 35579 gene locus_tag LOCUS_03030 36046 35579 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_03030 36222 37049 gene locus_tag LOCUS_03040 36222 37049 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_03040 37042 38718 gene locus_tag LOCUS_03050 37042 38718 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_03050 38806 41007 gene locus_tag LOCUS_03060 38806 41007 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_03060 41020 41763 gene locus_tag LOCUS_03070 41020 41763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 41767 42795 gene locus_tag LOCUS_03080 gene pdxA 41767 42795 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_03080 42867 45437 gene locus_tag LOCUS_03090 gene uvrA 42867 45437 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_03090 45686 46057 gene locus_tag LOCUS_03100 45686 46057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 46127 47722 gene locus_tag LOCUS_03110 gene secD 46127 47722 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_03110 47745 48824 gene locus_tag LOCUS_03120 gene secF 47745 48824 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_03120 49933 48986 gene locus_tag LOCUS_03130 49933 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 50696 50025 gene locus_tag LOCUS_03140 50696 50025 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792434.1 protein_id gnl|my_center|LOCUS_03140 50862 51833 gene locus_tag LOCUS_03150 50862 51833 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence007 887 390 gene locus_tag LOCUS_03160 887 390 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470592.1 protein_id gnl|my_center|LOCUS_03160 1343 1783 gene locus_tag LOCUS_03170 1343 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2288 1935 gene locus_tag LOCUS_03180 2288 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2766 2308 gene locus_tag LOCUS_03190 2766 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3852 3022 gene locus_tag LOCUS_03200 3852 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5394 3883 gene locus_tag LOCUS_03210 5394 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 6071 5391 gene locus_tag LOCUS_03220 6071 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6483 6094 gene locus_tag LOCUS_03230 6483 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 7178 6516 gene locus_tag LOCUS_03240 7178 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9096 7669 gene locus_tag LOCUS_03250 9096 7669 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_03250 12301 9098 gene locus_tag LOCUS_03260 12301 9098 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_03260 13480 12314 gene locus_tag LOCUS_03270 13480 12314 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_03270 14512 14042 gene locus_tag LOCUS_03280 14512 14042 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_03280 14837 16027 gene locus_tag LOCUS_03290 14837 16027 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948280.1 protein_id gnl|my_center|LOCUS_03290 16366 17721 gene locus_tag LOCUS_03300 16366 17721 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791846.1 protein_id gnl|my_center|LOCUS_03300 18621 17722 gene locus_tag LOCUS_03310 18621 17722 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_03310 18764 20422 gene locus_tag LOCUS_03320 18764 20422 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_03320 22106 20499 gene locus_tag LOCUS_03330 22106 20499 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_03330 23994 22489 gene locus_tag LOCUS_03340 23994 22489 CDS product succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816216.1 protein_id gnl|my_center|LOCUS_03340 25533 24019 gene locus_tag LOCUS_03350 25533 24019 CDS product succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816216.1 protein_id gnl|my_center|LOCUS_03350 25950 26171 gene locus_tag LOCUS_03360 25950 26171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 26194 27537 gene locus_tag LOCUS_03370 26194 27537 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294597.1 protein_id gnl|my_center|LOCUS_03370 27616 29142 gene locus_tag LOCUS_03380 27616 29142 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_03380 29263 30513 gene locus_tag LOCUS_03390 29263 30513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_03390 30681 32573 gene locus_tag LOCUS_03400 gene ftsH 30681 32573 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_03400 33082 32690 gene locus_tag LOCUS_03410 33082 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 34404 33523 gene locus_tag LOCUS_03420 34404 33523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_03420 34657 34863 gene locus_tag LOCUS_03430 34657 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 35042 36415 gene locus_tag LOCUS_03440 35042 36415 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_03440 36725 36489 gene locus_tag LOCUS_03450 gene acpP 36725 36489 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_03450 37682 36750 gene locus_tag LOCUS_03460 37682 36750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 38293 37832 gene locus_tag LOCUS_03470 38293 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 39307 38510 gene locus_tag LOCUS_03480 39307 38510 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_03480 39809 40012 gene locus_tag LOCUS_03490 39809 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 40271 41530 gene locus_tag LOCUS_03500 40271 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 41841 44498 gene locus_tag LOCUS_03510 41841 44498 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_03510 44523 45380 gene locus_tag LOCUS_03520 gene nadC 44523 45380 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_03520 45428 45907 gene locus_tag LOCUS_03530 45428 45907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 45963 46706 gene locus_tag LOCUS_03540 45963 46706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 47686 46790 gene locus_tag LOCUS_03550 47686 46790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 47876 49729 gene locus_tag LOCUS_03560 47876 49729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence008 165 794 gene locus_tag LOCUS_03570 165 794 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726800.1 protein_id gnl|my_center|LOCUS_03570 824 1132 gene locus_tag LOCUS_03580 824 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3351 1387 gene locus_tag LOCUS_03590 3351 1387 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_03590 4004 4435 gene locus_tag LOCUS_03600 gene fliS 4004 4435 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 protein_id gnl|my_center|LOCUS_03600 4463 4789 gene locus_tag LOCUS_03610 4463 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6192 4942 gene locus_tag LOCUS_03620 6192 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6801 10688 gene locus_tag LOCUS_03630 6801 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 11687 10761 gene locus_tag LOCUS_03640 11687 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 12000 13922 gene locus_tag LOCUS_03650 12000 13922 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_03650 15646 13955 gene locus_tag LOCUS_03660 15646 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 16148 16471 gene locus_tag LOCUS_03670 16148 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 16502 17110 gene locus_tag LOCUS_03680 gene coaE 16502 17110 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579584.1 protein_id gnl|my_center|LOCUS_03680 17243 17797 gene locus_tag LOCUS_03690 17243 17797 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_03690 17794 18276 gene locus_tag LOCUS_03700 gene greA 17794 18276 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_03700 18376 18975 gene locus_tag LOCUS_03710 gene cobO 18376 18975 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_03710 19613 19017 gene locus_tag LOCUS_03720 19613 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 20540 19635 gene locus_tag LOCUS_03730 20540 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 21628 20615 gene locus_tag LOCUS_03740 gene aroF 21628 20615 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_03740 22268 23533 gene locus_tag LOCUS_03750 22268 23533 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_03750 23776 25377 gene locus_tag LOCUS_03760 gene cimA 23776 25377 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_03760 26034 25393 gene locus_tag LOCUS_03770 26034 25393 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_03770 26159 27322 gene locus_tag LOCUS_03780 gene ftsY 26159 27322 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_03780 28509 27397 gene locus_tag LOCUS_03790 28509 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143805.1 protein_id gnl|my_center|LOCUS_03790 28707 30671 gene locus_tag LOCUS_03800 28707 30671 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_03800 30685 31515 gene locus_tag LOCUS_03810 30685 31515 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939089.1 protein_id gnl|my_center|LOCUS_03810 31885 32178 gene locus_tag LOCUS_03820 31885 32178 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_03820 32269 34110 gene locus_tag LOCUS_03830 gene ptsP 32269 34110 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092157593.1 protein_id gnl|my_center|LOCUS_03830 34116 34598 gene locus_tag LOCUS_03840 gene smpB 34116 34598 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_03840 35370 34681 gene locus_tag LOCUS_03850 35370 34681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 35832 37118 gene locus_tag LOCUS_03860 35832 37118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_03860 37934 37125 gene locus_tag LOCUS_03870 37934 37125 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_03870 38315 38157 gene locus_tag LOCUS_03880 38315 38157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 38253 39713 gene locus_tag LOCUS_03890 gene glpA 38253 39713 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_03890 41254 39953 gene locus_tag LOCUS_03900 gene glpB 41254 39953 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939225.1 protein_id gnl|my_center|LOCUS_03900 43024 41303 gene locus_tag LOCUS_03910 43024 41303 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_03910 44122 43046 gene locus_tag LOCUS_03920 44122 43046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_03920 45389 44262 gene locus_tag LOCUS_03930 45389 44262 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681411.1 protein_id gnl|my_center|LOCUS_03930 45819 47009 gene locus_tag LOCUS_03940 45819 47009 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057410.1 protein_id gnl|my_center|LOCUS_03940 47006 48082 gene locus_tag LOCUS_03950 47006 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 48739 48212 gene locus_tag LOCUS_03960 48739 48212 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_03960 49498 48935 gene locus_tag LOCUS_03970 49498 48935 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence009 1698 625 gene locus_tag LOCUS_03980 1698 625 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_03980 2063 1761 gene locus_tag LOCUS_03990 2063 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2877 2365 gene locus_tag LOCUS_04000 2877 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5341 3119 gene locus_tag LOCUS_04010 5341 3119 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924828.1 protein_id gnl|my_center|LOCUS_04010 5478 6899 gene locus_tag LOCUS_04020 5478 6899 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_04020 7514 7113 gene locus_tag LOCUS_04030 7514 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 8450 7518 gene locus_tag LOCUS_04040 8450 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 8899 8510 gene locus_tag LOCUS_04050 8899 8510 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_04050 10645 8978 gene locus_tag LOCUS_04060 10645 8978 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_04060 11828 10845 gene locus_tag LOCUS_04070 11828 10845 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_04070 13755 11794 gene locus_tag LOCUS_04080 13755 11794 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_04080 14692 13880 gene locus_tag LOCUS_04090 14692 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15468 14701 gene locus_tag LOCUS_04100 15468 14701 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_04100 15866 16423 gene locus_tag LOCUS_04110 15866 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 16533 18869 gene locus_tag LOCUS_04120 16533 18869 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_04120 18882 19637 gene locus_tag LOCUS_04130 18882 19637 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_04130 19696 20940 gene locus_tag LOCUS_04140 gene nrfD 19696 20940 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_04140 21143 21943 gene locus_tag LOCUS_04150 21143 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21962 22447 gene locus_tag LOCUS_04160 21962 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 24098 22386 gene locus_tag LOCUS_04170 gene nadB 24098 22386 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_04170 24270 24947 gene locus_tag LOCUS_04180 24270 24947 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_04180 24944 25690 gene locus_tag LOCUS_04190 24944 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 26099 26476 gene locus_tag LOCUS_04200 26099 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 26547 27257 gene locus_tag LOCUS_04210 26547 27257 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_04210 33162 27403 gene locus_tag LOCUS_04220 33162 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 33429 36095 gene locus_tag LOCUS_04230 gene mutS 33429 36095 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04230 36261 38309 gene locus_tag LOCUS_04240 36261 38309 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_04240 39651 38320 gene locus_tag LOCUS_04250 39651 38320 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941608.1 protein_id gnl|my_center|LOCUS_04250 40048 39710 gene locus_tag LOCUS_04260 40048 39710 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_04260 41200 40373 gene locus_tag LOCUS_04270 41200 40373 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_04270 41511 41344 gene locus_tag LOCUS_04280 41511 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 42518 41508 gene locus_tag LOCUS_04290 gene prfB 42518 41508 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_04290 44165 42639 gene locus_tag LOCUS_04300 gene lnt 44165 42639 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_04300 45080 44250 gene locus_tag LOCUS_04310 45080 44250 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_04310 46126 45200 gene locus_tag LOCUS_04320 gene speB 46126 45200 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_04320 46582 46139 gene locus_tag LOCUS_04330 gene speD 46582 46139 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583767.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence010 1122 166 gene locus_tag LOCUS_04340 gene meaB 1122 166 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_04340 1638 1210 gene locus_tag LOCUS_04350 1638 1210 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_04350 3453 1750 gene locus_tag LOCUS_04360 3453 1750 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_04360 4218 5492 gene locus_tag LOCUS_04370 4218 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6317 5553 gene locus_tag LOCUS_04380 6317 5553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_04380 6612 9533 gene locus_tag LOCUS_04390 6612 9533 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_04390 10147 9530 gene locus_tag LOCUS_04400 10147 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 12390 10300 gene locus_tag LOCUS_04410 gene fusA 12390 10300 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_04410 14690 12771 gene locus_tag LOCUS_04420 14690 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14905 15066 gene locus_tag LOCUS_04430 14905 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 16932 15091 gene locus_tag LOCUS_04440 16932 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 17395 17844 gene locus_tag LOCUS_04450 gene tadA 17395 17844 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_04450 17973 18068 gene locus_tag LOCUS_t00030 17973 18068 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18134 18226 gene locus_tag LOCUS_t00040 18134 18226 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18300 20165 gene locus_tag LOCUS_04460 gene dnaX 18300 20165 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_04460 20279 20605 gene locus_tag LOCUS_04470 20279 20605 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_04470 20612 21211 gene locus_tag LOCUS_04480 gene recR 20612 21211 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_04480 21775 22326 gene locus_tag LOCUS_04490 21775 22326 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_04490 22329 22622 gene locus_tag LOCUS_04500 gene porD 22329 22622 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250932.1 protein_id gnl|my_center|LOCUS_04500 22624 23802 gene locus_tag LOCUS_04510 gene porA 22624 23802 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_04510 23803 24771 gene locus_tag LOCUS_04520 gene porB 23803 24771 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_04520 26422 25013 gene locus_tag LOCUS_04530 gene gltX 26422 25013 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_04530 26737 27240 gene locus_tag LOCUS_04540 26737 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 27549 28103 gene locus_tag LOCUS_04550 27549 28103 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_04550 28186 28368 gene locus_tag LOCUS_04560 gene rpmF 28186 28368 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_04560 28396 29457 gene locus_tag LOCUS_04570 gene plsX 28396 29457 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_04570 29647 30816 gene locus_tag LOCUS_04580 29647 30816 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_04580 31004 31795 gene locus_tag LOCUS_04590 31004 31795 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_04590 31792 32991 gene locus_tag LOCUS_04600 31792 32991 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_04600 33079 33822 gene locus_tag LOCUS_04610 gene fabG 33079 33822 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_04610 33897 35156 gene locus_tag LOCUS_04620 gene fabF 33897 35156 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_04620 35536 36798 gene locus_tag LOCUS_04630 35536 36798 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964195.1 protein_id gnl|my_center|LOCUS_04630 37636 36935 gene locus_tag LOCUS_04640 37636 36935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 37817 39364 gene locus_tag LOCUS_04650 gene hutH 37817 39364 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_04650 39469 41523 gene locus_tag LOCUS_04660 39469 41523 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_04660 41641 42945 gene locus_tag LOCUS_04670 gene hutI 41641 42945 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_04670 44509 43184 gene locus_tag LOCUS_04680 44509 43184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 44889 44692 gene locus_tag LOCUS_04690 44889 44692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 45083 45328 gene locus_tag LOCUS_04700 45083 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 45356 45628 gene locus_tag LOCUS_04710 45356 45628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence011 1975 476 gene locus_tag LOCUS_04720 1975 476 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944040.1 protein_id gnl|my_center|LOCUS_04720 3937 2042 gene locus_tag LOCUS_04730 gene nuoL 3937 2042 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944041.1 protein_id gnl|my_center|LOCUS_04730 4246 3941 gene locus_tag LOCUS_04740 gene nuoK 4246 3941 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944042.1 protein_id gnl|my_center|LOCUS_04740 4761 4243 gene locus_tag LOCUS_04750 4761 4243 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944043.1 protein_id gnl|my_center|LOCUS_04750 5339 4785 gene locus_tag LOCUS_04760 gene nuoI 5339 4785 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944044.1 protein_id gnl|my_center|LOCUS_04760 6333 5341 gene locus_tag LOCUS_04770 gene nuoH 6333 5341 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_04770 8980 6506 gene locus_tag LOCUS_04780 8980 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 10250 8973 gene locus_tag LOCUS_04790 gene nuoF 10250 8973 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944051.1 protein_id gnl|my_center|LOCUS_04790 10745 10254 gene locus_tag LOCUS_04800 gene nuoE 10745 10254 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_04800 13205 10770 gene locus_tag LOCUS_04810 13205 10770 CDS product NADH-quinone oxidoreductase subunit B/C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944054.1 protein_id gnl|my_center|LOCUS_04810 13594 13181 gene locus_tag LOCUS_04820 gene ndhC 13594 13181 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944055.1 protein_id gnl|my_center|LOCUS_04820 13906 14727 gene locus_tag LOCUS_04830 gene thiM 13906 14727 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146833.1 protein_id gnl|my_center|LOCUS_04830 14724 15401 gene locus_tag LOCUS_04840 gene thiE 14724 15401 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_04840 15558 16745 gene locus_tag LOCUS_04850 15558 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 16888 17049 gene locus_tag LOCUS_04860 16888 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 19865 17124 gene locus_tag LOCUS_04870 gene glnE 19865 17124 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_04870 20044 20787 gene locus_tag LOCUS_04880 gene kdsB 20044 20787 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_04880 20966 22147 gene locus_tag LOCUS_04890 gene carA 20966 22147 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_04890 22186 25413 gene locus_tag LOCUS_04900 gene carB 22186 25413 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_04900 25501 26961 gene locus_tag LOCUS_04910 gene purF 25501 26961 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_04910 27119 28954 gene locus_tag LOCUS_04920 27119 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 30254 29124 gene locus_tag LOCUS_04930 30254 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 30681 30298 gene locus_tag LOCUS_04940 gene queD 30681 30298 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020994.1 protein_id gnl|my_center|LOCUS_04940 30919 30992 gene locus_tag LOCUS_t00050 30919 30992 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31389 31676 gene locus_tag LOCUS_04950 31389 31676 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_04950 31701 32831 gene locus_tag LOCUS_04960 31701 32831 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_04960 32838 33641 gene locus_tag LOCUS_04970 32838 33641 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_04970 33642 34634 gene locus_tag LOCUS_04980 33642 34634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 34776 35468 gene locus_tag LOCUS_04990 34776 35468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 36783 35434 gene locus_tag LOCUS_05000 gene dnaA 36783 35434 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_05000 37813 37634 gene locus_tag LOCUS_05010 37813 37634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 39447 38161 gene locus_tag LOCUS_05020 39447 38161 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_05020 40580 39447 gene locus_tag LOCUS_05030 gene lpxB 40580 39447 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_05030 42541 40565 gene locus_tag LOCUS_05040 42541 40565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 43356 42541 gene locus_tag LOCUS_05050 gene lpxA 43356 42541 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence012 1619 2086 gene locus_tag LOCUS_05060 1619 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2864 2676 gene locus_tag LOCUS_05070 2864 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3242 5560 gene locus_tag LOCUS_05080 3242 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5831 9205 gene locus_tag LOCUS_05090 5831 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9219 9647 gene locus_tag LOCUS_05100 9219 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 9668 10798 gene locus_tag LOCUS_05110 9668 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 10809 13907 gene locus_tag LOCUS_05120 10809 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13920 14420 gene locus_tag LOCUS_05130 13920 14420 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878873.1 protein_id gnl|my_center|LOCUS_05130 14695 15432 gene locus_tag LOCUS_05140 14695 15432 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022853557.1 protein_id gnl|my_center|LOCUS_05140 17610 15703 gene locus_tag LOCUS_05150 17610 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 18796 20052 gene locus_tag LOCUS_05160 18796 20052 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_05160 22105 20225 gene locus_tag LOCUS_05170 gene ptsG 22105 20225 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475735.1 protein_id gnl|my_center|LOCUS_05170 24700 22142 gene locus_tag LOCUS_05180 gene ptsP 24700 22142 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918336.1 protein_id gnl|my_center|LOCUS_05180 25642 25124 gene locus_tag LOCUS_05190 25642 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 26392 25682 gene locus_tag LOCUS_05200 26392 25682 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462031.1 protein_id gnl|my_center|LOCUS_05200 26869 26468 gene locus_tag LOCUS_05210 26869 26468 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943588.1 protein_id gnl|my_center|LOCUS_05210 27447 27899 gene locus_tag LOCUS_05220 27447 27899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 27887 29647 gene locus_tag LOCUS_05230 27887 29647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 29693 31054 gene locus_tag LOCUS_05240 gene zraR 29693 31054 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_05240 31308 32831 gene locus_tag LOCUS_05250 gene amrB 31308 32831 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_05250 32884 34026 gene locus_tag LOCUS_05260 gene amrS 32884 34026 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_05260 36337 34109 gene locus_tag LOCUS_05270 36337 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 36315 36563 gene locus_tag LOCUS_05280 36315 36563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 37942 36677 gene locus_tag LOCUS_05290 37942 36677 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_05290 38600 38028 gene locus_tag LOCUS_05300 gene coaD 38600 38028 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_05300 39728 38799 gene locus_tag LOCUS_05310 39728 38799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 41185 39851 gene locus_tag LOCUS_05320 41185 39851 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_05320 41809 41516 gene locus_tag LOCUS_05330 41809 41516 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_05330 <42753 41800 gene locus_tag LOCUS_05340 <42753 41800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461742.1:FAD-dependent oxidoreductase >Feature sequence013 1387 416 gene locus_tag LOCUS_05350 1387 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1785 2789 gene locus_tag LOCUS_05360 1785 2789 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082657.1 protein_id gnl|my_center|LOCUS_05360 3372 2863 gene locus_tag LOCUS_05370 gene tpx 3372 2863 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_05370 5008 3668 gene locus_tag LOCUS_05380 5008 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 6200 5241 gene locus_tag LOCUS_05390 6200 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6670 6278 gene locus_tag LOCUS_05400 6670 6278 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_05400 7193 6807 gene locus_tag LOCUS_05410 gene flaF 7193 6807 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_05410 8146 7232 gene locus_tag LOCUS_05420 8146 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9027 8566 gene locus_tag LOCUS_05430 9027 8566 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_05430 9217 9930 gene locus_tag LOCUS_05440 9217 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9956 10633 gene locus_tag LOCUS_05450 9956 10633 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 protein_id gnl|my_center|LOCUS_05450 11220 10759 gene locus_tag LOCUS_05460 11220 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 11883 12191 gene locus_tag LOCUS_05470 11883 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 12629 12297 gene locus_tag LOCUS_05480 12629 12297 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_05480 13735 12698 gene locus_tag LOCUS_05490 13735 12698 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941966.1 protein_id gnl|my_center|LOCUS_05490 14310 15122 gene locus_tag LOCUS_05500 gene rfbF 14310 15122 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_05500 15231 16739 gene locus_tag LOCUS_05510 15231 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 16739 17344 gene locus_tag LOCUS_05520 16739 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 17354 19150 gene locus_tag LOCUS_05530 17354 19150 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411767.1 protein_id gnl|my_center|LOCUS_05530 19256 21064 gene locus_tag LOCUS_05540 19256 21064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 21376 21537 gene locus_tag LOCUS_05550 21376 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 21722 22777 gene locus_tag LOCUS_05560 21722 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 22764 23792 gene locus_tag LOCUS_05570 22764 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 23857 24927 gene locus_tag LOCUS_05580 23857 24927 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_05580 25119 28637 gene locus_tag LOCUS_05590 25119 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 28726 29889 gene locus_tag LOCUS_05600 28726 29889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 30064 30615 gene locus_tag LOCUS_05610 30064 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 30686 31756 gene locus_tag LOCUS_05620 30686 31756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 31967 33931 gene locus_tag LOCUS_05630 31967 33931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 34437 34195 gene locus_tag LOCUS_05640 34437 34195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 34860 34669 gene locus_tag LOCUS_05650 34860 34669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 36130 35975 gene locus_tag LOCUS_05660 36130 35975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 36760 36137 gene locus_tag LOCUS_05670 36760 36137 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970529.1 protein_id gnl|my_center|LOCUS_05670 38917 36902 gene locus_tag LOCUS_05680 gene lon 38917 36902 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545787.1 protein_id gnl|my_center|LOCUS_05680 39178 39945 gene locus_tag LOCUS_05690 39178 39945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 39991 41061 gene locus_tag LOCUS_05700 39991 41061 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940556.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence014 <1 767 gene locus_tag LOCUS_05710 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230818.1:class II fructose-bisphosphate aldolase 858 3341 gene locus_tag LOCUS_05720 858 3341 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057914.1 protein_id gnl|my_center|LOCUS_05720 3478 4905 gene locus_tag LOCUS_05730 gene pyk 3478 4905 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_05730 5210 7648 gene locus_tag LOCUS_05740 5210 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7892 9235 gene locus_tag LOCUS_05750 gene algB 7892 9235 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_05750 9584 11425 gene locus_tag LOCUS_05760 9584 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 11624 13357 gene locus_tag LOCUS_05770 gene kdpA 11624 13357 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089518.1 protein_id gnl|my_center|LOCUS_05770 13412 15433 gene locus_tag LOCUS_05780 gene kdpB 13412 15433 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965691.1 protein_id gnl|my_center|LOCUS_05780 15445 16059 gene locus_tag LOCUS_05790 15445 16059 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_05790 16068 17756 gene locus_tag LOCUS_05800 16068 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 17793 18722 gene locus_tag LOCUS_05810 17793 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 18967 20790 gene locus_tag LOCUS_05820 18967 20790 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_05820 22594 20948 gene locus_tag LOCUS_05830 22594 20948 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 protein_id gnl|my_center|LOCUS_05830 23603 22665 gene locus_tag LOCUS_05840 23603 22665 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_05840 24757 25056 gene locus_tag LOCUS_05850 24757 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 25336 27594 gene locus_tag LOCUS_05860 25336 27594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_05860 27594 28565 gene locus_tag LOCUS_05870 27594 28565 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924841.1 protein_id gnl|my_center|LOCUS_05870 28578 29582 gene locus_tag LOCUS_05880 28578 29582 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545600.1 protein_id gnl|my_center|LOCUS_05880 29579 30349 gene locus_tag LOCUS_05890 29579 30349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546427.1 protein_id gnl|my_center|LOCUS_05890 30364 34176 gene locus_tag LOCUS_05900 gene cobN 30364 34176 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870959.1 protein_id gnl|my_center|LOCUS_05900 34182 35204 gene locus_tag LOCUS_05910 34182 35204 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545241.1 protein_id gnl|my_center|LOCUS_05910 35226 37022 gene locus_tag LOCUS_05920 35226 37022 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546102.1 protein_id gnl|my_center|LOCUS_05920 37475 40057 gene locus_tag LOCUS_05930 37475 40057 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence015 1477 173 gene locus_tag LOCUS_05940 1477 173 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_05940 2863 1481 gene locus_tag LOCUS_05950 2863 1481 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940286.1 protein_id gnl|my_center|LOCUS_05950 3224 5002 gene locus_tag LOCUS_05960 3224 5002 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546216.1 protein_id gnl|my_center|LOCUS_05960 5103 5657 gene locus_tag LOCUS_05970 5103 5657 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940291.1 protein_id gnl|my_center|LOCUS_05970 5654 7813 gene locus_tag LOCUS_05980 5654 7813 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940292.1 protein_id gnl|my_center|LOCUS_05980 8169 8348 gene locus_tag LOCUS_05990 8169 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8805 9440 gene locus_tag LOCUS_06000 8805 9440 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_06000 9457 9606 gene locus_tag LOCUS_06010 9457 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 9769 11043 gene locus_tag LOCUS_06020 9769 11043 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_06020 11048 11839 gene locus_tag LOCUS_06030 11048 11839 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943576.1 protein_id gnl|my_center|LOCUS_06030 11881 13068 gene locus_tag LOCUS_06040 11881 13068 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943156.1 protein_id gnl|my_center|LOCUS_06040 13714 13250 gene locus_tag LOCUS_06050 13714 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 13724 14041 gene locus_tag LOCUS_06060 13724 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 14900 14031 gene locus_tag LOCUS_06070 14900 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 15855 14878 gene locus_tag LOCUS_06080 15855 14878 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_06080 16757 15957 gene locus_tag LOCUS_06090 gene mlaF 16757 15957 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 protein_id gnl|my_center|LOCUS_06090 17570 16779 gene locus_tag LOCUS_06100 17570 16779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_06100 17914 17576 gene locus_tag LOCUS_06110 17914 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 18351 17911 gene locus_tag LOCUS_06120 18351 17911 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377010.1 protein_id gnl|my_center|LOCUS_06120 19647 18352 gene locus_tag LOCUS_06130 19647 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 21429 19945 gene locus_tag LOCUS_06140 21429 19945 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_06140 22078 21572 gene locus_tag LOCUS_06150 22078 21572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 22150 23091 gene locus_tag LOCUS_06160 22150 23091 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_06160 23350 23177 gene locus_tag LOCUS_06170 23350 23177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 24468 23425 gene locus_tag LOCUS_06180 24468 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 25059 27101 gene locus_tag LOCUS_06190 gene fusA 25059 27101 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_06190 27200 27442 gene locus_tag LOCUS_06200 27200 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 28313 27651 gene locus_tag LOCUS_06210 28313 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 29246 28611 gene locus_tag LOCUS_06220 29246 28611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_06220 29695 29243 gene locus_tag LOCUS_06230 29695 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 31058 29730 gene locus_tag LOCUS_06240 gene fliI 31058 29730 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_06240 31749 31039 gene locus_tag LOCUS_06250 gene fliH 31749 31039 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_06250 32755 31742 gene locus_tag LOCUS_06260 gene fliG 32755 31742 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_06260 34366 32759 gene locus_tag LOCUS_06270 gene fliF 34366 32759 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_06270 34698 34396 gene locus_tag LOCUS_06280 gene fliE 34698 34396 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460760.1 protein_id gnl|my_center|LOCUS_06280 35150 34713 gene locus_tag LOCUS_06290 gene flgC 35150 34713 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_06290 35539 35150 gene locus_tag LOCUS_06300 gene flgB 35539 35150 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_06300 37049 35721 gene locus_tag LOCUS_06310 37049 35721 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792552.1 protein_id gnl|my_center|LOCUS_06310 39366 37081 gene locus_tag LOCUS_06320 39366 37081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 40079 39627 gene locus_tag LOCUS_06330 40079 39627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 41130 40096 gene locus_tag LOCUS_06340 41130 40096 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence016 16 501 gene locus_tag LOCUS_06350 16 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 705 1781 gene locus_tag LOCUS_06360 705 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1825 2607 gene locus_tag LOCUS_06370 1825 2607 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_06370 2836 4533 gene locus_tag LOCUS_06380 2836 4533 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878476.1 protein_id gnl|my_center|LOCUS_06380 5216 4650 gene locus_tag LOCUS_06390 5216 4650 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_06390 5462 6724 gene locus_tag LOCUS_06400 5462 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 6987 6694 gene locus_tag LOCUS_06410 6987 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 7539 9995 gene locus_tag LOCUS_06420 7539 9995 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_06420 10060 10275 gene locus_tag LOCUS_06430 10060 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 10521 11519 gene locus_tag LOCUS_06440 10521 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12165 11701 gene locus_tag LOCUS_06450 12165 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 13468 12230 gene locus_tag LOCUS_06460 13468 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 13981 16479 gene locus_tag LOCUS_06470 13981 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 16570 17670 gene locus_tag LOCUS_06480 16570 17670 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_06480 21026 17757 gene locus_tag LOCUS_06490 21026 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 22090 21410 gene locus_tag LOCUS_06500 22090 21410 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_06500 23677 22160 gene locus_tag LOCUS_06510 23677 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 23958 24566 gene locus_tag LOCUS_06520 23958 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 24776 25525 gene locus_tag LOCUS_06530 24776 25525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_06530 26071 27024 gene locus_tag LOCUS_06540 26071 27024 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_06540 27043 27300 gene locus_tag LOCUS_06550 27043 27300 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393481.1 protein_id gnl|my_center|LOCUS_06550 27293 28456 gene locus_tag LOCUS_06560 27293 28456 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_06560 28453 29289 gene locus_tag LOCUS_06570 28453 29289 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250080.1 protein_id gnl|my_center|LOCUS_06570 29286 29831 gene locus_tag LOCUS_06580 29286 29831 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_06580 29865 31298 gene locus_tag LOCUS_06590 29865 31298 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_06590 31461 32336 gene locus_tag LOCUS_06600 31461 32336 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_06600 32420 34348 gene locus_tag LOCUS_06610 32420 34348 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_06610 34463 35485 gene locus_tag LOCUS_06620 34463 35485 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_06620 35543 36061 gene locus_tag LOCUS_06630 35543 36061 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804396.1 protein_id gnl|my_center|LOCUS_06630 36043 37326 gene locus_tag LOCUS_06640 36043 37326 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099149.1 protein_id gnl|my_center|LOCUS_06640 37378 37737 gene locus_tag LOCUS_06650 37378 37737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 37776 38639 gene locus_tag LOCUS_06660 37776 38639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 38796 40046 gene locus_tag LOCUS_06670 38796 40046 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence017 176 1138 gene locus_tag LOCUS_06680 176 1138 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 protein_id gnl|my_center|LOCUS_06680 1194 1598 gene locus_tag LOCUS_06690 1194 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1679 2557 gene locus_tag LOCUS_06700 1679 2557 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_06700 2674 3105 gene locus_tag LOCUS_06710 2674 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3108 3557 gene locus_tag LOCUS_06720 3108 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3596 4525 gene locus_tag LOCUS_06730 3596 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4624 5016 gene locus_tag LOCUS_06740 4624 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5297 5103 gene locus_tag LOCUS_06750 5297 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5366 6250 gene locus_tag LOCUS_06760 5366 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6254 6604 gene locus_tag LOCUS_06770 6254 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 6718 7329 gene locus_tag LOCUS_06780 6718 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7368 7787 gene locus_tag LOCUS_06790 7368 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 7916 13645 gene locus_tag LOCUS_06800 7916 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13648 14034 gene locus_tag LOCUS_06810 13648 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 14044 16005 gene locus_tag LOCUS_06820 14044 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 16016 16807 gene locus_tag LOCUS_06830 16016 16807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 16903 17595 gene locus_tag LOCUS_06840 16903 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 19067 17751 gene locus_tag LOCUS_06850 19067 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 20357 19419 gene locus_tag LOCUS_06860 20357 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 21117 20404 gene locus_tag LOCUS_06870 21117 20404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 21390 22748 gene locus_tag LOCUS_06880 21390 22748 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_06880 22826 24157 gene locus_tag LOCUS_06890 22826 24157 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_06890 24336 27296 gene locus_tag LOCUS_06900 24336 27296 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_06900 27377 28729 gene locus_tag LOCUS_06910 gene nrfD 27377 28729 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_06910 28722 29237 gene locus_tag LOCUS_06920 28722 29237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 29227 30450 gene locus_tag LOCUS_06930 29227 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_06930 30519 31058 gene locus_tag LOCUS_06940 30519 31058 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_06940 31089 32486 gene locus_tag LOCUS_06950 31089 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06950 32483 33433 gene locus_tag LOCUS_06960 32483 33433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 33430 33705 gene locus_tag LOCUS_06970 33430 33705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 33711 33974 gene locus_tag LOCUS_06980 33711 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 33992 34285 gene locus_tag LOCUS_06990 33992 34285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 34282 34797 gene locus_tag LOCUS_07000 34282 34797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 34853 35587 gene locus_tag LOCUS_07010 34853 35587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 35768 38353 gene locus_tag LOCUS_07020 35768 38353 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence018 563 363 gene locus_tag LOCUS_07030 563 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1070 744 gene locus_tag LOCUS_07040 1070 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1857 1075 gene locus_tag LOCUS_07050 1857 1075 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_07050 3224 1914 gene locus_tag LOCUS_07060 3224 1914 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_07060 4005 3301 gene locus_tag LOCUS_07070 4005 3301 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_07070 5210 4002 gene locus_tag LOCUS_07080 gene coaBC 5210 4002 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_07080 5841 5350 gene locus_tag LOCUS_07090 5841 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6553 5915 gene locus_tag LOCUS_07100 6553 5915 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_07100 7123 6602 gene locus_tag LOCUS_07110 7123 6602 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_07110 7498 8295 gene locus_tag LOCUS_07120 7498 8295 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_07120 8450 9241 gene locus_tag LOCUS_07130 8450 9241 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_07130 9254 9745 gene locus_tag LOCUS_07140 gene mlaD 9254 9745 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_07140 9854 10762 gene locus_tag LOCUS_07150 9854 10762 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008870867.1 protein_id gnl|my_center|LOCUS_07150 11556 11759 gene locus_tag LOCUS_07160 11556 11759 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_07160 12694 11900 gene locus_tag LOCUS_07170 12694 11900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_07170 13964 12702 gene locus_tag LOCUS_07180 13964 12702 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_07180 16190 14097 gene locus_tag LOCUS_07190 gene pnp 16190 14097 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_07190 16531 16262 gene locus_tag LOCUS_07200 gene rpsO 16531 16262 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_07200 17655 16726 gene locus_tag LOCUS_07210 17655 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 18684 17701 gene locus_tag LOCUS_07220 18684 17701 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_07220 19033 18677 gene locus_tag LOCUS_07230 gene rbfA 19033 18677 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_07230 19457 19167 gene locus_tag LOCUS_07240 19457 19167 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393381.1 protein_id gnl|my_center|LOCUS_07240 22317 19465 gene locus_tag LOCUS_07250 22317 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 24023 22719 gene locus_tag LOCUS_07260 gene nusA 24023 22719 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_07260 24572 24075 gene locus_tag LOCUS_07270 gene rimP 24572 24075 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_07270 24851 24776 gene locus_tag LOCUS_t00060 24851 24776 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25234 26697 gene locus_tag LOCUS_07280 25234 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 26701 27336 gene locus_tag LOCUS_07290 26701 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 27361 28746 gene locus_tag LOCUS_07300 27361 28746 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_07300 28914 29105 gene locus_tag LOCUS_07310 28914 29105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 29105 29308 gene locus_tag LOCUS_07320 29105 29308 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496483.1 protein_id gnl|my_center|LOCUS_07320 30824 29463 gene locus_tag LOCUS_07330 30824 29463 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937786.1 protein_id gnl|my_center|LOCUS_07330 31080 32207 gene locus_tag LOCUS_07340 31080 32207 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898675.1 protein_id gnl|my_center|LOCUS_07340 33279 32335 gene locus_tag LOCUS_07350 gene lpxC 33279 32335 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693459.1 protein_id gnl|my_center|LOCUS_07350 33700 35205 gene locus_tag LOCUS_07360 gene thrC 33700 35205 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_07360 35205 35786 gene locus_tag LOCUS_07370 35205 35786 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841462.1 protein_id gnl|my_center|LOCUS_07370 36203 35952 gene locus_tag LOCUS_07380 36203 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 37001 36231 gene locus_tag LOCUS_07390 37001 36231 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932610.1 protein_id gnl|my_center|LOCUS_07390 37818 37003 gene locus_tag LOCUS_07400 37818 37003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence019 1399 3510 gene locus_tag LOCUS_07410 1399 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3507 4190 gene locus_tag LOCUS_07420 3507 4190 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_07420 4259 5206 gene locus_tag LOCUS_07430 4259 5206 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_07430 5745 5251 gene locus_tag LOCUS_07440 5745 5251 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_07440 7774 5810 gene locus_tag LOCUS_07450 7774 5810 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_07450 8522 7794 gene locus_tag LOCUS_07460 8522 7794 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819827.1 protein_id gnl|my_center|LOCUS_07460 9446 8988 gene locus_tag LOCUS_07470 9446 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 9718 10263 gene locus_tag LOCUS_07480 9718 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10295 11806 gene locus_tag LOCUS_07490 10295 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 12046 13815 gene locus_tag LOCUS_07500 12046 13815 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_07500 13784 14170 gene locus_tag LOCUS_07510 13784 14170 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_07510 14303 16261 gene locus_tag LOCUS_07520 gene uvrC 14303 16261 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_07520 16432 18513 gene locus_tag LOCUS_07530 16432 18513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 18972 18601 gene locus_tag LOCUS_07540 18972 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 19940 19224 gene locus_tag LOCUS_07550 19940 19224 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763970.1 protein_id gnl|my_center|LOCUS_07550 21295 20066 gene locus_tag LOCUS_07560 21295 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 22541 21300 gene locus_tag LOCUS_07570 22541 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 25509 22900 gene locus_tag LOCUS_07580 25509 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 25933 27486 gene locus_tag LOCUS_07590 25933 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 29121 27529 gene locus_tag LOCUS_07600 29121 27529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 29415 31637 gene locus_tag LOCUS_07610 29415 31637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 32116 31937 gene locus_tag LOCUS_07620 32116 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 32111 35650 gene locus_tag LOCUS_07630 32111 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence020 430 1131 gene locus_tag LOCUS_07640 430 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1145 1486 gene locus_tag LOCUS_07650 1145 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1504 2541 gene locus_tag LOCUS_07660 1504 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3174 4448 gene locus_tag LOCUS_07670 3174 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4525 4451 gene locus_tag LOCUS_t00070 4525 4451 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5054 4641 gene locus_tag LOCUS_07680 5054 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5182 5841 gene locus_tag LOCUS_07690 gene nth 5182 5841 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_07690 6813 5875 gene locus_tag LOCUS_07700 6813 5875 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_07700 7836 6979 gene locus_tag LOCUS_07710 gene larE 7836 6979 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_07710 9046 7850 gene locus_tag LOCUS_07720 9046 7850 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_07720 10007 9222 gene locus_tag LOCUS_07730 10007 9222 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_07730 10136 10537 gene locus_tag LOCUS_07740 10136 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 10743 11006 gene locus_tag LOCUS_07750 10743 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_07750 11578 11105 gene locus_tag LOCUS_07760 11578 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 12126 12368 gene locus_tag LOCUS_07770 12126 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 13394 12462 gene locus_tag LOCUS_07780 13394 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 15298 13712 gene locus_tag LOCUS_07790 15298 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 17079 15340 gene locus_tag LOCUS_07800 17079 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 17826 17206 gene locus_tag LOCUS_07810 17826 17206 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_07810 18227 17814 gene locus_tag LOCUS_07820 18227 17814 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548117.1 protein_id gnl|my_center|LOCUS_07820 19452 18340 gene locus_tag LOCUS_07830 19452 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 20100 19795 gene locus_tag LOCUS_07840 20100 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 20139 20636 gene locus_tag LOCUS_07850 20139 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 23145 20815 gene locus_tag LOCUS_07860 23145 20815 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940549.1 protein_id gnl|my_center|LOCUS_07860 24870 23212 gene locus_tag LOCUS_07870 24870 23212 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_07870 25964 24834 gene locus_tag LOCUS_07880 25964 24834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791395.1 protein_id gnl|my_center|LOCUS_07880 28425 26359 gene locus_tag LOCUS_07890 28425 26359 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_07890 28929 28645 gene locus_tag LOCUS_07900 28929 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 29176 29373 gene locus_tag LOCUS_07910 29176 29373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 29398 30381 gene locus_tag LOCUS_07920 29398 30381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30378 30752 gene locus_tag LOCUS_07930 30378 30752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 31571 30921 gene locus_tag LOCUS_07940 31571 30921 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_07940 32171 31830 gene locus_tag LOCUS_07950 32171 31830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 32637 33917 gene locus_tag LOCUS_07960 32637 33917 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_07960 34032 35048 gene locus_tag LOCUS_07970 34032 35048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence021 2713 614 gene locus_tag LOCUS_07980 gene flhA 2713 614 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_07980 3737 2715 gene locus_tag LOCUS_07990 gene flhB 3737 2715 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_07990 4965 4198 gene locus_tag LOCUS_08000 gene fliR 4965 4198 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_08000 5241 4972 gene locus_tag LOCUS_08010 gene fliQ 5241 4972 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_08010 6063 5251 gene locus_tag LOCUS_08020 gene fliP 6063 5251 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_08020 6359 6060 gene locus_tag LOCUS_08030 6359 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6728 6414 gene locus_tag LOCUS_08040 6728 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 7751 6768 gene locus_tag LOCUS_08050 gene fliM 7751 6768 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_08050 8238 7768 gene locus_tag LOCUS_08060 8238 7768 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_08060 8732 9400 gene locus_tag LOCUS_08070 8732 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 9470 10258 gene locus_tag LOCUS_08080 9470 10258 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_08080 13126 10589 gene locus_tag LOCUS_08090 13126 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 14406 13330 gene locus_tag LOCUS_08100 14406 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 15529 14612 gene locus_tag LOCUS_08110 gene fabD 15529 14612 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_08110 15897 15721 gene locus_tag LOCUS_08120 15897 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 17417 16005 gene locus_tag LOCUS_08130 gene tilS 17417 16005 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_08130 18211 17414 gene locus_tag LOCUS_08140 18211 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 18355 19248 gene locus_tag LOCUS_08150 18355 19248 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_08150 19255 20235 gene locus_tag LOCUS_08160 19255 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 20232 21344 gene locus_tag LOCUS_08170 20232 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 21500 22591 gene locus_tag LOCUS_08180 21500 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 22588 23118 gene locus_tag LOCUS_08190 22588 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 25505 23214 gene locus_tag LOCUS_08200 25505 23214 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_08200 26080 25577 gene locus_tag LOCUS_08210 26080 25577 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_08210 28239 26152 gene locus_tag LOCUS_08220 28239 26152 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545814.1 protein_id gnl|my_center|LOCUS_08220 28829 29080 gene locus_tag LOCUS_08230 28829 29080 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393102.1 protein_id gnl|my_center|LOCUS_08230 29540 29145 gene locus_tag LOCUS_08240 29540 29145 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_08240 29628 30359 gene locus_tag LOCUS_08250 29628 30359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 30564 31691 gene locus_tag LOCUS_08260 30564 31691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_08260 31950 33125 gene locus_tag LOCUS_08270 31950 33125 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_08270 33104 33916 gene locus_tag LOCUS_08280 33104 33916 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861615.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence022 308 2668 gene locus_tag LOCUS_08290 308 2668 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_08290 4103 3036 gene locus_tag LOCUS_08300 4103 3036 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 protein_id gnl|my_center|LOCUS_08300 4412 4200 gene locus_tag LOCUS_08310 4412 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4467 7028 gene locus_tag LOCUS_08320 4467 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7189 7530 gene locus_tag LOCUS_08330 7189 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7814 8497 gene locus_tag LOCUS_08340 gene cysC 7814 8497 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643136.1 protein_id gnl|my_center|LOCUS_08340 8546 9571 gene locus_tag LOCUS_08350 8546 9571 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403825.1 protein_id gnl|my_center|LOCUS_08350 9820 9680 gene locus_tag LOCUS_08360 9820 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 10975 9929 gene locus_tag LOCUS_08370 10975 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11946 10975 gene locus_tag LOCUS_08380 11946 10975 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_08380 12846 12043 gene locus_tag LOCUS_08390 gene purN 12846 12043 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836289.1 protein_id gnl|my_center|LOCUS_08390 13710 12901 gene locus_tag LOCUS_08400 13710 12901 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_08400 15039 13744 gene locus_tag LOCUS_08410 gene purD 15039 13744 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_08410 15670 15068 gene locus_tag LOCUS_08420 15670 15068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16467 15715 gene locus_tag LOCUS_08430 16467 15715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811722.1 protein_id gnl|my_center|LOCUS_08430 17090 16686 gene locus_tag LOCUS_08440 gene nusB 17090 16686 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_08440 17690 17223 gene locus_tag LOCUS_08450 gene ribE 17690 17223 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_08450 18916 17690 gene locus_tag LOCUS_08460 18916 17690 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_08460 19703 19044 gene locus_tag LOCUS_08470 19703 19044 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_08470 20829 19714 gene locus_tag LOCUS_08480 gene ribD 20829 19714 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_08480 22155 20920 gene locus_tag LOCUS_08490 22155 20920 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938499.1 protein_id gnl|my_center|LOCUS_08490 22449 23147 gene locus_tag LOCUS_08500 22449 23147 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_08500 24433 23165 gene locus_tag LOCUS_08510 gene ilvA 24433 23165 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_08510 25641 24433 gene locus_tag LOCUS_08520 25641 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 27279 25780 gene locus_tag LOCUS_08530 27279 25780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 27498 28214 gene locus_tag LOCUS_08540 27498 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 29659 28430 gene locus_tag LOCUS_08550 29659 28430 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_08550 31064 29670 gene locus_tag LOCUS_08560 31064 29670 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937697.1 protein_id gnl|my_center|LOCUS_08560 31745 31071 gene locus_tag LOCUS_08570 31745 31071 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_08570 32500 31745 gene locus_tag LOCUS_08580 32500 31745 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937695.1 protein_id gnl|my_center|LOCUS_08580 33191 32523 gene locus_tag LOCUS_08590 33191 32523 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_08590 34082 33321 gene locus_tag LOCUS_08600 34082 33321 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence023 <1 21197 gene locus_tag LOCUS_08610 <1 21197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 21497 21832 gene locus_tag LOCUS_08620 21497 21832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 22088 23929 gene locus_tag LOCUS_08630 22088 23929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 23930 26080 gene locus_tag LOCUS_08640 23930 26080 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_08640 26073 28064 gene locus_tag LOCUS_08650 gene secA 26073 28064 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583762.1 protein_id gnl|my_center|LOCUS_08650 28175 28978 gene locus_tag LOCUS_08660 28175 28978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 29062 29514 gene locus_tag LOCUS_08670 29062 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 29692 30699 gene locus_tag LOCUS_08680 29692 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 31024 31485 gene locus_tag LOCUS_08690 31024 31485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 32072 31623 gene locus_tag LOCUS_08700 32072 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence024 1155 361 gene locus_tag LOCUS_08710 1155 361 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528708.1 protein_id gnl|my_center|LOCUS_08710 2414 1335 gene locus_tag LOCUS_08720 2414 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3310 2543 gene locus_tag LOCUS_08730 3310 2543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_08730 3860 3387 gene locus_tag LOCUS_08740 3860 3387 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_08740 5412 4042 gene locus_tag LOCUS_08750 5412 4042 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_08750 6934 5582 gene locus_tag LOCUS_08760 gene gdhA 6934 5582 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_08760 8595 7486 gene locus_tag LOCUS_08770 gene alr 8595 7486 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08770 10075 8783 gene locus_tag LOCUS_08780 10075 8783 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_08780 13319 10221 gene locus_tag LOCUS_08790 13319 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294648.1 protein_id gnl|my_center|LOCUS_08790 13862 14713 gene locus_tag LOCUS_08800 gene panC 13862 14713 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_08800 14717 15922 gene locus_tag LOCUS_08810 14717 15922 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_08810 16176 16835 gene locus_tag LOCUS_08820 16176 16835 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869292.1 protein_id gnl|my_center|LOCUS_08820 17273 17482 gene locus_tag LOCUS_08830 17273 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 17589 17984 gene locus_tag LOCUS_08840 17589 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19131 18034 gene locus_tag LOCUS_08850 19131 18034 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031178.1 protein_id gnl|my_center|LOCUS_08850 20186 19344 gene locus_tag LOCUS_08860 20186 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20450 21547 gene locus_tag LOCUS_08870 20450 21547 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_08870 22426 21764 gene locus_tag LOCUS_08880 22426 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 22565 23356 gene locus_tag LOCUS_08890 22565 23356 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_08890 24319 23540 gene locus_tag LOCUS_08900 24319 23540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 24616 26328 gene locus_tag LOCUS_08910 24616 26328 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_08910 26411 26974 gene locus_tag LOCUS_08920 26411 26974 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_08920 27138 27213 gene locus_tag LOCUS_t00080 27138 27213 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27402 27584 gene locus_tag LOCUS_08930 27402 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 28411 27653 gene locus_tag LOCUS_08940 28411 27653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 28630 28469 gene locus_tag LOCUS_08950 28630 28469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 29934 28681 gene locus_tag LOCUS_08960 29934 28681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_08960 30674 29955 gene locus_tag LOCUS_08970 30674 29955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence025 <1 627 gene locus_tag LOCUS_08980 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205298.1:site-specific integrase 1393 1908 gene locus_tag LOCUS_08990 1393 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1976 2179 gene locus_tag LOCUS_09000 1976 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2514 2197 gene locus_tag LOCUS_09010 2514 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2630 2815 gene locus_tag LOCUS_09020 2630 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2827 3408 gene locus_tag LOCUS_09030 2827 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3409 4371 gene locus_tag LOCUS_09040 3409 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4368 4538 gene locus_tag LOCUS_09050 4368 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4535 4753 gene locus_tag LOCUS_09060 4535 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4907 5401 gene locus_tag LOCUS_09070 4907 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 5398 7113 gene locus_tag LOCUS_09080 5398 7113 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_09080 7097 7762 gene locus_tag LOCUS_09090 7097 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 7766 8407 gene locus_tag LOCUS_09100 7766 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 8404 8613 gene locus_tag LOCUS_09110 8404 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 8585 8833 gene locus_tag LOCUS_09120 8585 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 8817 8990 gene locus_tag LOCUS_09130 8817 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8987 9307 gene locus_tag LOCUS_09140 8987 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 9319 11628 gene locus_tag LOCUS_09150 9319 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11639 12016 gene locus_tag LOCUS_09160 11639 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12026 12265 gene locus_tag LOCUS_09170 12026 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12268 12669 gene locus_tag LOCUS_09180 12268 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12666 12836 gene locus_tag LOCUS_09190 12666 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12944 13942 gene locus_tag LOCUS_09200 12944 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 13977 14954 gene locus_tag LOCUS_09210 13977 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 15002 15727 gene locus_tag LOCUS_09220 15002 15727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 15793 16068 gene locus_tag LOCUS_09230 15793 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 16084 18870 gene locus_tag LOCUS_09240 16084 18870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 18884 19075 gene locus_tag LOCUS_09250 18884 19075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 19089 19691 gene locus_tag LOCUS_09260 19089 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 19749 20066 gene locus_tag LOCUS_09270 19749 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 20079 20879 gene locus_tag LOCUS_09280 20079 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 20876 21085 gene locus_tag LOCUS_09290 20876 21085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 21179 21430 gene locus_tag LOCUS_09300 21179 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 21557 22027 gene locus_tag LOCUS_09310 21557 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 22024 22464 gene locus_tag LOCUS_09320 22024 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 22473 23333 gene locus_tag LOCUS_09330 22473 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 23334 24221 gene locus_tag LOCUS_09340 23334 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 24224 25777 gene locus_tag LOCUS_09350 24224 25777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 25780 26766 gene locus_tag LOCUS_09360 25780 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 26851 27318 gene locus_tag LOCUS_09370 26851 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 27501 28613 gene locus_tag LOCUS_09380 27501 28613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 28623 30128 gene locus_tag LOCUS_09390 28623 30128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence026 1044 895 gene locus_tag LOCUS_09400 1044 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1526 1266 gene locus_tag LOCUS_09410 1526 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1841 1557 gene locus_tag LOCUS_09420 1841 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1788 2168 gene locus_tag LOCUS_09430 1788 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2174 3358 gene locus_tag LOCUS_09440 gene devC 2174 3358 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_09440 3361 4647 gene locus_tag LOCUS_09450 3361 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6019 4562 gene locus_tag LOCUS_09460 6019 4562 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860110.1 protein_id gnl|my_center|LOCUS_09460 7834 6284 gene locus_tag LOCUS_09470 7834 6284 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_09470 8129 8428 gene locus_tag LOCUS_09480 8129 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 8509 8808 gene locus_tag LOCUS_09490 8509 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 8938 9645 gene locus_tag LOCUS_09500 8938 9645 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_09500 10285 9950 gene locus_tag LOCUS_09510 10285 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 10184 11170 gene locus_tag LOCUS_09520 10184 11170 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_09520 11184 14354 gene locus_tag LOCUS_09530 11184 14354 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544956.1 protein_id gnl|my_center|LOCUS_09530 14359 15780 gene locus_tag LOCUS_09540 14359 15780 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855661.1 protein_id gnl|my_center|LOCUS_09540 16456 15893 gene locus_tag LOCUS_09550 16456 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 18176 16719 gene locus_tag LOCUS_09560 18176 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 18892 18377 gene locus_tag LOCUS_09570 18892 18377 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_09570 20217 19021 gene locus_tag LOCUS_09580 20217 19021 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_09580 21570 20422 gene locus_tag LOCUS_09590 21570 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 22580 21588 gene locus_tag LOCUS_09600 22580 21588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 23993 22746 gene locus_tag LOCUS_09610 23993 22746 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456721.1 protein_id gnl|my_center|LOCUS_09610 25381 24083 gene locus_tag LOCUS_09620 25381 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 27451 25397 gene locus_tag LOCUS_09630 27451 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 28912 27581 gene locus_tag LOCUS_09640 28912 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 30330 29038 gene locus_tag LOCUS_09650 30330 29038 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048165814.1 protein_id gnl|my_center|LOCUS_09650 31288 30404 gene locus_tag LOCUS_09660 31288 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence027 781 14 gene locus_tag LOCUS_09670 781 14 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 protein_id gnl|my_center|LOCUS_09670 1935 796 gene locus_tag LOCUS_09680 gene acdA 1935 796 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_09680 3608 2142 gene locus_tag LOCUS_09690 3608 2142 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_09690 5244 3661 gene locus_tag LOCUS_09700 5244 3661 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_09700 7058 5574 gene locus_tag LOCUS_09710 7058 5574 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462282.1 protein_id gnl|my_center|LOCUS_09710 8534 7518 gene locus_tag LOCUS_09720 gene cydB 8534 7518 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141196.1 protein_id gnl|my_center|LOCUS_09720 9948 8569 gene locus_tag LOCUS_09730 9948 8569 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141197.1 protein_id gnl|my_center|LOCUS_09730 10424 10179 gene locus_tag LOCUS_09740 10424 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11467 10535 gene locus_tag LOCUS_09750 11467 10535 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 protein_id gnl|my_center|LOCUS_09750 11682 12086 gene locus_tag LOCUS_09760 11682 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 12898 12083 gene locus_tag LOCUS_09770 12898 12083 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_09770 13049 13894 gene locus_tag LOCUS_09780 13049 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 15428 14013 gene locus_tag LOCUS_09790 15428 14013 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_09790 16763 15453 gene locus_tag LOCUS_09800 16763 15453 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_09800 17725 16766 gene locus_tag LOCUS_09810 17725 16766 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_09810 18070 18540 gene locus_tag LOCUS_09820 gene greA 18070 18540 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_09820 18836 19753 gene locus_tag LOCUS_09830 18836 19753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 19929 21344 gene locus_tag LOCUS_09840 19929 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 21570 21373 gene locus_tag LOCUS_09850 21570 21373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 22020 23117 gene locus_tag LOCUS_09860 22020 23117 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_09860 23274 24038 gene locus_tag LOCUS_09870 gene cobB 23274 24038 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_09870 24038 24826 gene locus_tag LOCUS_09880 gene tolQ 24038 24826 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_09880 24837 25295 gene locus_tag LOCUS_09890 gene tolR 24837 25295 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_09890 25355 26302 gene locus_tag LOCUS_09900 25355 26302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 26329 27651 gene locus_tag LOCUS_09910 gene tolB 26329 27651 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_09910 27680 28252 gene locus_tag LOCUS_09920 gene pal 27680 28252 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_09920 28407 29252 gene locus_tag LOCUS_09930 28407 29252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 29383 31200 gene locus_tag LOCUS_09940 29383 31200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence028 1457 75 gene locus_tag LOCUS_09950 1457 75 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_09950 2260 4128 gene locus_tag LOCUS_09960 2260 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7694 4218 gene locus_tag LOCUS_09970 7694 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 9812 7974 gene locus_tag LOCUS_09980 9812 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 10739 9858 gene locus_tag LOCUS_09990 gene ubiA 10739 9858 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_09990 12295 10865 gene locus_tag LOCUS_10000 gene pyk 12295 10865 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_10000 14052 12292 gene locus_tag LOCUS_10010 14052 12292 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_10010 15500 14097 gene locus_tag LOCUS_10020 15500 14097 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_10020 15901 17082 gene locus_tag LOCUS_10030 15901 17082 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_10030 17813 17142 gene locus_tag LOCUS_10040 gene lepB 17813 17142 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_10040 17943 19004 gene locus_tag LOCUS_10050 gene pilM 17943 19004 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_10050 19001 19579 gene locus_tag LOCUS_10060 19001 19579 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_10060 19585 20226 gene locus_tag LOCUS_10070 19585 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 20319 21800 gene locus_tag LOCUS_10080 20319 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 21883 22557 gene locus_tag LOCUS_10090 21883 22557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 23758 22823 gene locus_tag LOCUS_10100 23758 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 25094 24375 gene locus_tag LOCUS_10110 25094 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 25315 25118 gene locus_tag LOCUS_10120 25315 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 26032 25958 gene locus_tag LOCUS_t00090 26032 25958 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 27401 26115 gene locus_tag LOCUS_10130 gene eno 27401 26115 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_10130 27747 28319 gene locus_tag LOCUS_10140 gene efp 27747 28319 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_10140 28319 29248 gene locus_tag LOCUS_10150 gene epmA 28319 29248 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_10150 <30060 29378 gene locus_tag LOCUS_10160 <30060 29378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272325.1:glutaconate CoA-transferase >Feature sequence029 582 262 gene locus_tag LOCUS_10170 582 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1772 2332 gene locus_tag LOCUS_10180 1772 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2350 3420 gene locus_tag LOCUS_10190 2350 3420 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_10190 3667 3858 gene locus_tag LOCUS_10200 3667 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3848 4528 gene locus_tag LOCUS_10210 3848 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4494 4904 gene locus_tag LOCUS_10220 4494 4904 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_10220 5118 7823 gene locus_tag LOCUS_10230 5118 7823 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_10230 7840 8181 gene locus_tag LOCUS_10240 7840 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8185 9939 gene locus_tag LOCUS_10250 8185 9939 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_10250 9936 10334 gene locus_tag LOCUS_10260 9936 10334 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_10260 10401 10799 gene locus_tag LOCUS_10270 10401 10799 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_10270 11487 10897 gene locus_tag LOCUS_10280 11487 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 11898 12089 gene locus_tag LOCUS_10290 11898 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 13058 12354 gene locus_tag LOCUS_10300 13058 12354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_10300 13778 13065 gene locus_tag LOCUS_10310 13778 13065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_10310 14759 13782 gene locus_tag LOCUS_10320 14759 13782 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_10320 15647 14772 gene locus_tag LOCUS_10330 15647 14772 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_10330 16923 15727 gene locus_tag LOCUS_10340 16923 15727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_10340 17942 17217 gene locus_tag LOCUS_10350 17942 17217 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937785.1 protein_id gnl|my_center|LOCUS_10350 19228 17939 gene locus_tag LOCUS_10360 gene dacB 19228 17939 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_10360 20730 19450 gene locus_tag LOCUS_10370 gene aroA 20730 19450 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_10370 21556 20714 gene locus_tag LOCUS_10380 21556 20714 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_10380 22391 21672 gene locus_tag LOCUS_10390 22391 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 23520 22378 gene locus_tag LOCUS_10400 gene pheA 23520 22378 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_10400 24762 23737 gene locus_tag LOCUS_10410 24762 23737 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_10410 25972 25043 gene locus_tag LOCUS_10420 25972 25043 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_10420 26964 25972 gene locus_tag LOCUS_10430 gene moaA 26964 25972 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_10430 27504 27094 gene locus_tag LOCUS_10440 gene tsaA 27504 27094 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229491.1 protein_id gnl|my_center|LOCUS_10440 29917 27734 gene locus_tag LOCUS_10450 29917 27734 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence030 <1 1843 gene locus_tag LOCUS_10460 <1 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870743.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1886 2878 gene locus_tag LOCUS_10470 1886 2878 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_10470 3354 3163 gene locus_tag LOCUS_10480 3354 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3870 5549 gene locus_tag LOCUS_10490 3870 5549 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_10490 5595 5993 gene locus_tag LOCUS_10500 5595 5993 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_10500 6298 7293 gene locus_tag LOCUS_10510 gene meaB 6298 7293 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_10510 7274 7678 gene locus_tag LOCUS_10520 gene mce 7274 7678 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_10520 8542 7916 gene locus_tag LOCUS_10530 8542 7916 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_10530 9327 8587 gene locus_tag LOCUS_10540 9327 8587 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545867.1 protein_id gnl|my_center|LOCUS_10540 9798 11357 gene locus_tag LOCUS_10550 9798 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 12912 11515 gene locus_tag LOCUS_10560 12912 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 13096 14493 gene locus_tag LOCUS_10570 gene hydG 13096 14493 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_10570 14647 15888 gene locus_tag LOCUS_10580 gene hydF 14647 15888 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_10580 15885 16988 gene locus_tag LOCUS_10590 gene hydE 15885 16988 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_10590 16985 17251 gene locus_tag LOCUS_10600 16985 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 17261 18973 gene locus_tag LOCUS_10610 17261 18973 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_10610 18970 20157 gene locus_tag LOCUS_10620 18970 20157 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_10620 20604 20212 gene locus_tag LOCUS_10630 20604 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 24261 20938 gene locus_tag LOCUS_10640 24261 20938 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_10640 25478 24258 gene locus_tag LOCUS_10650 25478 24258 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_10650 26727 25471 gene locus_tag LOCUS_10660 26727 25471 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923195.1 protein_id gnl|my_center|LOCUS_10660 27738 27665 gene locus_tag LOCUS_t00100 27738 27665 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 <1 3020 gene locus_tag LOCUS_10670 <1 3020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase 3030 3233 gene locus_tag LOCUS_10680 3030 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10680 3279 3470 gene locus_tag LOCUS_10690 3279 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3548 4666 gene locus_tag LOCUS_10700 3548 4666 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879490.1 protein_id gnl|my_center|LOCUS_10700 4697 6229 gene locus_tag LOCUS_10710 4697 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:4862..4864,aa:Sec) note codon on position 56 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10710 6244 7956 gene locus_tag LOCUS_10720 6244 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10720 8132 8416 gene locus_tag LOCUS_10730 8132 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10730 8486 9292 gene locus_tag LOCUS_10740 8486 9292 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_10740 9304 11340 gene locus_tag LOCUS_10750 9304 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:9709..9711,aa:Sec) note codon on position 136 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10750 11592 13298 gene locus_tag LOCUS_10760 11592 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13489 13836 gene locus_tag LOCUS_10770 13489 13836 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10770 13915 14850 gene locus_tag LOCUS_10780 13915 14850 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_10780 14867 16216 gene locus_tag LOCUS_10790 14867 16216 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870705.1 protein_id gnl|my_center|LOCUS_10790 16842 16555 gene locus_tag LOCUS_10800 16842 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 17252 17007 gene locus_tag LOCUS_10810 17252 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 18078 17611 gene locus_tag LOCUS_10820 18078 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 19714 18332 gene locus_tag LOCUS_10830 19714 18332 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_10830 20213 21394 gene locus_tag LOCUS_10840 20213 21394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_10840 22428 21568 gene locus_tag LOCUS_10850 22428 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23967 22543 gene locus_tag LOCUS_10860 23967 22543 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_10860 25534 24068 gene locus_tag LOCUS_10870 25534 24068 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_10870 27534 25591 gene locus_tag LOCUS_10880 gene nuoL 27534 25591 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_10880 27850 27542 gene locus_tag LOCUS_10890 gene nuoK 27850 27542 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_10890 28377 27847 gene locus_tag LOCUS_10900 28377 27847 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_10900 28989 28474 gene locus_tag LOCUS_10910 gene nuoI 28989 28474 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086544.1 protein_id gnl|my_center|LOCUS_10910 <29592 29008 gene locus_tag LOCUS_10920 <29592 29008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392496.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence032 2097 1216 gene locus_tag LOCUS_10930 2097 1216 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_10930 2532 2113 gene locus_tag LOCUS_10940 2532 2113 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942695.1 protein_id gnl|my_center|LOCUS_10940 2413 2688 gene locus_tag LOCUS_10950 2413 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5082 3025 gene locus_tag LOCUS_10960 gene shc 5082 3025 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_10960 6550 5411 gene locus_tag LOCUS_10970 6550 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 7061 6582 gene locus_tag LOCUS_10980 7061 6582 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_10980 7638 8084 gene locus_tag LOCUS_10990 gene paaI 7638 8084 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_10990 8690 8157 gene locus_tag LOCUS_11000 8690 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 9848 8733 gene locus_tag LOCUS_11010 gene ahbD 9848 8733 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11010 10832 9852 gene locus_tag LOCUS_11020 gene hemB 10832 9852 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_11020 11914 10997 gene locus_tag LOCUS_11030 gene fmt 11914 10997 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_11030 12966 11950 gene locus_tag LOCUS_11040 12966 11950 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_11040 13517 13035 gene locus_tag LOCUS_11050 13517 13035 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_11050 14100 13639 gene locus_tag LOCUS_11060 14100 13639 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_11060 14613 14125 gene locus_tag LOCUS_11070 14613 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 15033 14623 gene locus_tag LOCUS_11080 15033 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 15351 15785 gene locus_tag LOCUS_11090 15351 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546783.1 protein_id gnl|my_center|LOCUS_11090 17056 15899 gene locus_tag LOCUS_11100 17056 15899 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_11100 17464 17802 gene locus_tag LOCUS_11110 17464 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 18026 17886 gene locus_tag LOCUS_11120 18026 17886 CDS product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083239502.1 protein_id gnl|my_center|LOCUS_11120 19732 18365 gene locus_tag LOCUS_11130 19732 18365 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_11130 21032 19698 gene locus_tag LOCUS_11140 21032 19698 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_11140 21192 21851 gene locus_tag LOCUS_11150 21192 21851 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_11150 21881 22552 gene locus_tag LOCUS_11160 21881 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 22989 22666 gene locus_tag LOCUS_11170 22989 22666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 23416 23859 gene locus_tag LOCUS_11180 23416 23859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 24434 24000 gene locus_tag LOCUS_11190 24434 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 24936 24436 gene locus_tag LOCUS_11200 24936 24436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 25663 24914 gene locus_tag LOCUS_11210 25663 24914 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_11210 27759 25783 gene locus_tag LOCUS_11220 27759 25783 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_11220 28441 27746 gene locus_tag LOCUS_11230 28441 27746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 29043 28438 gene locus_tag LOCUS_11240 29043 28438 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence033 <1 652 gene locus_tag LOCUS_11250 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942409.1:polyprenyl synthetase family protein 737 2674 gene locus_tag LOCUS_11260 gene dxs 737 2674 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_11260 1304 1211 gene locus_tag LOCUS_t00110 1304 1211 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2631 3386 gene locus_tag LOCUS_11270 2631 3386 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_11270 3386 3856 gene locus_tag LOCUS_11280 gene rlmH 3386 3856 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027000.1 protein_id gnl|my_center|LOCUS_11280 4102 3884 gene locus_tag LOCUS_11290 4102 3884 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_11290 4359 4892 gene locus_tag LOCUS_11300 gene hpt 4359 4892 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_11300 4943 5707 gene locus_tag LOCUS_11310 4943 5707 CDS product zinc-ribbon and DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938880.1 protein_id gnl|my_center|LOCUS_11310 5931 7130 gene locus_tag LOCUS_11320 gene serS 5931 7130 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_11320 7157 7438 gene locus_tag LOCUS_11330 7157 7438 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_11330 7995 7666 gene locus_tag LOCUS_11340 7995 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8281 8003 gene locus_tag LOCUS_11350 8281 8003 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_11350 10330 8294 gene locus_tag LOCUS_11360 gene ligA 10330 8294 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_11360 11118 10399 gene locus_tag LOCUS_11370 11118 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 11475 11203 gene locus_tag LOCUS_11380 11475 11203 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_11380 11854 13140 gene locus_tag LOCUS_11390 11854 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13143 15374 gene locus_tag LOCUS_11400 gene priA 13143 15374 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_11400 15381 17060 gene locus_tag LOCUS_11410 15381 17060 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237994.1 protein_id gnl|my_center|LOCUS_11410 17967 17077 gene locus_tag LOCUS_11420 17967 17077 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_11420 18881 18087 gene locus_tag LOCUS_11430 18881 18087 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_11430 19918 19337 gene locus_tag LOCUS_11440 gene satP 19918 19337 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 protein_id gnl|my_center|LOCUS_11440 25102 20729 gene locus_tag LOCUS_11450 25102 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 25681 26064 gene locus_tag LOCUS_11460 25681 26064 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_11460 26224 28911 gene locus_tag LOCUS_11470 gene clpB 26224 28911 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253835.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence034 159 1052 gene locus_tag LOCUS_11480 159 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1065 1433 gene locus_tag LOCUS_11490 1065 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1462 2130 gene locus_tag LOCUS_11500 1462 2130 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_11500 3551 2181 gene locus_tag LOCUS_11510 gene rfbH 3551 2181 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_11510 5185 3725 gene locus_tag LOCUS_11520 gene hldE 5185 3725 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404685.1 protein_id gnl|my_center|LOCUS_11520 5708 5409 gene locus_tag LOCUS_11530 5708 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6939 5860 gene locus_tag LOCUS_11540 gene rfbG 6939 5860 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_11540 7163 6927 gene locus_tag LOCUS_11550 7163 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7307 8314 gene locus_tag LOCUS_11560 7307 8314 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_11560 8553 10247 gene locus_tag LOCUS_11570 8553 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 10449 11495 gene locus_tag LOCUS_11580 10449 11495 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_11580 11645 12571 gene locus_tag LOCUS_11590 gene rfbA 11645 12571 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_11590 12845 13570 gene locus_tag LOCUS_11600 gene elyC 12845 13570 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 protein_id gnl|my_center|LOCUS_11600 13838 14872 gene locus_tag LOCUS_11610 13838 14872 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_11610 15232 16413 gene locus_tag LOCUS_11620 15232 16413 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_11620 18379 20127 gene locus_tag LOCUS_11630 18379 20127 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_11630 20322 21947 gene locus_tag LOCUS_11640 20322 21947 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942489.1 protein_id gnl|my_center|LOCUS_11640 22499 22684 gene locus_tag LOCUS_11650 22499 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 22678 23883 gene locus_tag LOCUS_11660 22678 23883 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525085.1 protein_id gnl|my_center|LOCUS_11660 23913 26210 gene locus_tag LOCUS_11670 23913 26210 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525086.1 protein_id gnl|my_center|LOCUS_11670 26905 28089 gene locus_tag LOCUS_11680 gene gmd 26905 28089 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_11680 28274 28068 gene locus_tag LOCUS_11690 28274 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence035 259 759 gene locus_tag LOCUS_11700 259 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 756 1373 gene locus_tag LOCUS_11710 756 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2399 1467 gene locus_tag LOCUS_11720 2399 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3399 4343 gene locus_tag LOCUS_11730 gene cdhD 3399 4343 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_11730 4422 6419 gene locus_tag LOCUS_11740 gene cooS 4422 6419 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_11740 6507 8726 gene locus_tag LOCUS_11750 gene acsB 6507 8726 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_11750 8802 10142 gene locus_tag LOCUS_11760 gene acsC 8802 10142 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_11760 10162 11046 gene locus_tag LOCUS_11770 10162 11046 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546439.1 protein_id gnl|my_center|LOCUS_11770 12401 11166 gene locus_tag LOCUS_11780 gene icd 12401 11166 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_11780 13273 12398 gene locus_tag LOCUS_11790 gene prmA 13273 12398 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_11790 13737 13363 gene locus_tag LOCUS_11800 13737 13363 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_11800 14006 15019 gene locus_tag LOCUS_11810 14006 15019 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940752.1 protein_id gnl|my_center|LOCUS_11810 15544 15032 gene locus_tag LOCUS_11820 15544 15032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_11820 16079 17245 gene locus_tag LOCUS_11830 16079 17245 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_11830 18643 17504 gene locus_tag LOCUS_11840 18643 17504 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_11840 19655 18876 gene locus_tag LOCUS_11850 19655 18876 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_11850 20518 19667 gene locus_tag LOCUS_11860 20518 19667 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_11860 21001 20768 gene locus_tag LOCUS_11870 21001 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 22186 21002 gene locus_tag LOCUS_11880 22186 21002 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_11880 22727 23449 gene locus_tag LOCUS_11890 22727 23449 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845492.1 protein_id gnl|my_center|LOCUS_11890 23449 23631 gene locus_tag LOCUS_11900 23449 23631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 24268 23612 gene locus_tag LOCUS_11910 24268 23612 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_11910 25059 24271 gene locus_tag LOCUS_11920 25059 24271 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_11920 25949 25149 gene locus_tag LOCUS_11930 25949 25149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 27894 26077 gene locus_tag LOCUS_11940 27894 26077 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence036 <1 841 gene locus_tag LOCUS_11950 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957093.1:translation elongation factor 4 834 1952 gene locus_tag LOCUS_11960 gene hemW 834 1952 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_11960 2679 2479 gene locus_tag LOCUS_11970 gene cspB 2679 2479 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179150.1 protein_id gnl|my_center|LOCUS_11970 3912 3157 gene locus_tag LOCUS_11980 3912 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4221 6131 gene locus_tag LOCUS_11990 gene ftsH 4221 6131 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528329.1 protein_id gnl|my_center|LOCUS_11990 6276 6536 gene locus_tag LOCUS_12000 gene rpsT 6276 6536 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545489.1 protein_id gnl|my_center|LOCUS_12000 7600 6533 gene locus_tag LOCUS_12010 7600 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 8217 7603 gene locus_tag LOCUS_12020 8217 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 10793 8304 gene locus_tag LOCUS_12030 gene leuS 10793 8304 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_12030 13029 11074 gene locus_tag LOCUS_12040 gene metG 13029 11074 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_12040 13870 13052 gene locus_tag LOCUS_12050 13870 13052 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_12050 14846 13815 gene locus_tag LOCUS_12060 gene holB 14846 13815 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583155.1 protein_id gnl|my_center|LOCUS_12060 15938 14904 gene locus_tag LOCUS_12070 15938 14904 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_12070 16239 16478 gene locus_tag LOCUS_12080 16239 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 16471 18366 gene locus_tag LOCUS_12090 16471 18366 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_12090 19585 18455 gene locus_tag LOCUS_12100 19585 18455 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_12100 20200 19673 gene locus_tag LOCUS_12110 20200 19673 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_12110 20721 20323 gene locus_tag LOCUS_12120 20721 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12120 21076 21414 gene locus_tag LOCUS_12130 21076 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 22847 21567 gene locus_tag LOCUS_12140 gene odhB 22847 21567 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_12140 25761 23038 gene locus_tag LOCUS_12150 25761 23038 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_12150 26546 26163 gene locus_tag LOCUS_12160 26546 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 26933 27718 gene locus_tag LOCUS_12170 gene pcaD 26933 27718 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 protein_id gnl|my_center|LOCUS_12170 28683 27787 gene locus_tag LOCUS_12180 28683 27787 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence037 1213 548 gene locus_tag LOCUS_12190 1213 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3061 1217 gene locus_tag LOCUS_12200 gene treZ 3061 1217 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_12200 3697 3209 gene locus_tag LOCUS_12210 3697 3209 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_12210 4186 3953 gene locus_tag LOCUS_12220 4186 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4737 6245 gene locus_tag LOCUS_12230 4737 6245 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_12230 7745 6282 gene locus_tag LOCUS_12240 7745 6282 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_12240 8263 9300 gene locus_tag LOCUS_12250 8263 9300 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925684.1 protein_id gnl|my_center|LOCUS_12250 10018 9482 gene locus_tag LOCUS_12260 10018 9482 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338151.1 protein_id gnl|my_center|LOCUS_12260 10294 10046 gene locus_tag LOCUS_12270 10294 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 10414 11190 gene locus_tag LOCUS_12280 10414 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11322 11696 gene locus_tag LOCUS_12290 11322 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 11940 12614 gene locus_tag LOCUS_12300 11940 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 12614 13105 gene locus_tag LOCUS_12310 gene moaC 12614 13105 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705487.1 protein_id gnl|my_center|LOCUS_12310 13186 13548 gene locus_tag LOCUS_12320 gene dksA 13186 13548 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939427.1 protein_id gnl|my_center|LOCUS_12320 14562 13564 gene locus_tag LOCUS_12330 14562 13564 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192063.1 protein_id gnl|my_center|LOCUS_12330 15328 14585 gene locus_tag LOCUS_12340 gene cobS 15328 14585 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_12340 15895 15365 gene locus_tag LOCUS_12350 gene cobU 15895 15365 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388428.1 protein_id gnl|my_center|LOCUS_12350 16326 15892 gene locus_tag LOCUS_12360 16326 15892 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_12360 16606 16367 gene locus_tag LOCUS_12370 16606 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 16797 17348 gene locus_tag LOCUS_12380 16797 17348 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_12380 17371 18735 gene locus_tag LOCUS_12390 17371 18735 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_12390 19614 18937 gene locus_tag LOCUS_12400 19614 18937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 21055 19646 gene locus_tag LOCUS_12410 gene mnmE 21055 19646 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_12410 21754 21074 gene locus_tag LOCUS_12420 21754 21074 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966995.1 protein_id gnl|my_center|LOCUS_12420 23487 21817 gene locus_tag LOCUS_12430 gene yidC 23487 21817 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_12430 24095 23745 gene locus_tag LOCUS_12440 gene rnpA 24095 23745 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_12440 25360 24431 gene locus_tag LOCUS_12450 25360 24431 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_12450 26030 25377 gene locus_tag LOCUS_12460 26030 25377 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_12460 <28701 26027 gene locus_tag LOCUS_12470 <28701 26027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence038 7 678 gene locus_tag LOCUS_12480 7 678 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791820.1 protein_id gnl|my_center|LOCUS_12480 797 1717 gene locus_tag LOCUS_12490 797 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2741 3193 gene locus_tag LOCUS_12500 gene nuoE 2741 3193 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_12500 3177 4982 gene locus_tag LOCUS_12510 gene nuoF 3177 4982 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_12510 5053 7770 gene locus_tag LOCUS_12520 gene fdhF 5053 7770 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_12520 8631 9653 gene locus_tag LOCUS_12530 8631 9653 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206423.1 protein_id gnl|my_center|LOCUS_12530 9709 10053 gene locus_tag LOCUS_12540 9709 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 10014 10166 gene locus_tag LOCUS_12550 10014 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10418 11410 gene locus_tag LOCUS_12560 10418 11410 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206423.1 protein_id gnl|my_center|LOCUS_12560 11447 13138 gene locus_tag LOCUS_12570 11447 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 13161 14270 gene locus_tag LOCUS_12580 13161 14270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_12580 14267 14911 gene locus_tag LOCUS_12590 14267 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 15091 15270 gene locus_tag LOCUS_12600 15091 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 15274 15477 gene locus_tag LOCUS_12610 15274 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 15530 16018 gene locus_tag LOCUS_12620 15530 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 16132 16061 gene locus_tag LOCUS_t00120 16132 16061 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17307 16282 gene locus_tag LOCUS_12630 17307 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 17528 17304 gene locus_tag LOCUS_12640 17528 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 17884 17531 gene locus_tag LOCUS_12650 17884 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 18620 18114 gene locus_tag LOCUS_12660 18620 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 19113 18604 gene locus_tag LOCUS_12670 19113 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 19808 19095 gene locus_tag LOCUS_12680 19808 19095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 20778 19789 gene locus_tag LOCUS_12690 20778 19789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 20915 21307 gene locus_tag LOCUS_12700 20915 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 22074 21313 gene locus_tag LOCUS_12710 22074 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 22672 22076 gene locus_tag LOCUS_12720 22672 22076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 23598 22684 gene locus_tag LOCUS_12730 23598 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 23806 23579 gene locus_tag LOCUS_12740 23806 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 24197 23793 gene locus_tag LOCUS_12750 24197 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 24501 24190 gene locus_tag LOCUS_12760 24501 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 25422 24511 gene locus_tag LOCUS_12770 25422 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 25765 25538 gene locus_tag LOCUS_12780 25765 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 26018 25770 gene locus_tag LOCUS_12790 26018 25770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 27880 26015 gene locus_tag LOCUS_12800 27880 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence039 176 15 gene locus_tag LOCUS_12810 176 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 159 1763 gene locus_tag LOCUS_12820 159 1763 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_12820 1818 2933 gene locus_tag LOCUS_12830 1818 2933 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_12830 2984 3766 gene locus_tag LOCUS_12840 2984 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4530 3781 gene locus_tag LOCUS_12850 4530 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 7737 4711 gene locus_tag LOCUS_12860 7737 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8668 7898 gene locus_tag LOCUS_12870 8668 7898 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_12870 9242 9649 gene locus_tag LOCUS_12880 9242 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9658 10554 gene locus_tag LOCUS_12890 9658 10554 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_12890 10618 11394 gene locus_tag LOCUS_12900 10618 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11465 13132 gene locus_tag LOCUS_12910 11465 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 13731 13279 gene locus_tag LOCUS_12920 gene trxA 13731 13279 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_12920 13965 14609 gene locus_tag LOCUS_12930 13965 14609 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768312.1 protein_id gnl|my_center|LOCUS_12930 14635 15414 gene locus_tag LOCUS_12940 14635 15414 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_12940 15438 16229 gene locus_tag LOCUS_12950 gene folE2 15438 16229 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_12950 16392 17999 gene locus_tag LOCUS_12960 16392 17999 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_12960 18124 18324 gene locus_tag LOCUS_12970 18124 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 19583 18669 gene locus_tag LOCUS_12980 19583 18669 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_12980 20181 19552 gene locus_tag LOCUS_12990 20181 19552 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_12990 20725 20303 gene locus_tag LOCUS_13000 20725 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 20941 21537 gene locus_tag LOCUS_13010 20941 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 21994 21515 gene locus_tag LOCUS_13020 21994 21515 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_13020 22082 26785 gene locus_tag LOCUS_13030 22082 26785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence040 106 324 gene locus_tag LOCUS_13040 106 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 393 1478 gene locus_tag LOCUS_13050 gene hflK 393 1478 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_13050 1566 2546 gene locus_tag LOCUS_13060 gene hflC 1566 2546 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_13060 2563 3777 gene locus_tag LOCUS_13070 2563 3777 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_13070 3796 4158 gene locus_tag LOCUS_13080 3796 4158 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937449.1 protein_id gnl|my_center|LOCUS_13080 5562 4324 gene locus_tag LOCUS_13090 5562 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6052 7719 gene locus_tag LOCUS_13100 gene argS 6052 7719 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_13100 7745 8524 gene locus_tag LOCUS_13110 7745 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 8899 9993 gene locus_tag LOCUS_13120 8899 9993 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_13120 10170 10655 gene locus_tag LOCUS_13130 10170 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 10909 12621 gene locus_tag LOCUS_13140 10909 12621 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_13140 13011 15431 gene locus_tag LOCUS_13150 gene gyrB 13011 15431 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_13150 15567 17996 gene locus_tag LOCUS_13160 gene gyrA 15567 17996 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_13160 17993 19024 gene locus_tag LOCUS_13170 17993 19024 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_13170 19317 21980 gene locus_tag LOCUS_13180 19317 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 22175 23251 gene locus_tag LOCUS_13190 22175 23251 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_13190 23482 23904 gene locus_tag LOCUS_13200 23482 23904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939266.1 protein_id gnl|my_center|LOCUS_13200 24705 23938 gene locus_tag LOCUS_13210 24705 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 25411 24722 gene locus_tag LOCUS_13220 25411 24722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 26037 25408 gene locus_tag LOCUS_13230 26037 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 26018 26266 gene locus_tag LOCUS_13240 26018 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 26291 26491 gene locus_tag LOCUS_13250 26291 26491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 27104 26619 gene locus_tag LOCUS_13260 27104 26619 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528293.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence041 <1 1151 gene locus_tag LOCUS_13270 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086860976.1:TOMM precursor leader peptide-binding protein 2878 1202 gene locus_tag LOCUS_13280 2878 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4297 2897 gene locus_tag LOCUS_13290 4297 2897 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_13290 5329 4349 gene locus_tag LOCUS_13300 5329 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6074 5385 gene locus_tag LOCUS_13310 6074 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7938 6247 gene locus_tag LOCUS_13320 gene asnB 7938 6247 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_13320 9070 8000 gene locus_tag LOCUS_13330 9070 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9256 10125 gene locus_tag LOCUS_13340 9256 10125 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_13340 11337 10156 gene locus_tag LOCUS_13350 11337 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13146 11398 gene locus_tag LOCUS_13360 13146 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 14680 13220 gene locus_tag LOCUS_13370 14680 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17660 14721 gene locus_tag LOCUS_13380 17660 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 19948 17657 gene locus_tag LOCUS_13390 19948 17657 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13390 21528 20068 gene locus_tag LOCUS_13400 21528 20068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 22150 21758 gene locus_tag LOCUS_13410 22150 21758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 22500 22255 gene locus_tag LOCUS_13420 22500 22255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 22988 24685 gene locus_tag LOCUS_13430 22988 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 24691 26073 gene locus_tag LOCUS_13440 24691 26073 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence042 958 1374 gene locus_tag LOCUS_13450 958 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1509 1772 gene locus_tag LOCUS_13460 1509 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1836 2615 gene locus_tag LOCUS_13470 1836 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2605 3588 gene locus_tag LOCUS_13480 2605 3588 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_13480 4166 3687 gene locus_tag LOCUS_13490 4166 3687 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_13490 4449 5099 gene locus_tag LOCUS_13500 gene thiE 4449 5099 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_13500 5363 5160 gene locus_tag LOCUS_13510 5363 5160 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_13510 6047 5436 gene locus_tag LOCUS_13520 6047 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6286 6044 gene locus_tag LOCUS_13530 6286 6044 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_13530 6398 6649 gene locus_tag LOCUS_13540 6398 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 7378 6530 gene locus_tag LOCUS_13550 gene phnX 7378 6530 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 protein_id gnl|my_center|LOCUS_13550 8458 7577 gene locus_tag LOCUS_13560 gene sucD 8458 7577 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_13560 9637 8471 gene locus_tag LOCUS_13570 gene sucC 9637 8471 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_13570 12238 9989 gene locus_tag LOCUS_13580 12238 9989 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_13580 12420 12235 gene locus_tag LOCUS_13590 12420 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12531 12947 gene locus_tag LOCUS_13600 12531 12947 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_13600 13731 13045 gene locus_tag LOCUS_13610 13731 13045 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_13610 13954 15582 gene locus_tag LOCUS_13620 gene hcp 13954 15582 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_13620 15666 16358 gene locus_tag LOCUS_13630 15666 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 16399 17139 gene locus_tag LOCUS_13640 16399 17139 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_13640 17725 18261 gene locus_tag LOCUS_13650 17725 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 18540 18334 gene locus_tag LOCUS_13660 18540 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 19083 20021 gene locus_tag LOCUS_13670 19083 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 20782 20078 gene locus_tag LOCUS_13680 20782 20078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_13680 21560 20775 gene locus_tag LOCUS_13690 21560 20775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925352.1 protein_id gnl|my_center|LOCUS_13690 22599 21550 gene locus_tag LOCUS_13700 22599 21550 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_13700 23492 22599 gene locus_tag LOCUS_13710 23492 22599 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_13710 24784 23651 gene locus_tag LOCUS_13720 24784 23651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_13720 26169 24934 gene locus_tag LOCUS_13730 26169 24934 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_13730 26686 26243 gene locus_tag LOCUS_13740 26686 26243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939911.1 protein_id gnl|my_center|LOCUS_13740 27072 26914 gene locus_tag LOCUS_13750 27072 26914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 <27882 27128 gene locus_tag LOCUS_13760 <27882 27128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000347567.1:low-specificity L-threonine aldolase >Feature sequence043 777 337 gene locus_tag LOCUS_13770 777 337 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_13770 3275 1881 gene locus_tag LOCUS_13780 3275 1881 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942633.1 protein_id gnl|my_center|LOCUS_13780 4314 3268 gene locus_tag LOCUS_13790 4314 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 6014 5826 gene locus_tag LOCUS_13800 6014 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6450 6911 gene locus_tag LOCUS_13810 gene mraZ 6450 6911 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_13810 7072 7863 gene locus_tag LOCUS_13820 gene rsmH 7072 7863 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_13820 8153 7914 gene locus_tag LOCUS_13830 8153 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8215 8403 gene locus_tag LOCUS_13840 8215 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 8492 8848 gene locus_tag LOCUS_13850 8492 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 8873 10849 gene locus_tag LOCUS_13860 8873 10849 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_13860 11031 12554 gene locus_tag LOCUS_13870 11031 12554 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_13870 12551 13951 gene locus_tag LOCUS_13880 12551 13951 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_13880 13948 15297 gene locus_tag LOCUS_13890 gene murD 13948 15297 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_13890 15508 16689 gene locus_tag LOCUS_13900 gene ftsW 15508 16689 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_13900 16682 18103 gene locus_tag LOCUS_13910 gene murC 16682 18103 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_13910 18079 19029 gene locus_tag LOCUS_13920 gene murB 18079 19029 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_13920 19317 19913 gene locus_tag LOCUS_13930 19317 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 19984 21207 gene locus_tag LOCUS_13940 gene ftsA 19984 21207 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_13940 21307 22581 gene locus_tag LOCUS_13950 gene ftsZ 21307 22581 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_13950 22792 24759 gene locus_tag LOCUS_13960 22792 24759 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974271.1 protein_id gnl|my_center|LOCUS_13960 25088 25639 gene locus_tag LOCUS_13970 25088 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 26069 25881 gene locus_tag LOCUS_13980 26069 25881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence044 202 1284 gene locus_tag LOCUS_13990 gene recA 202 1284 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_13990 1339 3999 gene locus_tag LOCUS_14000 gene alaS 1339 3999 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_14000 4378 5364 gene locus_tag LOCUS_14010 4378 5364 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_14010 5683 6999 gene locus_tag LOCUS_14020 5683 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8471 7140 gene locus_tag LOCUS_14030 gene rimO 8471 7140 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_14030 9563 8559 gene locus_tag LOCUS_14040 9563 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 9774 9989 gene locus_tag LOCUS_14050 9774 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 10573 10130 gene locus_tag LOCUS_14060 10573 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 11584 10577 gene locus_tag LOCUS_14070 11584 10577 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_14070 12332 11706 gene locus_tag LOCUS_14080 gene rpsD 12332 11706 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_14080 12779 12384 gene locus_tag LOCUS_14090 gene rpsK 12779 12384 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_14090 13166 12792 gene locus_tag LOCUS_14100 gene rpsM 13166 12792 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_14100 13553 13332 gene locus_tag LOCUS_14110 gene infA 13553 13332 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_14110 14375 13599 gene locus_tag LOCUS_14120 gene map 14375 13599 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_14120 15029 14388 gene locus_tag LOCUS_14130 15029 14388 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_14130 16425 15115 gene locus_tag LOCUS_14140 gene secY 16425 15115 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_14140 16887 16429 gene locus_tag LOCUS_14150 gene rplO 16887 16429 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_14150 17094 16912 gene locus_tag LOCUS_14160 gene rpmD 17094 16912 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_14160 17675 17178 gene locus_tag LOCUS_14170 gene rpsE 17675 17178 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_14170 18074 17703 gene locus_tag LOCUS_14180 gene rplR 18074 17703 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_14180 18632 18090 gene locus_tag LOCUS_14190 gene rplF 18632 18090 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_14190 19073 18675 gene locus_tag LOCUS_14200 gene rpsH 19073 18675 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_14200 19288 19103 gene locus_tag LOCUS_14210 19288 19103 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_14210 19842 19303 gene locus_tag LOCUS_14220 gene rplE 19842 19303 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_14220 20202 19879 gene locus_tag LOCUS_14230 gene rplX 20202 19879 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_14230 20591 20223 gene locus_tag LOCUS_14240 gene rplN 20591 20223 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_14240 20900 20637 gene locus_tag LOCUS_14250 gene rpsQ 20900 20637 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_14250 21114 20914 gene locus_tag LOCUS_14260 gene rpmC 21114 20914 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_14260 21479 21111 gene locus_tag LOCUS_14270 gene rplP 21479 21111 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_14270 22258 21632 gene locus_tag LOCUS_14280 gene rpsC 22258 21632 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_14280 22654 22322 gene locus_tag LOCUS_14290 gene rplV 22654 22322 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_14290 22941 22654 gene locus_tag LOCUS_14300 gene rpsS 22941 22654 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_14300 23860 23036 gene locus_tag LOCUS_14310 gene rplB 23860 23036 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_14310 24175 23882 gene locus_tag LOCUS_14320 24175 23882 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_14320 24804 24172 gene locus_tag LOCUS_14330 gene rplD 24804 24172 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_14330 25462 24830 gene locus_tag LOCUS_14340 gene rplC 25462 24830 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_14340 25816 25505 gene locus_tag LOCUS_14350 gene rpsJ 25816 25505 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_14350 <27067 25880 gene locus_tag LOCUS_14360 <27067 25880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940180.1:elongation factor Tu >Feature sequence045 720 538 gene locus_tag LOCUS_14370 720 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1101 5732 gene locus_tag LOCUS_14380 1101 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 5729 8125 gene locus_tag LOCUS_14390 5729 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 8122 9459 gene locus_tag LOCUS_14400 8122 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 10505 9456 gene locus_tag LOCUS_14410 10505 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 11402 10509 gene locus_tag LOCUS_14420 gene pyrB 11402 10509 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_14420 12441 11422 gene locus_tag LOCUS_14430 12441 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 13418 12567 gene locus_tag LOCUS_14440 13418 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 13895 15583 gene locus_tag LOCUS_14450 13895 15583 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_14450 15982 17250 gene locus_tag LOCUS_14460 15982 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 17291 18652 gene locus_tag LOCUS_14470 17291 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 18666 19304 gene locus_tag LOCUS_14480 18666 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 19351 20340 gene locus_tag LOCUS_14490 19351 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 20407 20733 gene locus_tag LOCUS_14500 20407 20733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 20737 21150 gene locus_tag LOCUS_14510 20737 21150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 21150 21740 gene locus_tag LOCUS_14520 21150 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 21715 22158 gene locus_tag LOCUS_14530 21715 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 22169 23125 gene locus_tag LOCUS_14540 22169 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 23152 23571 gene locus_tag LOCUS_14550 23152 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence046 907 125 gene locus_tag LOCUS_14560 907 125 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_14560 1472 954 gene locus_tag LOCUS_14570 1472 954 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_14570 1772 1608 gene locus_tag LOCUS_14580 1772 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2137 1772 gene locus_tag LOCUS_14590 2137 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3053 2412 gene locus_tag LOCUS_14600 gene pyrE 3053 2412 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_14600 3597 3076 gene locus_tag LOCUS_14610 3597 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4693 3770 gene locus_tag LOCUS_14620 4693 3770 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_14620 5076 6965 gene locus_tag LOCUS_14630 gene mnmG 5076 6965 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_14630 7085 7522 gene locus_tag LOCUS_14640 7085 7522 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_14640 7906 8703 gene locus_tag LOCUS_14650 7906 8703 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_14650 8718 9707 gene locus_tag LOCUS_14660 8718 9707 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_14660 9931 10455 gene locus_tag LOCUS_14670 gene spy 9931 10455 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705764.1 protein_id gnl|my_center|LOCUS_14670 10439 11134 gene locus_tag LOCUS_14680 gene rpoE 10439 11134 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_14680 11151 11450 gene locus_tag LOCUS_14690 11151 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 11464 11868 gene locus_tag LOCUS_14700 11464 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 12084 11884 gene locus_tag LOCUS_14710 12084 11884 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_14710 12880 12371 gene locus_tag LOCUS_14720 gene coaD 12880 12371 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_14720 13454 12900 gene locus_tag LOCUS_14730 gene rsmD 13454 12900 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241227.1 protein_id gnl|my_center|LOCUS_14730 14480 13461 gene locus_tag LOCUS_14740 14480 13461 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_14740 15731 14661 gene locus_tag LOCUS_14750 15731 14661 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_14750 16259 15759 gene locus_tag LOCUS_14760 gene leuD 16259 15759 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_14760 17524 16259 gene locus_tag LOCUS_14770 gene leuC 17524 16259 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_14770 18428 17538 gene locus_tag LOCUS_14780 gene pssA 18428 17538 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_14780 19078 18413 gene locus_tag LOCUS_14790 19078 18413 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_14790 20294 19293 gene locus_tag LOCUS_14800 gene ilvC 20294 19293 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_14800 20818 20318 gene locus_tag LOCUS_14810 gene ilvN 20818 20318 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_14810 22579 20861 gene locus_tag LOCUS_14820 gene ilvB 22579 20861 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_14820 24310 22919 gene locus_tag LOCUS_14830 gene cbpB 24310 22919 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence047 214 1209 gene locus_tag LOCUS_14840 214 1209 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_14840 1283 2281 gene locus_tag LOCUS_14850 gene hpnH 1283 2281 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_14850 2274 3128 gene locus_tag LOCUS_14860 2274 3128 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_14860 3830 3048 gene locus_tag LOCUS_14870 3830 3048 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942542.1 protein_id gnl|my_center|LOCUS_14870 4791 5525 gene locus_tag LOCUS_14880 4791 5525 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233691.1 protein_id gnl|my_center|LOCUS_14880 5546 6361 gene locus_tag LOCUS_14890 5546 6361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939615.1 protein_id gnl|my_center|LOCUS_14890 6390 7097 gene locus_tag LOCUS_14900 6390 7097 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939614.1 protein_id gnl|my_center|LOCUS_14900 7099 7791 gene locus_tag LOCUS_14910 7099 7791 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939613.1 protein_id gnl|my_center|LOCUS_14910 8168 8010 gene locus_tag LOCUS_14920 8168 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8106 10091 gene locus_tag LOCUS_14930 8106 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 10833 11795 gene locus_tag LOCUS_14940 10833 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 13180 11810 gene locus_tag LOCUS_14950 13180 11810 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_14950 13445 14560 gene locus_tag LOCUS_14960 13445 14560 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_14960 15626 14781 gene locus_tag LOCUS_14970 15626 14781 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_14970 16259 15642 gene locus_tag LOCUS_14980 16259 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 17044 16349 gene locus_tag LOCUS_14990 17044 16349 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 protein_id gnl|my_center|LOCUS_14990 18286 17297 gene locus_tag LOCUS_15000 18286 17297 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_15000 18505 19614 gene locus_tag LOCUS_15010 gene hisC 18505 19614 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_15010 19621 20298 gene locus_tag LOCUS_15020 gene cmk 19621 20298 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 protein_id gnl|my_center|LOCUS_15020 20396 22165 gene locus_tag LOCUS_15030 20396 22165 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_15030 22267 23139 gene locus_tag LOCUS_15040 gene sppA 22267 23139 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_15040 23800 23186 gene locus_tag LOCUS_15050 23800 23186 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_15050 23926 24984 gene locus_tag LOCUS_15060 23926 24984 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence048 3482 1974 gene locus_tag LOCUS_15070 3482 1974 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459208.1 protein_id gnl|my_center|LOCUS_15070 3863 3492 gene locus_tag LOCUS_15080 3863 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5015 4056 gene locus_tag LOCUS_15090 5015 4056 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_15090 6527 5598 gene locus_tag LOCUS_15100 6527 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 7597 6824 gene locus_tag LOCUS_15110 gene modA 7597 6824 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 protein_id gnl|my_center|LOCUS_15110 8271 7594 gene locus_tag LOCUS_15120 gene modB 8271 7594 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_15120 8909 10027 gene locus_tag LOCUS_15130 8909 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9997 10233 gene locus_tag LOCUS_15140 9997 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 10640 11401 gene locus_tag LOCUS_15150 10640 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 11487 12269 gene locus_tag LOCUS_15160 11487 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 12886 13446 gene locus_tag LOCUS_15170 12886 13446 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_15170 13443 14324 gene locus_tag LOCUS_15180 13443 14324 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_15180 14353 16311 gene locus_tag LOCUS_15190 14353 16311 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939674.1 protein_id gnl|my_center|LOCUS_15190 16299 17762 gene locus_tag LOCUS_15200 16299 17762 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939673.1 protein_id gnl|my_center|LOCUS_15200 17762 18829 gene locus_tag LOCUS_15210 17762 18829 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_15210 18822 19667 gene locus_tag LOCUS_15220 18822 19667 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_15220 20401 19838 gene locus_tag LOCUS_15230 20401 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 21629 20406 gene locus_tag LOCUS_15240 21629 20406 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942678.1 protein_id gnl|my_center|LOCUS_15240 22033 21626 gene locus_tag LOCUS_15250 22033 21626 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942679.1 protein_id gnl|my_center|LOCUS_15250 22517 22008 gene locus_tag LOCUS_15260 22517 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 <26193 22514 gene locus_tag LOCUS_15270 <26193 22514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942681.1:PilC/PilY family type IV pilus protein >Feature sequence049 2730 586 gene locus_tag LOCUS_15280 2730 586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122387.1 protein_id gnl|my_center|LOCUS_15280 4100 2772 gene locus_tag LOCUS_15290 4100 2772 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922250.1 protein_id gnl|my_center|LOCUS_15290 5298 4324 gene locus_tag LOCUS_15300 5298 4324 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_15300 5964 5362 gene locus_tag LOCUS_15310 5964 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6717 6049 gene locus_tag LOCUS_15320 6717 6049 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_15320 6771 7028 gene locus_tag LOCUS_15330 6771 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8057 7035 gene locus_tag LOCUS_15340 8057 7035 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938970.1 protein_id gnl|my_center|LOCUS_15340 9568 8123 gene locus_tag LOCUS_15350 9568 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9788 11635 gene locus_tag LOCUS_15360 gene mutL 9788 11635 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_15360 11601 12572 gene locus_tag LOCUS_15370 gene miaA 11601 12572 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_15370 12627 13694 gene locus_tag LOCUS_15380 12627 13694 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876410.1 protein_id gnl|my_center|LOCUS_15380 15715 13814 gene locus_tag LOCUS_15390 15715 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 19087 16394 gene locus_tag LOCUS_15400 gene acnA 19087 16394 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_15400 19498 20574 gene locus_tag LOCUS_15410 gene dmlA 19498 20574 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978494.1 protein_id gnl|my_center|LOCUS_15410 22114 20735 gene locus_tag LOCUS_15420 22114 20735 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_15420 23490 22648 gene locus_tag LOCUS_15430 gene hag 23490 22648 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_15430 25009 23912 gene locus_tag LOCUS_15440 25009 23912 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479905.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence050 210 1097 gene locus_tag LOCUS_15450 gene folD 210 1097 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_15450 3207 1201 gene locus_tag LOCUS_15460 3207 1201 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15460 3645 3244 gene locus_tag LOCUS_15470 3645 3244 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_15470 4148 4645 gene locus_tag LOCUS_15480 4148 4645 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_15480 4764 5369 gene locus_tag LOCUS_15490 4764 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5427 5717 gene locus_tag LOCUS_15500 gene gatC 5427 5717 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_15500 5792 7252 gene locus_tag LOCUS_15510 gene gatA 5792 7252 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_15510 7830 7408 gene locus_tag LOCUS_15520 7830 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 9504 8374 gene locus_tag LOCUS_15530 9504 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 10692 9565 gene locus_tag LOCUS_15540 10692 9565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_15540 12461 10740 gene locus_tag LOCUS_15550 12461 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 13836 12820 gene locus_tag LOCUS_15560 13836 12820 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861989.1 protein_id gnl|my_center|LOCUS_15560 15016 14033 gene locus_tag LOCUS_15570 gene ala 15016 14033 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_15570 15353 15982 gene locus_tag LOCUS_15580 15353 15982 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_15580 16007 16732 gene locus_tag LOCUS_15590 16007 16732 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965675.1 protein_id gnl|my_center|LOCUS_15590 17571 18494 gene locus_tag LOCUS_15600 17571 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 18594 18510 gene locus_tag LOCUS_t00130 18594 18510 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18802 19176 gene locus_tag LOCUS_15610 18802 19176 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 protein_id gnl|my_center|LOCUS_15610 19610 19332 gene locus_tag LOCUS_15620 19610 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 20392 19646 gene locus_tag LOCUS_15630 20392 19646 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_15630 21060 20488 gene locus_tag LOCUS_15640 21060 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 21703 21131 gene locus_tag LOCUS_15650 21703 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 22298 21729 gene locus_tag LOCUS_15660 22298 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 24343 22454 gene locus_tag LOCUS_15670 24343 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 <25601 24340 gene locus_tag LOCUS_15680 <25601 24340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028529.1:O-antigen ligase family protein >Feature sequence051 189 1037 gene locus_tag LOCUS_15690 gene htpX 189 1037 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_15690 2236 1172 gene locus_tag LOCUS_15700 2236 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3335 2400 gene locus_tag LOCUS_15710 3335 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4309 3932 gene locus_tag LOCUS_15720 4309 3932 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942061.1 protein_id gnl|my_center|LOCUS_15720 4807 4451 gene locus_tag LOCUS_15730 4807 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5705 5487 gene locus_tag LOCUS_15740 5705 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6026 5754 gene locus_tag LOCUS_15750 6026 5754 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_15750 6367 6167 gene locus_tag LOCUS_15760 gene cspB 6367 6167 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179150.1 protein_id gnl|my_center|LOCUS_15760 7088 6579 gene locus_tag LOCUS_15770 7088 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 7521 7279 gene locus_tag LOCUS_15780 7521 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7971 7801 gene locus_tag LOCUS_15790 7971 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 9186 7990 gene locus_tag LOCUS_15800 9186 7990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485506.1 protein_id gnl|my_center|LOCUS_15800 10453 9533 gene locus_tag LOCUS_15810 10453 9533 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532005.1 protein_id gnl|my_center|LOCUS_15810 11492 10743 gene locus_tag LOCUS_15820 11492 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 12363 11611 gene locus_tag LOCUS_15830 12363 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12485 12658 gene locus_tag LOCUS_15840 12485 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13073 12915 gene locus_tag LOCUS_15850 13073 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 14490 13060 gene locus_tag LOCUS_15860 14490 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 17384 14550 gene locus_tag LOCUS_15870 17384 14550 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143551.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 17727 18146 gene locus_tag LOCUS_15880 17727 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 18049 18450 gene locus_tag LOCUS_15890 18049 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 18435 18812 gene locus_tag LOCUS_15900 18435 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 19419 19634 gene locus_tag LOCUS_15910 19419 19634 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227795.1 protein_id gnl|my_center|LOCUS_15910 21398 19869 gene locus_tag LOCUS_15920 21398 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 22058 22888 gene locus_tag LOCUS_15930 gene hag 22058 22888 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_15930 23121 23300 gene locus_tag LOCUS_15940 23121 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 24173 23934 gene locus_tag LOCUS_15950 24173 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence052 <1 1222 gene locus_tag LOCUS_15960 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528391.1:PAS domain S-box protein 1219 1851 gene locus_tag LOCUS_15970 1219 1851 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_15970 2261 5368 gene locus_tag LOCUS_15980 2261 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294648.1 protein_id gnl|my_center|LOCUS_15980 5341 5781 gene locus_tag LOCUS_15990 5341 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 6504 6031 gene locus_tag LOCUS_16000 6504 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7099 7443 gene locus_tag LOCUS_16010 7099 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 7427 7603 gene locus_tag LOCUS_16020 7427 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 8074 7880 gene locus_tag LOCUS_16030 8074 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8152 9219 gene locus_tag LOCUS_16040 gene arsB 8152 9219 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_16040 9256 9639 gene locus_tag LOCUS_16050 9256 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 9879 10028 gene locus_tag LOCUS_16060 9879 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 10090 10530 gene locus_tag LOCUS_16070 10090 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 10670 10873 gene locus_tag LOCUS_16080 10670 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10960 11277 gene locus_tag LOCUS_16090 10960 11277 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_16090 11370 12641 gene locus_tag LOCUS_16100 11370 12641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124897.1 protein_id gnl|my_center|LOCUS_16100 14386 13364 gene locus_tag LOCUS_16110 14386 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14628 14398 gene locus_tag LOCUS_16120 14628 14398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15269 14625 gene locus_tag LOCUS_16130 15269 14625 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072852.1 protein_id gnl|my_center|LOCUS_16130 15769 15269 gene locus_tag LOCUS_16140 15769 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 16049 15804 gene locus_tag LOCUS_16150 16049 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 16774 15941 gene locus_tag LOCUS_16160 16774 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 17174 16740 gene locus_tag LOCUS_16170 17174 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 17456 17205 gene locus_tag LOCUS_16180 17456 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 18094 17342 gene locus_tag LOCUS_16190 18094 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 19008 18205 gene locus_tag LOCUS_16200 19008 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16200 19439 18900 gene locus_tag LOCUS_16210 19439 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16210 20584 19439 gene locus_tag LOCUS_16220 20584 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 21044 20853 gene locus_tag LOCUS_16230 21044 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 21621 21121 gene locus_tag LOCUS_16240 21621 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 21713 22210 gene locus_tag LOCUS_16250 21713 22210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 22307 22945 gene locus_tag LOCUS_16260 22307 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 23247 23522 gene locus_tag LOCUS_16270 23247 23522 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_16270 23522 23848 gene locus_tag LOCUS_16280 23522 23848 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_16280 24088 24261 gene locus_tag LOCUS_16290 24088 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 24428 24237 gene locus_tag LOCUS_16300 24428 24237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence053 1363 2943 gene locus_tag LOCUS_16310 1363 2943 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_16310 3862 3020 gene locus_tag LOCUS_16320 gene hag 3862 3020 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_16320 4160 4447 gene locus_tag LOCUS_16330 4160 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4757 5821 gene locus_tag LOCUS_16340 4757 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5815 6480 gene locus_tag LOCUS_16350 5815 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6500 7003 gene locus_tag LOCUS_16360 6500 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 7058 7222 gene locus_tag LOCUS_16370 7058 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 7499 7870 gene locus_tag LOCUS_16380 7499 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8204 9184 gene locus_tag LOCUS_16390 8204 9184 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808773.1 protein_id gnl|my_center|LOCUS_16390 9188 10258 gene locus_tag LOCUS_16400 9188 10258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_16400 10268 11917 gene locus_tag LOCUS_16410 10268 11917 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808776.1 protein_id gnl|my_center|LOCUS_16410 12159 12338 gene locus_tag LOCUS_16420 12159 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 12361 12606 gene locus_tag LOCUS_16430 12361 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 14119 12773 gene locus_tag LOCUS_16440 14119 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 15531 14116 gene locus_tag LOCUS_16450 15531 14116 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_16450 16389 15616 gene locus_tag LOCUS_16460 16389 15616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_16460 17336 16386 gene locus_tag LOCUS_16470 17336 16386 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_16470 17739 17527 gene locus_tag LOCUS_16480 17739 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 18924 17761 gene locus_tag LOCUS_16490 gene dnaJ 18924 17761 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_16490 19472 19086 gene locus_tag LOCUS_16500 19472 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 19859 19476 gene locus_tag LOCUS_16510 19859 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 20525 20073 gene locus_tag LOCUS_16520 20525 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 20669 22063 gene locus_tag LOCUS_16530 gene asnS 20669 22063 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 protein_id gnl|my_center|LOCUS_16530 23878 22133 gene locus_tag LOCUS_16540 23878 22133 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence054 723 217 gene locus_tag LOCUS_16550 gene cheW 723 217 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 protein_id gnl|my_center|LOCUS_16550 1166 1963 gene locus_tag LOCUS_16560 gene mqnB 1166 1963 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_16560 2053 2886 gene locus_tag LOCUS_16570 2053 2886 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_16570 2921 4003 gene locus_tag LOCUS_16580 2921 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4238 4975 gene locus_tag LOCUS_16590 4238 4975 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_16590 5045 6202 gene locus_tag LOCUS_16600 5045 6202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_16600 6490 7494 gene locus_tag LOCUS_16610 6490 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 8844 7585 gene locus_tag LOCUS_16620 gene cysS 8844 7585 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_16620 10348 9014 gene locus_tag LOCUS_16630 10348 9014 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_16630 10990 10460 gene locus_tag LOCUS_16640 10990 10460 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_16640 12304 11081 gene locus_tag LOCUS_16650 12304 11081 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826550.1 protein_id gnl|my_center|LOCUS_16650 12600 13049 gene locus_tag LOCUS_16660 12600 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 13400 13212 gene locus_tag LOCUS_16670 13400 13212 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_16670 14113 13796 gene locus_tag LOCUS_16680 14113 13796 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_16680 15596 14130 gene locus_tag LOCUS_16690 gene cobB 15596 14130 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272194.1 protein_id gnl|my_center|LOCUS_16690 16758 15658 gene locus_tag LOCUS_16700 gene dsrB 16758 15658 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937710.1 protein_id gnl|my_center|LOCUS_16700 18045 16771 gene locus_tag LOCUS_16710 gene dsrA 18045 16771 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937709.1 protein_id gnl|my_center|LOCUS_16710 18476 18240 gene locus_tag LOCUS_16720 18476 18240 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393105.1 protein_id gnl|my_center|LOCUS_16720 18886 19521 gene locus_tag LOCUS_16730 18886 19521 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393104.1 protein_id gnl|my_center|LOCUS_16730 19558 20055 gene locus_tag LOCUS_16740 19558 20055 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669747.1 protein_id gnl|my_center|LOCUS_16740 20950 20141 gene locus_tag LOCUS_16750 20950 20141 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_16750 22163 20985 gene locus_tag LOCUS_16760 22163 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 22337 23323 gene locus_tag LOCUS_16770 22337 23323 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_16770 23331 23672 gene locus_tag LOCUS_16780 23331 23672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940531.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence055 161 529 gene locus_tag LOCUS_16790 161 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 564 3512 gene locus_tag LOCUS_16800 564 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6917 3612 gene locus_tag LOCUS_16810 6917 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7413 7655 gene locus_tag LOCUS_16820 7413 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7941 9056 gene locus_tag LOCUS_16830 7941 9056 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_16830 9434 9132 gene locus_tag LOCUS_16840 9434 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 11350 9866 gene locus_tag LOCUS_16850 gene cysS 11350 9866 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_16850 12846 11371 gene locus_tag LOCUS_16860 gene gltX 12846 11371 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_16860 13322 12843 gene locus_tag LOCUS_16870 gene ispF 13322 12843 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_16870 13989 13300 gene locus_tag LOCUS_16880 gene ispD 13989 13300 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_16880 15163 14513 gene locus_tag LOCUS_16890 15163 14513 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_16890 15245 15769 gene locus_tag LOCUS_16900 gene aroL 15245 15769 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_16900 17122 15857 gene locus_tag LOCUS_16910 gene argJ 17122 15857 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240078.1 protein_id gnl|my_center|LOCUS_16910 19580 17058 gene locus_tag LOCUS_16920 gene secA 19580 17058 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_16920 20314 19853 gene locus_tag LOCUS_16930 20314 19853 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938878.1 protein_id gnl|my_center|LOCUS_16930 21531 20392 gene locus_tag LOCUS_16940 21531 20392 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_16940 22342 21515 gene locus_tag LOCUS_16950 gene fdhD 22342 21515 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_16950 23015 22560 gene locus_tag LOCUS_16960 23015 22560 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence056 734 2965 gene locus_tag LOCUS_16970 734 2965 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941801.1 protein_id gnl|my_center|LOCUS_16970 3096 3593 gene locus_tag LOCUS_16980 3096 3593 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_16980 3755 4594 gene locus_tag LOCUS_16990 3755 4594 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_16990 4656 5729 gene locus_tag LOCUS_17000 4656 5729 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_17000 5800 6312 gene locus_tag LOCUS_17010 5800 6312 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941955.1 protein_id gnl|my_center|LOCUS_17010 6641 7843 gene locus_tag LOCUS_17020 gene rpsA 6641 7843 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_17020 7911 8867 gene locus_tag LOCUS_17030 7911 8867 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_17030 8903 9544 gene locus_tag LOCUS_17040 8903 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10108 9647 gene locus_tag LOCUS_17050 10108 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 10525 11373 gene locus_tag LOCUS_17060 10525 11373 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545813.1 protein_id gnl|my_center|LOCUS_17060 12046 11576 gene locus_tag LOCUS_17070 12046 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 11933 12142 gene locus_tag LOCUS_17080 11933 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 17169 12316 gene locus_tag LOCUS_17090 17169 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 19277 17946 gene locus_tag LOCUS_17100 gene der 19277 17946 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_17100 19601 19876 gene locus_tag LOCUS_17110 19601 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 20461 21024 gene locus_tag LOCUS_17120 20461 21024 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392710.1 protein_id gnl|my_center|LOCUS_17120 21043 21900 gene locus_tag LOCUS_17130 21043 21900 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence057 1554 1775 gene locus_tag LOCUS_17140 1554 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2016 3851 gene locus_tag LOCUS_17150 gene glmS 2016 3851 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_17150 4455 3838 gene locus_tag LOCUS_17160 4455 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4816 5361 gene locus_tag LOCUS_17170 gene pyrR 4816 5361 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_17170 5466 5542 gene locus_tag LOCUS_t00140 5466 5542 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5990 5682 gene locus_tag LOCUS_17180 5990 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6155 7231 gene locus_tag LOCUS_17190 6155 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 7459 7662 gene locus_tag LOCUS_17200 7459 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 8282 9457 gene locus_tag LOCUS_17210 8282 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 13027 9779 gene locus_tag LOCUS_17220 13027 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 13717 13268 gene locus_tag LOCUS_17230 13717 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 15339 13921 gene locus_tag LOCUS_17240 15339 13921 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_17240 16107 18179 gene locus_tag LOCUS_17250 16107 18179 CDS product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_17250 18181 19131 gene locus_tag LOCUS_17260 gene trpX 18181 19131 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263096.1 protein_id gnl|my_center|LOCUS_17260 19143 21137 gene locus_tag LOCUS_17270 19143 21137 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114254.1 protein_id gnl|my_center|LOCUS_17270 21258 21443 gene locus_tag LOCUS_17280 21258 21443 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_17280 22265 21516 gene locus_tag LOCUS_17290 22265 21516 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence058 156 440 gene locus_tag LOCUS_17300 156 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 653 907 gene locus_tag LOCUS_17310 653 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1363 1085 gene locus_tag LOCUS_17320 1363 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2983 1637 gene locus_tag LOCUS_17330 2983 1637 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_17330 5016 3709 gene locus_tag LOCUS_17340 5016 3709 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928587.1 protein_id gnl|my_center|LOCUS_17340 5631 5311 gene locus_tag LOCUS_17350 5631 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5870 5628 gene locus_tag LOCUS_17360 5870 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 7726 6023 gene locus_tag LOCUS_17370 7726 6023 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_17370 9527 7701 gene locus_tag LOCUS_17380 9527 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 9915 9556 gene locus_tag LOCUS_17390 9915 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 10230 9934 gene locus_tag LOCUS_17400 10230 9934 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725098.1 protein_id gnl|my_center|LOCUS_17400 11970 10243 gene locus_tag LOCUS_17410 gene kaiC 11970 10243 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_17410 12203 11967 gene locus_tag LOCUS_17420 12203 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 12773 12489 gene locus_tag LOCUS_17430 12773 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 13906 14061 gene locus_tag LOCUS_17440 13906 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 14180 14371 gene locus_tag LOCUS_17450 14180 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 14467 14958 gene locus_tag LOCUS_17460 14467 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 14973 15206 gene locus_tag LOCUS_17470 14973 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 15457 15801 gene locus_tag LOCUS_17480 15457 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 16446 16580 gene locus_tag LOCUS_17490 16446 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 16577 18181 gene locus_tag LOCUS_17500 gene treZ 16577 18181 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389950.1 protein_id gnl|my_center|LOCUS_17500 18174 20201 gene locus_tag LOCUS_17510 18174 20201 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence059 <1 2034 gene locus_tag LOCUS_17520 <1 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938439.1:Mu transposase C-terminal domain-containing protein 2054 2797 gene locus_tag LOCUS_17530 2054 2797 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938438.1 protein_id gnl|my_center|LOCUS_17530 2784 3431 gene locus_tag LOCUS_17540 2784 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3424 3714 gene locus_tag LOCUS_17550 3424 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3766 4272 gene locus_tag LOCUS_17560 3766 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4317 4796 gene locus_tag LOCUS_17570 4317 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4825 5016 gene locus_tag LOCUS_17580 4825 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5016 5288 gene locus_tag LOCUS_17590 5016 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 5291 5776 gene locus_tag LOCUS_17600 5291 5776 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 protein_id gnl|my_center|LOCUS_17600 5812 6135 gene locus_tag LOCUS_17610 5812 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6326 6718 gene locus_tag LOCUS_17620 6326 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6715 7029 gene locus_tag LOCUS_17630 6715 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 7043 7453 gene locus_tag LOCUS_17640 7043 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 7441 7800 gene locus_tag LOCUS_17650 7441 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7802 8347 gene locus_tag LOCUS_17660 7802 8347 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 protein_id gnl|my_center|LOCUS_17660 8580 8942 gene locus_tag LOCUS_17670 8580 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 8942 9451 gene locus_tag LOCUS_17680 8942 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9478 9732 gene locus_tag LOCUS_17690 9478 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 10176 10667 gene locus_tag LOCUS_17700 10176 10667 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_17700 10677 11105 gene locus_tag LOCUS_17710 10677 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 11127 11486 gene locus_tag LOCUS_17720 11127 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 11483 11734 gene locus_tag LOCUS_17730 11483 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 11731 12282 gene locus_tag LOCUS_17740 11731 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 12279 13754 gene locus_tag LOCUS_17750 12279 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_17750 13754 15325 gene locus_tag LOCUS_17760 13754 15325 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 protein_id gnl|my_center|LOCUS_17760 15318 16448 gene locus_tag LOCUS_17770 15318 16448 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939976.1 protein_id gnl|my_center|LOCUS_17770 16632 17762 gene locus_tag LOCUS_17780 16632 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_17780 17819 18583 gene locus_tag LOCUS_17790 17819 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 18674 19651 gene locus_tag LOCUS_17800 18674 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 19728 20015 gene locus_tag LOCUS_17810 19728 20015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 20015 20443 gene locus_tag LOCUS_17820 20015 20443 CDS product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 protein_id gnl|my_center|LOCUS_17820 20455 21027 gene locus_tag LOCUS_17830 20455 21027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 21031 21483 gene locus_tag LOCUS_17840 21031 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence060 243 1199 gene locus_tag LOCUS_17850 243 1199 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461383.1 protein_id gnl|my_center|LOCUS_17850 1213 2508 gene locus_tag LOCUS_17860 1213 2508 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287748.1 protein_id gnl|my_center|LOCUS_17860 2505 2792 gene locus_tag LOCUS_17870 2505 2792 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_17870 3017 4201 gene locus_tag LOCUS_17880 3017 4201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_17880 4297 5154 gene locus_tag LOCUS_17890 4297 5154 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931547.1 protein_id gnl|my_center|LOCUS_17890 5175 6173 gene locus_tag LOCUS_17900 5175 6173 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_17900 6170 6922 gene locus_tag LOCUS_17910 6170 6922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_17910 6912 7745 gene locus_tag LOCUS_17920 6912 7745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_17920 7670 8857 gene locus_tag LOCUS_17930 7670 8857 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943943.1 protein_id gnl|my_center|LOCUS_17930 9034 10890 gene locus_tag LOCUS_17940 9034 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11081 12457 gene locus_tag LOCUS_17950 11081 12457 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_17950 12527 14116 gene locus_tag LOCUS_17960 12527 14116 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_17960 14933 15259 gene locus_tag LOCUS_17970 14933 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 16045 16689 gene locus_tag LOCUS_17980 16045 16689 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_17980 16772 18088 gene locus_tag LOCUS_17990 16772 18088 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809693.1 protein_id gnl|my_center|LOCUS_17990 18282 19175 gene locus_tag LOCUS_18000 18282 19175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18000 19176 20210 gene locus_tag LOCUS_18010 19176 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18010 20241 20996 gene locus_tag LOCUS_18020 20241 20996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_18020 20996 21706 gene locus_tag LOCUS_18030 20996 21706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence061 1501 2346 gene locus_tag LOCUS_18040 1501 2346 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_18040 2677 3021 gene locus_tag LOCUS_18050 2677 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3040 4119 gene locus_tag LOCUS_18060 3040 4119 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_18060 4160 4393 gene locus_tag LOCUS_18070 4160 4393 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_18070 7192 4493 gene locus_tag LOCUS_18080 7192 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 7980 7531 gene locus_tag LOCUS_18090 7980 7531 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_18090 12497 7977 gene locus_tag LOCUS_18100 12497 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 12738 12514 gene locus_tag LOCUS_18110 12738 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 13047 14096 gene locus_tag LOCUS_18120 13047 14096 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938277.1 protein_id gnl|my_center|LOCUS_18120 14737 14246 gene locus_tag LOCUS_18130 14737 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 16082 14913 gene locus_tag LOCUS_18140 16082 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 16916 16101 gene locus_tag LOCUS_18150 16916 16101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392936.1 protein_id gnl|my_center|LOCUS_18150 17941 16916 gene locus_tag LOCUS_18160 17941 16916 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_18160 18939 17938 gene locus_tag LOCUS_18170 18939 17938 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392932.1 protein_id gnl|my_center|LOCUS_18170 19820 19011 gene locus_tag LOCUS_18180 19820 19011 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 protein_id gnl|my_center|LOCUS_18180 20501 19905 gene locus_tag LOCUS_18190 20501 19905 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_18190 <21669 20515 gene locus_tag LOCUS_18200 <21669 20515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390968.1:TonB-dependent receptor >Feature sequence062 3 248 gene locus_tag LOCUS_18210 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 594 1106 gene locus_tag LOCUS_18220 594 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1854 1168 gene locus_tag LOCUS_18230 1854 1168 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_18230 2864 1851 gene locus_tag LOCUS_18240 gene amrS 2864 1851 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_18240 3719 2883 gene locus_tag LOCUS_18250 3719 2883 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_18250 5560 3896 gene locus_tag LOCUS_18260 gene ilvD 5560 3896 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_18260 5749 6180 gene locus_tag LOCUS_18270 5749 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 6203 7138 gene locus_tag LOCUS_18280 6203 7138 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_18280 9934 7205 gene locus_tag LOCUS_18290 9934 7205 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_18290 10802 10035 gene locus_tag LOCUS_18300 10802 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 12513 11092 gene locus_tag LOCUS_18310 12513 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 12817 13146 gene locus_tag LOCUS_18320 12817 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 14379 13153 gene locus_tag LOCUS_18330 14379 13153 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_18330 15665 14409 gene locus_tag LOCUS_18340 gene ahcY 15665 14409 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_18340 17099 15909 gene locus_tag LOCUS_18350 gene metK 17099 15909 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_18350 17564 17178 gene locus_tag LOCUS_18360 17564 17178 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_18360 18128 19885 gene locus_tag LOCUS_18370 18128 19885 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_18370 19892 21172 gene locus_tag LOCUS_18380 19892 21172 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942891.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence063 <1 647 gene locus_tag LOCUS_18390 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421529.1:SAM-dependent chlorinase/fluorinase 796 1053 gene locus_tag LOCUS_18400 796 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1161 2171 gene locus_tag LOCUS_18410 gene gap 1161 2171 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_18410 2264 3463 gene locus_tag LOCUS_18420 gene pgk 2264 3463 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_18420 3509 4273 gene locus_tag LOCUS_18430 3509 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18430 4291 4764 gene locus_tag LOCUS_18440 4291 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5176 6984 gene locus_tag LOCUS_18450 5176 6984 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_18450 7172 8866 gene locus_tag LOCUS_18460 7172 8866 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706435.1 protein_id gnl|my_center|LOCUS_18460 8848 9564 gene locus_tag LOCUS_18470 gene btsR 8848 9564 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947378.1 protein_id gnl|my_center|LOCUS_18470 9768 10313 gene locus_tag LOCUS_18480 9768 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 10488 11072 gene locus_tag LOCUS_18490 10488 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 11261 13270 gene locus_tag LOCUS_18500 gene uvrB 11261 13270 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_18500 14284 13400 gene locus_tag LOCUS_18510 14284 13400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 15730 14351 gene locus_tag LOCUS_18520 15730 14351 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_18520 17200 15836 gene locus_tag LOCUS_18530 17200 15836 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_18530 18006 17290 gene locus_tag LOCUS_18540 18006 17290 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_18540 19729 18008 gene locus_tag LOCUS_18550 gene sdhA 19729 18008 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_18550 20998 19802 gene locus_tag LOCUS_18560 20998 19802 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228614.1 protein_id gnl|my_center|LOCUS_18560 <21540 21029 gene locus_tag LOCUS_18570 <21540 21029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943084.1:aconitate hydratase >Feature sequence064 1057 263 gene locus_tag LOCUS_18580 1057 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2017 1523 gene locus_tag LOCUS_18590 2017 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18590 3037 2141 gene locus_tag LOCUS_18600 3037 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3363 3860 gene locus_tag LOCUS_18610 3363 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4347 3844 gene locus_tag LOCUS_18620 4347 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5594 4539 gene locus_tag LOCUS_18630 gene nadA 5594 4539 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_18630 6145 5702 gene locus_tag LOCUS_18640 6145 5702 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_18640 6621 6172 gene locus_tag LOCUS_18650 6621 6172 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937835.1 protein_id gnl|my_center|LOCUS_18650 7777 7701 gene locus_tag LOCUS_t00150 7777 7701 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7862 7790 gene locus_tag LOCUS_t00160 7862 7790 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10441 8006 gene locus_tag LOCUS_18660 gene lon 10441 8006 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_18660 11847 10594 gene locus_tag LOCUS_18670 gene clpX 11847 10594 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_18670 13595 12174 gene locus_tag LOCUS_18680 13595 12174 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_18680 14110 15192 gene locus_tag LOCUS_18690 14110 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 15472 17871 gene locus_tag LOCUS_18700 15472 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 18425 17940 gene locus_tag LOCUS_18710 gene yjgA 18425 17940 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 protein_id gnl|my_center|LOCUS_18710 18734 18516 gene locus_tag LOCUS_18720 18734 18516 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_18720 18804 18986 gene locus_tag LOCUS_18730 18804 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 19679 21070 gene locus_tag LOCUS_18740 19679 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence065 2077 488 gene locus_tag LOCUS_18750 gene serA 2077 488 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_18750 2799 2080 gene locus_tag LOCUS_18760 2799 2080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_18760 3568 2792 gene locus_tag LOCUS_18770 3568 2792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_18770 4595 3570 gene locus_tag LOCUS_18780 4595 3570 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_18780 5537 4608 gene locus_tag LOCUS_18790 5537 4608 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_18790 6970 5801 gene locus_tag LOCUS_18800 6970 5801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_18800 7660 7442 gene locus_tag LOCUS_18810 7660 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 7916 8902 gene locus_tag LOCUS_18820 7916 8902 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_18820 10403 8973 gene locus_tag LOCUS_18830 10403 8973 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_18830 11566 10640 gene locus_tag LOCUS_18840 11566 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 12782 11595 gene locus_tag LOCUS_18850 12782 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 13728 13000 gene locus_tag LOCUS_18860 13728 13000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_18860 14929 13721 gene locus_tag LOCUS_18870 14929 13721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_18870 14913 15125 gene locus_tag LOCUS_18880 14913 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 16186 15212 gene locus_tag LOCUS_18890 16186 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 16507 17715 gene locus_tag LOCUS_18900 16507 17715 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_18900 17906 19000 gene locus_tag LOCUS_18910 17906 19000 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_18910 20204 19110 gene locus_tag LOCUS_18920 20204 19110 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence066 719 393 gene locus_tag LOCUS_18930 719 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1236 751 gene locus_tag LOCUS_18940 1236 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2839 1655 gene locus_tag LOCUS_18950 2839 1655 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_18950 4034 2829 gene locus_tag LOCUS_18960 4034 2829 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_18960 5737 4031 gene locus_tag LOCUS_18970 5737 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6563 6375 gene locus_tag LOCUS_18980 6563 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 7007 7678 gene locus_tag LOCUS_18990 7007 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 7682 9427 gene locus_tag LOCUS_19000 7682 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 9400 10404 gene locus_tag LOCUS_19010 9400 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 10394 11068 gene locus_tag LOCUS_19020 10394 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 11092 12513 gene locus_tag LOCUS_19030 11092 12513 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483455.1 protein_id gnl|my_center|LOCUS_19030 12516 14051 gene locus_tag LOCUS_19040 12516 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 14274 16958 gene locus_tag LOCUS_19050 14274 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 16996 17997 gene locus_tag LOCUS_19060 16996 17997 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_19060 18014 19099 gene locus_tag LOCUS_19070 18014 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 19301 20680 gene locus_tag LOCUS_19080 gene murJ 19301 20680 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582940.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence067 866 153 gene locus_tag LOCUS_19090 gene pxpB 866 153 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_19090 1684 965 gene locus_tag LOCUS_19100 1684 965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_19100 2433 1681 gene locus_tag LOCUS_19110 2433 1681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_19110 3440 2433 gene locus_tag LOCUS_19120 3440 2433 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_19120 4342 3428 gene locus_tag LOCUS_19130 4342 3428 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_19130 5653 4346 gene locus_tag LOCUS_19140 5653 4346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965994.1 protein_id gnl|my_center|LOCUS_19140 7196 5874 gene locus_tag LOCUS_19150 7196 5874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085208.1 protein_id gnl|my_center|LOCUS_19150 8636 7503 gene locus_tag LOCUS_19160 8636 7503 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_19160 9801 8671 gene locus_tag LOCUS_19170 9801 8671 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_19170 10661 9810 gene locus_tag LOCUS_19180 10661 9810 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_19180 11876 10701 gene locus_tag LOCUS_19190 11876 10701 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 protein_id gnl|my_center|LOCUS_19190 12569 12258 gene locus_tag LOCUS_19200 12569 12258 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_19200 12752 13324 gene locus_tag LOCUS_19210 12752 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 13482 14801 gene locus_tag LOCUS_19220 13482 14801 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545483.1 protein_id gnl|my_center|LOCUS_19220 14865 15794 gene locus_tag LOCUS_19230 14865 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 16158 18497 gene locus_tag LOCUS_19240 16158 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 18728 19441 gene locus_tag LOCUS_19250 18728 19441 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_19250 <21106 19550 gene locus_tag LOCUS_19260 <21106 19550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021615.1:M1 family metallopeptidase >Feature sequence068 403 630 gene locus_tag LOCUS_19270 403 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 884 693 gene locus_tag LOCUS_19280 884 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1012 1254 gene locus_tag LOCUS_19290 1012 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2896 1643 gene locus_tag LOCUS_19300 2896 1643 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_19300 3333 2911 gene locus_tag LOCUS_19310 3333 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3631 3287 gene locus_tag LOCUS_19320 3631 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5464 4010 gene locus_tag LOCUS_19330 5464 4010 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_19330 7328 5442 gene locus_tag LOCUS_19340 7328 5442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810002.1 protein_id gnl|my_center|LOCUS_19340 10916 7827 gene locus_tag LOCUS_19350 10916 7827 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942209.1 protein_id gnl|my_center|LOCUS_19350 11341 10985 gene locus_tag LOCUS_19360 11341 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 13092 11764 gene locus_tag LOCUS_19370 13092 11764 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_19370 14805 13093 gene locus_tag LOCUS_19380 14805 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19380 15073 15381 gene locus_tag LOCUS_19390 15073 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 15381 16541 gene locus_tag LOCUS_19400 15381 16541 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_19400 16723 17532 gene locus_tag LOCUS_19410 16723 17532 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704713.1 protein_id gnl|my_center|LOCUS_19410 17599 18942 gene locus_tag LOCUS_19420 17599 18942 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 protein_id gnl|my_center|LOCUS_19420 18982 20883 gene locus_tag LOCUS_19430 18982 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence069 <1 732 gene locus_tag LOCUS_19440 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886407.1:putative hydro-lyase 758 1519 gene locus_tag LOCUS_19450 758 1519 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249291.1 protein_id gnl|my_center|LOCUS_19450 1686 2063 gene locus_tag LOCUS_19460 1686 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2700 2227 gene locus_tag LOCUS_19470 2700 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2960 2697 gene locus_tag LOCUS_19480 2960 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2938 3465 gene locus_tag LOCUS_19490 gene cpxP 2938 3465 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080295.1 protein_id gnl|my_center|LOCUS_19490 3745 6102 gene locus_tag LOCUS_19500 3745 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 6523 10845 gene locus_tag LOCUS_19510 6523 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 11297 12106 gene locus_tag LOCUS_19520 11297 12106 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_19520 12168 13886 gene locus_tag LOCUS_19530 12168 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 14046 13897 gene locus_tag LOCUS_19540 14046 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 15658 14111 gene locus_tag LOCUS_19550 15658 14111 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_19550 16560 15844 gene locus_tag LOCUS_19560 16560 15844 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943089.1 protein_id gnl|my_center|LOCUS_19560 17249 16563 gene locus_tag LOCUS_19570 17249 16563 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939484.1 protein_id gnl|my_center|LOCUS_19570 20396 17262 gene locus_tag LOCUS_19580 20396 17262 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144016.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence070 1285 2574 gene locus_tag LOCUS_19590 1285 2574 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_19590 3253 2675 gene locus_tag LOCUS_19600 3253 2675 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_19600 4167 3388 gene locus_tag LOCUS_19610 4167 3388 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_19610 5075 4221 gene locus_tag LOCUS_19620 5075 4221 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_19620 6301 5051 gene locus_tag LOCUS_19630 6301 5051 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_19630 6480 6331 gene locus_tag LOCUS_19640 6480 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 7590 6562 gene locus_tag LOCUS_19650 gene mqnC 7590 6562 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_19650 8695 7583 gene locus_tag LOCUS_19660 gene mqnE 8695 7583 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940022.1 protein_id gnl|my_center|LOCUS_19660 9383 8688 gene locus_tag LOCUS_19670 9383 8688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_19670 9503 9694 gene locus_tag LOCUS_19680 9503 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 10772 10020 gene locus_tag LOCUS_19690 gene surE 10772 10020 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_19690 11361 10753 gene locus_tag LOCUS_19700 11361 10753 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_19700 12205 11363 gene locus_tag LOCUS_19710 12205 11363 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_19710 13363 12218 gene locus_tag LOCUS_19720 13363 12218 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_19720 13857 13534 gene locus_tag LOCUS_19730 13857 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 14157 14678 gene locus_tag LOCUS_19740 14157 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 15519 14758 gene locus_tag LOCUS_19750 15519 14758 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_19750 15548 17035 gene locus_tag LOCUS_19760 15548 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 17653 17093 gene locus_tag LOCUS_19770 17653 17093 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704158.1 protein_id gnl|my_center|LOCUS_19770 18161 19396 gene locus_tag LOCUS_19780 18161 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 20178 19432 gene locus_tag LOCUS_19790 20178 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence071 230 1036 gene locus_tag LOCUS_19800 230 1036 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_19800 2462 1056 gene locus_tag LOCUS_19810 2462 1056 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_19810 2777 3253 gene locus_tag LOCUS_19820 2777 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4585 3335 gene locus_tag LOCUS_19830 4585 3335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_19830 5433 5642 gene locus_tag LOCUS_19840 5433 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 6590 5721 gene locus_tag LOCUS_19850 6590 5721 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_19850 7393 6962 gene locus_tag LOCUS_19860 7393 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8614 7646 gene locus_tag LOCUS_19870 8614 7646 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_19870 8504 8710 gene locus_tag LOCUS_19880 8504 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9583 8846 gene locus_tag LOCUS_19890 9583 8846 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_19890 11407 9695 gene locus_tag LOCUS_19900 gene ilvB 11407 9695 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937667.1 protein_id gnl|my_center|LOCUS_19900 11679 11530 gene locus_tag LOCUS_19910 11679 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 12455 11772 gene locus_tag LOCUS_19920 12455 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 13029 12445 gene locus_tag LOCUS_19930 13029 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 13829 13128 gene locus_tag LOCUS_19940 13829 13128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_19940 14916 13822 gene locus_tag LOCUS_19950 14916 13822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_19950 15718 14933 gene locus_tag LOCUS_19960 15718 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 17749 15902 gene locus_tag LOCUS_19970 17749 15902 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_19970 18791 17796 gene locus_tag LOCUS_19980 18791 17796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 19932 19723 gene locus_tag LOCUS_19990 gene secE2 19932 19723 CDS product calcium dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401885.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence072 22 1134 gene locus_tag LOCUS_20000 gene thiH 22 1134 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_20000 1201 1401 gene locus_tag LOCUS_20010 gene thiS 1201 1401 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_20010 1518 1321 gene locus_tag LOCUS_20020 1518 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2367 1561 gene locus_tag LOCUS_20030 2367 1561 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_20030 2505 2861 gene locus_tag LOCUS_20040 2505 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3976 2942 gene locus_tag LOCUS_20050 3976 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4933 3989 gene locus_tag LOCUS_20060 4933 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8630 5100 gene locus_tag LOCUS_20070 gene mfd 8630 5100 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_20070 8711 8881 gene locus_tag LOCUS_20080 8711 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 8922 10340 gene locus_tag LOCUS_20090 gene selA 8922 10340 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_20090 10704 10495 gene locus_tag LOCUS_20100 10704 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 11369 10836 gene locus_tag LOCUS_20110 11369 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 11815 12573 gene locus_tag LOCUS_20120 11815 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 12935 14725 gene locus_tag LOCUS_20130 12935 14725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_20130 14924 16099 gene locus_tag LOCUS_20140 14924 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 16270 18222 gene locus_tag LOCUS_20150 16270 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 18341 18721 gene locus_tag LOCUS_20160 18341 18721 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_20160 18823 20187 gene locus_tag LOCUS_20170 gene ffh 18823 20187 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence073 3475 3266 gene locus_tag LOCUS_20180 3475 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3519 3737 gene locus_tag LOCUS_20190 3519 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3728 5200 gene locus_tag LOCUS_20200 3728 5200 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812985.1 protein_id gnl|my_center|LOCUS_20200 6367 5333 gene locus_tag LOCUS_20210 6367 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 7168 6395 gene locus_tag LOCUS_20220 7168 6395 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_20220 7414 7836 gene locus_tag LOCUS_20230 7414 7836 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_20230 7969 8544 gene locus_tag LOCUS_20240 7969 8544 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_20240 8564 9772 gene locus_tag LOCUS_20250 8564 9772 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_20250 10033 11004 gene locus_tag LOCUS_20260 10033 11004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_20260 11107 11841 gene locus_tag LOCUS_20270 11107 11841 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_20270 13240 11936 gene locus_tag LOCUS_20280 13240 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 13476 13988 gene locus_tag LOCUS_20290 13476 13988 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_20290 14214 15593 gene locus_tag LOCUS_20300 14214 15593 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_20300 15652 15840 gene locus_tag LOCUS_20310 15652 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 15863 16510 gene locus_tag LOCUS_20320 15863 16510 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545867.1 protein_id gnl|my_center|LOCUS_20320 16855 16544 gene locus_tag LOCUS_20330 16855 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 18499 16982 gene locus_tag LOCUS_20340 18499 16982 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_20340 19366 18614 gene locus_tag LOCUS_20350 19366 18614 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_20350 20295 19621 gene locus_tag LOCUS_20360 gene tmk 20295 19621 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence074 784 50 gene locus_tag LOCUS_20370 gene ndk 784 50 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250258.1 protein_id gnl|my_center|LOCUS_20370 1947 943 gene locus_tag LOCUS_20380 1947 943 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391607.1 protein_id gnl|my_center|LOCUS_20380 2815 2021 gene locus_tag LOCUS_20390 2815 2021 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965997.1 protein_id gnl|my_center|LOCUS_20390 4028 2892 gene locus_tag LOCUS_20400 4028 2892 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_20400 4122 4490 gene locus_tag LOCUS_20410 4122 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4487 5062 gene locus_tag LOCUS_20420 4487 5062 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_20420 6170 5169 gene locus_tag LOCUS_20430 6170 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 8031 6229 gene locus_tag LOCUS_20440 8031 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9074 8028 gene locus_tag LOCUS_20450 9074 8028 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_20450 10038 9088 gene locus_tag LOCUS_20460 10038 9088 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_20460 12188 10647 gene locus_tag LOCUS_20470 12188 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 12517 12822 gene locus_tag LOCUS_20480 12517 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 13323 14591 gene locus_tag LOCUS_20490 13323 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 14604 14774 gene locus_tag LOCUS_20500 14604 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 14785 16053 gene locus_tag LOCUS_20510 14785 16053 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_20510 16121 19576 gene locus_tag LOCUS_20520 16121 19576 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 protein_id gnl|my_center|LOCUS_20520 20188 19676 gene locus_tag LOCUS_20530 20188 19676 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_20530 20429 20292 gene locus_tag LOCUS_20540 20429 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence075 2041 575 gene locus_tag LOCUS_20550 2041 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4866 2017 gene locus_tag LOCUS_20560 4866 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6645 4966 gene locus_tag LOCUS_20570 gene recN 6645 4966 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_20570 7102 8403 gene locus_tag LOCUS_20580 7102 8403 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_20580 8431 8865 gene locus_tag LOCUS_20590 8431 8865 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_20590 8918 10075 gene locus_tag LOCUS_20600 8918 10075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_20600 10083 10958 gene locus_tag LOCUS_20610 10083 10958 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_20610 11029 11982 gene locus_tag LOCUS_20620 11029 11982 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_20620 11930 12754 gene locus_tag LOCUS_20630 11930 12754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_20630 12733 13458 gene locus_tag LOCUS_20640 12733 13458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_20640 14249 13563 gene locus_tag LOCUS_20650 14249 13563 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410019.1 protein_id gnl|my_center|LOCUS_20650 15014 14520 gene locus_tag LOCUS_20660 15014 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 15464 17494 gene locus_tag LOCUS_20670 15464 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 17764 17522 gene locus_tag LOCUS_20680 17764 17522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 17854 20181 gene locus_tag LOCUS_20690 17854 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence076 2089 1145 gene locus_tag LOCUS_20700 2089 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2691 3278 gene locus_tag LOCUS_20710 2691 3278 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941436.1 protein_id gnl|my_center|LOCUS_20710 4255 3377 gene locus_tag LOCUS_20720 gene rfbD 4255 3377 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_20720 4897 4337 gene locus_tag LOCUS_20730 gene rfbC 4897 4337 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_20730 5955 4894 gene locus_tag LOCUS_20740 gene rfbB 5955 4894 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_20740 7426 6083 gene locus_tag LOCUS_20750 7426 6083 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 protein_id gnl|my_center|LOCUS_20750 7899 10127 gene locus_tag LOCUS_20760 7899 10127 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943164.1 protein_id gnl|my_center|LOCUS_20760 10398 10201 gene locus_tag LOCUS_20770 10398 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10501 12456 gene locus_tag LOCUS_20780 10501 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 12525 13868 gene locus_tag LOCUS_20790 12525 13868 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_20790 13880 14440 gene locus_tag LOCUS_20800 13880 14440 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880262.1 protein_id gnl|my_center|LOCUS_20800 14585 14857 gene locus_tag LOCUS_20810 14585 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 15214 16275 gene locus_tag LOCUS_20820 gene cobT 15214 16275 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_20820 16479 16679 gene locus_tag LOCUS_20830 16479 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 17649 16681 gene locus_tag LOCUS_20840 17649 16681 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957776.1 protein_id gnl|my_center|LOCUS_20840 18656 17754 gene locus_tag LOCUS_20850 18656 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence077 <1 632 gene locus_tag LOCUS_20860 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272344.1:class I SAM-dependent methyltransferase 641 1087 gene locus_tag LOCUS_20870 641 1087 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272844.1 protein_id gnl|my_center|LOCUS_20870 1084 2457 gene locus_tag LOCUS_20880 1084 2457 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812866.1 protein_id gnl|my_center|LOCUS_20880 2454 3788 gene locus_tag LOCUS_20890 2454 3788 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812868.1 protein_id gnl|my_center|LOCUS_20890 3799 4839 gene locus_tag LOCUS_20900 3799 4839 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_20900 4935 6656 gene locus_tag LOCUS_20910 4935 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 8163 6748 gene locus_tag LOCUS_20920 8163 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8665 10284 gene locus_tag LOCUS_20930 8665 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 10313 11458 gene locus_tag LOCUS_20940 10313 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 11637 11900 gene locus_tag LOCUS_20950 11637 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 14545 12092 gene locus_tag LOCUS_20960 14545 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 15605 15372 gene locus_tag LOCUS_20970 15605 15372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 15486 17558 gene locus_tag LOCUS_20980 15486 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 17678 19180 gene locus_tag LOCUS_20990 17678 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 19266 19496 gene locus_tag LOCUS_21000 19266 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 19960 19535 gene locus_tag LOCUS_21010 19960 19535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence078 <1 844 gene locus_tag LOCUS_21020 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938893.1:ATP-dependent Clp protease ATP-binding subunit ClpA 848 1531 gene locus_tag LOCUS_21030 gene aat 848 1531 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_21030 1592 2953 gene locus_tag LOCUS_21040 1592 2953 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_21040 6210 3010 gene locus_tag LOCUS_21050 gene carB 6210 3010 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_21050 6646 6443 gene locus_tag LOCUS_21060 6646 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6902 8467 gene locus_tag LOCUS_21070 6902 8467 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_21070 8484 8690 gene locus_tag LOCUS_21080 8484 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 9464 8874 gene locus_tag LOCUS_21090 9464 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 10802 9552 gene locus_tag LOCUS_21100 10802 9552 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793041.1 protein_id gnl|my_center|LOCUS_21100 11113 11418 gene locus_tag LOCUS_21110 11113 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 11805 12701 gene locus_tag LOCUS_21120 11805 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 14150 12861 gene locus_tag LOCUS_21130 14150 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 15021 14359 gene locus_tag LOCUS_21140 15021 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 15514 16710 gene locus_tag LOCUS_21150 15514 16710 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_21150 16724 19852 gene locus_tag LOCUS_21160 16724 19852 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940506.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence079 1671 1952 gene locus_tag LOCUS_21170 1671 1952 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_21170 2213 3421 gene locus_tag LOCUS_21180 2213 3421 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147320.1 protein_id gnl|my_center|LOCUS_21180 3449 4354 gene locus_tag LOCUS_21190 gene porB 3449 4354 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_21190 7928 4497 gene locus_tag LOCUS_21200 7928 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 8452 8730 gene locus_tag LOCUS_21210 8452 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8817 9278 gene locus_tag LOCUS_21220 8817 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9423 10424 gene locus_tag LOCUS_21230 9423 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 10569 10742 gene locus_tag LOCUS_21240 10569 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 11242 11039 gene locus_tag LOCUS_21250 11242 11039 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 protein_id gnl|my_center|LOCUS_21250 11773 11264 gene locus_tag LOCUS_21260 11773 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 12371 13816 gene locus_tag LOCUS_21270 12371 13816 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 protein_id gnl|my_center|LOCUS_21270 13813 14313 gene locus_tag LOCUS_21280 gene ogt 13813 14313 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 protein_id gnl|my_center|LOCUS_21280 16964 14319 gene locus_tag LOCUS_21290 16964 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence080 998 81 gene locus_tag LOCUS_21300 998 81 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_21300 2810 1347 gene locus_tag LOCUS_21310 2810 1347 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_21310 3091 5127 gene locus_tag LOCUS_21320 3091 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6010 5189 gene locus_tag LOCUS_21330 6010 5189 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_21330 6488 7159 gene locus_tag LOCUS_21340 6488 7159 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_21340 7235 7957 gene locus_tag LOCUS_21350 gene cobI 7235 7957 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_21350 8103 9122 gene locus_tag LOCUS_21360 8103 9122 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937952.1 protein_id gnl|my_center|LOCUS_21360 9161 9886 gene locus_tag LOCUS_21370 9161 9886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937951.1 protein_id gnl|my_center|LOCUS_21370 10059 10901 gene locus_tag LOCUS_21380 10059 10901 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792785.1 protein_id gnl|my_center|LOCUS_21380 11599 10931 gene locus_tag LOCUS_21390 11599 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 11552 12217 gene locus_tag LOCUS_21400 11552 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 12207 13511 gene locus_tag LOCUS_21410 12207 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 14523 13585 gene locus_tag LOCUS_21420 14523 13585 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_21420 14770 16497 gene locus_tag LOCUS_21430 gene ispH 14770 16497 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_21430 17773 16712 gene locus_tag LOCUS_21440 gene aroC 17773 16712 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_21440 17907 18221 gene locus_tag LOCUS_21450 17907 18221 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence081 882 3944 gene locus_tag LOCUS_21460 882 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 4047 5435 gene locus_tag LOCUS_21470 4047 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5432 6904 gene locus_tag LOCUS_21480 5432 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 7654 7082 gene locus_tag LOCUS_21490 7654 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 7942 8601 gene locus_tag LOCUS_21500 7942 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 8631 8897 gene locus_tag LOCUS_21510 8631 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 9047 9811 gene locus_tag LOCUS_21520 9047 9811 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_21520 10029 10295 gene locus_tag LOCUS_21530 10029 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 12006 10597 gene locus_tag LOCUS_21540 12006 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 13339 12434 gene locus_tag LOCUS_21550 13339 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304987.1 protein_id gnl|my_center|LOCUS_21550 14469 13447 gene locus_tag LOCUS_21560 14469 13447 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130716.1 protein_id gnl|my_center|LOCUS_21560 15905 14556 gene locus_tag LOCUS_21570 gene glmM 15905 14556 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_21570 17197 15950 gene locus_tag LOCUS_21580 17197 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 19448 17244 gene locus_tag LOCUS_21590 19448 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence082 858 250 gene locus_tag LOCUS_21600 858 250 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_21600 1219 872 gene locus_tag LOCUS_21610 1219 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1631 4708 gene locus_tag LOCUS_21620 gene fdnG 1631 4708 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021760008.1 transl_except (pos:2201..2203,aa:Sec) note codon on position 191 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_21620 4712 5419 gene locus_tag LOCUS_21630 4712 5419 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791820.1 protein_id gnl|my_center|LOCUS_21630 5637 6536 gene locus_tag LOCUS_21640 5637 6536 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_21640 7545 6598 gene locus_tag LOCUS_21650 7545 6598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 protein_id gnl|my_center|LOCUS_21650 7885 8457 gene locus_tag LOCUS_21660 7885 8457 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941436.1 protein_id gnl|my_center|LOCUS_21660 8585 14401 gene locus_tag LOCUS_21670 8585 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 14406 16649 gene locus_tag LOCUS_21680 14406 16649 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_21680 17634 16660 gene locus_tag LOCUS_21690 17634 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 18457 18909 gene locus_tag LOCUS_21700 gene nuoE 18457 18909 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence083 <1 659 gene locus_tag LOCUS_21710 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942630.1:TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase 681 1364 gene locus_tag LOCUS_21720 681 1364 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640491.1 protein_id gnl|my_center|LOCUS_21720 1467 2873 gene locus_tag LOCUS_21730 1467 2873 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109099387.1 protein_id gnl|my_center|LOCUS_21730 2901 5009 gene locus_tag LOCUS_21740 2901 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5006 5743 gene locus_tag LOCUS_21750 5006 5743 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256018.1 protein_id gnl|my_center|LOCUS_21750 5950 6135 gene locus_tag LOCUS_21760 5950 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6220 7611 gene locus_tag LOCUS_21770 6220 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7608 8756 gene locus_tag LOCUS_21780 7608 8756 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_21780 8746 9978 gene locus_tag LOCUS_21790 8746 9978 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_21790 10041 11243 gene locus_tag LOCUS_21800 10041 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 11259 12476 gene locus_tag LOCUS_21810 11259 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 12486 13391 gene locus_tag LOCUS_21820 12486 13391 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 protein_id gnl|my_center|LOCUS_21820 13429 14742 gene locus_tag LOCUS_21830 13429 14742 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_21830 14924 16000 gene locus_tag LOCUS_21840 14924 16000 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973529.1 protein_id gnl|my_center|LOCUS_21840 16000 17076 gene locus_tag LOCUS_21850 16000 17076 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_21850 17081 18280 gene locus_tag LOCUS_21860 17081 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence084 680 444 gene locus_tag LOCUS_21870 680 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1049 681 gene locus_tag LOCUS_21880 1049 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1309 1022 gene locus_tag LOCUS_21890 1309 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1599 1306 gene locus_tag LOCUS_21900 1599 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1934 1596 gene locus_tag LOCUS_21910 1934 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2501 2004 gene locus_tag LOCUS_21920 gene dcd 2501 2004 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_21920 3975 2566 gene locus_tag LOCUS_21930 3975 2566 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125454.1 protein_id gnl|my_center|LOCUS_21930 5058 4003 gene locus_tag LOCUS_21940 5058 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5304 5074 gene locus_tag LOCUS_21950 5304 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6089 5853 gene locus_tag LOCUS_21960 6089 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6334 6086 gene locus_tag LOCUS_21970 6334 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7045 6383 gene locus_tag LOCUS_21980 7045 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 7596 7045 gene locus_tag LOCUS_21990 7596 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 7929 7600 gene locus_tag LOCUS_22000 7929 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 8170 8009 gene locus_tag LOCUS_22010 8170 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 8962 8690 gene locus_tag LOCUS_22020 8962 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 9276 9088 gene locus_tag LOCUS_22030 9276 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 9499 9197 gene locus_tag LOCUS_22040 9499 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 11216 9708 gene locus_tag LOCUS_22050 11216 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 11643 11296 gene locus_tag LOCUS_22060 11643 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 11831 12049 gene locus_tag LOCUS_22070 11831 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 13592 13873 gene locus_tag LOCUS_22080 13592 13873 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_22080 13894 14208 gene locus_tag LOCUS_22090 13894 14208 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_22090 15024 14770 gene locus_tag LOCUS_22100 15024 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 15251 15021 gene locus_tag LOCUS_22110 15251 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 15528 15169 gene locus_tag LOCUS_22120 15528 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 15747 16043 gene locus_tag LOCUS_22130 15747 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 16040 16588 gene locus_tag LOCUS_22140 16040 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 16578 17990 gene locus_tag LOCUS_22150 16578 17990 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_22150 18002 18331 gene locus_tag LOCUS_22160 18002 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 18328 19017 gene locus_tag LOCUS_22170 18328 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence085 1658 165 gene locus_tag LOCUS_22180 1658 165 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880464.1 protein_id gnl|my_center|LOCUS_22180 4461 1888 gene locus_tag LOCUS_22190 4461 1888 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_22190 5203 4676 gene locus_tag LOCUS_22200 5203 4676 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_22200 5452 6045 gene locus_tag LOCUS_22210 5452 6045 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_22210 6059 6808 gene locus_tag LOCUS_22220 6059 6808 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_22220 6958 7461 gene locus_tag LOCUS_22230 gene ruvC 6958 7461 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_22230 7458 8057 gene locus_tag LOCUS_22240 gene ruvA 7458 8057 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_22240 8084 9112 gene locus_tag LOCUS_22250 gene ruvB 8084 9112 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_22250 10108 9392 gene locus_tag LOCUS_22260 10108 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 10519 11406 gene locus_tag LOCUS_22270 10519 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 11403 12125 gene locus_tag LOCUS_22280 11403 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 12869 12246 gene locus_tag LOCUS_22290 12869 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 14170 12920 gene locus_tag LOCUS_22300 14170 12920 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_22300 14303 15379 gene locus_tag LOCUS_22310 14303 15379 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_22310 16399 15554 gene locus_tag LOCUS_22320 16399 15554 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_22320 17183 16437 gene locus_tag LOCUS_22330 17183 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 17774 17496 gene locus_tag LOCUS_22340 17774 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence086 <1 1358 gene locus_tag LOCUS_22350 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:Tex family protein 1866 1393 gene locus_tag LOCUS_22360 1866 1393 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 protein_id gnl|my_center|LOCUS_22360 2253 2753 gene locus_tag LOCUS_22370 2253 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3272 5056 gene locus_tag LOCUS_22380 gene typA 3272 5056 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_22380 6796 5189 gene locus_tag LOCUS_22390 6796 5189 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_22390 7128 7955 gene locus_tag LOCUS_22400 7128 7955 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_22400 8008 9198 gene locus_tag LOCUS_22410 8008 9198 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_22410 10028 9255 gene locus_tag LOCUS_22420 gene tam 10028 9255 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_22420 10253 11932 gene locus_tag LOCUS_22430 gene ettA 10253 11932 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_22430 12518 12003 gene locus_tag LOCUS_22440 12518 12003 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_22440 12929 12564 gene locus_tag LOCUS_22450 12929 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 14569 12971 gene locus_tag LOCUS_22460 14569 12971 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_22460 15034 15279 gene locus_tag LOCUS_22470 15034 15279 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_22470 15300 15578 gene locus_tag LOCUS_22480 15300 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 15822 16961 gene locus_tag LOCUS_22490 15822 16961 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_22490 18483 17023 gene locus_tag LOCUS_22500 18483 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 19073 18855 gene locus_tag LOCUS_22510 19073 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence087 946 140 gene locus_tag LOCUS_22520 946 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2711 1323 gene locus_tag LOCUS_22530 2711 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3938 2742 gene locus_tag LOCUS_22540 3938 2742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_22540 4063 4650 gene locus_tag LOCUS_22550 4063 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 4814 5290 gene locus_tag LOCUS_22560 4814 5290 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941789.1 protein_id gnl|my_center|LOCUS_22560 5396 6334 gene locus_tag LOCUS_22570 gene rarD 5396 6334 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_22570 6304 8397 gene locus_tag LOCUS_22580 6304 8397 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_22580 8823 9287 gene locus_tag LOCUS_22590 8823 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 9416 9652 gene locus_tag LOCUS_22600 9416 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 10102 12216 gene locus_tag LOCUS_22610 10102 12216 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_22610 12397 12594 gene locus_tag LOCUS_22620 gene cspB 12397 12594 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179150.1 protein_id gnl|my_center|LOCUS_22620 13073 12798 gene locus_tag LOCUS_22630 13073 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 13402 13070 gene locus_tag LOCUS_22640 13402 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 13820 14014 gene locus_tag LOCUS_22650 13820 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 14281 14727 gene locus_tag LOCUS_22660 gene rpiB 14281 14727 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_22660 14928 15800 gene locus_tag LOCUS_22670 gene glyQ 14928 15800 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_22670 15806 17893 gene locus_tag LOCUS_22680 gene glyS 15806 17893 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_22680 18034 18456 gene locus_tag LOCUS_22690 18034 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence088 2078 1047 gene locus_tag LOCUS_22700 2078 1047 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_22700 2886 2503 gene locus_tag LOCUS_22710 2886 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4415 2940 gene locus_tag LOCUS_22720 4415 2940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940686.1 protein_id gnl|my_center|LOCUS_22720 5091 4468 gene locus_tag LOCUS_22730 5091 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 6752 5088 gene locus_tag LOCUS_22740 6752 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 6945 7142 gene locus_tag LOCUS_22750 6945 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 7369 7055 gene locus_tag LOCUS_22760 7369 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 8038 8325 gene locus_tag LOCUS_22770 8038 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 9237 8458 gene locus_tag LOCUS_22780 9237 8458 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_22780 10193 9237 gene locus_tag LOCUS_22790 10193 9237 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_22790 10361 11242 gene locus_tag LOCUS_22800 10361 11242 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_22800 11620 11303 gene locus_tag LOCUS_22810 11620 11303 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_22810 12288 11953 gene locus_tag LOCUS_22820 12288 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 13289 12297 gene locus_tag LOCUS_22830 gene hgcA 13289 12297 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_22830 14207 13527 gene locus_tag LOCUS_22840 14207 13527 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_22840 15001 14231 gene locus_tag LOCUS_22850 15001 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22850 15494 15021 gene locus_tag LOCUS_22860 15494 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 15841 15626 gene locus_tag LOCUS_22870 15841 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 16715 15861 gene locus_tag LOCUS_22880 gene ccsB 16715 15861 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_22880 18102 16738 gene locus_tag LOCUS_22890 18102 16738 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_22890 18736 18341 gene locus_tag LOCUS_22900 gene mutT 18736 18341 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence089 2279 63 gene locus_tag LOCUS_22910 2279 63 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_22910 3544 2285 gene locus_tag LOCUS_22920 3544 2285 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_22920 5823 4264 gene locus_tag LOCUS_22930 5823 4264 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_22930 6015 8321 gene locus_tag LOCUS_22940 6015 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 8336 9055 gene locus_tag LOCUS_22950 8336 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 9343 10038 gene locus_tag LOCUS_22960 9343 10038 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_22960 10183 11064 gene locus_tag LOCUS_22970 gene ilvE 10183 11064 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_22970 11566 11105 gene locus_tag LOCUS_22980 11566 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 11828 11598 gene locus_tag LOCUS_22990 11828 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 12293 12054 gene locus_tag LOCUS_23000 12293 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 12580 12404 gene locus_tag LOCUS_23010 12580 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 12768 12577 gene locus_tag LOCUS_23020 12768 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 13670 12801 gene locus_tag LOCUS_23030 13670 12801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931603.1 protein_id gnl|my_center|LOCUS_23030 14505 13699 gene locus_tag LOCUS_23040 14505 13699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145679980.1 protein_id gnl|my_center|LOCUS_23040 15371 14535 gene locus_tag LOCUS_23050 15371 14535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_23050 16288 15410 gene locus_tag LOCUS_23060 16288 15410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145679980.1 protein_id gnl|my_center|LOCUS_23060 17491 16391 gene locus_tag LOCUS_23070 17491 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence090 2437 1349 gene locus_tag LOCUS_23080 2437 1349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_23080 3499 2510 gene locus_tag LOCUS_23090 3499 2510 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384670.1 protein_id gnl|my_center|LOCUS_23090 3908 4159 gene locus_tag LOCUS_23100 3908 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4246 6393 gene locus_tag LOCUS_23110 4246 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 8710 6413 gene locus_tag LOCUS_23120 8710 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10033 8927 gene locus_tag LOCUS_23130 10033 8927 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_23130 10499 11350 gene locus_tag LOCUS_23140 gene modA 10499 11350 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454609.1 protein_id gnl|my_center|LOCUS_23140 11343 12131 gene locus_tag LOCUS_23150 11343 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 12131 13036 gene locus_tag LOCUS_23160 12131 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 13363 13031 gene locus_tag LOCUS_23170 gene saoD 13363 13031 CDS product DsrE-related protein SaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430785.1 protein_id gnl|my_center|LOCUS_23170 13606 13893 gene locus_tag LOCUS_23180 gene saoT 13606 13893 CDS product thioredoxin-like (seleno)protein SaoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048219.1 protein_id gnl|my_center|LOCUS_23180 13890 14975 gene locus_tag LOCUS_23190 gene saoE 13890 14975 CDS product efflux transporter SaoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048218.1 protein_id gnl|my_center|LOCUS_23190 14975 15445 gene locus_tag LOCUS_23200 14975 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 15499 16644 gene locus_tag LOCUS_23210 gene saoX 15499 16644 CDS product ABC transporter substrate-binding subunit SaoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048217.1 protein_id gnl|my_center|LOCUS_23210 16668 17450 gene locus_tag LOCUS_23220 16668 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 17472 18044 gene locus_tag LOCUS_23230 17472 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23230 18084 18221 gene locus_tag LOCUS_23240 18084 18221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence091 390 671 gene locus_tag LOCUS_23250 390 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 649 1701 gene locus_tag LOCUS_23260 649 1701 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_23260 1698 2501 gene locus_tag LOCUS_23270 1698 2501 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_23270 2510 3061 gene locus_tag LOCUS_23280 2510 3061 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_23280 3307 4128 gene locus_tag LOCUS_23290 gene mutM 3307 4128 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_23290 4169 4609 gene locus_tag LOCUS_23300 4169 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4621 5760 gene locus_tag LOCUS_23310 4621 5760 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_23310 5790 6635 gene locus_tag LOCUS_23320 5790 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6916 8076 gene locus_tag LOCUS_23330 6916 8076 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_23330 8120 8452 gene locus_tag LOCUS_23340 8120 8452 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_23340 8541 8873 gene locus_tag LOCUS_23350 8541 8873 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176702.1 protein_id gnl|my_center|LOCUS_23350 9840 9316 gene locus_tag LOCUS_23360 9840 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 10267 9974 gene locus_tag LOCUS_23370 10267 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 10728 11858 gene locus_tag LOCUS_23380 gene asnA 10728 11858 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284917.1 protein_id gnl|my_center|LOCUS_23380 12232 13785 gene locus_tag LOCUS_23390 12232 13785 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_23390 14358 13942 gene locus_tag LOCUS_23400 14358 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 17360 14634 gene locus_tag LOCUS_23410 17360 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 18297 17578 gene locus_tag LOCUS_23420 18297 17578 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence092 2184 412 gene locus_tag LOCUS_23430 2184 412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937324.1 protein_id gnl|my_center|LOCUS_23430 2875 2186 gene locus_tag LOCUS_23440 2875 2186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_23440 3462 3022 gene locus_tag LOCUS_23450 3462 3022 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_23450 4359 3466 gene locus_tag LOCUS_23460 gene pstA 4359 3466 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_23460 5370 4387 gene locus_tag LOCUS_23470 gene pstC 5370 4387 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_23470 6166 5354 gene locus_tag LOCUS_23480 6166 5354 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_23480 6501 7205 gene locus_tag LOCUS_23490 6501 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 7481 8434 gene locus_tag LOCUS_23500 7481 8434 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460669.1 protein_id gnl|my_center|LOCUS_23500 12280 8453 gene locus_tag LOCUS_23510 12280 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 14407 12749 gene locus_tag LOCUS_23520 14407 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 14957 15559 gene locus_tag LOCUS_23530 14957 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 15930 17354 gene locus_tag LOCUS_23540 15930 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 17351 18205 gene locus_tag LOCUS_23550 17351 18205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence093 1231 122 gene locus_tag LOCUS_23560 gene dnaN 1231 122 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_23560 1697 2728 gene locus_tag LOCUS_23570 gene dctP 1697 2728 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389894.1 protein_id gnl|my_center|LOCUS_23570 2926 3429 gene locus_tag LOCUS_23580 2926 3429 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389893.1 protein_id gnl|my_center|LOCUS_23580 3430 4722 gene locus_tag LOCUS_23590 3430 4722 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931068.1 protein_id gnl|my_center|LOCUS_23590 4900 6129 gene locus_tag LOCUS_23600 gene mutY 4900 6129 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_23600 6234 6899 gene locus_tag LOCUS_23610 6234 6899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868175.1 protein_id gnl|my_center|LOCUS_23610 7828 7133 gene locus_tag LOCUS_23620 7828 7133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_23620 9084 7858 gene locus_tag LOCUS_23630 9084 7858 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_23630 9477 10172 gene locus_tag LOCUS_23640 9477 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 11990 10224 gene locus_tag LOCUS_23650 11990 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 12701 12099 gene locus_tag LOCUS_23660 12701 12099 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545136.1 protein_id gnl|my_center|LOCUS_23660 12879 13340 gene locus_tag LOCUS_23670 12879 13340 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_23670 13367 13768 gene locus_tag LOCUS_23680 13367 13768 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_23680 14135 14905 gene locus_tag LOCUS_23690 14135 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 15052 15435 gene locus_tag LOCUS_23700 gene hypA 15052 15435 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_23700 15404 16087 gene locus_tag LOCUS_23710 gene hypB 15404 16087 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence094 900 250 gene locus_tag LOCUS_23720 900 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1339 1139 gene locus_tag LOCUS_23730 1339 1139 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_23730 1755 3113 gene locus_tag LOCUS_23740 gene dctA 1755 3113 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 protein_id gnl|my_center|LOCUS_23740 3137 4114 gene locus_tag LOCUS_23750 3137 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4528 4127 gene locus_tag LOCUS_23760 4528 4127 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_23760 5462 4530 gene locus_tag LOCUS_23770 5462 4530 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979108.1 protein_id gnl|my_center|LOCUS_23770 6281 5496 gene locus_tag LOCUS_23780 6281 5496 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_23780 6433 6765 gene locus_tag LOCUS_23790 6433 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 7017 8105 gene locus_tag LOCUS_23800 7017 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 8150 10795 gene locus_tag LOCUS_23810 8150 10795 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_23810 12429 10879 gene locus_tag LOCUS_23820 12429 10879 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_23820 13806 12634 gene locus_tag LOCUS_23830 13806 12634 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_23830 14106 13903 gene locus_tag LOCUS_23840 14106 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 14717 14508 gene locus_tag LOCUS_23850 14717 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 14965 14741 gene locus_tag LOCUS_23860 14965 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 15740 15069 gene locus_tag LOCUS_23870 15740 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 16386 15895 gene locus_tag LOCUS_23880 16386 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 <18091 16504 gene locus_tag LOCUS_23890 <18091 16504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044941.1:GAF domain-containing sensor histidine kinase >Feature sequence095 <1 793 gene locus_tag LOCUS_23900 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245322.1:catalase KatA 1406 1047 gene locus_tag LOCUS_23910 1406 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1745 1449 gene locus_tag LOCUS_23920 1745 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2768 1863 gene locus_tag LOCUS_23930 2768 1863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082669.1 protein_id gnl|my_center|LOCUS_23930 3936 2836 gene locus_tag LOCUS_23940 3936 2836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_23940 5564 3933 gene locus_tag LOCUS_23950 5564 3933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383659.1 protein_id gnl|my_center|LOCUS_23950 6123 6410 gene locus_tag LOCUS_23960 gene groES 6123 6410 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_23960 6435 8105 gene locus_tag LOCUS_23970 gene groL 6435 8105 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_23970 8568 9539 gene locus_tag LOCUS_23980 8568 9539 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969316.1 protein_id gnl|my_center|LOCUS_23980 9591 10736 gene locus_tag LOCUS_23990 gene trpD 9591 10736 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 protein_id gnl|my_center|LOCUS_23990 10868 10641 gene locus_tag LOCUS_24000 10868 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 12371 10920 gene locus_tag LOCUS_24010 gene cdaA 12371 10920 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_24010 12841 12389 gene locus_tag LOCUS_24020 12841 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 13211 13672 gene locus_tag LOCUS_24030 13211 13672 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_24030 14130 13957 gene locus_tag LOCUS_24040 14130 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 14208 17399 gene locus_tag LOCUS_24050 14208 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence096 899 261 gene locus_tag LOCUS_24060 899 261 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_24060 1280 900 gene locus_tag LOCUS_24070 gene queD 1280 900 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_24070 1661 2647 gene locus_tag LOCUS_24080 1661 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2693 3781 gene locus_tag LOCUS_24090 2693 3781 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_24090 3838 5508 gene locus_tag LOCUS_24100 gene gpmI 3838 5508 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_24100 5972 5676 gene locus_tag LOCUS_24110 5972 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6318 8726 gene locus_tag LOCUS_24120 6318 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10369 8804 gene locus_tag LOCUS_24130 10369 8804 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944072.1 protein_id gnl|my_center|LOCUS_24130 11152 12471 gene locus_tag LOCUS_24140 11152 12471 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_24140 12745 12494 gene locus_tag LOCUS_24150 12745 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 12833 13444 gene locus_tag LOCUS_24160 12833 13444 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172560.1 protein_id gnl|my_center|LOCUS_24160 13482 15134 gene locus_tag LOCUS_24170 13482 15134 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878476.1 protein_id gnl|my_center|LOCUS_24170 16196 15207 gene locus_tag LOCUS_24180 16196 15207 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_24180 16867 16193 gene locus_tag LOCUS_24190 16867 16193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence097 1232 1393 gene locus_tag LOCUS_24200 1232 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2886 1426 gene locus_tag LOCUS_24210 2886 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_24210 3404 2883 gene locus_tag LOCUS_24220 3404 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3651 3382 gene locus_tag LOCUS_24230 3651 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3998 3648 gene locus_tag LOCUS_24240 3998 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4581 4093 gene locus_tag LOCUS_24250 4581 4093 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_24250 4826 4668 gene locus_tag LOCUS_24260 4826 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 5002 5595 gene locus_tag LOCUS_24270 5002 5595 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_24270 5651 5953 gene locus_tag LOCUS_24280 5651 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6665 5955 gene locus_tag LOCUS_24290 6665 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 6792 7412 gene locus_tag LOCUS_24300 6792 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 10461 7477 gene locus_tag LOCUS_24310 10461 7477 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_24310 11479 10493 gene locus_tag LOCUS_24320 11479 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 12089 14755 gene locus_tag LOCUS_24330 12089 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence098 713 189 gene locus_tag LOCUS_24340 713 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1355 732 gene locus_tag LOCUS_24350 gene iorB 1355 732 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_24350 3236 1374 gene locus_tag LOCUS_24360 gene iorA 3236 1374 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_24360 4529 3252 gene locus_tag LOCUS_24370 4529 3252 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_24370 5445 4714 gene locus_tag LOCUS_24380 5445 4714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_24380 6277 5456 gene locus_tag LOCUS_24390 6277 5456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_24390 7260 6274 gene locus_tag LOCUS_24400 7260 6274 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_24400 8253 7378 gene locus_tag LOCUS_24410 8253 7378 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_24410 10350 8620 gene locus_tag LOCUS_24420 10350 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 11295 10369 gene locus_tag LOCUS_24430 11295 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 11918 11295 gene locus_tag LOCUS_24440 gene cbiM 11918 11295 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_24440 12396 12028 gene locus_tag LOCUS_24450 12396 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 12728 12393 gene locus_tag LOCUS_24460 12728 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 13539 12739 gene locus_tag LOCUS_24470 13539 12739 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_24470 13934 14104 gene locus_tag LOCUS_24480 13934 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 16859 14214 gene locus_tag LOCUS_24490 gene clpB 16859 14214 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence099 611 1756 gene locus_tag LOCUS_24500 611 1756 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_24500 2642 3364 gene locus_tag LOCUS_24510 2642 3364 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064061.1 protein_id gnl|my_center|LOCUS_24510 4107 3718 gene locus_tag LOCUS_24520 4107 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 7809 4354 gene locus_tag LOCUS_24530 7809 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 8799 8077 gene locus_tag LOCUS_24540 8799 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 9646 8852 gene locus_tag LOCUS_24550 gene larB 9646 8852 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_24550 9934 10338 gene locus_tag LOCUS_24560 9934 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 10614 12488 gene locus_tag LOCUS_24570 gene pcrA 10614 12488 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922262.1 protein_id gnl|my_center|LOCUS_24570 12641 13252 gene locus_tag LOCUS_24580 12641 13252 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_24580 13239 14324 gene locus_tag LOCUS_24590 13239 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 16152 14464 gene locus_tag LOCUS_24600 16152 14464 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_24600 16775 16590 gene locus_tag LOCUS_24610 16775 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence100 2253 2056 gene locus_tag LOCUS_24620 2253 2056 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881198.1 protein_id gnl|my_center|LOCUS_24620 3198 2296 gene locus_tag LOCUS_24630 3198 2296 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_24630 3431 4879 gene locus_tag LOCUS_24640 3431 4879 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444793.1 protein_id gnl|my_center|LOCUS_24640 6304 5057 gene locus_tag LOCUS_24650 6304 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 8611 6308 gene locus_tag LOCUS_24660 8611 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 9765 8704 gene locus_tag LOCUS_24670 9765 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 13179 9880 gene locus_tag LOCUS_24680 13179 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 13249 13566 gene locus_tag LOCUS_24690 13249 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 14325 13612 gene locus_tag LOCUS_24700 14325 13612 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545445.1 protein_id gnl|my_center|LOCUS_24700 14650 15087 gene locus_tag LOCUS_24710 14650 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 15334 16116 gene locus_tag LOCUS_24720 gene moeB 15334 16116 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence101 52 870 gene locus_tag LOCUS_24730 52 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 937 2088 gene locus_tag LOCUS_24740 937 2088 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_24740 3133 2177 gene locus_tag LOCUS_24750 3133 2177 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943965.1 protein_id gnl|my_center|LOCUS_24750 3497 3126 gene locus_tag LOCUS_24760 3497 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4211 3513 gene locus_tag LOCUS_24770 4211 3513 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_24770 4440 4706 gene locus_tag LOCUS_24780 4440 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4805 5971 gene locus_tag LOCUS_24790 4805 5971 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_24790 6957 6220 gene locus_tag LOCUS_24800 6957 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 8556 7027 gene locus_tag LOCUS_24810 8556 7027 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937393.1 protein_id gnl|my_center|LOCUS_24810 8764 9375 gene locus_tag LOCUS_24820 8764 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 10960 9383 gene locus_tag LOCUS_24830 10960 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 12399 11242 gene locus_tag LOCUS_24840 12399 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 <16867 12445 gene locus_tag LOCUS_24850 <16867 12445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393945.1:DNA-directed RNA polymerase subunit beta >Feature sequence102 2 616 gene locus_tag LOCUS_24860 2 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 890 666 gene locus_tag LOCUS_24870 890 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 990 1376 gene locus_tag LOCUS_24880 990 1376 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_24880 2128 1373 gene locus_tag LOCUS_24890 2128 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2957 2490 gene locus_tag LOCUS_24900 2957 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 3375 2962 gene locus_tag LOCUS_24910 3375 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3924 3388 gene locus_tag LOCUS_24920 3924 3388 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_24920 5160 3970 gene locus_tag LOCUS_24930 5160 3970 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_24930 5888 6625 gene locus_tag LOCUS_24940 5888 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 6631 8445 gene locus_tag LOCUS_24950 6631 8445 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545213.1 protein_id gnl|my_center|LOCUS_24950 8506 9195 gene locus_tag LOCUS_24960 8506 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 9206 10447 gene locus_tag LOCUS_24970 9206 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 10444 12159 gene locus_tag LOCUS_24980 10444 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24980 12156 12611 gene locus_tag LOCUS_24990 12156 12611 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_24990 12632 13456 gene locus_tag LOCUS_25000 12632 13456 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_25000 13446 13895 gene locus_tag LOCUS_25010 13446 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 14084 15307 gene locus_tag LOCUS_25020 14084 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 15295 16557 gene locus_tag LOCUS_25030 15295 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence103 1595 1164 gene locus_tag LOCUS_25040 1595 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1987 2352 gene locus_tag LOCUS_25050 1987 2352 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_25050 3184 2408 gene locus_tag LOCUS_25060 3184 2408 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388500.1 protein_id gnl|my_center|LOCUS_25060 4352 3627 gene locus_tag LOCUS_25070 4352 3627 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_25070 7238 4569 gene locus_tag LOCUS_25080 7238 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8601 8029 gene locus_tag LOCUS_25090 gene sigZ 8601 8029 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_25090 8879 8619 gene locus_tag LOCUS_25100 8879 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 9452 9102 gene locus_tag LOCUS_25110 9452 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 10350 9661 gene locus_tag LOCUS_25120 10350 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 10870 13827 gene locus_tag LOCUS_25130 10870 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 14517 13915 gene locus_tag LOCUS_25140 14517 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 16071 14992 gene locus_tag LOCUS_25150 16071 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 16205 16342 gene locus_tag LOCUS_25160 16205 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 16383 16457 gene locus_tag LOCUS_t00170 16383 16457 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104 426 10 gene locus_tag LOCUS_25170 426 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2548 893 gene locus_tag LOCUS_25180 2548 893 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_25180 3955 2756 gene locus_tag LOCUS_25190 3955 2756 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_25190 4763 3987 gene locus_tag LOCUS_25200 gene truA 4763 3987 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_25200 5818 4781 gene locus_tag LOCUS_25210 gene argC 5818 4781 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_25210 6362 5970 gene locus_tag LOCUS_25220 gene rpsI 6362 5970 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_25220 6820 6380 gene locus_tag LOCUS_25230 gene rplM 6820 6380 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_25230 9329 6933 gene locus_tag LOCUS_25240 9329 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 10744 9467 gene locus_tag LOCUS_25250 10744 9467 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_25250 12761 10962 gene locus_tag LOCUS_25260 12761 10962 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956991.1 protein_id gnl|my_center|LOCUS_25260 13038 13853 gene locus_tag LOCUS_25270 gene proC 13038 13853 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_25270 14574 13888 gene locus_tag LOCUS_25280 14574 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 16017 14953 gene locus_tag LOCUS_25290 gene mnmA 16017 14953 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_25290 16509 16087 gene locus_tag LOCUS_25300 16509 16087 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence105 923 54 gene locus_tag LOCUS_25310 923 54 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_25310 1152 2447 gene locus_tag LOCUS_25320 gene purB 1152 2447 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_25320 2468 4576 gene locus_tag LOCUS_25330 2468 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 5471 4677 gene locus_tag LOCUS_25340 5471 4677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_25340 6391 5468 gene locus_tag LOCUS_25350 6391 5468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_25350 7057 6581 gene locus_tag LOCUS_25360 7057 6581 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_25360 7720 7292 gene locus_tag LOCUS_25370 7720 7292 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_25370 8417 8214 gene locus_tag LOCUS_25380 8417 8214 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_25380 8774 9973 gene locus_tag LOCUS_25390 8774 9973 CDS product lmo2826 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990083.1 protein_id gnl|my_center|LOCUS_25390 10059 12362 gene locus_tag LOCUS_25400 gene pucD 10059 12362 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 protein_id gnl|my_center|LOCUS_25400 12359 12898 gene locus_tag LOCUS_25410 12359 12898 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_25410 12895 13770 gene locus_tag LOCUS_25420 gene xdhB 12895 13770 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_25420 14822 13767 gene locus_tag LOCUS_25430 gene corA 14822 13767 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_25430 15290 15958 gene locus_tag LOCUS_25440 15290 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence106 2007 889 gene locus_tag LOCUS_25450 2007 889 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_25450 2929 1997 gene locus_tag LOCUS_25460 2929 1997 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063779.1 protein_id gnl|my_center|LOCUS_25460 3767 2994 gene locus_tag LOCUS_25470 3767 2994 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_25470 5148 3790 gene locus_tag LOCUS_25480 gene glmM 5148 3790 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_25480 6243 5362 gene locus_tag LOCUS_25490 gene folP 6243 5362 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_25490 6836 6390 gene locus_tag LOCUS_25500 6836 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 8370 6997 gene locus_tag LOCUS_25510 8370 6997 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_25510 8945 8394 gene locus_tag LOCUS_25520 8945 8394 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_25520 9178 8942 gene locus_tag LOCUS_25530 9178 8942 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_25530 9750 9235 gene locus_tag LOCUS_25540 9750 9235 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939209.1 protein_id gnl|my_center|LOCUS_25540 11469 9826 gene locus_tag LOCUS_25550 11469 9826 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 protein_id gnl|my_center|LOCUS_25550 12474 11536 gene locus_tag LOCUS_25560 12474 11536 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_25560 14158 12878 gene locus_tag LOCUS_25570 14158 12878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_25570 15556 14393 gene locus_tag LOCUS_25580 15556 14393 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_25580 <16538 15597 gene locus_tag LOCUS_25590 <16538 15597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546105.1:type IV pilus twitching motility protein PilT >Feature sequence107 <1 962 gene locus_tag LOCUS_25600 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261804.1:efflux RND transporter periplasmic adaptor subunit 959 5362 gene locus_tag LOCUS_25610 959 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 5526 7109 gene locus_tag LOCUS_25620 5526 7109 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_25620 8906 7251 gene locus_tag LOCUS_25630 8906 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 10114 8903 gene locus_tag LOCUS_25640 10114 8903 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_25640 12219 10111 gene locus_tag LOCUS_25650 12219 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 14372 12480 gene locus_tag LOCUS_25660 gene asnB 14372 12480 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_25660 15376 14378 gene locus_tag LOCUS_25670 15376 14378 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence108 1418 363 gene locus_tag LOCUS_25680 1418 363 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_25680 3081 1915 gene locus_tag LOCUS_25690 3081 1915 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_25690 3470 3102 gene locus_tag LOCUS_25700 gene spo0F 3470 3102 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 protein_id gnl|my_center|LOCUS_25700 5784 3805 gene locus_tag LOCUS_25710 5784 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 7441 5834 gene locus_tag LOCUS_25720 7441 5834 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_25720 8335 8601 gene locus_tag LOCUS_25730 8335 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 10130 8724 gene locus_tag LOCUS_25740 10130 8724 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_25740 10490 10663 gene locus_tag LOCUS_25750 10490 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 11370 12086 gene locus_tag LOCUS_25760 11370 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 12541 12681 gene locus_tag LOCUS_25770 12541 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 14418 14083 gene locus_tag LOCUS_25780 14418 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 15069 16070 gene locus_tag LOCUS_25790 gene csm6 15069 16070 CDS product CRISPR-associated ring nuclease Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546577.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence109 521 258 gene locus_tag LOCUS_25800 521 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1108 1875 gene locus_tag LOCUS_25810 1108 1875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_25810 2024 3103 gene locus_tag LOCUS_25820 2024 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3292 4086 gene locus_tag LOCUS_25830 3292 4086 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528708.1 protein_id gnl|my_center|LOCUS_25830 4092 4958 gene locus_tag LOCUS_25840 4092 4958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974810.1 protein_id gnl|my_center|LOCUS_25840 5012 5782 gene locus_tag LOCUS_25850 5012 5782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_25850 6270 7433 gene locus_tag LOCUS_25860 6270 7433 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862165.1 protein_id gnl|my_center|LOCUS_25860 7596 7889 gene locus_tag LOCUS_25870 7596 7889 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_25870 7903 9348 gene locus_tag LOCUS_25880 7903 9348 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945509.1 protein_id gnl|my_center|LOCUS_25880 9368 10735 gene locus_tag LOCUS_25890 9368 10735 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868826.1 protein_id gnl|my_center|LOCUS_25890 10752 11855 gene locus_tag LOCUS_25900 10752 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 11863 12525 gene locus_tag LOCUS_25910 gene eutL 11863 12525 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868828.1 protein_id gnl|my_center|LOCUS_25910 12530 14023 gene locus_tag LOCUS_25920 12530 14023 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868830.1 protein_id gnl|my_center|LOCUS_25920 14119 14436 gene locus_tag LOCUS_25930 gene eutM 14119 14436 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_25930 14593 15351 gene locus_tag LOCUS_25940 gene eutT 14593 15351 CDS product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651289.1 protein_id gnl|my_center|LOCUS_25940 15409 16260 gene locus_tag LOCUS_25950 gene eutJ 15409 16260 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815263.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence110 <1 2148 gene locus_tag LOCUS_25960 <1 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939841.1:ferrous iron transport protein B 2369 3463 gene locus_tag LOCUS_25970 gene aroB 2369 3463 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_25970 3685 3945 gene locus_tag LOCUS_25980 3685 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4516 4085 gene locus_tag LOCUS_25990 4516 4085 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942323.1 protein_id gnl|my_center|LOCUS_25990 5981 4524 gene locus_tag LOCUS_26000 5981 4524 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942327.1 protein_id gnl|my_center|LOCUS_26000 6164 6970 gene locus_tag LOCUS_26010 6164 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 7986 7153 gene locus_tag LOCUS_26020 7986 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 10266 8230 gene locus_tag LOCUS_26030 10266 8230 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_26030 10446 10655 gene locus_tag LOCUS_26040 10446 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 11435 10647 gene locus_tag LOCUS_26050 11435 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 12172 11864 gene locus_tag LOCUS_26060 12172 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 12565 12640 gene locus_tag LOCUS_t00180 12565 12640 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13857 12730 gene locus_tag LOCUS_26070 13857 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 15138 14071 gene locus_tag LOCUS_26080 15138 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 15676 15368 gene locus_tag LOCUS_26090 15676 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence111 79 357 gene locus_tag LOCUS_26100 79 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26100 437 1315 gene locus_tag LOCUS_26110 437 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26110 2378 1521 gene locus_tag LOCUS_26120 2378 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3293 3217 gene locus_tag LOCUS_t00190 3293 3217 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3661 3479 gene locus_tag LOCUS_26130 3661 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 3949 5169 gene locus_tag LOCUS_26140 gene lhgO 3949 5169 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_26140 5176 5796 gene locus_tag LOCUS_26150 5176 5796 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_26150 5829 6119 gene locus_tag LOCUS_26160 5829 6119 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_26160 6694 9408 gene locus_tag LOCUS_26170 gene fdhF 6694 9408 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:7771..7773,aa:Sec) note codon on position 360 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_26170 9599 11233 gene locus_tag LOCUS_26180 9599 11233 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937486.1 protein_id gnl|my_center|LOCUS_26180 11233 11736 gene locus_tag LOCUS_26190 11233 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 11796 12611 gene locus_tag LOCUS_26200 gene fdhD 11796 12611 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978022.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence112 200 679 gene locus_tag LOCUS_26210 200 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 984 2813 gene locus_tag LOCUS_26220 984 2813 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_26220 2983 4413 gene locus_tag LOCUS_26230 gene gatB 2983 4413 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_26230 4517 5563 gene locus_tag LOCUS_26240 gene mtnA 4517 5563 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_26240 5664 6668 gene locus_tag LOCUS_26250 gene sppA 5664 6668 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_26250 6981 7571 gene locus_tag LOCUS_26260 6981 7571 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940335.1 protein_id gnl|my_center|LOCUS_26260 7597 8193 gene locus_tag LOCUS_26270 7597 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 8279 8464 gene locus_tag LOCUS_26280 8279 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 8505 8699 gene locus_tag LOCUS_26290 8505 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 8769 9089 gene locus_tag LOCUS_26300 8769 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 8992 11094 gene locus_tag LOCUS_26310 8992 11094 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_26310 11099 11890 gene locus_tag LOCUS_26320 11099 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 11905 14007 gene locus_tag LOCUS_26330 11905 14007 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273505.1 protein_id gnl|my_center|LOCUS_26330 14180 14734 gene locus_tag LOCUS_26340 14180 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 <16071 14822 gene locus_tag LOCUS_26350 <16071 14822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001884020.1:MATE family efflux transporter >Feature sequence113 1967 645 gene locus_tag LOCUS_26360 1967 645 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393790.1 protein_id gnl|my_center|LOCUS_26360 3340 2012 gene locus_tag LOCUS_26370 3340 2012 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_26370 4089 3361 gene locus_tag LOCUS_26380 4089 3361 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_26380 4595 4095 gene locus_tag LOCUS_26390 4595 4095 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_26390 6802 4649 gene locus_tag LOCUS_26400 6802 4649 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868596.1 protein_id gnl|my_center|LOCUS_26400 7335 8756 gene locus_tag LOCUS_26410 7335 8756 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393410.1 protein_id gnl|my_center|LOCUS_26410 9360 8896 gene locus_tag LOCUS_26420 9360 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 9609 9403 gene locus_tag LOCUS_26430 9609 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence114 355 723 gene locus_tag LOCUS_26440 355 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 788 714 gene locus_tag LOCUS_t00200 788 714 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1023 1481 gene locus_tag LOCUS_26450 1023 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1522 1770 gene locus_tag LOCUS_26460 1522 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1794 2759 gene locus_tag LOCUS_26470 1794 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2859 3305 gene locus_tag LOCUS_26480 gene rplI 2859 3305 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_26480 3309 4646 gene locus_tag LOCUS_26490 gene dnaB 3309 4646 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_26490 4674 5987 gene locus_tag LOCUS_26500 4674 5987 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_26500 6027 7718 gene locus_tag LOCUS_26510 gene hflX 6027 7718 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_26510 9013 8069 gene locus_tag LOCUS_26520 9013 8069 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_26520 9107 9192 gene locus_tag LOCUS_t00210 9107 9192 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10008 9472 gene locus_tag LOCUS_26530 10008 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 13136 10878 gene locus_tag LOCUS_26540 13136 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 13532 13191 gene locus_tag LOCUS_26550 13532 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 14240 13635 gene locus_tag LOCUS_26560 14240 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 14404 14225 gene locus_tag LOCUS_26570 14404 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 15024 14461 gene locus_tag LOCUS_26580 15024 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 15383 15027 gene locus_tag LOCUS_26590 15383 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence115 1389 1718 gene locus_tag LOCUS_26600 gene trxA 1389 1718 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_26600 1763 2695 gene locus_tag LOCUS_26610 gene trxB 1763 2695 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_26610 2721 3497 gene locus_tag LOCUS_26620 2721 3497 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_26620 3819 5135 gene locus_tag LOCUS_26630 gene rho 3819 5135 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_26630 5313 5534 gene locus_tag LOCUS_26640 gene rpmE 5313 5534 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_26640 5693 6772 gene locus_tag LOCUS_26650 gene prfA 5693 6772 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_26650 7244 6801 gene locus_tag LOCUS_26660 7244 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 7693 9363 gene locus_tag LOCUS_26670 7693 9363 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_26670 9477 10319 gene locus_tag LOCUS_26680 gene kdsA 9477 10319 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_26680 10316 10870 gene locus_tag LOCUS_26690 10316 10870 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_26690 11325 10933 gene locus_tag LOCUS_26700 11325 10933 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_26700 12028 12612 gene locus_tag LOCUS_26710 12028 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 12644 13210 gene locus_tag LOCUS_26720 12644 13210 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923319.1 protein_id gnl|my_center|LOCUS_26720 13213 13950 gene locus_tag LOCUS_26730 gene lptB 13213 13950 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_26730 13962 15407 gene locus_tag LOCUS_26740 gene rpoN 13962 15407 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence116 1232 351 gene locus_tag LOCUS_26750 1232 351 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_26750 1832 1296 gene locus_tag LOCUS_26760 1832 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2076 1906 gene locus_tag LOCUS_26770 2076 1906 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_26770 2580 2092 gene locus_tag LOCUS_26780 2580 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2915 2613 gene locus_tag LOCUS_26790 2915 2613 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_26790 4213 3056 gene locus_tag LOCUS_26800 4213 3056 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 protein_id gnl|my_center|LOCUS_26800 4236 4445 gene locus_tag LOCUS_26810 4236 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 4452 5057 gene locus_tag LOCUS_26820 gene ppiA 4452 5057 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 protein_id gnl|my_center|LOCUS_26820 5410 6249 gene locus_tag LOCUS_26830 gene panB 5410 6249 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_26830 6675 6953 gene locus_tag LOCUS_26840 6675 6953 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_26840 6958 7587 gene locus_tag LOCUS_26850 gene gmk 6958 7587 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_26850 7604 8356 gene locus_tag LOCUS_26860 gene rlmB 7604 8356 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_26860 9050 8340 gene locus_tag LOCUS_26870 9050 8340 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_26870 9622 9362 gene locus_tag LOCUS_26880 9622 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 10180 10680 gene locus_tag LOCUS_26890 gene frhD 10180 10680 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869751.1 protein_id gnl|my_center|LOCUS_26890 10677 12143 gene locus_tag LOCUS_26900 10677 12143 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_26900 12140 15220 gene locus_tag LOCUS_26910 12140 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence117 2733 1537 gene locus_tag LOCUS_26920 2733 1537 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_26920 6016 2738 gene locus_tag LOCUS_26930 6016 2738 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_26930 6685 7788 gene locus_tag LOCUS_26940 6685 7788 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930605.1 protein_id gnl|my_center|LOCUS_26940 7846 8367 gene locus_tag LOCUS_26950 7846 8367 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693871.1 protein_id gnl|my_center|LOCUS_26950 8364 9653 gene locus_tag LOCUS_26960 8364 9653 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_26960 10430 9864 gene locus_tag LOCUS_26970 10430 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 10767 11111 gene locus_tag LOCUS_26980 10767 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 11314 11811 gene locus_tag LOCUS_26990 11314 11811 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391975.1 protein_id gnl|my_center|LOCUS_26990 12459 12097 gene locus_tag LOCUS_27000 12459 12097 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_27000 13899 12475 gene locus_tag LOCUS_27010 13899 12475 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_27010 14119 14439 gene locus_tag LOCUS_27020 14119 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 <15458 14555 gene locus_tag LOCUS_27030 <15458 14555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768340.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence118 2750 1314 gene locus_tag LOCUS_27040 gene gltA 2750 1314 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_27040 3620 2751 gene locus_tag LOCUS_27050 3620 2751 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_27050 4341 5957 gene locus_tag LOCUS_27060 gene glgP 4341 5957 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_27060 6373 7020 gene locus_tag LOCUS_27070 6373 7020 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_27070 7017 7547 gene locus_tag LOCUS_27080 7017 7547 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_27080 7589 8953 gene locus_tag LOCUS_27090 7589 8953 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_27090 9324 11417 gene locus_tag LOCUS_27100 9324 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 11462 12697 gene locus_tag LOCUS_27110 11462 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 12732 13751 gene locus_tag LOCUS_27120 12732 13751 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_27120 13766 14605 gene locus_tag LOCUS_27130 gene cysQ 13766 14605 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence119 550 68 gene locus_tag LOCUS_27140 550 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 691 2289 gene locus_tag LOCUS_27150 691 2289 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_27150 2289 2975 gene locus_tag LOCUS_27160 2289 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3608 3009 gene locus_tag LOCUS_27170 3608 3009 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404550.1 protein_id gnl|my_center|LOCUS_27170 4732 4100 gene locus_tag LOCUS_27180 4732 4100 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_27180 5277 4915 gene locus_tag LOCUS_27190 gene atpE 5277 4915 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_27190 6075 5356 gene locus_tag LOCUS_27200 6075 5356 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_27200 6472 6080 gene locus_tag LOCUS_27210 6472 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 6681 6469 gene locus_tag LOCUS_27220 6681 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 8080 6773 gene locus_tag LOCUS_27230 gene hemL 8080 6773 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_27230 9660 8095 gene locus_tag LOCUS_27240 gene rng 9660 8095 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_27240 12190 9623 gene locus_tag LOCUS_27250 12190 9623 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_27250 12571 12864 gene locus_tag LOCUS_27260 12571 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 <14767 12926 gene locus_tag LOCUS_27270 <14767 12926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922564.1:DNA polymerase I >Feature sequence120 457 960 gene locus_tag LOCUS_27280 457 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 991 2982 gene locus_tag LOCUS_27290 991 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3011 3484 gene locus_tag LOCUS_27300 3011 3484 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 protein_id gnl|my_center|LOCUS_27300 3481 4818 gene locus_tag LOCUS_27310 3481 4818 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_27310 4885 5553 gene locus_tag LOCUS_27320 4885 5553 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_27320 5538 7916 gene locus_tag LOCUS_27330 5538 7916 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266949.1 protein_id gnl|my_center|LOCUS_27330 7931 9004 gene locus_tag LOCUS_27340 7931 9004 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525364.1 protein_id gnl|my_center|LOCUS_27340 9286 11379 gene locus_tag LOCUS_27350 9286 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 11551 12909 gene locus_tag LOCUS_27360 11551 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 12902 13426 gene locus_tag LOCUS_27370 12902 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 14129 13671 gene locus_tag LOCUS_27380 14129 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence121 211 978 gene locus_tag LOCUS_27390 211 978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_27390 980 1699 gene locus_tag LOCUS_27400 980 1699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_27400 2274 5087 gene locus_tag LOCUS_27410 2274 5087 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_27410 6792 5224 gene locus_tag LOCUS_27420 6792 5224 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_27420 7051 7338 gene locus_tag LOCUS_27430 7051 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 7415 8677 gene locus_tag LOCUS_27440 7415 8677 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_27440 8700 11855 gene locus_tag LOCUS_27450 8700 11855 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544956.1 protein_id gnl|my_center|LOCUS_27450 13430 11937 gene locus_tag LOCUS_27460 13430 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence122 1571 924 gene locus_tag LOCUS_27470 1571 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2943 1849 gene locus_tag LOCUS_27480 2943 1849 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_27480 4511 3192 gene locus_tag LOCUS_27490 4511 3192 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243031.1 protein_id gnl|my_center|LOCUS_27490 5080 4508 gene locus_tag LOCUS_27500 5080 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 6293 5289 gene locus_tag LOCUS_27510 6293 5289 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_27510 7403 6525 gene locus_tag LOCUS_27520 7403 6525 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060027.1 protein_id gnl|my_center|LOCUS_27520 8746 7859 gene locus_tag LOCUS_27530 8746 7859 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_27530 10004 8889 gene locus_tag LOCUS_27540 10004 8889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_27540 11182 10007 gene locus_tag LOCUS_27550 11182 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 12945 11179 gene locus_tag LOCUS_27560 12945 11179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_27560 13986 12955 gene locus_tag LOCUS_27570 13986 12955 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_27570 14232 14032 gene locus_tag LOCUS_27580 14232 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence123 2771 261 gene locus_tag LOCUS_27590 2771 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3312 3710 gene locus_tag LOCUS_27600 3312 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3847 5232 gene locus_tag LOCUS_27610 gene lpdA 3847 5232 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_27610 7006 5453 gene locus_tag LOCUS_27620 gene murJ 7006 5453 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792519.1 protein_id gnl|my_center|LOCUS_27620 7240 8460 gene locus_tag LOCUS_27630 7240 8460 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_27630 8547 8909 gene locus_tag LOCUS_27640 8547 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 9354 8959 gene locus_tag LOCUS_27650 9354 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 11556 9583 gene locus_tag LOCUS_27660 11556 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 13385 11934 gene locus_tag LOCUS_27670 13385 11934 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_27670 <14139 13527 gene locus_tag LOCUS_27680 <14139 13527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein >Feature sequence124 243 1304 gene locus_tag LOCUS_27690 243 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1514 2605 gene locus_tag LOCUS_27700 1514 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2687 2611 gene locus_tag LOCUS_t00220 2687 2611 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4124 2982 gene locus_tag LOCUS_27710 4124 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 4633 4139 gene locus_tag LOCUS_27720 4633 4139 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_27720 5280 4636 gene locus_tag LOCUS_27730 5280 4636 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_27730 6798 5401 gene locus_tag LOCUS_27740 6798 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7006 7308 gene locus_tag LOCUS_27750 7006 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7812 7552 gene locus_tag LOCUS_27760 7812 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 8941 8057 gene locus_tag LOCUS_27770 8941 8057 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_27770 9392 10522 gene locus_tag LOCUS_27780 9392 10522 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868973.1 protein_id gnl|my_center|LOCUS_27780 10943 12283 gene locus_tag LOCUS_27790 10943 12283 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941701.1 protein_id gnl|my_center|LOCUS_27790 12667 12939 gene locus_tag LOCUS_27800 12667 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 12952 13467 gene locus_tag LOCUS_27810 12952 13467 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939592.1 protein_id gnl|my_center|LOCUS_27810 13522 13896 gene locus_tag LOCUS_27820 13522 13896 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence125 1999 962 gene locus_tag LOCUS_27830 1999 962 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_27830 2371 3546 gene locus_tag LOCUS_27840 2371 3546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_27840 4062 5402 gene locus_tag LOCUS_27850 gene dcuB 4062 5402 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899146.1 protein_id gnl|my_center|LOCUS_27850 6237 5503 gene locus_tag LOCUS_27860 6237 5503 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860384.1 protein_id gnl|my_center|LOCUS_27860 6815 8152 gene locus_tag LOCUS_27870 6815 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 8474 8355 gene locus_tag LOCUS_27880 8474 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 8879 8475 gene locus_tag LOCUS_27890 8879 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 8766 10100 gene locus_tag LOCUS_27900 8766 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 10344 11681 gene locus_tag LOCUS_27910 10344 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 <14011 11737 gene locus_tag LOCUS_27920 <14011 11737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141175.1:NB-ARC domain-containing protein >Feature sequence126 2019 139 gene locus_tag LOCUS_27930 2019 139 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929324.1 protein_id gnl|my_center|LOCUS_27930 2610 2957 gene locus_tag LOCUS_27940 2610 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3347 5230 gene locus_tag LOCUS_27950 3347 5230 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_27950 5367 6359 gene locus_tag LOCUS_27960 5367 6359 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_27960 6532 7107 gene locus_tag LOCUS_27970 6532 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 9567 7240 gene locus_tag LOCUS_27980 9567 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 10621 9794 gene locus_tag LOCUS_27990 10621 9794 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898500.1 protein_id gnl|my_center|LOCUS_27990 10954 12075 gene locus_tag LOCUS_28000 10954 12075 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_28000 12264 13166 gene locus_tag LOCUS_28010 12264 13166 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence127 749 300 gene locus_tag LOCUS_28020 749 300 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939377.1 protein_id gnl|my_center|LOCUS_28020 1525 812 gene locus_tag LOCUS_28030 1525 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_28030 2834 1539 gene locus_tag LOCUS_28040 2834 1539 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_28040 3704 3351 gene locus_tag LOCUS_28050 3704 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3912 3724 gene locus_tag LOCUS_28060 3912 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 7534 4007 gene locus_tag LOCUS_28070 7534 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 7430 7720 gene locus_tag LOCUS_28080 7430 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 8223 8792 gene locus_tag LOCUS_28090 8223 8792 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_28090 8808 10454 gene locus_tag LOCUS_28100 8808 10454 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940324.1 protein_id gnl|my_center|LOCUS_28100 10634 12187 gene locus_tag LOCUS_28110 10634 12187 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_28110 13168 12251 gene locus_tag LOCUS_28120 gene era 13168 12251 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_28120 <13873 13195 gene locus_tag LOCUS_28130 <13873 13195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942867.1:radical SAM protein >Feature sequence128 <1 553 gene locus_tag LOCUS_28140 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262357.1:endonuclease/exonuclease/phosphatase family protein 671 2302 gene locus_tag LOCUS_28150 671 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2507 5797 gene locus_tag LOCUS_28160 2507 5797 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_28160 5892 6155 gene locus_tag LOCUS_28170 5892 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 6236 8827 gene locus_tag LOCUS_28180 gene glnD 6236 8827 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_28180 8840 9616 gene locus_tag LOCUS_28190 8840 9616 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_28190 9678 10250 gene locus_tag LOCUS_28200 9678 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence129 <1 2348 gene locus_tag LOCUS_28210 <1 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940506.1:multidrug efflux RND transporter permease subunit 2698 3930 gene locus_tag LOCUS_28220 2698 3930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035557.1 protein_id gnl|my_center|LOCUS_28220 4111 5157 gene locus_tag LOCUS_28230 4111 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 5793 5266 gene locus_tag LOCUS_28240 5793 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 6147 6785 gene locus_tag LOCUS_28250 6147 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 6909 8273 gene locus_tag LOCUS_28260 6909 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 8373 8549 gene locus_tag LOCUS_28270 8373 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 8748 9566 gene locus_tag LOCUS_28280 8748 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 10086 11711 gene locus_tag LOCUS_28290 10086 11711 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_28290 11918 12343 gene locus_tag LOCUS_28300 11918 12343 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_28300 12377 13360 gene locus_tag LOCUS_28310 gene akrN 12377 13360 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence130 319 666 gene locus_tag LOCUS_28320 319 666 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807950.1 protein_id gnl|my_center|LOCUS_28320 663 1388 gene locus_tag LOCUS_28330 663 1388 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113185.1 protein_id gnl|my_center|LOCUS_28330 1388 2095 gene locus_tag LOCUS_28340 1388 2095 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072852.1 protein_id gnl|my_center|LOCUS_28340 2092 2979 gene locus_tag LOCUS_28350 2092 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2991 7580 gene locus_tag LOCUS_28360 2991 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 7585 7968 gene locus_tag LOCUS_28370 7585 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 7978 9486 gene locus_tag LOCUS_28380 7978 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 9496 9993 gene locus_tag LOCUS_28390 9496 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 10697 12268 gene locus_tag LOCUS_28400 10697 12268 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_28400 12733 12443 gene locus_tag LOCUS_28410 12733 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 13145 13339 gene locus_tag LOCUS_28420 13145 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence131 1034 765 gene locus_tag LOCUS_28430 1034 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1616 2584 gene locus_tag LOCUS_28440 1616 2584 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_28440 2590 3435 gene locus_tag LOCUS_28450 2590 3435 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_28450 3485 4417 gene locus_tag LOCUS_28460 3485 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 5407 4424 gene locus_tag LOCUS_28470 5407 4424 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393222.1 protein_id gnl|my_center|LOCUS_28470 5538 6221 gene locus_tag LOCUS_28480 5538 6221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932770.1 protein_id gnl|my_center|LOCUS_28480 6218 7009 gene locus_tag LOCUS_28490 gene fetB 6218 7009 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_28490 7246 8079 gene locus_tag LOCUS_28500 7246 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 8076 8717 gene locus_tag LOCUS_28510 8076 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 8732 9292 gene locus_tag LOCUS_28520 8732 9292 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_28520 9625 10575 gene locus_tag LOCUS_28530 gene selD 9625 10575 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_28530 10908 11372 gene locus_tag LOCUS_28540 10908 11372 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791692.1 protein_id gnl|my_center|LOCUS_28540 11398 11907 gene locus_tag LOCUS_28550 11398 11907 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940018.1 protein_id gnl|my_center|LOCUS_28550 13537 12056 gene locus_tag LOCUS_28560 13537 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence132 3016 2132 gene locus_tag LOCUS_28570 gene xerD 3016 2132 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_28570 4878 3223 gene locus_tag LOCUS_28580 4878 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28580 6381 4942 gene locus_tag LOCUS_28590 6381 4942 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_28590 7278 7354 gene locus_tag LOCUS_t00230 7278 7354 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8512 7664 gene locus_tag LOCUS_28600 8512 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 9238 10452 gene locus_tag LOCUS_28610 gene dpaL 9238 10452 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_28610 10625 11098 gene locus_tag LOCUS_28620 10625 11098 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_28620 11694 11212 gene locus_tag LOCUS_28630 11694 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 12580 11729 gene locus_tag LOCUS_28640 12580 11729 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_28640 13345 12668 gene locus_tag LOCUS_28650 13345 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence133 54 632 gene locus_tag LOCUS_28660 54 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 646 1533 gene locus_tag LOCUS_28670 646 1533 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_28670 1552 2400 gene locus_tag LOCUS_28680 1552 2400 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_28680 2422 3096 gene locus_tag LOCUS_28690 2422 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3107 3604 gene locus_tag LOCUS_28700 3107 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 4001 3618 gene locus_tag LOCUS_28710 4001 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4385 5062 gene locus_tag LOCUS_28720 gene flgF 4385 5062 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_28720 5117 5896 gene locus_tag LOCUS_28730 gene flgG 5117 5896 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_28730 5914 6924 gene locus_tag LOCUS_28740 5914 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6967 7728 gene locus_tag LOCUS_28750 6967 7728 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_28750 7744 8859 gene locus_tag LOCUS_28760 7744 8859 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_28760 8909 9325 gene locus_tag LOCUS_28770 8909 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 9380 9763 gene locus_tag LOCUS_28780 9380 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 9767 11068 gene locus_tag LOCUS_28790 gene flgK 9767 11068 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_28790 11088 11996 gene locus_tag LOCUS_28800 gene flgL 11088 11996 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460796.1 protein_id gnl|my_center|LOCUS_28800 12644 12168 gene locus_tag LOCUS_28810 12644 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence134 54 1106 gene locus_tag LOCUS_28820 gene aroF 54 1106 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_28820 1134 2657 gene locus_tag LOCUS_28830 gene trpE 1134 2657 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_28830 2671 3270 gene locus_tag LOCUS_28840 gene pabA 2671 3270 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_28840 3267 4283 gene locus_tag LOCUS_28850 gene trpD 3267 4283 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_28850 4302 5099 gene locus_tag LOCUS_28860 gene trpC 4302 5099 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_28860 5092 5766 gene locus_tag LOCUS_28870 5092 5766 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_28870 5763 7016 gene locus_tag LOCUS_28880 gene trpB 5763 7016 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097340.1 protein_id gnl|my_center|LOCUS_28880 7009 7818 gene locus_tag LOCUS_28890 gene trpA 7009 7818 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_28890 8194 7979 gene locus_tag LOCUS_28900 8194 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 8805 9545 gene locus_tag LOCUS_28910 8805 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 10266 9676 gene locus_tag LOCUS_28920 10266 9676 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 protein_id gnl|my_center|LOCUS_28920 11674 10388 gene locus_tag LOCUS_28930 11674 10388 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_28930 12506 11631 gene locus_tag LOCUS_28940 12506 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence135 2392 386 gene locus_tag LOCUS_28950 2392 386 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_28950 3897 2947 gene locus_tag LOCUS_28960 3897 2947 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_28960 4159 5133 gene locus_tag LOCUS_28970 4159 5133 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_28970 5246 5659 gene locus_tag LOCUS_28980 5246 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_28980 6132 5785 gene locus_tag LOCUS_28990 6132 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 7142 6702 gene locus_tag LOCUS_29000 gene dtd 7142 6702 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_29000 7229 8626 gene locus_tag LOCUS_29010 7229 8626 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_29010 8784 8539 gene locus_tag LOCUS_29020 8784 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 9557 8781 gene locus_tag LOCUS_29030 9557 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 10242 9835 gene locus_tag LOCUS_29040 10242 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 12862 10295 gene locus_tag LOCUS_29050 12862 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence136 442 1992 gene locus_tag LOCUS_29060 442 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 2073 3425 gene locus_tag LOCUS_29070 2073 3425 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_29070 5134 3446 gene locus_tag LOCUS_29080 5134 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 5353 6612 gene locus_tag LOCUS_29090 5353 6612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_29090 6857 9109 gene locus_tag LOCUS_29100 6857 9109 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_29100 9176 10630 gene locus_tag LOCUS_29110 9176 10630 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087310.1 protein_id gnl|my_center|LOCUS_29110 10743 10991 gene locus_tag LOCUS_29120 10743 10991 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 protein_id gnl|my_center|LOCUS_29120 10988 11485 gene locus_tag LOCUS_29130 gene rfaE2 10988 11485 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_29130 11693 11878 gene locus_tag LOCUS_29140 11693 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 11862 12182 gene locus_tag LOCUS_29150 11862 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence137 <1 1741 gene locus_tag LOCUS_29160 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881716.1:ATP-dependent DNA helicase 1771 2136 gene locus_tag LOCUS_29170 1771 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2112 3059 gene locus_tag LOCUS_29180 2112 3059 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545320.1 protein_id gnl|my_center|LOCUS_29180 3581 3138 gene locus_tag LOCUS_29190 3581 3138 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_29190 5162 3594 gene locus_tag LOCUS_29200 5162 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 10227 5176 gene locus_tag LOCUS_29210 10227 5176 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_29210 11857 10532 gene locus_tag LOCUS_29220 11857 10532 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943127.1 protein_id gnl|my_center|LOCUS_29220 <13187 12472 gene locus_tag LOCUS_29230 <13187 12472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545239.1:carbon starvation protein A >Feature sequence138 1176 2756 gene locus_tag LOCUS_29240 gene serA 1176 2756 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_29240 2784 3209 gene locus_tag LOCUS_29250 2784 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3256 4065 gene locus_tag LOCUS_29260 gene ispE 3256 4065 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_29260 4148 4222 gene locus_tag LOCUS_t00240 4148 4222 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4266 5204 gene locus_tag LOCUS_29270 4266 5204 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_29270 5240 5827 gene locus_tag LOCUS_29280 5240 5827 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_29280 6046 6648 gene locus_tag LOCUS_29290 gene pth 6046 6648 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_29290 7473 6865 gene locus_tag LOCUS_29300 gene clpP 7473 6865 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_29300 8841 7480 gene locus_tag LOCUS_29310 gene tig 8841 7480 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_29310 8978 8894 gene locus_tag LOCUS_t00250 8978 8894 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9813 9115 gene locus_tag LOCUS_29320 9813 9115 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393990.1 protein_id gnl|my_center|LOCUS_29320 11122 9821 gene locus_tag LOCUS_29330 11122 9821 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_29330 11317 11505 gene locus_tag LOCUS_29340 11317 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 12167 11754 gene locus_tag LOCUS_29350 12167 11754 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_29350 12342 12941 gene locus_tag LOCUS_29360 12342 12941 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence139 1605 505 gene locus_tag LOCUS_29370 1605 505 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_29370 3629 1602 gene locus_tag LOCUS_29380 3629 1602 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_29380 4068 3919 gene locus_tag LOCUS_29390 4068 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 5993 4656 gene locus_tag LOCUS_29400 5993 4656 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006005062.1 protein_id gnl|my_center|LOCUS_29400 7200 8087 gene locus_tag LOCUS_29410 7200 8087 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393277.1 protein_id gnl|my_center|LOCUS_29410 8080 9102 gene locus_tag LOCUS_29420 gene dmpG 8080 9102 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_29420 10383 9352 gene locus_tag LOCUS_29430 10383 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 10732 11505 gene locus_tag LOCUS_29440 10732 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence140 1556 432 gene locus_tag LOCUS_29450 1556 432 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392495.1 protein_id gnl|my_center|LOCUS_29450 2019 1546 gene locus_tag LOCUS_29460 2019 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2552 2016 gene locus_tag LOCUS_29470 2552 2016 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_29470 2914 2537 gene locus_tag LOCUS_29480 gene ndhC 2914 2537 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140750.1 protein_id gnl|my_center|LOCUS_29480 3377 4930 gene locus_tag LOCUS_29490 3377 4930 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_29490 4939 5448 gene locus_tag LOCUS_29500 gene tsaE 4939 5448 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_29500 5833 5522 gene locus_tag LOCUS_29510 5833 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 6256 5882 gene locus_tag LOCUS_29520 6256 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 7979 6354 gene locus_tag LOCUS_29530 7979 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 9341 8070 gene locus_tag LOCUS_29540 gene thiC 9341 8070 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_29540 11905 9611 gene locus_tag LOCUS_29550 11905 9611 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_29550 12679 12362 gene locus_tag LOCUS_29560 12679 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 13055 12837 gene locus_tag LOCUS_29570 13055 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence141 289 906 gene locus_tag LOCUS_29580 289 906 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_29580 903 4235 gene locus_tag LOCUS_29590 903 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4326 5912 gene locus_tag LOCUS_29600 4326 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 5941 6552 gene locus_tag LOCUS_29610 5941 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29610 6568 8379 gene locus_tag LOCUS_29620 6568 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29620 8935 9846 gene locus_tag LOCUS_29630 gene argB 8935 9846 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_29630 9849 11066 gene locus_tag LOCUS_29640 9849 11066 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_29640 11038 11961 gene locus_tag LOCUS_29650 gene argF 11038 11961 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence142 <1 836 gene locus_tag LOCUS_29660 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940039.1:YitT family protein 845 1675 gene locus_tag LOCUS_29670 845 1675 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_29670 2331 1690 gene locus_tag LOCUS_29680 gene coxH3 2331 1690 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_29680 2584 3651 gene locus_tag LOCUS_29690 2584 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3648 4646 gene locus_tag LOCUS_29700 3648 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 5174 5614 gene locus_tag LOCUS_29710 5174 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 5716 8175 gene locus_tag LOCUS_29720 5716 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 8299 8982 gene locus_tag LOCUS_29730 8299 8982 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942672.1 protein_id gnl|my_center|LOCUS_29730 9720 9235 gene locus_tag LOCUS_29740 gene lspA 9720 9235 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036354.1 protein_id gnl|my_center|LOCUS_29740 12612 9820 gene locus_tag LOCUS_29750 gene ileS 12612 9820 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence143 <1 857 gene locus_tag LOCUS_29760 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 918 2033 gene locus_tag LOCUS_29770 gene rodA 918 2033 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_29770 2271 2696 gene locus_tag LOCUS_29780 2271 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2697 3299 gene locus_tag LOCUS_29790 2697 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3296 3847 gene locus_tag LOCUS_29800 gene atpH 3296 3847 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_29800 3848 5365 gene locus_tag LOCUS_29810 gene atpA 3848 5365 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_29810 5399 6277 gene locus_tag LOCUS_29820 5399 6277 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_29820 6314 7723 gene locus_tag LOCUS_29830 gene atpD 6314 7723 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_29830 7744 8148 gene locus_tag LOCUS_29840 7744 8148 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_29840 9073 10578 gene locus_tag LOCUS_29850 gene rny 9073 10578 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_29850 10609 11883 gene locus_tag LOCUS_29860 gene tyrS 10609 11883 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence144 1636 50 gene locus_tag LOCUS_29870 1636 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 4574 1845 gene locus_tag LOCUS_29880 4574 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 5514 4621 gene locus_tag LOCUS_29890 5514 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 6744 5536 gene locus_tag LOCUS_29900 6744 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 7459 6800 gene locus_tag LOCUS_29910 7459 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 7727 7548 gene locus_tag LOCUS_29920 7727 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 8937 8473 gene locus_tag LOCUS_29930 8937 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 9523 9014 gene locus_tag LOCUS_29940 9523 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence145 1218 238 gene locus_tag LOCUS_29950 1218 238 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_29950 3418 1490 gene locus_tag LOCUS_29960 gene dnaK 3418 1490 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_29960 4875 3766 gene locus_tag LOCUS_29970 4875 3766 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_29970 5115 6662 gene locus_tag LOCUS_29980 5115 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 7367 6978 gene locus_tag LOCUS_29990 7367 6978 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_29990 8660 7431 gene locus_tag LOCUS_30000 8660 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 9223 8768 gene locus_tag LOCUS_30010 9223 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30010 9997 9314 gene locus_tag LOCUS_30020 9997 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30020 11001 10159 gene locus_tag LOCUS_30030 11001 10159 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_30030 12084 11029 gene locus_tag LOCUS_30040 12084 11029 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_30040 <12733 12161 gene locus_tag LOCUS_30050 <12733 12161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392333.1:4Fe-4S dicluster domain-containing protein >Feature sequence146 1988 39 gene locus_tag LOCUS_30060 1988 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2949 3326 gene locus_tag LOCUS_30070 2949 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5203 3413 gene locus_tag LOCUS_30080 5203 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 6186 6710 gene locus_tag LOCUS_30090 6186 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 7568 8368 gene locus_tag LOCUS_30100 7568 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 8577 10109 gene locus_tag LOCUS_30110 8577 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 10229 12538 gene locus_tag LOCUS_30120 10229 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence147 <1 1416 gene locus_tag LOCUS_30130 <1 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938721.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) 2206 1457 gene locus_tag LOCUS_30140 2206 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2636 2490 gene locus_tag LOCUS_30150 2636 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2586 4247 gene locus_tag LOCUS_30160 2586 4247 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939515.1 protein_id gnl|my_center|LOCUS_30160 4259 5572 gene locus_tag LOCUS_30170 4259 5572 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392504.1 protein_id gnl|my_center|LOCUS_30170 5581 6651 gene locus_tag LOCUS_30180 gene rlmN 5581 6651 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_30180 6641 7018 gene locus_tag LOCUS_30190 gene hisI 6641 7018 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_30190 7015 7887 gene locus_tag LOCUS_30200 gene hisG 7015 7887 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_30200 7894 9303 gene locus_tag LOCUS_30210 7894 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 9366 10502 gene locus_tag LOCUS_30220 9366 10502 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_30220 10508 11101 gene locus_tag LOCUS_30230 gene yihA 10508 11101 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_30230 11252 12031 gene locus_tag LOCUS_30240 gene scpB 11252 12031 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069498.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence148 964 518 gene locus_tag LOCUS_30250 964 518 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_30250 1780 1040 gene locus_tag LOCUS_30260 gene hisA 1780 1040 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_30260 2213 1815 gene locus_tag LOCUS_30270 2213 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3456 2215 gene locus_tag LOCUS_30280 3456 2215 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_30280 4959 3652 gene locus_tag LOCUS_30290 4959 3652 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_30290 6340 5123 gene locus_tag LOCUS_30300 gene alaC 6340 5123 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_30300 6750 8666 gene locus_tag LOCUS_30310 gene selB 6750 8666 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_30310 10451 8694 gene locus_tag LOCUS_30320 10451 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 11937 11110 gene locus_tag LOCUS_30330 11937 11110 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124270.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence149 434 1366 gene locus_tag LOCUS_30340 gene dusB 434 1366 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_30340 2161 1373 gene locus_tag LOCUS_30350 gene xth 2161 1373 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_30350 2381 3199 gene locus_tag LOCUS_30360 gene rpsB 2381 3199 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_30360 3386 3979 gene locus_tag LOCUS_30370 gene tsf 3386 3979 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_30370 4018 4755 gene locus_tag LOCUS_30380 gene pyrH 4018 4755 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_30380 4745 5305 gene locus_tag LOCUS_30390 gene frr 4745 5305 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_30390 5306 6109 gene locus_tag LOCUS_30400 5306 6109 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_30400 6177 7010 gene locus_tag LOCUS_30410 6177 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 7153 8313 gene locus_tag LOCUS_30420 7153 8313 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_30420 8374 9465 gene locus_tag LOCUS_30430 gene rseP 8374 9465 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_30430 9571 10293 gene locus_tag LOCUS_30440 gene tsaB 9571 10293 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_30440 10466 10975 gene locus_tag LOCUS_30450 10466 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 11557 10868 gene locus_tag LOCUS_30460 11557 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 11774 11613 gene locus_tag LOCUS_30470 11774 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence150 231 1004 gene locus_tag LOCUS_30480 231 1004 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_30480 1221 1775 gene locus_tag LOCUS_30490 1221 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1785 2642 gene locus_tag LOCUS_30500 gene motA 1785 2642 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_30500 2648 3460 gene locus_tag LOCUS_30510 2648 3460 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546155.1 protein_id gnl|my_center|LOCUS_30510 3604 5004 gene locus_tag LOCUS_30520 3604 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 5001 5645 gene locus_tag LOCUS_30530 5001 5645 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_30530 5728 6804 gene locus_tag LOCUS_30540 5728 6804 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_30540 7721 6984 gene locus_tag LOCUS_30550 7721 6984 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937490.1 protein_id gnl|my_center|LOCUS_30550 8075 8809 gene locus_tag LOCUS_30560 gene aqpZ 8075 8809 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_30560 8854 9441 gene locus_tag LOCUS_30570 8854 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 10168 10728 gene locus_tag LOCUS_30580 10168 10728 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937870.1 protein_id gnl|my_center|LOCUS_30580 10744 11757 gene locus_tag LOCUS_30590 gene gap 10744 11757 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937869.1 protein_id gnl|my_center|LOCUS_30590 >Feature sequence151 1209 739 gene locus_tag LOCUS_30600 gene nuoE 1209 739 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_30600 3855 1309 gene locus_tag LOCUS_30610 gene fdhF 3855 1309 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_30610 4140 4925 gene locus_tag LOCUS_30620 gene cobM 4140 4925 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812298.1 protein_id gnl|my_center|LOCUS_30620 4876 5982 gene locus_tag LOCUS_30630 4876 5982 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229228.1 protein_id gnl|my_center|LOCUS_30630 6012 6776 gene locus_tag LOCUS_30640 6012 6776 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816685.1 protein_id gnl|my_center|LOCUS_30640 6773 7033 gene locus_tag LOCUS_30650 6773 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 7849 6971 gene locus_tag LOCUS_30660 7849 6971 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_30660 8466 8161 gene locus_tag LOCUS_30670 8466 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 8954 8463 gene locus_tag LOCUS_30680 8954 8463 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_30680 9441 8965 gene locus_tag LOCUS_30690 9441 8965 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_30690 10284 9550 gene locus_tag LOCUS_30700 10284 9550 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_30700 11875 10322 gene locus_tag LOCUS_30710 gene guaA 11875 10322 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence152 2336 1176 gene locus_tag LOCUS_30720 2336 1176 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119520.1 protein_id gnl|my_center|LOCUS_30720 3509 2364 gene locus_tag LOCUS_30730 gene devC 3509 2364 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_30730 4639 3512 gene locus_tag LOCUS_30740 gene devC 4639 3512 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_30740 5647 4652 gene locus_tag LOCUS_30750 5647 4652 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_30750 7280 5712 gene locus_tag LOCUS_30760 7280 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 8985 7810 gene locus_tag LOCUS_30770 8985 7810 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209885.1 protein_id gnl|my_center|LOCUS_30770 9620 8985 gene locus_tag LOCUS_30780 9620 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 9522 9764 gene locus_tag LOCUS_30790 9522 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 10383 9928 gene locus_tag LOCUS_30800 10383 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 10994 10491 gene locus_tag LOCUS_30810 10994 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 11226 11041 gene locus_tag LOCUS_30820 11226 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 12020 11505 gene locus_tag LOCUS_30830 12020 11505 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594450.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence153 18 3611 gene locus_tag LOCUS_30840 18 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3699 4166 gene locus_tag LOCUS_30850 3699 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4189 5889 gene locus_tag LOCUS_30860 4189 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 6210 6743 gene locus_tag LOCUS_30870 6210 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 6796 8301 gene locus_tag LOCUS_30880 gene tssC 6796 8301 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003040143.1 protein_id gnl|my_center|LOCUS_30880 8366 8524 gene locus_tag LOCUS_30890 8366 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 8548 9123 gene locus_tag LOCUS_30900 8548 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 9240 10496 gene locus_tag LOCUS_30910 gene tssK 9240 10496 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366554.1 protein_id gnl|my_center|LOCUS_30910 10569 10961 gene locus_tag LOCUS_30920 10569 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence154 2 1492 gene locus_tag LOCUS_30930 gene recJ 2 1492 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_30930 2139 1558 gene locus_tag LOCUS_30940 2139 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 4196 2547 gene locus_tag LOCUS_30950 4196 2547 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793021.1 protein_id gnl|my_center|LOCUS_30950 4794 4402 gene locus_tag LOCUS_30960 4794 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 6154 4838 gene locus_tag LOCUS_30970 6154 4838 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937837.1 protein_id gnl|my_center|LOCUS_30970 6893 6234 gene locus_tag LOCUS_30980 6893 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 protein_id gnl|my_center|LOCUS_30980 7355 9238 gene locus_tag LOCUS_30990 7355 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 9502 11454 gene locus_tag LOCUS_31000 gene acs 9502 11454 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence155 137 358 gene locus_tag LOCUS_31010 137 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 490 705 gene locus_tag LOCUS_31020 490 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 779 706 gene locus_tag LOCUS_t00260 779 706 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 864 791 gene locus_tag LOCUS_t00270 864 791 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1195 1377 gene locus_tag LOCUS_31030 1195 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1426 1716 gene locus_tag LOCUS_31040 1426 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1975 3429 gene locus_tag LOCUS_31050 1975 3429 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_31050 3452 4549 gene locus_tag LOCUS_31060 3452 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_31060 5212 4844 gene locus_tag LOCUS_31070 5212 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 5847 5416 gene locus_tag LOCUS_31080 5847 5416 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_31080 6111 6887 gene locus_tag LOCUS_31090 gene fabG 6111 6887 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_31090 7106 8449 gene locus_tag LOCUS_31100 gene hisS 7106 8449 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_31100 8562 10415 gene locus_tag LOCUS_31110 gene aspS 8562 10415 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence156 1282 215 gene locus_tag LOCUS_31120 1282 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 2228 1413 gene locus_tag LOCUS_31130 2228 1413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_31130 3816 2281 gene locus_tag LOCUS_31140 3816 2281 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_31140 5283 3916 gene locus_tag LOCUS_31150 5283 3916 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_31150 7502 6246 gene locus_tag LOCUS_31160 7502 6246 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939924.1 protein_id gnl|my_center|LOCUS_31160 7789 8820 gene locus_tag LOCUS_31170 7789 8820 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_31170 9707 8955 gene locus_tag LOCUS_31180 9707 8955 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530348.1 protein_id gnl|my_center|LOCUS_31180 10185 11021 gene locus_tag LOCUS_31190 10185 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence157 <1 884 gene locus_tag LOCUS_31200 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G 1119 2207 gene locus_tag LOCUS_31210 1119 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2220 2729 gene locus_tag LOCUS_31220 gene mog 2220 2729 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_31220 3190 2867 gene locus_tag LOCUS_31230 3190 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3711 3190 gene locus_tag LOCUS_31240 3711 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4481 3708 gene locus_tag LOCUS_31250 4481 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 6243 4549 gene locus_tag LOCUS_31260 6243 4549 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_31260 6453 7694 gene locus_tag LOCUS_31270 gene amrB 6453 7694 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_31270 7713 9056 gene locus_tag LOCUS_31280 gene mtaB 7713 9056 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_31280 9166 9780 gene locus_tag LOCUS_31290 9166 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence158 99 500 gene locus_tag LOCUS_31300 99 500 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_31300 1085 486 gene locus_tag LOCUS_31310 1085 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 1618 1082 gene locus_tag LOCUS_31320 1618 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2663 1824 gene locus_tag LOCUS_31330 2663 1824 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_31330 3520 2660 gene locus_tag LOCUS_31340 3520 2660 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_31340 5068 3578 gene locus_tag LOCUS_31350 gene glgA 5068 3578 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_31350 5327 6403 gene locus_tag LOCUS_31360 gene ispG 5327 6403 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_31360 6508 8646 gene locus_tag LOCUS_31370 6508 8646 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_31370 9071 8784 gene locus_tag LOCUS_31380 9071 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 9485 9757 gene locus_tag LOCUS_31390 9485 9757 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence159 2244 382 gene locus_tag LOCUS_31400 2244 382 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_31400 2441 2292 gene locus_tag LOCUS_31410 2441 2292 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_31410 2846 2451 gene locus_tag LOCUS_31420 2846 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 4812 2926 gene locus_tag LOCUS_31430 4812 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 6057 4867 gene locus_tag LOCUS_31440 6057 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 6832 6077 gene locus_tag LOCUS_31450 6832 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 7710 6817 gene locus_tag LOCUS_31460 7710 6817 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_31460 9611 7707 gene locus_tag LOCUS_31470 gene asnB 9611 7707 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_31470 10881 9583 gene locus_tag LOCUS_31480 10881 9583 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_31480 <11487 10886 gene locus_tag LOCUS_31490 <11487 10886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327691.1:tetratricopeptide repeat protein >Feature sequence160 1078 251 gene locus_tag LOCUS_31500 1078 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 1422 1168 gene locus_tag LOCUS_31510 1422 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3893 1809 gene locus_tag LOCUS_31520 3893 1809 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_31520 4503 6308 gene locus_tag LOCUS_31530 4503 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 8238 6370 gene locus_tag LOCUS_31540 8238 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 9496 8687 gene locus_tag LOCUS_31550 9496 8687 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_31550 10904 9555 gene locus_tag LOCUS_31560 10904 9555 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_31560 11281 10901 gene locus_tag LOCUS_31570 11281 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence161 <1 661 gene locus_tag LOCUS_31580 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001033576.1:O157 family O-antigen flippase 749 1531 gene locus_tag LOCUS_31590 749 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 1567 2826 gene locus_tag LOCUS_31600 1567 2826 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_31600 2829 4262 gene locus_tag LOCUS_31610 2829 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 4259 5173 gene locus_tag LOCUS_31620 4259 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5178 5990 gene locus_tag LOCUS_31630 5178 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 6001 6807 gene locus_tag LOCUS_31640 6001 6807 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257257.1 protein_id gnl|my_center|LOCUS_31640 6811 7968 gene locus_tag LOCUS_31650 6811 7968 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202255.1 protein_id gnl|my_center|LOCUS_31650 8005 8970 gene locus_tag LOCUS_31660 8005 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 9178 10374 gene locus_tag LOCUS_31670 9178 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 10414 11052 gene locus_tag LOCUS_31680 gene hisH 10414 11052 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence162 1074 592 gene locus_tag LOCUS_31690 1074 592 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284399.1 protein_id gnl|my_center|LOCUS_31690 1733 3028 gene locus_tag LOCUS_31700 1733 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3140 4090 gene locus_tag LOCUS_31710 3140 4090 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_31710 4138 4812 gene locus_tag LOCUS_31720 4138 4812 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_31720 4923 7550 gene locus_tag LOCUS_31730 4923 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 9801 7714 gene locus_tag LOCUS_31740 9801 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 10674 9814 gene locus_tag LOCUS_31750 10674 9814 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence163 2787 397 gene locus_tag LOCUS_31760 gene prsT 2787 397 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_31760 3964 2777 gene locus_tag LOCUS_31770 3964 2777 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_31770 4843 3986 gene locus_tag LOCUS_31780 4843 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 6604 4862 gene locus_tag LOCUS_31790 6604 4862 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_31790 7888 6812 gene locus_tag LOCUS_31800 7888 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 7944 8102 gene locus_tag LOCUS_31810 7944 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 8825 8196 gene locus_tag LOCUS_31820 8825 8196 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_31820 10064 9000 gene locus_tag LOCUS_31830 10064 9000 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_31830 10575 10171 gene locus_tag LOCUS_31840 10575 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence164 7344 7084 gene locus_tag LOCUS_31850 7344 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 7621 8469 gene locus_tag LOCUS_31860 7621 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 9625 8642 gene locus_tag LOCUS_31870 9625 8642 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_31870 9773 10201 gene locus_tag LOCUS_31880 9773 10201 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence165 2002 98 gene locus_tag LOCUS_31890 2002 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2371 4005 gene locus_tag LOCUS_31900 2371 4005 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_31900 4086 4424 gene locus_tag LOCUS_31910 4086 4424 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_31910 4492 7089 gene locus_tag LOCUS_31920 gene glnD 4492 7089 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_31920 7507 8919 gene locus_tag LOCUS_31930 gene glnA 7507 8919 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_31930 9012 9332 gene locus_tag LOCUS_31940 9012 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 9898 9590 gene locus_tag LOCUS_31950 9898 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 9989 9792 gene locus_tag LOCUS_31960 9989 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 10461 10291 gene locus_tag LOCUS_31970 10461 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 10658 10882 gene locus_tag LOCUS_31980 10658 10882 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence166 3107 1692 gene locus_tag LOCUS_31990 gene rlmD 3107 1692 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_31990 4562 3450 gene locus_tag LOCUS_32000 4562 3450 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_32000 5669 6889 gene locus_tag LOCUS_32010 5669 6889 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_32010 7390 7250 gene locus_tag LOCUS_32020 7390 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 7803 8024 gene locus_tag LOCUS_32030 7803 8024 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_32030 8078 8230 gene locus_tag LOCUS_32040 8078 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 8362 8556 gene locus_tag LOCUS_32050 8362 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 9176 8661 gene locus_tag LOCUS_32060 9176 8661 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240066.1 protein_id gnl|my_center|LOCUS_32060 9438 9638 gene locus_tag LOCUS_32070 9438 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 9628 10704 gene locus_tag LOCUS_32080 gene queA 9628 10704 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence167 67 1485 gene locus_tag LOCUS_32090 gene argH 67 1485 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_32090 1491 2567 gene locus_tag LOCUS_32100 1491 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2721 3941 gene locus_tag LOCUS_32110 gene lysA 2721 3941 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_32110 4003 4869 gene locus_tag LOCUS_32120 gene dapF 4003 4869 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_32120 4887 5783 gene locus_tag LOCUS_32130 gene dapA 4887 5783 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_32130 5795 6598 gene locus_tag LOCUS_32140 gene dapB 5795 6598 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_32140 6612 7778 gene locus_tag LOCUS_32150 6612 7778 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_32150 7791 8285 gene locus_tag LOCUS_32160 gene folK 7791 8285 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_32160 8291 8560 gene locus_tag LOCUS_32170 8291 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 8594 9250 gene locus_tag LOCUS_32180 gene fsa 8594 9250 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_32180 9301 9957 gene locus_tag LOCUS_32190 9301 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 10003 10602 gene locus_tag LOCUS_32200 gene pgsA 10003 10602 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence168 1986 1753 gene locus_tag LOCUS_32210 1986 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3180 2185 gene locus_tag LOCUS_32220 3180 2185 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_32220 5769 3286 gene locus_tag LOCUS_32230 5769 3286 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459062.1 protein_id gnl|my_center|LOCUS_32230 7256 6330 gene locus_tag LOCUS_32240 gene lipA 7256 6330 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_32240 7781 9736 gene locus_tag LOCUS_32250 gene glgB 7781 9736 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_32250 9892 10110 gene locus_tag LOCUS_32260 9892 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence169 1808 585 gene locus_tag LOCUS_32270 1808 585 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_32270 3903 1969 gene locus_tag LOCUS_32280 3903 1969 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_32280 4917 3913 gene locus_tag LOCUS_32290 4917 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 5910 4921 gene locus_tag LOCUS_32300 5910 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 6356 7654 gene locus_tag LOCUS_32310 6356 7654 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942694.1 protein_id gnl|my_center|LOCUS_32310 7753 8934 gene locus_tag LOCUS_32320 7753 8934 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_32320 8995 10050 gene locus_tag LOCUS_32330 gene waaF 8995 10050 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence170 1568 408 gene locus_tag LOCUS_32340 1568 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1698 1555 gene locus_tag LOCUS_32350 1698 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2248 3276 gene locus_tag LOCUS_32360 2248 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 5488 3341 gene locus_tag LOCUS_32370 5488 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 7097 5466 gene locus_tag LOCUS_32380 7097 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 10628 7254 gene locus_tag LOCUS_32390 10628 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence171 192 1544 gene locus_tag LOCUS_32400 192 1544 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_32400 1966 3126 gene locus_tag LOCUS_32410 1966 3126 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 protein_id gnl|my_center|LOCUS_32410 4031 3237 gene locus_tag LOCUS_32420 4031 3237 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946447.1 protein_id gnl|my_center|LOCUS_32420 4501 4064 gene locus_tag LOCUS_32430 4501 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 4431 4724 gene locus_tag LOCUS_32440 4431 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 4747 6708 gene locus_tag LOCUS_32450 4747 6708 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_32450 6961 7197 gene locus_tag LOCUS_32460 6961 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 7952 7320 gene locus_tag LOCUS_32470 gene metW 7952 7320 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_32470 9093 7939 gene locus_tag LOCUS_32480 9093 7939 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_32480 10041 9112 gene locus_tag LOCUS_32490 gene cysK 10041 9112 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_32490 <10596 10044 gene locus_tag LOCUS_32500 <10596 10044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022675.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence172 2105 1728 gene locus_tag LOCUS_32510 2105 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 2816 2163 gene locus_tag LOCUS_32520 2816 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 4146 2914 gene locus_tag LOCUS_32530 4146 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 6315 4153 gene locus_tag LOCUS_32540 6315 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 6850 6470 gene locus_tag LOCUS_32550 6850 6470 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_32550 8581 6857 gene locus_tag LOCUS_32560 8581 6857 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_32560 8927 8583 gene locus_tag LOCUS_32570 8927 8583 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940220.1 protein_id gnl|my_center|LOCUS_32570 10309 8924 gene locus_tag LOCUS_32580 10309 8924 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940219.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence173 <1 661 gene locus_tag LOCUS_32590 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392481.1:signal recognition particle protein 809 1060 gene locus_tag LOCUS_32600 gene rpsP 809 1060 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_32600 1102 1335 gene locus_tag LOCUS_32610 1102 1335 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_32610 1340 1855 gene locus_tag LOCUS_32620 gene rimM 1340 1855 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_32620 1856 2599 gene locus_tag LOCUS_32630 gene trmD 1856 2599 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_32630 2635 3195 gene locus_tag LOCUS_32640 2635 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32640 3290 3652 gene locus_tag LOCUS_32650 gene rplS 3290 3652 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_32650 3754 3575 gene locus_tag LOCUS_32660 3754 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 3847 4461 gene locus_tag LOCUS_32670 3847 4461 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_32670 4454 4819 gene locus_tag LOCUS_32680 4454 4819 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813234.1 protein_id gnl|my_center|LOCUS_32680 4797 5672 gene locus_tag LOCUS_32690 gene rsmI 4797 5672 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_32690 6805 5768 gene locus_tag LOCUS_32700 6805 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 7414 6935 gene locus_tag LOCUS_32710 7414 6935 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_32710 7861 8691 gene locus_tag LOCUS_32720 7861 8691 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_32720 8785 9555 gene locus_tag LOCUS_32730 8785 9555 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_32730 9565 10188 gene locus_tag LOCUS_32740 9565 10188 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388158.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence174 318 1103 gene locus_tag LOCUS_32750 318 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3698 1125 gene locus_tag LOCUS_32760 3698 1125 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_32760 3895 5205 gene locus_tag LOCUS_32770 3895 5205 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 protein_id gnl|my_center|LOCUS_32770 5239 6144 gene locus_tag LOCUS_32780 5239 6144 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_32780 6177 7661 gene locus_tag LOCUS_32790 6177 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 7646 9082 gene locus_tag LOCUS_32800 7646 9082 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_32800 9903 9136 gene locus_tag LOCUS_32810 9903 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 10143 10217 gene locus_tag LOCUS_t00280 10143 10217 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence175 2035 851 gene locus_tag LOCUS_32820 2035 851 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_32820 2531 3094 gene locus_tag LOCUS_32830 2531 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3098 4024 gene locus_tag LOCUS_32840 3098 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 4021 4521 gene locus_tag LOCUS_32850 4021 4521 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_32850 4532 4876 gene locus_tag LOCUS_32860 4532 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4962 5333 gene locus_tag LOCUS_32870 4962 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 5689 6849 gene locus_tag LOCUS_32880 5689 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 7506 7297 gene locus_tag LOCUS_32890 7506 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence176 <1 679 gene locus_tag LOCUS_32900 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868851.1:phosphate ABC transporter substrate-binding protein 630 1610 gene locus_tag LOCUS_32910 gene pstC 630 1610 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_32910 1610 2455 gene locus_tag LOCUS_32920 gene pstA 1610 2455 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_32920 2449 3207 gene locus_tag LOCUS_32930 gene pstB 2449 3207 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_32930 3219 3965 gene locus_tag LOCUS_32940 gene pstB 3219 3965 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_32940 3998 4687 gene locus_tag LOCUS_32950 gene phoU 3998 4687 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_32950 4861 5703 gene locus_tag LOCUS_32960 4861 5703 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_32960 6634 5831 gene locus_tag LOCUS_32970 6634 5831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_32970 7768 6752 gene locus_tag LOCUS_32980 7768 6752 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391329.1 protein_id gnl|my_center|LOCUS_32980 8490 7765 gene locus_tag LOCUS_32990 gene radC 8490 7765 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_32990 9497 8868 gene locus_tag LOCUS_33000 9497 8868 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence177 1197 25 gene locus_tag LOCUS_33010 1197 25 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_33010 1696 1178 gene locus_tag LOCUS_33020 1696 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1973 1701 gene locus_tag LOCUS_33030 1973 1701 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_33030 2824 4182 gene locus_tag LOCUS_33040 2824 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 4715 5482 gene locus_tag LOCUS_33050 4715 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 5897 7204 gene locus_tag LOCUS_33060 5897 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 <10033 7371 gene locus_tag LOCUS_33070 <10033 7371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:PAS domain S-box protein >Feature sequence178 1762 614 gene locus_tag LOCUS_33080 1762 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 2006 2263 gene locus_tag LOCUS_33090 gene csrA 2006 2263 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965507.1 protein_id gnl|my_center|LOCUS_33090 2294 2740 gene locus_tag LOCUS_33100 2294 2740 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869419.1 protein_id gnl|my_center|LOCUS_33100 3338 2802 gene locus_tag LOCUS_33110 3338 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 4141 3455 gene locus_tag LOCUS_33120 gene mazG 4141 3455 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938482.1 protein_id gnl|my_center|LOCUS_33120 4721 4188 gene locus_tag LOCUS_33130 4721 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 5426 6451 gene locus_tag LOCUS_33140 5426 6451 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_33140 6454 8934 gene locus_tag LOCUS_33150 6454 8934 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_33150 8831 9307 gene locus_tag LOCUS_33160 gene ybeY 8831 9307 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence179 1466 624 gene locus_tag LOCUS_33170 1466 624 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_33170 2799 1519 gene locus_tag LOCUS_33180 2799 1519 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_33180 4072 2912 gene locus_tag LOCUS_33190 gene larC 4072 2912 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_33190 4294 4386 gene locus_tag LOCUS_t00290 4294 4386 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4402 4494 gene locus_tag LOCUS_t00300 4402 4494 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5269 4979 gene locus_tag LOCUS_33200 5269 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 7684 5384 gene locus_tag LOCUS_33210 7684 5384 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_33210 8943 7822 gene locus_tag LOCUS_33220 8943 7822 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_33220 9495 8992 gene locus_tag LOCUS_33230 9495 8992 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939670.1 protein_id gnl|my_center|LOCUS_33230 9733 9575 gene locus_tag LOCUS_33240 9733 9575 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940442.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence180 436 663 gene locus_tag LOCUS_33250 436 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 793 2175 gene locus_tag LOCUS_33260 793 2175 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_33260 2168 3481 gene locus_tag LOCUS_33270 2168 3481 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253924.1 protein_id gnl|my_center|LOCUS_33270 3485 4402 gene locus_tag LOCUS_33280 3485 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 4431 5447 gene locus_tag LOCUS_33290 4431 5447 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_33290 5460 5831 gene locus_tag LOCUS_33300 5460 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 5841 6185 gene locus_tag LOCUS_33310 5841 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 6190 7518 gene locus_tag LOCUS_33320 6190 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 7531 8046 gene locus_tag LOCUS_33330 7531 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 8053 8406 gene locus_tag LOCUS_33340 8053 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 8406 8852 gene locus_tag LOCUS_33350 8406 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 8869 9114 gene locus_tag LOCUS_33360 8869 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 9107 9316 gene locus_tag LOCUS_33370 9107 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 9333 9614 gene locus_tag LOCUS_33380 9333 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence181 1884 1321 gene locus_tag LOCUS_33390 1884 1321 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943354.1 protein_id gnl|my_center|LOCUS_33390 2622 1903 gene locus_tag LOCUS_33400 gene hoxU 2622 1903 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_33400 4336 2660 gene locus_tag LOCUS_33410 4336 2660 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943356.1 protein_id gnl|my_center|LOCUS_33410 4989 4420 gene locus_tag LOCUS_33420 gene hoxE 4989 4420 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 protein_id gnl|my_center|LOCUS_33420 5721 6431 gene locus_tag LOCUS_33430 5721 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 6495 7214 gene locus_tag LOCUS_33440 6495 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 7359 8378 gene locus_tag LOCUS_33450 7359 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 8995 8501 gene locus_tag LOCUS_33460 8995 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 9899 9072 gene locus_tag LOCUS_33470 9899 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence182 392 84 gene locus_tag LOCUS_33480 392 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1482 523 gene locus_tag LOCUS_33490 1482 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 2045 1491 gene locus_tag LOCUS_33500 2045 1491 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_33500 4263 2047 gene locus_tag LOCUS_33510 4263 2047 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_33510 4511 4753 gene locus_tag LOCUS_33520 4511 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 4997 5275 gene locus_tag LOCUS_33530 4997 5275 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_33530 5309 6133 gene locus_tag LOCUS_33540 gene arsM 5309 6133 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_33540 6524 7594 gene locus_tag LOCUS_33550 6524 7594 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence183 616 200 gene locus_tag LOCUS_33560 616 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1461 613 gene locus_tag LOCUS_33570 1461 613 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966216.1 protein_id gnl|my_center|LOCUS_33570 4135 1697 gene locus_tag LOCUS_33580 4135 1697 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_33580 4457 5485 gene locus_tag LOCUS_33590 4457 5485 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_33590 6089 5610 gene locus_tag LOCUS_33600 6089 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 6540 6863 gene locus_tag LOCUS_33610 6540 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 8151 6916 gene locus_tag LOCUS_33620 8151 6916 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence184 328 777 gene locus_tag LOCUS_33630 328 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 803 2710 gene locus_tag LOCUS_33640 gene aprA 803 2710 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_33640 2938 4167 gene locus_tag LOCUS_33650 gene sat 2938 4167 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_33650 4576 4872 gene locus_tag LOCUS_33660 4576 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980654.1 protein_id gnl|my_center|LOCUS_33660 5297 6562 gene locus_tag LOCUS_33670 5297 6562 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_33670 6547 6711 gene locus_tag LOCUS_33680 6547 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 6724 7887 gene locus_tag LOCUS_33690 6724 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 8055 8315 gene locus_tag LOCUS_33700 8055 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 8325 9044 gene locus_tag LOCUS_33710 8325 9044 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence185 1218 640 gene locus_tag LOCUS_33720 1218 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 2041 4275 gene locus_tag LOCUS_33730 2041 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4393 7731 gene locus_tag LOCUS_33740 4393 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 7843 8169 gene locus_tag LOCUS_33750 7843 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence186 992 807 gene locus_tag LOCUS_33760 992 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1490 1053 gene locus_tag LOCUS_33770 1490 1053 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_33770 1786 2187 gene locus_tag LOCUS_33780 1786 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 2529 2236 gene locus_tag LOCUS_33790 2529 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3985 2552 gene locus_tag LOCUS_33800 gene lpdA 3985 2552 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_33800 5397 4024 gene locus_tag LOCUS_33810 5397 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 6391 5411 gene locus_tag LOCUS_33820 6391 5411 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_33820 7571 6411 gene locus_tag LOCUS_33830 gene pdhA 7571 6411 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_33830 8045 9322 gene locus_tag LOCUS_33840 8045 9322 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_33840 9361 9579 gene locus_tag LOCUS_33850 9361 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence187 <1 507 gene locus_tag LOCUS_33860 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013364052.1:CCA tRNA nucleotidyltransferase 571 879 gene locus_tag LOCUS_33870 571 879 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_33870 1678 899 gene locus_tag LOCUS_33880 gene hisF 1678 899 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_33880 2334 1672 gene locus_tag LOCUS_33890 gene hisH 2334 1672 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_33890 2605 4392 gene locus_tag LOCUS_33900 2605 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 6488 4632 gene locus_tag LOCUS_33910 6488 4632 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_33910 6621 7025 gene locus_tag LOCUS_33920 6621 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 8710 7151 gene locus_tag LOCUS_33930 8710 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence188 244 1401 gene locus_tag LOCUS_33940 gene msrB 244 1401 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_33940 1995 1747 gene locus_tag LOCUS_33950 1995 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 2057 2698 gene locus_tag LOCUS_33960 gene cheD 2057 2698 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_33960 2915 3094 gene locus_tag LOCUS_33970 2915 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 3121 3459 gene locus_tag LOCUS_33980 3121 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3453 3878 gene locus_tag LOCUS_33990 3453 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3842 4072 gene locus_tag LOCUS_34000 3842 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 4385 5287 gene locus_tag LOCUS_34010 4385 5287 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388064.1 protein_id gnl|my_center|LOCUS_34010 8265 5554 gene locus_tag LOCUS_34020 gene fdhF 8265 5554 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(7201..7203),aa:Sec) note codon on position 355 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_34020 <9470 8286 gene locus_tag LOCUS_34030 <9470 8286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence189 2297 3046 gene locus_tag LOCUS_34040 2297 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3472 3260 gene locus_tag LOCUS_34050 3472 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 4017 3523 gene locus_tag LOCUS_34060 4017 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 4814 4071 gene locus_tag LOCUS_34070 4814 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 5124 6341 gene locus_tag LOCUS_34080 5124 6341 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_34080 7738 6356 gene locus_tag LOCUS_34090 7738 6356 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_34090 8076 7900 gene locus_tag LOCUS_34100 8076 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 8589 8083 gene locus_tag LOCUS_34110 gene saoL 8589 8083 CDS product MerB-like organometallic lyase SaoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357410.1 protein_id gnl|my_center|LOCUS_34110 <9202 8689 gene locus_tag LOCUS_34120 <9202 8689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048215.1:ABC transporter ATP-binding protein SaoA >Feature sequence190 <1 1040 gene locus_tag LOCUS_34130 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944039.1:NADH-quinone oxidoreductase subunit N 1293 3005 gene locus_tag LOCUS_34140 1293 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 3017 3673 gene locus_tag LOCUS_34150 gene rpe 3017 3673 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_34150 4207 3875 gene locus_tag LOCUS_34160 4207 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4942 4244 gene locus_tag LOCUS_34170 4942 4244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_34170 5290 6165 gene locus_tag LOCUS_34180 5290 6165 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_34180 6183 6488 gene locus_tag LOCUS_34190 6183 6488 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_34190 6507 6779 gene locus_tag LOCUS_34200 6507 6779 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence191 1307 3457 gene locus_tag LOCUS_34210 1307 3457 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 protein_id gnl|my_center|LOCUS_34210 3686 4897 gene locus_tag LOCUS_34220 3686 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 4919 5920 gene locus_tag LOCUS_34230 4919 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 5984 6862 gene locus_tag LOCUS_34240 5984 6862 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_34240 6862 7878 gene locus_tag LOCUS_34250 6862 7878 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_34250 7932 8705 gene locus_tag LOCUS_34260 7932 8705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence192 265 552 gene locus_tag LOCUS_34270 265 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 621 1004 gene locus_tag LOCUS_34280 621 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 967 2793 gene locus_tag LOCUS_34290 967 2793 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_34290 2783 2965 gene locus_tag LOCUS_34300 2783 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 2962 4260 gene locus_tag LOCUS_34310 2962 4260 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975496.1 protein_id gnl|my_center|LOCUS_34310 4220 5212 gene locus_tag LOCUS_34320 4220 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 5293 6621 gene locus_tag LOCUS_34330 5293 6621 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975494.1 protein_id gnl|my_center|LOCUS_34330 6669 7094 gene locus_tag LOCUS_34340 6669 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975493.1 protein_id gnl|my_center|LOCUS_34340 7195 8154 gene locus_tag LOCUS_34350 7195 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 8223 8591 gene locus_tag LOCUS_34360 8223 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence193 1993 2394 gene locus_tag LOCUS_34370 1993 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 2357 2794 gene locus_tag LOCUS_34380 2357 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 2794 3375 gene locus_tag LOCUS_34390 2794 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3522 4043 gene locus_tag LOCUS_34400 3522 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 4102 5985 gene locus_tag LOCUS_34410 4102 5985 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_34410 6009 6215 gene locus_tag LOCUS_34420 6009 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 7101 6358 gene locus_tag LOCUS_34430 7101 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 7821 8102 gene locus_tag LOCUS_34440 7821 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence194 26 1372 gene locus_tag LOCUS_34450 26 1372 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_34450 1365 2414 gene locus_tag LOCUS_34460 gene cydB 1365 2414 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_34460 3110 2544 gene locus_tag LOCUS_34470 3110 2544 CDS product DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 protein_id gnl|my_center|LOCUS_34470 4267 3107 gene locus_tag LOCUS_34480 gene nahK 4267 3107 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_34480 5453 4272 gene locus_tag LOCUS_34490 5453 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 6708 5506 gene locus_tag LOCUS_34500 6708 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 6899 8506 gene locus_tag LOCUS_34510 6899 8506 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence195 1397 243 gene locus_tag LOCUS_34520 1397 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 2121 1663 gene locus_tag LOCUS_34530 2121 1663 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_34530 3668 2301 gene locus_tag LOCUS_34540 gene rsmB 3668 2301 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_34540 4491 3670 gene locus_tag LOCUS_34550 4491 3670 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940619.1 protein_id gnl|my_center|LOCUS_34550 5475 4498 gene locus_tag LOCUS_34560 gene fmt 5475 4498 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_34560 5954 5442 gene locus_tag LOCUS_34570 gene def 5954 5442 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_34570 6364 7380 gene locus_tag LOCUS_34580 6364 7380 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence196 231 1397 gene locus_tag LOCUS_34590 231 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 1543 1471 gene locus_tag LOCUS_t00310 1543 1471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1763 1846 gene locus_tag LOCUS_t00320 1763 1846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2162 1848 gene locus_tag LOCUS_34600 2162 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 2464 2096 gene locus_tag LOCUS_34610 2464 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2432 2668 gene locus_tag LOCUS_34620 2432 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 4788 2929 gene locus_tag LOCUS_34630 4788 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 6076 5111 gene locus_tag LOCUS_34640 6076 5111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_34640 6831 6616 gene locus_tag LOCUS_34650 6831 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 8114 6975 gene locus_tag LOCUS_34660 8114 6975 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099305.1 protein_id gnl|my_center|LOCUS_34660 >Feature sequence197 348 136 gene locus_tag LOCUS_34670 348 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 581 766 gene locus_tag LOCUS_34680 581 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 855 779 gene locus_tag LOCUS_t00330 855 779 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2186 1140 gene locus_tag LOCUS_34690 2186 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 2692 4530 gene locus_tag LOCUS_34700 2692 4530 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_34700 4874 4641 gene locus_tag LOCUS_34710 4874 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 5236 4886 gene locus_tag LOCUS_34720 5236 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 5592 5257 gene locus_tag LOCUS_34730 5592 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 5873 5589 gene locus_tag LOCUS_34740 5873 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 6149 7171 gene locus_tag LOCUS_34750 gene thiL 6149 7171 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_34750 7182 7979 gene locus_tag LOCUS_34760 gene thiD 7182 7979 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392386.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence198 945 334 gene locus_tag LOCUS_34770 945 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2155 1046 gene locus_tag LOCUS_34780 gene mraY 2155 1046 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769458.1 protein_id gnl|my_center|LOCUS_34780 4299 2152 gene locus_tag LOCUS_34790 4299 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 5094 4438 gene locus_tag LOCUS_34800 5094 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 5457 5203 gene locus_tag LOCUS_34810 5457 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 6934 5546 gene locus_tag LOCUS_34820 6934 5546 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_34820 7963 7028 gene locus_tag LOCUS_34830 7963 7028 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence199 1861 275 gene locus_tag LOCUS_34840 1861 275 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_34840 2376 2152 gene locus_tag LOCUS_34850 2376 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2586 2786 gene locus_tag LOCUS_34860 2586 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 3071 3514 gene locus_tag LOCUS_34870 gene gspG 3071 3514 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_34870 5395 3563 gene locus_tag LOCUS_34880 5395 3563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_34880 7081 5399 gene locus_tag LOCUS_34890 7081 5399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_34890 7448 8008 gene locus_tag LOCUS_34900 7448 8008 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence200 282 671 gene locus_tag LOCUS_34910 282 671 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_34910 746 1147 gene locus_tag LOCUS_34920 746 1147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937451.1 protein_id gnl|my_center|LOCUS_34920 1282 2082 gene locus_tag LOCUS_34930 1282 2082 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_34930 2279 3634 gene locus_tag LOCUS_34940 2279 3634 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_34940 3644 5119 gene locus_tag LOCUS_34950 3644 5119 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_34950 5120 6589 gene locus_tag LOCUS_34960 5120 6589 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_34960 7155 6637 gene locus_tag LOCUS_34970 gene rnhA 7155 6637 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_34970 <8022 7155 gene locus_tag LOCUS_34980 <8022 7155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937763.1:DHH family phosphoesterase >Feature sequence201 2473 2102 gene locus_tag LOCUS_34990 2473 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 2705 2505 gene locus_tag LOCUS_35000 2705 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 3431 2838 gene locus_tag LOCUS_35010 3431 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 4606 3455 gene locus_tag LOCUS_35020 4606 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 5257 4847 gene locus_tag LOCUS_35030 5257 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7304 5598 gene locus_tag LOCUS_35040 7304 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence202 215 1033 gene locus_tag LOCUS_35050 215 1033 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938636.1 protein_id gnl|my_center|LOCUS_35050 1289 2611 gene locus_tag LOCUS_35060 1289 2611 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_35060 2598 3518 gene locus_tag LOCUS_35070 2598 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3973 3524 gene locus_tag LOCUS_35080 3973 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 4194 4790 gene locus_tag LOCUS_35090 4194 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 6042 4903 gene locus_tag LOCUS_35100 6042 4903 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262583.1 protein_id gnl|my_center|LOCUS_35100 6763 6062 gene locus_tag LOCUS_35110 6763 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 <7611 6918 gene locus_tag LOCUS_35120 <7611 6918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000808183.1:PBP1A family penicillin-binding protein >Feature sequence203 1365 259 gene locus_tag LOCUS_35130 1365 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4310 1572 gene locus_tag LOCUS_35140 4310 1572 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_35140 7520 6537 gene locus_tag LOCUS_35150 7520 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence204 1634 63 gene locus_tag LOCUS_35160 1634 63 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_35160 2796 1831 gene locus_tag LOCUS_35170 2796 1831 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_35170 4270 2867 gene locus_tag LOCUS_35180 4270 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4332 4541 gene locus_tag LOCUS_35190 4332 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 5108 6121 gene locus_tag LOCUS_35200 5108 6121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_35200 6218 6976 gene locus_tag LOCUS_35210 6218 6976 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence205 503 1210 gene locus_tag LOCUS_35220 503 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 1220 1588 gene locus_tag LOCUS_35230 1220 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 1764 2618 gene locus_tag LOCUS_35240 1764 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 2953 3495 gene locus_tag LOCUS_35250 2953 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 3620 4057 gene locus_tag LOCUS_35260 3620 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 5216 4209 gene locus_tag LOCUS_35270 5216 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 6794 5490 gene locus_tag LOCUS_35280 gene clcA 6794 5490 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393094.1 protein_id gnl|my_center|LOCUS_35280 7045 7269 gene locus_tag LOCUS_35290 7045 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 >Feature sequence206 564 385 gene locus_tag LOCUS_35300 564 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 1993 590 gene locus_tag LOCUS_35310 1993 590 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_35310 2919 2395 gene locus_tag LOCUS_35320 2919 2395 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943406.1 protein_id gnl|my_center|LOCUS_35320 3193 3008 gene locus_tag LOCUS_35330 3193 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943405.1 protein_id gnl|my_center|LOCUS_35330 3570 3337 gene locus_tag LOCUS_35340 3570 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35340 3767 4207 gene locus_tag LOCUS_35350 3767 4207 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016796.1 protein_id gnl|my_center|LOCUS_35350 4483 6429 gene locus_tag LOCUS_35360 4483 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 7107 6559 gene locus_tag LOCUS_35370 7107 6559 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328056.1 protein_id gnl|my_center|LOCUS_35370 >Feature sequence207 667 1443 gene locus_tag LOCUS_35380 667 1443 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_35380 1445 2758 gene locus_tag LOCUS_35390 gene hisD 1445 2758 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_35390 3105 2755 gene locus_tag LOCUS_35400 3105 2755 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_35400 3135 4895 gene locus_tag LOCUS_35410 3135 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 4951 5655 gene locus_tag LOCUS_35420 gene queC 4951 5655 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_35420 5732 6193 gene locus_tag LOCUS_35430 gene queF 5732 6193 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972191.1 protein_id gnl|my_center|LOCUS_35430 6968 6231 gene locus_tag LOCUS_35440 6968 6231 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870180.1 protein_id gnl|my_center|LOCUS_35440 7200 6994 gene locus_tag LOCUS_35450 7200 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence208 952 329 gene locus_tag LOCUS_35460 gene rnc 952 329 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_35460 887 1087 gene locus_tag LOCUS_35470 887 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 1209 1781 gene locus_tag LOCUS_35480 1209 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1871 3772 gene locus_tag LOCUS_35490 1871 3772 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868773.1 protein_id gnl|my_center|LOCUS_35490 4063 3848 gene locus_tag LOCUS_35500 4063 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 4135 4818 gene locus_tag LOCUS_35510 4135 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 4909 6057 gene locus_tag LOCUS_35520 4909 6057 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_35520 6322 6420 gene locus_tag LOCUS_t00340 6322 6420 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 1161 1511 gene locus_tag LOCUS_35530 1161 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 1508 2050 gene locus_tag LOCUS_35540 1508 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 2047 3030 gene locus_tag LOCUS_35550 2047 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3619 4056 gene locus_tag LOCUS_35560 3619 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 4251 4484 gene locus_tag LOCUS_35570 4251 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 4481 6961 gene locus_tag LOCUS_35580 4481 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence210 <1 1433 gene locus_tag LOCUS_35590 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392160.1:DNA primase 1454 3244 gene locus_tag LOCUS_35600 gene rpoD 1454 3244 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_35600 3355 3431 gene locus_tag LOCUS_t00350 3355 3431 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3614 4450 gene locus_tag LOCUS_35610 3614 4450 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_35610 4505 5251 gene locus_tag LOCUS_35620 4505 5251 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_35620 5429 6382 gene locus_tag LOCUS_35630 5429 6382 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence211 423 67 gene locus_tag LOCUS_35640 423 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 1559 588 gene locus_tag LOCUS_35650 1559 588 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_35650 1452 1670 gene locus_tag LOCUS_35660 1452 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2639 1656 gene locus_tag LOCUS_35670 2639 1656 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_35670 3936 2755 gene locus_tag LOCUS_35680 gene nifS 3936 2755 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_35680 4760 3933 gene locus_tag LOCUS_35690 gene nifU 4760 3933 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_35690 5594 7357 gene locus_tag LOCUS_35700 5594 7357 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence212 2326 1649 gene locus_tag LOCUS_35710 2326 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 4799 2958 gene locus_tag LOCUS_35720 4799 2958 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393602.1 protein_id gnl|my_center|LOCUS_35720 5959 4904 gene locus_tag LOCUS_35730 5959 4904 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_35730 6609 6214 gene locus_tag LOCUS_35740 6609 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 7410 6727 gene locus_tag LOCUS_35750 7410 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35750 >Feature sequence213 534 1841 gene locus_tag LOCUS_35760 534 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 1923 1851 gene locus_tag LOCUS_t00360 1923 1851 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3905 2028 gene locus_tag LOCUS_35770 3905 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 4645 3902 gene locus_tag LOCUS_35780 4645 3902 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583818.1 protein_id gnl|my_center|LOCUS_35780 5791 4790 gene locus_tag LOCUS_35790 gene trpS 5791 4790 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_35790 6529 5867 gene locus_tag LOCUS_35800 6529 5867 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_35800 <7311 6624 gene locus_tag LOCUS_35810 <7311 6624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938942.1:CBS domain-containing protein >Feature sequence214 272 36 gene locus_tag LOCUS_35820 272 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 475 230 gene locus_tag LOCUS_35830 475 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 679 479 gene locus_tag LOCUS_35840 679 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 1329 751 gene locus_tag LOCUS_35850 1329 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 1600 1527 gene locus_tag LOCUS_t00370 1600 1527 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1883 1701 gene locus_tag LOCUS_35860 1883 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 2340 3086 gene locus_tag LOCUS_35870 2340 3086 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234130.1 protein_id gnl|my_center|LOCUS_35870 3388 5691 gene locus_tag LOCUS_35880 3388 5691 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_35880 6083 6211 gene locus_tag LOCUS_35890 6083 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 7103 6357 gene locus_tag LOCUS_35900 7103 6357 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_35900 >Feature sequence215 637 1452 gene locus_tag LOCUS_35910 637 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1630 2481 gene locus_tag LOCUS_35920 gene recO 1630 2481 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_35920 2491 3198 gene locus_tag LOCUS_35930 2491 3198 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462031.1 protein_id gnl|my_center|LOCUS_35930 3195 3734 gene locus_tag LOCUS_35940 3195 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 3756 5033 gene locus_tag LOCUS_35950 gene glgC 3756 5033 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_35950 <7260 5113 gene locus_tag LOCUS_35960 <7260 5113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044977.1:EAL domain-containing protein >Feature sequence216 69 142 gene locus_tag LOCUS_t00380 69 142 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 710 1042 gene locus_tag LOCUS_35970 710 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 1513 1232 gene locus_tag LOCUS_35980 1513 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 2065 3402 gene locus_tag LOCUS_35990 2065 3402 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260208.1 protein_id gnl|my_center|LOCUS_35990 3517 4596 gene locus_tag LOCUS_36000 3517 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4665 5501 gene locus_tag LOCUS_36010 gene fba 4665 5501 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_36010 5542 7113 gene locus_tag LOCUS_36020 gene xylB 5542 7113 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence217 1441 4164 gene locus_tag LOCUS_36030 1441 4164 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938851.1 protein_id gnl|my_center|LOCUS_36030 4303 6636 gene locus_tag LOCUS_36040 4303 6636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459976.1 protein_id gnl|my_center|LOCUS_36040 6633 6845 gene locus_tag LOCUS_36050 6633 6845 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938849.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence218 1437 49 gene locus_tag LOCUS_36060 1437 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 2528 1896 gene locus_tag LOCUS_36070 2528 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3153 2806 gene locus_tag LOCUS_36080 3153 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 4976 3489 gene locus_tag LOCUS_36090 4976 3489 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_36090 5201 5398 gene locus_tag LOCUS_36100 5201 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 6406 5441 gene locus_tag LOCUS_36110 6406 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence219 429 76 gene locus_tag LOCUS_36120 429 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 1384 443 gene locus_tag LOCUS_36130 1384 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3504 1582 gene locus_tag LOCUS_36140 3504 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 4386 3580 gene locus_tag LOCUS_36150 gene lgt 4386 3580 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_36150 4461 4730 gene locus_tag LOCUS_36160 4461 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 4900 5559 gene locus_tag LOCUS_36170 4900 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 5556 6143 gene locus_tag LOCUS_36180 5556 6143 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence220 1655 849 gene locus_tag LOCUS_36190 1655 849 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_36190 2022 2097 gene locus_tag LOCUS_t00390 2022 2097 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2553 2624 gene locus_tag LOCUS_t00400 2553 2624 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3586 5040 gene locus_tag LOCUS_36200 3586 5040 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_36200 5037 6257 gene locus_tag LOCUS_36210 5037 6257 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123362.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence221 <1 1829 gene locus_tag LOCUS_36220 <1 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393063.1:GspE/PulE family protein 1826 2677 gene locus_tag LOCUS_36230 1826 2677 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_36230 3692 2832 gene locus_tag LOCUS_36240 3692 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3922 5001 gene locus_tag LOCUS_36250 3922 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence222 1195 1013 gene locus_tag LOCUS_36260 1195 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 4765 1523 gene locus_tag LOCUS_36270 4765 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 5845 6096 gene locus_tag LOCUS_36280 5845 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence223 2935 734 gene locus_tag LOCUS_36290 2935 734 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_36290 3444 3064 gene locus_tag LOCUS_36300 3444 3064 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_36300 4580 3525 gene locus_tag LOCUS_36310 4580 3525 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 protein_id gnl|my_center|LOCUS_36310 5072 4611 gene locus_tag LOCUS_36320 5072 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 5451 5029 gene locus_tag LOCUS_36330 5451 5029 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_36330 6062 5490 gene locus_tag LOCUS_36340 6062 5490 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_36340 <6743 6034 gene locus_tag LOCUS_36350 <6743 6034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706839.1:protein-glutamate O-methyltransferase >Feature sequence224 <1 607 gene locus_tag LOCUS_36360 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258713.1:2-dehydropantoate 2-reductase 1307 777 gene locus_tag LOCUS_36370 1307 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 2092 1391 gene locus_tag LOCUS_36380 2092 1391 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_36380 3675 2338 gene locus_tag LOCUS_36390 3675 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 5124 4093 gene locus_tag LOCUS_36400 5124 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence225 426 755 gene locus_tag LOCUS_36410 426 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3156 724 gene locus_tag LOCUS_36420 3156 724 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939547.1 protein_id gnl|my_center|LOCUS_36420 3732 5192 gene locus_tag LOCUS_36430 3732 5192 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550944.1 protein_id gnl|my_center|LOCUS_36430 5596 6576 gene locus_tag LOCUS_36440 5596 6576 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence226 2465 213 gene locus_tag LOCUS_36450 2465 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 5385 3199 gene locus_tag LOCUS_36460 5385 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36460 <6353 5396 gene locus_tag LOCUS_36470 <6353 5396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044978.1:response regulator >Feature sequence227 46 1086 gene locus_tag LOCUS_36480 46 1086 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_36480 1426 2250 gene locus_tag LOCUS_36490 1426 2250 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022650.1 protein_id gnl|my_center|LOCUS_36490 2483 2136 gene locus_tag LOCUS_36500 2483 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 2525 2752 gene locus_tag LOCUS_36510 2525 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 2881 4260 gene locus_tag LOCUS_36520 2881 4260 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_36520 4253 5566 gene locus_tag LOCUS_36530 4253 5566 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253972.1 protein_id gnl|my_center|LOCUS_36530 5570 6172 gene locus_tag LOCUS_36540 5570 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence228 608 1492 gene locus_tag LOCUS_36550 gene cas7c 608 1492 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_36550 1492 3687 gene locus_tag LOCUS_36560 1492 3687 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_36560 3847 4353 gene locus_tag LOCUS_36570 gene cas4 3847 4353 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_36570 5051 4401 gene locus_tag LOCUS_36580 5051 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 4944 5381 gene locus_tag LOCUS_36590 4944 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 5393 5683 gene locus_tag LOCUS_36600 gene cas2 5393 5683 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_36600 5866 6161 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtgcccctcgcgggcgcgtggattgaaac >Feature sequence229 <1 519 gene locus_tag LOCUS_36610 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256515.1:glycerate kinase 973 545 gene locus_tag LOCUS_36620 973 545 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526860.1 protein_id gnl|my_center|LOCUS_36620 1531 1346 gene locus_tag LOCUS_36630 1531 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1443 2888 gene locus_tag LOCUS_36640 1443 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 3105 3698 gene locus_tag LOCUS_36650 3105 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 3712 5106 gene locus_tag LOCUS_36660 gene glrR 3712 5106 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703177.1 protein_id gnl|my_center|LOCUS_36660 5529 5897 gene locus_tag LOCUS_36670 5529 5897 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence230 648 202 gene locus_tag LOCUS_36680 648 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1033 656 gene locus_tag LOCUS_36690 1033 656 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942200.1 protein_id gnl|my_center|LOCUS_36690 1578 1045 gene locus_tag LOCUS_36700 1578 1045 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942199.1 protein_id gnl|my_center|LOCUS_36700 3568 1571 gene locus_tag LOCUS_36710 3568 1571 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045006.1 protein_id gnl|my_center|LOCUS_36710 4855 3893 gene locus_tag LOCUS_36720 4855 3893 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_36720 6012 5050 gene locus_tag LOCUS_36730 gene hypE 6012 5050 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_36730 >Feature sequence231 2361 769 gene locus_tag LOCUS_36740 2361 769 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_36740 4216 2711 gene locus_tag LOCUS_36750 4216 2711 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225134.1 protein_id gnl|my_center|LOCUS_36750 4577 4389 gene locus_tag LOCUS_36760 4577 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 4836 4657 gene locus_tag LOCUS_36770 4836 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 5689 5054 gene locus_tag LOCUS_36780 5689 5054 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869660.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence232 <1 2112 gene locus_tag LOCUS_36790 <1 2112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933069.1:ATP-dependent RecD-like DNA helicase 2117 2473 gene locus_tag LOCUS_36800 2117 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 2486 2725 gene locus_tag LOCUS_36810 2486 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3377 3772 gene locus_tag LOCUS_36820 3377 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 3769 4182 gene locus_tag LOCUS_36830 3769 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 4364 5995 gene locus_tag LOCUS_36840 4364 5995 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104551.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence233 358 1329 gene locus_tag LOCUS_36850 358 1329 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743398.1 protein_id gnl|my_center|LOCUS_36850 1420 2208 gene locus_tag LOCUS_36860 1420 2208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_36860 2219 2959 gene locus_tag LOCUS_36870 2219 2959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_36870 2975 3724 gene locus_tag LOCUS_36880 2975 3724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_36880 3835 4803 gene locus_tag LOCUS_36890 gene mtaA 3835 4803 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_36890 4875 5525 gene locus_tag LOCUS_36900 4875 5525 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence234 144 1 gene locus_tag LOCUS_36910 144 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2118 292 gene locus_tag LOCUS_36920 2118 292 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_36920 2537 4270 gene locus_tag LOCUS_36930 2537 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 4427 5674 gene locus_tag LOCUS_36940 4427 5674 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence235 629 1840 gene locus_tag LOCUS_36950 629 1840 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_36950 1846 3579 gene locus_tag LOCUS_36960 1846 3579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_36960 3679 3966 gene locus_tag LOCUS_36970 gene groES 3679 3966 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_36970 4007 5635 gene locus_tag LOCUS_36980 gene groL 4007 5635 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence236 6 1379 gene locus_tag LOCUS_36990 6 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 1724 1557 gene locus_tag LOCUS_37000 1724 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 1793 2953 gene locus_tag LOCUS_37010 1793 2953 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878637.1 protein_id gnl|my_center|LOCUS_37010 3973 2999 gene locus_tag LOCUS_37020 gene bioB 3973 2999 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_37020 4215 4925 gene locus_tag LOCUS_37030 4215 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 5026 5514 gene locus_tag LOCUS_37040 5026 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 5833 5615 gene locus_tag LOCUS_37050 5833 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence237 1295 1780 gene locus_tag LOCUS_37060 1295 1780 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_37060 2705 1827 gene locus_tag LOCUS_37070 2705 1827 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_37070 4601 3009 gene locus_tag LOCUS_37080 4601 3009 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_37080 <5879 4843 gene locus_tag LOCUS_37090 <5879 4843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943066.1:peptidylprolyl isomerase >Feature sequence238 <1 1128 gene locus_tag LOCUS_37100 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 2631 1246 gene locus_tag LOCUS_37110 gene hslU 2631 1246 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_37110 3174 2635 gene locus_tag LOCUS_37120 gene hslV 3174 2635 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_37120 4223 3282 gene locus_tag LOCUS_37130 gene xerC 4223 3282 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_37130 >Feature sequence239 1055 1252 gene locus_tag LOCUS_37140 1055 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 2099 1593 gene locus_tag LOCUS_37150 2099 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3812 2745 gene locus_tag LOCUS_37160 3812 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 4045 3788 gene locus_tag LOCUS_37170 4045 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 4350 4042 gene locus_tag LOCUS_37180 4350 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 <5553 4347 gene locus_tag LOCUS_37190 <5553 4347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706440.1:DEAD/DEAH box helicase >Feature sequence240 <1 850 gene locus_tag LOCUS_37200 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791906.1:lysine--tRNA ligase 857 2098 gene locus_tag LOCUS_37210 857 2098 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_37210 2091 2819 gene locus_tag LOCUS_37220 2091 2819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence241 <1 3282 gene locus_tag LOCUS_37230 <1 3282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939304.1:BREX-1 system adenine-specific DNA-methyltransferase PglX >Feature sequence242 <5379 1756 gene locus_tag LOCUS_37240 <5379 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence243 604 167 gene locus_tag LOCUS_37250 604 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 968 567 gene locus_tag LOCUS_37260 968 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 1162 971 gene locus_tag LOCUS_37270 1162 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 3512 1797 gene locus_tag LOCUS_37280 3512 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3744 3914 gene locus_tag LOCUS_37290 3744 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4687 3959 gene locus_tag LOCUS_37300 4687 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 4865 4647 gene locus_tag LOCUS_37310 4865 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 5307 4870 gene locus_tag LOCUS_37320 5307 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence244 926 1942 gene locus_tag LOCUS_37330 926 1942 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_37330 1954 2325 gene locus_tag LOCUS_37340 1954 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 2339 2683 gene locus_tag LOCUS_37350 2339 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 2688 4016 gene locus_tag LOCUS_37360 2688 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 4030 4545 gene locus_tag LOCUS_37370 4030 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 4551 4904 gene locus_tag LOCUS_37380 4551 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence245 689 432 gene locus_tag LOCUS_37390 gene xseB 689 432 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351725.1 protein_id gnl|my_center|LOCUS_37390 2079 703 gene locus_tag LOCUS_37400 gene xseA 2079 703 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_37400 3220 2090 gene locus_tag LOCUS_37410 3220 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4237 3236 gene locus_tag LOCUS_37420 4237 3236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_37420 <5195 4294 gene locus_tag LOCUS_37430 <5195 4294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338430.1:NAD(+) diphosphatase >Feature sequence246 <1 2291 gene locus_tag LOCUS_37440 <1 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393311.1:malto-oligosyltrehalose synthase 2257 2961 gene locus_tag LOCUS_37450 2257 2961 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869051.1 protein_id gnl|my_center|LOCUS_37450 2966 4213 gene locus_tag LOCUS_37460 2966 4213 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence247 776 1117 gene locus_tag LOCUS_37470 776 1117 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789182.1 protein_id gnl|my_center|LOCUS_37470 1534 1773 gene locus_tag LOCUS_37480 1534 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2669 2283 gene locus_tag LOCUS_37490 2669 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_37490 3664 2669 gene locus_tag LOCUS_37500 gene cmr4 3664 2669 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence248 1563 424 gene locus_tag LOCUS_37510 1563 424 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_37510 3840 1699 gene locus_tag LOCUS_37520 3840 1699 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_37520 4809 3973 gene locus_tag LOCUS_37530 4809 3973 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040590.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence249 19 969 gene locus_tag LOCUS_37540 19 969 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461747.1 protein_id gnl|my_center|LOCUS_37540 982 2277 gene locus_tag LOCUS_37550 982 2277 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 protein_id gnl|my_center|LOCUS_37550 2268 2561 gene locus_tag LOCUS_37560 2268 2561 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_37560 2821 4158 gene locus_tag LOCUS_37570 2821 4158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_37570 <4944 4325 gene locus_tag LOCUS_37580 <4944 4325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262351.1:protein phosphatase CheZ >Feature sequence250 2159 1008 gene locus_tag LOCUS_37590 2159 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 3490 2159 gene locus_tag LOCUS_37600 3490 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 3726 4568 gene locus_tag LOCUS_37610 3726 4568 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870308.1 protein_id gnl|my_center|LOCUS_37610 4600 4857 gene locus_tag LOCUS_37620 4600 4857 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence251 1518 727 gene locus_tag LOCUS_37630 1518 727 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_37630 2726 1545 gene locus_tag LOCUS_37640 2726 1545 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 protein_id gnl|my_center|LOCUS_37640 3939 2908 gene locus_tag LOCUS_37650 3939 2908 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence252 1456 83 gene locus_tag LOCUS_37660 1456 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 2182 1646 gene locus_tag LOCUS_37670 2182 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 2537 4543 gene locus_tag LOCUS_37680 2537 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence253 1396 86 gene locus_tag LOCUS_37690 1396 86 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_37690 2306 1437 gene locus_tag LOCUS_37700 2306 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 2218 2397 gene locus_tag LOCUS_37710 2218 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 3267 2557 gene locus_tag LOCUS_37720 3267 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 3998 3507 gene locus_tag LOCUS_37730 3998 3507 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583144.1 protein_id gnl|my_center|LOCUS_37730 4201 4043 gene locus_tag LOCUS_37740 4201 4043 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_37740 >Feature sequence254 <1 1138 gene locus_tag LOCUS_37750 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932549.1:quinone-interacting membrane-bound oxidoreductase complex subunit QmoC 1645 1872 gene locus_tag LOCUS_37760 1645 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 2165 1926 gene locus_tag LOCUS_37770 2165 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 2548 2282 gene locus_tag LOCUS_37780 gene minE 2548 2282 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869948.1 protein_id gnl|my_center|LOCUS_37780 3354 2563 gene locus_tag LOCUS_37790 gene minD 3354 2563 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_37790 4103 3444 gene locus_tag LOCUS_37800 gene minC 4103 3444 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence255 500 901 gene locus_tag LOCUS_37810 500 901 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940496.1 protein_id gnl|my_center|LOCUS_37810 970 3606 gene locus_tag LOCUS_37820 970 3606 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_37820 3695 4660 gene locus_tag LOCUS_37830 3695 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence256 137 1138 gene locus_tag LOCUS_37840 gene tgt 137 1138 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37840 1266 1343 gene locus_tag LOCUS_t00410 1266 1343 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2523 1357 gene locus_tag LOCUS_37850 2523 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4220 3141 gene locus_tag LOCUS_37860 4220 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 4569 4222 gene locus_tag LOCUS_37870 4569 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence257 1039 272 gene locus_tag LOCUS_37880 gene pyrF 1039 272 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_37880 <4656 1143 gene locus_tag LOCUS_37890 <4656 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545209.1:PEP/pyruvate-binding domain-containing protein >Feature sequence258 432 235 gene locus_tag LOCUS_37900 432 235 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869521.1 protein_id gnl|my_center|LOCUS_37900 1968 472 gene locus_tag LOCUS_37910 1968 472 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943775.1 protein_id gnl|my_center|LOCUS_37910 2462 1998 gene locus_tag LOCUS_37920 gene nrfH 2462 1998 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943776.1 protein_id gnl|my_center|LOCUS_37920 3479 2868 gene locus_tag LOCUS_37930 gene rpsD 3479 2868 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 protein_id gnl|my_center|LOCUS_37930 >Feature sequence259 1287 1550 gene locus_tag LOCUS_37940 1287 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 1842 3668 gene locus_tag LOCUS_37950 1842 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 >Feature sequence260 1018 653 gene locus_tag LOCUS_37960 1018 653 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938884.1 protein_id gnl|my_center|LOCUS_37960 1441 1103 gene locus_tag LOCUS_37970 1441 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 3383 1470 gene locus_tag LOCUS_37980 3383 1470 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044990.1 protein_id gnl|my_center|LOCUS_37980 3840 3439 gene locus_tag LOCUS_37990 3840 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 <4526 4020 gene locus_tag LOCUS_38000 <4526 4020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941505.1:sigma-54 dependent transcriptional regulator >Feature sequence261 856 1755 gene locus_tag LOCUS_38010 856 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 2666 1773 gene locus_tag LOCUS_38020 2666 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 2616 2828 gene locus_tag LOCUS_38030 2616 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 2953 3993 gene locus_tag LOCUS_38040 2953 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence262 2449 2030 gene locus_tag LOCUS_38050 2449 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 3102 2491 gene locus_tag LOCUS_38060 3102 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 3459 3106 gene locus_tag LOCUS_38070 3459 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence263 1270 974 gene locus_tag LOCUS_38080 1270 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 1723 1409 gene locus_tag LOCUS_38090 1723 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 2209 1799 gene locus_tag LOCUS_38100 2209 1799 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188723.1 protein_id gnl|my_center|LOCUS_38100 3127 2795 gene locus_tag LOCUS_38110 3127 2795 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_38110 3795 3214 gene locus_tag LOCUS_38120 3795 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4100 3777 gene locus_tag LOCUS_38130 4100 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence264 1449 2519 gene locus_tag LOCUS_38140 1449 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 2583 4085 gene locus_tag LOCUS_38150 2583 4085 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_38150 4400 4158 gene locus_tag LOCUS_38160 4400 4158 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213017.1 protein_id gnl|my_center|LOCUS_38160 >Feature sequence265 3377 549 gene locus_tag LOCUS_38170 3377 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 >Feature sequence266 <1 1071 gene locus_tag LOCUS_38180 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064616.1:4-hydroxyphenylacetate 3-hydroxylase family protein 1221 2330 gene locus_tag LOCUS_38190 gene acdA 1221 2330 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_38190 2346 3119 gene locus_tag LOCUS_38200 2346 3119 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 protein_id gnl|my_center|LOCUS_38200 3134 4090 gene locus_tag LOCUS_38210 3134 4090 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461383.1 protein_id gnl|my_center|LOCUS_38210 >Feature sequence267 750 1226 gene locus_tag LOCUS_38220 750 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 1228 3177 gene locus_tag LOCUS_38230 1228 3177 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_38230 4065 3781 gene locus_tag LOCUS_38240 4065 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence268 627 112 gene locus_tag LOCUS_38250 627 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1149 685 gene locus_tag LOCUS_38260 1149 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 2507 1206 gene locus_tag LOCUS_38270 2507 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 3388 2507 gene locus_tag LOCUS_38280 3388 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 <4347 3372 gene locus_tag LOCUS_38290 <4347 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000523689.1:phage portal protein >Feature sequence269 166 699 gene locus_tag LOCUS_38300 166 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 701 1729 gene locus_tag LOCUS_38310 701 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38310 1618 2634 gene locus_tag LOCUS_38320 1618 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence270 <1 907 gene locus_tag LOCUS_38330 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000523689.1:phage portal protein 891 1733 gene locus_tag LOCUS_38340 891 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1749 3053 gene locus_tag LOCUS_38350 1749 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 3104 3586 gene locus_tag LOCUS_38360 3104 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3638 4144 gene locus_tag LOCUS_38370 3638 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence271 1292 543 gene locus_tag LOCUS_38380 1292 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 3236 1398 gene locus_tag LOCUS_38390 3236 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence272 639 103 gene locus_tag LOCUS_38400 639 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 992 639 gene locus_tag LOCUS_38410 992 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 1552 998 gene locus_tag LOCUS_38420 1552 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 1954 1568 gene locus_tag LOCUS_38430 1954 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 2904 1966 gene locus_tag LOCUS_38440 2904 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 3156 2908 gene locus_tag LOCUS_38450 3156 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 3634 3263 gene locus_tag LOCUS_38460 3634 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 <4216 3647 gene locus_tag LOCUS_38470 <4216 3647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339609.1:major capsid protein >Feature sequence273 <1 1375 gene locus_tag LOCUS_38480 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207707612.1:DUF1156 domain-containing protein 1353 2453 gene locus_tag LOCUS_38490 1353 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_38490 3499 2780 gene locus_tag LOCUS_38500 3499 2780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_38500 >Feature sequence274 1749 1615 gene locus_tag LOCUS_38510 1749 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 1836 2018 gene locus_tag LOCUS_38520 1836 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 2823 2110 gene locus_tag LOCUS_38530 2823 2110 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869386.1 protein_id gnl|my_center|LOCUS_38530 <4165 2820 gene locus_tag LOCUS_38540 <4165 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392959.1:ribonucleoside triphosphate reductase >Feature sequence275 <1 1628 gene locus_tag LOCUS_38550 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943154.1:rhodanese-like domain-containing protein 1625 2266 gene locus_tag LOCUS_38560 1625 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 2403 3005 gene locus_tag LOCUS_38570 gene yedF 2403 3005 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_38570 3153 4097 gene locus_tag LOCUS_38580 gene selD 3153 4097 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_38580 >Feature sequence276 402 1346 gene locus_tag LOCUS_38590 402 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1689 3119 gene locus_tag LOCUS_38600 1689 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3723 3130 gene locus_tag LOCUS_38610 gene hisB 3723 3130 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence277 791 1810 gene locus_tag LOCUS_38620 791 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 1820 2665 gene locus_tag LOCUS_38630 1820 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 2686 3534 gene locus_tag LOCUS_38640 2686 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 3660 4021 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcgaagggggcgac >Feature sequence278 246 773 gene locus_tag LOCUS_38650 gene raiA 246 773 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_38650 995 1456 gene locus_tag LOCUS_38660 995 1456 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_38660 1565 2440 gene locus_tag LOCUS_38670 gene rapZ 1565 2440 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_38670 2453 2896 gene locus_tag LOCUS_38680 2453 2896 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_38680 2906 3415 gene locus_tag LOCUS_38690 gene rimI 2906 3415 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942401.1 protein_id gnl|my_center|LOCUS_38690 >Feature sequence279 913 2004 gene locus_tag LOCUS_38700 913 2004 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_38700 2168 3331 gene locus_tag LOCUS_38710 2168 3331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_38710 3366 3926 gene locus_tag LOCUS_38720 3366 3926 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence280 <1 1735 gene locus_tag LOCUS_38730 <1 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938783.1:tape measure protein 1740 2180 gene locus_tag LOCUS_38740 1740 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 2186 2791 gene locus_tag LOCUS_38750 2186 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 2778 3182 gene locus_tag LOCUS_38760 2778 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence281 531 1097 gene locus_tag LOCUS_38770 531 1097 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_38770 1996 1091 gene locus_tag LOCUS_38780 1996 1091 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_38780 2165 3526 gene locus_tag LOCUS_38790 2165 3526 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence282 1395 988 gene locus_tag LOCUS_38800 1395 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 1833 1540 gene locus_tag LOCUS_38810 1833 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2105 1845 gene locus_tag LOCUS_38820 2105 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 <3859 2115 gene locus_tag LOCUS_38830 <3859 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142856.1:SMC family ATPase >Feature sequence283 2418 2708 gene locus_tag LOCUS_38840 2418 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2754 3686 gene locus_tag LOCUS_38850 2754 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 >Feature sequence284 3318 913 gene locus_tag LOCUS_38860 3318 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 >Feature sequence285 298 56 gene locus_tag LOCUS_38870 298 56 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_38870 723 445 gene locus_tag LOCUS_38880 723 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 1382 882 gene locus_tag LOCUS_38890 1382 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 1472 2374 gene locus_tag LOCUS_38900 1472 2374 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_38900 2447 3181 gene locus_tag LOCUS_38910 2447 3181 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_38910 >Feature sequence286 361 573 gene locus_tag LOCUS_38920 361 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 524 742 gene locus_tag LOCUS_38930 524 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 798 1292 gene locus_tag LOCUS_38940 798 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 1296 1523 gene locus_tag LOCUS_38950 1296 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 1525 2340 gene locus_tag LOCUS_38960 1525 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 2528 2842 gene locus_tag LOCUS_38970 2528 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence287 1377 673 gene locus_tag LOCUS_38980 gene rplA 1377 673 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940185.1 protein_id gnl|my_center|LOCUS_38980 1828 1406 gene locus_tag LOCUS_38990 gene rplK 1828 1406 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_38990 2398 1865 gene locus_tag LOCUS_39000 gene nusG 2398 1865 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_39000 2794 2453 gene locus_tag LOCUS_39010 2794 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3068 2919 gene locus_tag LOCUS_39020 gene rpmG 3068 2919 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_39020 >Feature sequence288 551 1201 gene locus_tag LOCUS_39030 551 1201 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814069.1 protein_id gnl|my_center|LOCUS_39030 1489 3321 gene locus_tag LOCUS_39040 1489 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence289 2081 759 gene locus_tag LOCUS_39050 2081 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 2796 2182 gene locus_tag LOCUS_39060 2796 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 <3324 2812 gene locus_tag LOCUS_39070 <3324 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522112.1:MlaD family protein >Feature sequence290 1197 10 gene locus_tag LOCUS_39080 1197 10 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_39080 2849 1296 gene locus_tag LOCUS_39090 2849 1296 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_39090 >Feature sequence291 <1 1651 gene locus_tag LOCUS_39100 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545582.1:DUF3365 domain-containing protein 1656 3047 gene locus_tag LOCUS_39110 1656 3047 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence292 451 1305 gene locus_tag LOCUS_39120 451 1305 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_39120 1324 2193 gene locus_tag LOCUS_39130 1324 2193 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_39130 >Feature sequence293 139 654 gene locus_tag LOCUS_39140 139 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 654 839 gene locus_tag LOCUS_39150 654 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence294 2163 1012 gene locus_tag LOCUS_39160 gene dinB 2163 1012 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_39160 2587 2168 gene locus_tag LOCUS_39170 2587 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence295 <1 556 gene locus_tag LOCUS_39180 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881424.1:NAD-dependent deacylase 2787 2494 gene locus_tag LOCUS_39190 2787 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 >Feature sequence296 156 1544 gene locus_tag LOCUS_39200 156 1544 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_39200 1765 2475 gene locus_tag LOCUS_39210 1765 2475 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640740.1 protein_id gnl|my_center|LOCUS_39210 >Feature sequence297 <1 752 gene locus_tag LOCUS_39220 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002937291.1:ABC transporter ATP-binding protein 755 1480 gene locus_tag LOCUS_39230 755 1480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_39230 1489 2811 gene locus_tag LOCUS_39240 1489 2811 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_39240 2827 3030 gene locus_tag LOCUS_39250 2827 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence298 1581 607 gene locus_tag LOCUS_39260 1581 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1810 2165 gene locus_tag LOCUS_tm00010 1810 2165 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2341 2559 gene locus_tag LOCUS_39270 2341 2559 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_39270 2704 2540 gene locus_tag LOCUS_39280 2704 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence299 918 97 gene locus_tag LOCUS_39290 918 97 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_39290 <2946 884 gene locus_tag LOCUS_39300 <2946 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942301.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence300 >Feature sequence301 973 497 gene locus_tag LOCUS_39310 973 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 1307 1450 gene locus_tag LOCUS_39320 1307 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 1656 1874 gene locus_tag LOCUS_39330 1656 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 2205 1921 gene locus_tag LOCUS_39340 2205 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 2377 2916 gene locus_tag LOCUS_39350 gene cysC 2377 2916 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_39350 >Feature sequence302 772 644 gene locus_tag LOCUS_39360 772 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 962 1423 gene locus_tag LOCUS_39370 962 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 2143 1502 gene locus_tag LOCUS_39380 2143 1502 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_39380 >Feature sequence303 <1 2234 gene locus_tag LOCUS_39390 <1 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence304 <1 1560 gene locus_tag LOCUS_39400 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009993989.1:DEAD/DEAH box helicase 1678 1806 gene locus_tag LOCUS_39410 1678 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 1919 2227 gene locus_tag LOCUS_39420 gene rplU 1919 2227 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_39420 2292 2558 gene locus_tag LOCUS_39430 gene rpmA 2292 2558 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_39430 >Feature sequence305 52 1032 gene locus_tag LOCUS_39440 52 1032 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 protein_id gnl|my_center|LOCUS_39440 >Feature sequence306 <2367 952 gene locus_tag LOCUS_39450 <2367 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430738.1:4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase >Feature sequence307 1785 1423 gene locus_tag LOCUS_39460 1785 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence308 1802 624 gene locus_tag LOCUS_39470 1802 624 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_39470 >Feature sequence309 2042 1461 gene locus_tag LOCUS_39480 2042 1461 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_39480 >Feature sequence310 >Feature sequence311 475 2172 gene locus_tag LOCUS_39490 475 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence312 >Feature sequence313 194 721 gene locus_tag LOCUS_39500 194 721 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_39500 844 1929 gene locus_tag LOCUS_39510 gene lpxD 844 1929 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055887.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence314 >Feature sequence315 505 29 gene locus_tag LOCUS_39520 505 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 1095 502 gene locus_tag LOCUS_39530 1095 502 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_39530 1828 1283 gene locus_tag LOCUS_39540 1828 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence316 866 144 gene locus_tag LOCUS_39550 866 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 1422 868 gene locus_tag LOCUS_39560 1422 868 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_39560 >Feature sequence317 1574 657 gene locus_tag LOCUS_39570 1574 657 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_39570 >Feature sequence318 98 973 gene locus_tag LOCUS_39580 98 973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_39580