>Feature sequence001 1761 784 gene locus_tag LOCUS_00010 1761 784 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_00010 2936 1800 gene locus_tag LOCUS_00020 2936 1800 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_00020 3855 2926 gene locus_tag LOCUS_00030 3855 2926 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_00030 4799 4593 gene locus_tag LOCUS_00040 4799 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4809 5024 gene locus_tag LOCUS_00050 4809 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5316 5065 gene locus_tag LOCUS_00060 gene csrA 5316 5065 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865081.1 protein_id gnl|my_center|LOCUS_00060 5902 5426 gene locus_tag LOCUS_00070 gene fliW 5902 5426 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_00070 8344 5990 gene locus_tag LOCUS_00080 8344 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9318 8347 gene locus_tag LOCUS_00090 9318 8347 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_00090 10538 9387 gene locus_tag LOCUS_00100 gene flgL 10538 9387 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_00100 12264 10618 gene locus_tag LOCUS_00110 gene flgK 12264 10618 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545686.1 protein_id gnl|my_center|LOCUS_00110 12769 12272 gene locus_tag LOCUS_00120 12769 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13123 12803 gene locus_tag LOCUS_00130 13123 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13541 13185 gene locus_tag LOCUS_00140 13541 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14681 13599 gene locus_tag LOCUS_00150 14681 13599 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_00150 15564 14863 gene locus_tag LOCUS_00160 15564 14863 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_00160 16316 15561 gene locus_tag LOCUS_00170 16316 15561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17119 16328 gene locus_tag LOCUS_00180 gene flgG 17119 16328 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_00180 17933 17214 gene locus_tag LOCUS_00190 gene flgF 17933 17214 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529801.1 protein_id gnl|my_center|LOCUS_00190 19000 18260 gene locus_tag LOCUS_00200 gene motD 19000 18260 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_00200 19798 19037 gene locus_tag LOCUS_00210 19798 19037 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_00210 20303 19815 gene locus_tag LOCUS_00220 20303 19815 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_00220 20767 20982 gene locus_tag LOCUS_00230 20767 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21354 21103 gene locus_tag LOCUS_00240 21354 21103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21665 21348 gene locus_tag LOCUS_00250 21665 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00250 22281 21808 gene locus_tag LOCUS_00260 22281 21808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24411 22309 gene locus_tag LOCUS_00270 24411 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25454 24519 gene locus_tag LOCUS_00280 25454 24519 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_00280 27483 25579 gene locus_tag LOCUS_00290 27483 25579 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_00290 28205 27564 gene locus_tag LOCUS_00300 28205 27564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28652 28251 gene locus_tag LOCUS_00310 28652 28251 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_00310 29383 29156 gene locus_tag LOCUS_00320 29383 29156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 32536 29573 gene locus_tag LOCUS_00330 32536 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33808 32540 gene locus_tag LOCUS_00340 33808 32540 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035604.1 protein_id gnl|my_center|LOCUS_00340 34443 34096 gene locus_tag LOCUS_00350 34443 34096 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408073.1 protein_id gnl|my_center|LOCUS_00350 35180 35001 gene locus_tag LOCUS_00360 35180 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35356 35535 gene locus_tag LOCUS_00370 35356 35535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36575 35508 gene locus_tag LOCUS_00380 36575 35508 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_00380 37494 36886 gene locus_tag LOCUS_00390 gene cheD 37494 36886 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_00390 38408 37572 gene locus_tag LOCUS_00400 38408 37572 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_00400 39853 39314 gene locus_tag LOCUS_00410 39853 39314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42015 40210 gene locus_tag LOCUS_00420 42015 40210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44283 42055 gene locus_tag LOCUS_00430 44283 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44900 44361 gene locus_tag LOCUS_00440 44900 44361 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_00440 47139 45034 gene locus_tag LOCUS_00450 47139 45034 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_00450 47953 47582 gene locus_tag LOCUS_00460 47953 47582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_00460 49163 48111 gene locus_tag LOCUS_00470 49163 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 49602 49306 gene locus_tag LOCUS_00480 49602 49306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50841 49870 gene locus_tag LOCUS_00490 50841 49870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52171 50972 gene locus_tag LOCUS_00500 52171 50972 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_00500 53200 52406 gene locus_tag LOCUS_00510 53200 52406 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811933.1 protein_id gnl|my_center|LOCUS_00510 54136 53204 gene locus_tag LOCUS_00520 54136 53204 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881781.1 protein_id gnl|my_center|LOCUS_00520 55470 54136 gene locus_tag LOCUS_00530 gene flhF 55470 54136 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_00530 57559 55451 gene locus_tag LOCUS_00540 gene flhA 57559 55451 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_00540 58791 57715 gene locus_tag LOCUS_00550 58791 57715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 59569 58784 gene locus_tag LOCUS_00560 gene fliR 59569 58784 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_00560 59887 59618 gene locus_tag LOCUS_00570 gene fliQ 59887 59618 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_00570 60827 60051 gene locus_tag LOCUS_00580 60827 60051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 61258 60824 gene locus_tag LOCUS_00590 61258 60824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 61769 61344 gene locus_tag LOCUS_00600 61769 61344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62835 61831 gene locus_tag LOCUS_00610 gene fliM 62835 61831 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_00610 63408 62914 gene locus_tag LOCUS_00620 63408 62914 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941088.1 protein_id gnl|my_center|LOCUS_00620 65194 63854 gene locus_tag LOCUS_00630 65194 63854 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545614.1 protein_id gnl|my_center|LOCUS_00630 65926 65258 gene locus_tag LOCUS_00640 65926 65258 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_00640 67547 65985 gene locus_tag LOCUS_00650 67547 65985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 68153 67551 gene locus_tag LOCUS_00660 68153 67551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 68851 68405 gene locus_tag LOCUS_00670 68851 68405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 70191 68848 gene locus_tag LOCUS_00680 70191 68848 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937617.1 protein_id gnl|my_center|LOCUS_00680 70805 70188 gene locus_tag LOCUS_00690 70805 70188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 71802 70807 gene locus_tag LOCUS_00700 gene fliG 71802 70807 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_00700 73398 71806 gene locus_tag LOCUS_00710 gene fliF 73398 71806 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_00710 73850 73548 gene locus_tag LOCUS_00720 73850 73548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74328 73885 gene locus_tag LOCUS_00730 gene flgC 74328 73885 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_00730 74862 74446 gene locus_tag LOCUS_00740 gene flgB 74862 74446 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937623.1 protein_id gnl|my_center|LOCUS_00740 76561 75173 gene locus_tag LOCUS_00750 76561 75173 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_00750 77736 76573 gene locus_tag LOCUS_00760 77736 76573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79696 77717 gene locus_tag LOCUS_00770 79696 77717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 81493 80033 gene locus_tag LOCUS_00780 81493 80033 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_00780 81784 82011 gene locus_tag LOCUS_00790 81784 82011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 82635 82012 gene locus_tag LOCUS_00800 82635 82012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 84845 82656 gene locus_tag LOCUS_00810 gene lptD 84845 82656 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480552.1 protein_id gnl|my_center|LOCUS_00810 86239 84950 gene locus_tag LOCUS_00820 86239 84950 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_00820 87249 86389 gene locus_tag LOCUS_00830 gene accD 87249 86389 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_00830 88533 87490 gene locus_tag LOCUS_00840 gene moaA 88533 87490 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417297.1 protein_id gnl|my_center|LOCUS_00840 88993 88550 gene locus_tag LOCUS_00850 88993 88550 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383373.1 protein_id gnl|my_center|LOCUS_00850 89276 89016 gene locus_tag LOCUS_00860 89276 89016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 89830 89324 gene locus_tag LOCUS_00870 gene moaC 89830 89324 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722672.1 protein_id gnl|my_center|LOCUS_00870 89994 90347 gene locus_tag LOCUS_00880 89994 90347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 90638 93163 gene locus_tag LOCUS_00890 90638 93163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 94369 93365 gene locus_tag LOCUS_00900 94369 93365 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_00900 95433 94384 gene locus_tag LOCUS_00910 95433 94384 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_00910 96820 96284 gene locus_tag LOCUS_00920 96820 96284 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_00920 97271 97059 gene locus_tag LOCUS_00930 97271 97059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97950 97426 gene locus_tag LOCUS_00940 97950 97426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99296 98160 gene locus_tag LOCUS_00950 gene cobD 99296 98160 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_00950 100237 99281 gene locus_tag LOCUS_00960 gene cbiB 100237 99281 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_00960 101260 100484 gene locus_tag LOCUS_00970 gene cobS 101260 100484 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_00970 102345 101257 gene locus_tag LOCUS_00980 gene cobT 102345 101257 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_00980 102966 102349 gene locus_tag LOCUS_00990 gene cobU 102966 102349 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_00990 103646 103047 gene locus_tag LOCUS_01000 103646 103047 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_01000 104437 103733 gene locus_tag LOCUS_01010 104437 103733 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013653842.1 protein_id gnl|my_center|LOCUS_01010 105197 104478 gene locus_tag LOCUS_01020 gene bluB 105197 104478 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396627.1 protein_id gnl|my_center|LOCUS_01020 105790 105194 gene locus_tag LOCUS_01030 gene cobO 105790 105194 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_01030 107184 105787 gene locus_tag LOCUS_01040 107184 105787 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022072.1 protein_id gnl|my_center|LOCUS_01040 109208 107181 gene locus_tag LOCUS_01050 109208 107181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_01050 110318 109491 gene locus_tag LOCUS_01060 110318 109491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 111328 110318 gene locus_tag LOCUS_01070 111328 110318 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_01070 111246 111512 gene locus_tag LOCUS_01080 111246 111512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 112826 111579 gene locus_tag LOCUS_01090 112826 111579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 113889 113059 gene locus_tag LOCUS_01100 113889 113059 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 protein_id gnl|my_center|LOCUS_01100 115618 114056 gene locus_tag LOCUS_01110 115618 114056 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_01110 117131 115722 gene locus_tag LOCUS_01120 117131 115722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 117265 118140 gene locus_tag LOCUS_01130 117265 118140 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937978.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence002 236 1372 gene locus_tag LOCUS_01140 236 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2556 1585 gene locus_tag LOCUS_01150 2556 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3242 2679 gene locus_tag LOCUS_01160 3242 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 3852 3490 gene locus_tag LOCUS_01170 3852 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 4865 3879 gene locus_tag LOCUS_01180 4865 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 5471 5289 gene locus_tag LOCUS_01190 5471 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5934 5680 gene locus_tag LOCUS_01200 5934 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 6186 5944 gene locus_tag LOCUS_01210 6186 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 6370 6537 gene locus_tag LOCUS_01220 6370 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8497 6512 gene locus_tag LOCUS_01230 8497 6512 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_01230 8762 9550 gene locus_tag LOCUS_01240 8762 9550 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911295.1 protein_id gnl|my_center|LOCUS_01240 9832 9644 gene locus_tag LOCUS_01250 9832 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 9985 10239 gene locus_tag LOCUS_01260 9985 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 11053 10376 gene locus_tag LOCUS_01270 11053 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 11165 11692 gene locus_tag LOCUS_01280 11165 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 12804 11716 gene locus_tag LOCUS_01290 12804 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_01290 13008 13430 gene locus_tag LOCUS_01300 13008 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13628 13912 gene locus_tag LOCUS_01310 13628 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 14858 13959 gene locus_tag LOCUS_01320 14858 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 15012 15353 gene locus_tag LOCUS_01330 15012 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15572 16231 gene locus_tag LOCUS_01340 15572 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 16526 17602 gene locus_tag LOCUS_01350 gene aroF 16526 17602 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168037.1 protein_id gnl|my_center|LOCUS_01350 18169 17825 gene locus_tag LOCUS_01360 18169 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 18751 18323 gene locus_tag LOCUS_01370 18751 18323 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357640.1 protein_id gnl|my_center|LOCUS_01370 19604 19050 gene locus_tag LOCUS_01380 19604 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 20065 19877 gene locus_tag LOCUS_01390 20065 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 21876 21460 gene locus_tag LOCUS_01400 21876 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 24355 21911 gene locus_tag LOCUS_01410 24355 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 25153 25701 gene locus_tag LOCUS_01420 25153 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 25937 26380 gene locus_tag LOCUS_01430 25937 26380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 26446 26772 gene locus_tag LOCUS_01440 26446 26772 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_01440 26800 27357 gene locus_tag LOCUS_01450 26800 27357 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_01450 28380 27442 gene locus_tag LOCUS_01460 28380 27442 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_01460 28740 28558 gene locus_tag LOCUS_01470 28740 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 30008 28770 gene locus_tag LOCUS_01480 30008 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 30144 30434 gene locus_tag LOCUS_01490 30144 30434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 32389 30419 gene locus_tag LOCUS_01500 32389 30419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 34304 32409 gene locus_tag LOCUS_01510 34304 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 34694 35158 gene locus_tag LOCUS_01520 34694 35158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 35436 35654 gene locus_tag LOCUS_01530 35436 35654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 39436 35765 gene locus_tag LOCUS_01540 gene metH 39436 35765 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_01540 39662 40381 gene locus_tag LOCUS_01550 39662 40381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 40776 40423 gene locus_tag LOCUS_01560 40776 40423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 41022 41279 gene locus_tag LOCUS_01570 41022 41279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 41666 41382 gene locus_tag LOCUS_01580 41666 41382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 41806 42552 gene locus_tag LOCUS_01590 41806 42552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 42863 43462 gene locus_tag LOCUS_01600 42863 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 43812 43991 gene locus_tag LOCUS_01610 43812 43991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01610 44286 44005 gene locus_tag LOCUS_01620 44286 44005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01620 44577 44395 gene locus_tag LOCUS_01630 44577 44395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01630 45037 44885 gene locus_tag LOCUS_01640 45037 44885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 46112 45681 gene locus_tag LOCUS_01650 gene mutT 46112 45681 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461225.1 protein_id gnl|my_center|LOCUS_01650 46818 46102 gene locus_tag LOCUS_01660 46818 46102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 47392 48345 gene locus_tag LOCUS_01670 47392 48345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 50828 48510 gene locus_tag LOCUS_01680 50828 48510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 53103 50884 gene locus_tag LOCUS_01690 53103 50884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 54174 53452 gene locus_tag LOCUS_01700 54174 53452 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_01700 54719 57505 gene locus_tag LOCUS_01710 54719 57505 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228487.1 protein_id gnl|my_center|LOCUS_01710 57505 58413 gene locus_tag LOCUS_01720 gene nadC 57505 58413 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_01720 59157 59327 gene locus_tag LOCUS_01730 59157 59327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 59311 60087 gene locus_tag LOCUS_01740 59311 60087 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_01740 60201 60860 gene locus_tag LOCUS_01750 gene grpE 60201 60860 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546170.1 protein_id gnl|my_center|LOCUS_01750 60857 62788 gene locus_tag LOCUS_01760 gene dnaK 60857 62788 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_01760 62845 63966 gene locus_tag LOCUS_01770 gene dnaJ 62845 63966 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_01770 64006 64740 gene locus_tag LOCUS_01780 64006 64740 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223081.1 protein_id gnl|my_center|LOCUS_01780 65798 64761 gene locus_tag LOCUS_01790 65798 64761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 67423 65798 gene locus_tag LOCUS_01800 67423 65798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 68322 67945 gene locus_tag LOCUS_01810 68322 67945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 69384 68452 gene locus_tag LOCUS_01820 gene mltG 69384 68452 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_01820 72198 69538 gene locus_tag LOCUS_01830 gene alaS 72198 69538 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_01830 73341 72262 gene locus_tag LOCUS_01840 gene recA 73341 72262 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_01840 74039 73425 gene locus_tag LOCUS_01850 gene thpR 74039 73425 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_01850 75304 74039 gene locus_tag LOCUS_01860 75304 74039 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_01860 76020 75361 gene locus_tag LOCUS_01870 76020 75361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 76208 76915 gene locus_tag LOCUS_01880 76208 76915 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_01880 77190 76945 gene locus_tag LOCUS_01890 77190 76945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 77275 77496 gene locus_tag LOCUS_01900 77275 77496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 77538 78722 gene locus_tag LOCUS_01910 77538 78722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 79999 78758 gene locus_tag LOCUS_01920 79999 78758 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_01920 80202 80277 gene locus_tag LOCUS_t00010 80202 80277 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 81318 80353 gene locus_tag LOCUS_01930 81318 80353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 83522 82029 gene locus_tag LOCUS_01940 83522 82029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 85029 83674 gene locus_tag LOCUS_01950 85029 83674 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_01950 85442 86224 gene locus_tag LOCUS_01960 gene rpsB 85442 86224 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_01960 86280 86882 gene locus_tag LOCUS_01970 gene tsf 86280 86882 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_01970 86882 87610 gene locus_tag LOCUS_01980 gene pyrH 86882 87610 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_01980 87619 88182 gene locus_tag LOCUS_01990 gene frr 87619 88182 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_01990 88192 89418 gene locus_tag LOCUS_02000 gene alr 88192 89418 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_02000 89790 89479 gene locus_tag LOCUS_02010 89790 89479 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_02010 90446 89790 gene locus_tag LOCUS_02020 90446 89790 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_02020 91557 90658 gene locus_tag LOCUS_02030 gene metF 91557 90658 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_02030 92678 91590 gene locus_tag LOCUS_02040 92678 91590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 93647 92829 gene locus_tag LOCUS_02050 93647 92829 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_02050 94211 95329 gene locus_tag LOCUS_02060 94211 95329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 95322 96110 gene locus_tag LOCUS_02070 95322 96110 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_02070 96444 98054 gene locus_tag LOCUS_02080 96444 98054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 98044 99405 gene locus_tag LOCUS_02090 gene atoC 98044 99405 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_02090 100336 101373 gene locus_tag LOCUS_02100 100336 101373 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_02100 101342 101602 gene locus_tag LOCUS_02110 101342 101602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 101595 104327 gene locus_tag LOCUS_02120 101595 104327 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233935.1 protein_id gnl|my_center|LOCUS_02120 104311 105873 gene locus_tag LOCUS_02130 gene casA 104311 105873 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084093.1 protein_id gnl|my_center|LOCUS_02130 105892 106437 gene locus_tag LOCUS_02140 105892 106437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 106471 107547 gene locus_tag LOCUS_02150 gene cas7e 106471 107547 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_02150 107547 108362 gene locus_tag LOCUS_02160 gene cas5e 107547 108362 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_02160 108359 109057 gene locus_tag LOCUS_02170 gene cas6e 108359 109057 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387929.1 protein_id gnl|my_center|LOCUS_02170 109075 109995 gene locus_tag LOCUS_02180 gene cas1e 109075 109995 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_02180 109976 110296 gene locus_tag LOCUS_02190 gene cas2e 109976 110296 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_02190 110367 111678 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atgttccccgcaggcgcggggatgaaccg 112778 112146 gene locus_tag LOCUS_02200 112778 112146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence003 293 1027 gene locus_tag LOCUS_02210 293 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1052 1819 gene locus_tag LOCUS_02220 1052 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 1998 2861 gene locus_tag LOCUS_02230 1998 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2921 4381 gene locus_tag LOCUS_02240 2921 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4425 4619 gene locus_tag LOCUS_02250 4425 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4619 5101 gene locus_tag LOCUS_02260 4619 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5186 5824 gene locus_tag LOCUS_02270 5186 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 6685 7986 gene locus_tag LOCUS_02280 6685 7986 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 protein_id gnl|my_center|LOCUS_02280 9635 8067 gene locus_tag LOCUS_02290 gene zwf 9635 8067 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_02290 10266 10766 gene locus_tag LOCUS_02300 10266 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 10802 10990 gene locus_tag LOCUS_02310 10802 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02310 10997 11218 gene locus_tag LOCUS_02320 10997 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02320 11645 11445 gene locus_tag LOCUS_02330 11645 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 13427 12585 gene locus_tag LOCUS_02340 gene trpA 13427 12585 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_02340 14701 13508 gene locus_tag LOCUS_02350 gene trpB 14701 13508 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_02350 15385 14756 gene locus_tag LOCUS_02360 15385 14756 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_02360 16386 15541 gene locus_tag LOCUS_02370 gene trpC 16386 15541 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_02370 17408 16383 gene locus_tag LOCUS_02380 gene trpD 17408 16383 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_02380 18036 17449 gene locus_tag LOCUS_02390 gene pabA 18036 17449 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_02390 19553 18057 gene locus_tag LOCUS_02400 gene trpE 19553 18057 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_02400 20420 19707 gene locus_tag LOCUS_02410 20420 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 20629 21585 gene locus_tag LOCUS_02420 20629 21585 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_02420 21679 23580 gene locus_tag LOCUS_02430 21679 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122284.1 protein_id gnl|my_center|LOCUS_02430 23528 25681 gene locus_tag LOCUS_02440 gene ligA 23528 25681 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_02440 27091 25820 gene locus_tag LOCUS_02450 27091 25820 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_02450 27917 27342 gene locus_tag LOCUS_02460 27917 27342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 29337 28102 gene locus_tag LOCUS_02470 29337 28102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 29508 29930 gene locus_tag LOCUS_02480 29508 29930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 30112 32523 gene locus_tag LOCUS_02490 30112 32523 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_02490 33543 32515 gene locus_tag LOCUS_02500 gene queG 33543 32515 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294194.1 protein_id gnl|my_center|LOCUS_02500 35931 34282 gene locus_tag LOCUS_02510 gene groL 35931 34282 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_02510 36326 36009 gene locus_tag LOCUS_02520 36326 36009 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_02520 37621 36581 gene locus_tag LOCUS_02530 37621 36581 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_02530 37864 39087 gene locus_tag LOCUS_02540 37864 39087 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459022.1 protein_id gnl|my_center|LOCUS_02540 39129 40358 gene locus_tag LOCUS_02550 39129 40358 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_02550 40459 40968 gene locus_tag LOCUS_02560 gene ribE 40459 40968 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_02560 40965 41492 gene locus_tag LOCUS_02570 40965 41492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 41505 42875 gene locus_tag LOCUS_02580 gene purB 41505 42875 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140047.1 protein_id gnl|my_center|LOCUS_02580 42872 43576 gene locus_tag LOCUS_02590 42872 43576 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_02590 43692 43937 gene locus_tag LOCUS_02600 gene purS 43692 43937 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_02600 44029 44742 gene locus_tag LOCUS_02610 gene purQ 44029 44742 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_02610 44812 45018 gene locus_tag LOCUS_02620 44812 45018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 45170 47443 gene locus_tag LOCUS_02630 gene purL 45170 47443 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_02630 47538 48974 gene locus_tag LOCUS_02640 gene purF 47538 48974 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_02640 49090 49644 gene locus_tag LOCUS_02650 49090 49644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 49691 49930 gene locus_tag LOCUS_02660 49691 49930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 49927 50526 gene locus_tag LOCUS_02670 49927 50526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 50589 51392 gene locus_tag LOCUS_02680 50589 51392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 51385 51825 gene locus_tag LOCUS_02690 51385 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 51878 52903 gene locus_tag LOCUS_02700 51878 52903 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_02700 55225 53045 gene locus_tag LOCUS_02710 55225 53045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 57605 55464 gene locus_tag LOCUS_02720 57605 55464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 58253 60355 gene locus_tag LOCUS_02730 gene fusA 58253 60355 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_02730 61754 60381 gene locus_tag LOCUS_02740 61754 60381 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_02740 62410 61814 gene locus_tag LOCUS_02750 gene plsY 62410 61814 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_02750 63050 62433 gene locus_tag LOCUS_02760 gene pgsA 63050 62433 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_02760 63926 63078 gene locus_tag LOCUS_02770 gene kdsA 63926 63078 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_02770 65510 63942 gene locus_tag LOCUS_02780 65510 63942 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_02780 66417 65635 gene locus_tag LOCUS_02790 gene kdsB 66417 65635 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_02790 67471 66404 gene locus_tag LOCUS_02800 gene rfaE1 67471 66404 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_02800 68232 67471 gene locus_tag LOCUS_02810 gene lepB 68232 67471 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_02810 70054 68240 gene locus_tag LOCUS_02820 gene lepA 70054 68240 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546674.1 protein_id gnl|my_center|LOCUS_02820 70138 71559 gene locus_tag LOCUS_02830 gene bioA 70138 71559 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_02830 72356 71556 gene locus_tag LOCUS_02840 72356 71556 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_02840 72835 72359 gene locus_tag LOCUS_02850 gene greA 72835 72359 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_02850 76213 72899 gene locus_tag LOCUS_02860 gene carB 76213 72899 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_02860 77077 76223 gene locus_tag LOCUS_02870 77077 76223 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_02870 78118 77156 gene locus_tag LOCUS_02880 gene sppA 78118 77156 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_02880 79302 78118 gene locus_tag LOCUS_02890 gene carA 79302 78118 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_02890 79881 79354 gene locus_tag LOCUS_02900 79881 79354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 81213 79891 gene locus_tag LOCUS_02910 81213 79891 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_02910 82164 81223 gene locus_tag LOCUS_02920 82164 81223 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_02920 82723 82172 gene locus_tag LOCUS_02930 gene pyrR 82723 82172 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_02930 84751 82964 gene locus_tag LOCUS_02940 84751 82964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 84725 84910 gene locus_tag LOCUS_02950 84725 84910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 86176 84860 gene locus_tag LOCUS_02960 86176 84860 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_02960 87027 87392 gene locus_tag LOCUS_02970 87027 87392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 87575 87650 gene locus_tag LOCUS_t00020 87575 87650 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 87690 88712 gene locus_tag LOCUS_02980 87690 88712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 89661 88921 gene locus_tag LOCUS_02990 89661 88921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 90174 89989 gene locus_tag LOCUS_03000 90174 89989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 91009 90239 gene locus_tag LOCUS_03010 gene proC 91009 90239 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_03010 91403 92497 gene locus_tag LOCUS_03020 91403 92497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 92534 93637 gene locus_tag LOCUS_03030 92534 93637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 93798 94229 gene locus_tag LOCUS_03040 93798 94229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 95411 94320 gene locus_tag LOCUS_03050 95411 94320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 96959 95415 gene locus_tag LOCUS_03060 96959 95415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 97514 96984 gene locus_tag LOCUS_03070 97514 96984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 98236 97664 gene locus_tag LOCUS_03080 98236 97664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 98419 98589 gene locus_tag LOCUS_03090 98419 98589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 99122 98685 gene locus_tag LOCUS_03100 99122 98685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 99294 100850 gene locus_tag LOCUS_03110 99294 100850 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_03110 101024 101713 gene locus_tag LOCUS_03120 101024 101713 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_03120 101970 103856 gene locus_tag LOCUS_03130 gene acs 101970 103856 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_03130 106210 106004 gene locus_tag LOCUS_03140 106210 106004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence004 120 455 gene locus_tag LOCUS_03150 120 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 600 436 gene locus_tag LOCUS_03160 600 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 565 1785 gene locus_tag LOCUS_03170 565 1785 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 protein_id gnl|my_center|LOCUS_03170 3077 1971 gene locus_tag LOCUS_03180 3077 1971 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_03180 3617 3099 gene locus_tag LOCUS_03190 3617 3099 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_03190 3940 3641 gene locus_tag LOCUS_03200 3940 3641 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_03200 4918 4166 gene locus_tag LOCUS_03210 4918 4166 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_03210 6161 5406 gene locus_tag LOCUS_03220 gene pgeF 6161 5406 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_03220 7362 6166 gene locus_tag LOCUS_03230 gene ftsZ 7362 6166 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_03230 8728 7475 gene locus_tag LOCUS_03240 gene ftsA 8728 7475 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_03240 9553 8732 gene locus_tag LOCUS_03250 9553 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 10533 9550 gene locus_tag LOCUS_03260 10533 9550 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_03260 11514 10594 gene locus_tag LOCUS_03270 gene murB 11514 10594 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_03270 12932 11553 gene locus_tag LOCUS_03280 gene murC 12932 11553 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_03280 14346 13258 gene locus_tag LOCUS_03290 gene murG 14346 13258 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_03290 15542 14364 gene locus_tag LOCUS_03300 gene ftsW 15542 14364 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_03300 16965 15544 gene locus_tag LOCUS_03310 gene murD 16965 15544 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_03310 18055 16979 gene locus_tag LOCUS_03320 gene mraY 18055 16979 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_03320 19601 18186 gene locus_tag LOCUS_03330 19601 18186 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_03330 21131 19617 gene locus_tag LOCUS_03340 21131 19617 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_03340 22904 21135 gene locus_tag LOCUS_03350 22904 21135 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_03350 23248 22901 gene locus_tag LOCUS_03360 23248 22901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 24159 23245 gene locus_tag LOCUS_03370 gene rsmH 24159 23245 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_03370 25645 24344 gene locus_tag LOCUS_03380 gene asnS 25645 24344 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_03380 25758 26078 gene locus_tag LOCUS_03390 25758 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 27058 26129 gene locus_tag LOCUS_03400 27058 26129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_03400 27908 27123 gene locus_tag LOCUS_03410 27908 27123 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_03410 28220 27975 gene locus_tag LOCUS_03420 28220 27975 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_03420 29676 28333 gene locus_tag LOCUS_03430 gene xseA 29676 28333 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_03430 30465 29686 gene locus_tag LOCUS_03440 30465 29686 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_03440 32048 30486 gene locus_tag LOCUS_03450 gene rny 32048 30486 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546866.1 protein_id gnl|my_center|LOCUS_03450 33049 32756 gene locus_tag LOCUS_03460 33049 32756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 33300 33067 gene locus_tag LOCUS_03470 33300 33067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 35602 33350 gene locus_tag LOCUS_03480 35602 33350 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_03480 36805 35957 gene locus_tag LOCUS_03490 36805 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 38865 37018 gene locus_tag LOCUS_03500 38865 37018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 40449 38986 gene locus_tag LOCUS_03510 40449 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 41732 40446 gene locus_tag LOCUS_03520 41732 40446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 42576 42013 gene locus_tag LOCUS_03530 42576 42013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 43436 42576 gene locus_tag LOCUS_03540 43436 42576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 44219 47677 gene locus_tag LOCUS_03550 44219 47677 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_03550 49617 47947 gene locus_tag LOCUS_03560 49617 47947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 50199 49951 gene locus_tag LOCUS_03570 50199 49951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 50968 50894 gene locus_tag LOCUS_t00030 50968 50894 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 51235 51708 gene locus_tag LOCUS_03580 51235 51708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 52030 52704 gene locus_tag LOCUS_03590 52030 52704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 53906 52869 gene locus_tag LOCUS_03600 53906 52869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 54739 53903 gene locus_tag LOCUS_03610 54739 53903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 55507 54782 gene locus_tag LOCUS_03620 55507 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 56173 55535 gene locus_tag LOCUS_03630 56173 55535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 58097 56235 gene locus_tag LOCUS_03640 58097 56235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 58994 58164 gene locus_tag LOCUS_03650 58994 58164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 60187 59075 gene locus_tag LOCUS_03660 60187 59075 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_03660 61154 60216 gene locus_tag LOCUS_03670 61154 60216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 61995 61183 gene locus_tag LOCUS_03680 61995 61183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 63735 62020 gene locus_tag LOCUS_03690 63735 62020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 64334 63774 gene locus_tag LOCUS_03700 64334 63774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 65646 65299 gene locus_tag LOCUS_03710 65646 65299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 66756 65740 gene locus_tag LOCUS_03720 gene hpnH 66756 65740 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_03720 66932 66857 gene locus_tag LOCUS_t00040 66932 66857 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 68221 67022 gene locus_tag LOCUS_03730 gene ispG 68221 67022 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_03730 70126 68231 gene locus_tag LOCUS_03740 gene dxs 70126 68231 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_03740 70994 70278 gene locus_tag LOCUS_03750 70994 70278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 72271 71063 gene locus_tag LOCUS_03760 72271 71063 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_03760 72976 72284 gene locus_tag LOCUS_03770 72976 72284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_03770 73455 73009 gene locus_tag LOCUS_03780 gene mlaD 73455 73009 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_03780 74326 73577 gene locus_tag LOCUS_03790 74326 73577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_03790 75120 74353 gene locus_tag LOCUS_03800 75120 74353 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_03800 75788 75117 gene locus_tag LOCUS_03810 75788 75117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 78158 75978 gene locus_tag LOCUS_03820 gene shc 78158 75978 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_03820 79670 78363 gene locus_tag LOCUS_03830 79670 78363 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_03830 80227 79781 gene locus_tag LOCUS_03840 80227 79781 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_03840 82254 80605 gene locus_tag LOCUS_03850 82254 80605 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_03850 83793 82438 gene locus_tag LOCUS_03860 gene dnaB 83793 82438 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_03860 85105 83780 gene locus_tag LOCUS_03870 85105 83780 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_03870 86760 85177 gene locus_tag LOCUS_03880 gene serA 86760 85177 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_03880 88003 86921 gene locus_tag LOCUS_03890 gene serC 88003 86921 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 protein_id gnl|my_center|LOCUS_03890 88208 88486 gene locus_tag LOCUS_03900 88208 88486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 89562 88543 gene locus_tag LOCUS_03910 89562 88543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 91105 89615 gene locus_tag LOCUS_03920 91105 89615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 91296 92660 gene locus_tag LOCUS_03930 91296 92660 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_03930 92788 92958 gene locus_tag LOCUS_03940 92788 92958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 93608 93411 gene locus_tag LOCUS_03950 93608 93411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 93821 94450 gene locus_tag LOCUS_03960 93821 94450 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944026.1 protein_id gnl|my_center|LOCUS_03960 96363 94822 gene locus_tag LOCUS_03970 96363 94822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 96499 96302 gene locus_tag LOCUS_03980 96499 96302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 99182 97407 gene locus_tag LOCUS_03990 99182 97407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence005 341 1402 gene locus_tag LOCUS_04000 gene glk 341 1402 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_04000 1637 2338 gene locus_tag LOCUS_04010 gene rpiA 1637 2338 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_04010 2498 4054 gene locus_tag LOCUS_04020 2498 4054 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_04020 4252 4001 gene locus_tag LOCUS_04030 4252 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 4696 4773 gene locus_tag LOCUS_t00050 4696 4773 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4902 5996 gene locus_tag LOCUS_04040 4902 5996 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926062.1 protein_id gnl|my_center|LOCUS_04040 6075 6776 gene locus_tag LOCUS_04050 6075 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 6895 7155 gene locus_tag LOCUS_04060 6895 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 7188 8621 gene locus_tag LOCUS_04070 7188 8621 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_04070 8870 9460 gene locus_tag LOCUS_04080 8870 9460 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_04080 10387 9611 gene locus_tag LOCUS_04090 gene xth 10387 9611 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_04090 10487 11107 gene locus_tag LOCUS_04100 10487 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 11737 11165 gene locus_tag LOCUS_04110 11737 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12909 11749 gene locus_tag LOCUS_04120 12909 11749 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_04120 13418 12987 gene locus_tag LOCUS_04130 13418 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 13494 13673 gene locus_tag LOCUS_04140 13494 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 13781 14506 gene locus_tag LOCUS_04150 13781 14506 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_04150 14742 14990 gene locus_tag LOCUS_04160 14742 14990 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144400.1 protein_id gnl|my_center|LOCUS_04160 14995 15327 gene locus_tag LOCUS_04170 gene grxD 14995 15327 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214004.1 protein_id gnl|my_center|LOCUS_04170 15836 16516 gene locus_tag LOCUS_04180 15836 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 16655 17338 gene locus_tag LOCUS_04190 16655 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 17469 19157 gene locus_tag LOCUS_04200 17469 19157 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_04200 19150 20361 gene locus_tag LOCUS_04210 19150 20361 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_04210 20358 21161 gene locus_tag LOCUS_04220 20358 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 21487 21227 gene locus_tag LOCUS_04230 21487 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 21659 22363 gene locus_tag LOCUS_04240 21659 22363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 22368 23849 gene locus_tag LOCUS_04250 22368 23849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 23846 24433 gene locus_tag LOCUS_04260 23846 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24400 24918 gene locus_tag LOCUS_04270 24400 24918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 24947 26557 gene locus_tag LOCUS_04280 gene mshL 24947 26557 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_04280 26557 27381 gene locus_tag LOCUS_04290 26557 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 27409 28758 gene locus_tag LOCUS_04300 27409 28758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 29137 29322 gene locus_tag LOCUS_04310 29137 29322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 29678 31057 gene locus_tag LOCUS_04320 29678 31057 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461085.1 protein_id gnl|my_center|LOCUS_04320 31493 31122 gene locus_tag LOCUS_04330 31493 31122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 31791 33512 gene locus_tag LOCUS_04340 31791 33512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 33636 35345 gene locus_tag LOCUS_04350 33636 35345 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_04350 35546 37138 gene locus_tag LOCUS_04360 gene nhaB 35546 37138 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482404.1 protein_id gnl|my_center|LOCUS_04360 38369 37290 gene locus_tag LOCUS_04370 38369 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 40354 38846 gene locus_tag LOCUS_04380 40354 38846 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_04380 42666 40489 gene locus_tag LOCUS_04390 gene nuoL 42666 40489 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_04390 44165 42696 gene locus_tag LOCUS_04400 44165 42696 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_04400 44539 44162 gene locus_tag LOCUS_04410 44539 44162 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_04410 44981 44532 gene locus_tag LOCUS_04420 44981 44532 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_04420 45511 44978 gene locus_tag LOCUS_04430 45511 44978 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_04430 45807 45508 gene locus_tag LOCUS_04440 45807 45508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 46074 45808 gene locus_tag LOCUS_04450 46074 45808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 46565 46074 gene locus_tag LOCUS_04460 46565 46074 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335817.1 protein_id gnl|my_center|LOCUS_04460 50077 47051 gene locus_tag LOCUS_04470 50077 47051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 50560 50967 gene locus_tag LOCUS_04480 50560 50967 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_04480 51118 51786 gene locus_tag LOCUS_04490 51118 51786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 53726 52125 gene locus_tag LOCUS_04500 53726 52125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 54135 54947 gene locus_tag LOCUS_04510 54135 54947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 55059 55499 gene locus_tag LOCUS_04520 55059 55499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 58052 55743 gene locus_tag LOCUS_04530 58052 55743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 60324 58936 gene locus_tag LOCUS_04540 gene atoC 60324 58936 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_04540 62253 60328 gene locus_tag LOCUS_04550 62253 60328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 64188 62569 gene locus_tag LOCUS_04560 gene nhaB 64188 62569 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132255.1 protein_id gnl|my_center|LOCUS_04560 66045 64246 gene locus_tag LOCUS_04570 66045 64246 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_04570 67789 66398 gene locus_tag LOCUS_04580 67789 66398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 68546 69934 gene locus_tag LOCUS_04590 gene atoC 68546 69934 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_04590 70688 71242 gene locus_tag LOCUS_04600 70688 71242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 72442 73017 gene locus_tag LOCUS_04610 72442 73017 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_04610 73174 73010 gene locus_tag LOCUS_04620 73174 73010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 73297 73770 gene locus_tag LOCUS_04630 73297 73770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 73736 73966 gene locus_tag LOCUS_04640 73736 73966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 74099 75376 gene locus_tag LOCUS_04650 74099 75376 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_04650 75373 75822 gene locus_tag LOCUS_04660 75373 75822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 76338 75877 gene locus_tag LOCUS_04670 76338 75877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence006 2663 1989 gene locus_tag LOCUS_04680 2663 1989 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_04680 4564 2660 gene locus_tag LOCUS_04690 4564 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 5471 4815 gene locus_tag LOCUS_04700 5471 4815 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_04700 5618 5487 gene locus_tag LOCUS_04710 5618 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 6846 5659 gene locus_tag LOCUS_04720 6846 5659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_04720 7807 7004 gene locus_tag LOCUS_04730 7807 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8792 8445 gene locus_tag LOCUS_04740 8792 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 8966 10825 gene locus_tag LOCUS_04750 8966 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 10848 11903 gene locus_tag LOCUS_04760 10848 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 12146 12688 gene locus_tag LOCUS_04770 12146 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 13181 12831 gene locus_tag LOCUS_04780 13181 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13958 13209 gene locus_tag LOCUS_04790 13958 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 14914 14021 gene locus_tag LOCUS_04800 gene era 14914 14021 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721968.1 protein_id gnl|my_center|LOCUS_04800 15272 15003 gene locus_tag LOCUS_04810 15272 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 16652 15366 gene locus_tag LOCUS_04820 gene eno 16652 15366 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_04820 18125 16725 gene locus_tag LOCUS_04830 gene gatB 18125 16725 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_04830 18511 18197 gene locus_tag LOCUS_04840 18511 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 18908 18501 gene locus_tag LOCUS_04850 18908 18501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 20395 18923 gene locus_tag LOCUS_04860 gene gatA 20395 18923 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_04860 20829 20482 gene locus_tag LOCUS_04870 20829 20482 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101061.1 protein_id gnl|my_center|LOCUS_04870 21173 20880 gene locus_tag LOCUS_04880 gene gatC 21173 20880 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_04880 22077 21349 gene locus_tag LOCUS_04890 gene radC 22077 21349 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_04890 22204 22806 gene locus_tag LOCUS_04900 gene rsmD 22204 22806 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_04900 22803 23291 gene locus_tag LOCUS_04910 gene coaD 22803 23291 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_04910 23288 24481 gene locus_tag LOCUS_04920 23288 24481 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_04920 25021 24803 gene locus_tag LOCUS_04930 25021 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 25380 25952 gene locus_tag LOCUS_04940 25380 25952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 26652 26311 gene locus_tag LOCUS_04950 26652 26311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 27387 27311 gene locus_tag LOCUS_t00060 27387 27311 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27734 28201 gene locus_tag LOCUS_04960 27734 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 29179 28388 gene locus_tag LOCUS_04970 29179 28388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_04970 29931 29176 gene locus_tag LOCUS_04980 29931 29176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_04980 30629 29931 gene locus_tag LOCUS_04990 30629 29931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 31138 30635 gene locus_tag LOCUS_05000 gene mobB 31138 30635 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_05000 32450 31221 gene locus_tag LOCUS_05010 32450 31221 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_05010 33587 32622 gene locus_tag LOCUS_05020 33587 32622 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_05020 34125 33646 gene locus_tag LOCUS_05030 34125 33646 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_05030 35106 34150 gene locus_tag LOCUS_05040 gene tatC 35106 34150 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_05040 36694 35171 gene locus_tag LOCUS_05050 36694 35171 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_05050 36912 37094 gene locus_tag LOCUS_05060 36912 37094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 37465 37112 gene locus_tag LOCUS_05070 37465 37112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 37706 38659 gene locus_tag LOCUS_05080 37706 38659 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_05080 38749 38824 gene locus_tag LOCUS_t00070 38749 38824 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39555 40367 gene locus_tag LOCUS_05090 39555 40367 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_05090 41736 40462 gene locus_tag LOCUS_05100 41736 40462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 42366 45662 gene locus_tag LOCUS_05110 42366 45662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 48498 45760 gene locus_tag LOCUS_05120 48498 45760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 51943 48719 gene locus_tag LOCUS_05130 51943 48719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 55798 52241 gene locus_tag LOCUS_05140 55798 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 59203 56177 gene locus_tag LOCUS_05150 59203 56177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 59625 60302 gene locus_tag LOCUS_05160 59625 60302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 61248 60514 gene locus_tag LOCUS_05170 61248 60514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 62012 61245 gene locus_tag LOCUS_05180 62012 61245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 63345 62071 gene locus_tag LOCUS_05190 63345 62071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730217.1 protein_id gnl|my_center|LOCUS_05190 63818 63441 gene locus_tag LOCUS_05200 63818 63441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 64119 64769 gene locus_tag LOCUS_05210 64119 64769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 64936 64745 gene locus_tag LOCUS_05220 64936 64745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 64996 65994 gene locus_tag LOCUS_05230 64996 65994 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_05230 66053 68434 gene locus_tag LOCUS_05240 66053 68434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 69487 68447 gene locus_tag LOCUS_05250 gene mtnA 69487 68447 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_05250 72954 69595 gene locus_tag LOCUS_05260 72954 69595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 73155 74120 gene locus_tag LOCUS_05270 73155 74120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 74129 74551 gene locus_tag LOCUS_05280 74129 74551 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_05280 74570 75757 gene locus_tag LOCUS_05290 74570 75757 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence007 2217 556 gene locus_tag LOCUS_05300 2217 556 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_05300 2581 3789 gene locus_tag LOCUS_05310 gene glgA 2581 3789 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_05310 4140 3907 gene locus_tag LOCUS_05320 4140 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4272 4532 gene locus_tag LOCUS_05330 4272 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4810 4547 gene locus_tag LOCUS_05340 4810 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5727 5032 gene locus_tag LOCUS_05350 5727 5032 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_05350 6433 5750 gene locus_tag LOCUS_05360 6433 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7288 6635 gene locus_tag LOCUS_05370 7288 6635 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_05370 7742 7515 gene locus_tag LOCUS_05380 7742 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8660 8331 gene locus_tag LOCUS_05390 8660 8331 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 protein_id gnl|my_center|LOCUS_05390 8920 10581 gene locus_tag LOCUS_05400 8920 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_05400 11430 11927 gene locus_tag LOCUS_05410 11430 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 12132 12842 gene locus_tag LOCUS_05420 12132 12842 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_05420 12848 13159 gene locus_tag LOCUS_05430 12848 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 13288 13863 gene locus_tag LOCUS_05440 13288 13863 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_05440 14716 13979 gene locus_tag LOCUS_05450 14716 13979 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_05450 16421 14871 gene locus_tag LOCUS_05460 16421 14871 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_05460 17118 16462 gene locus_tag LOCUS_05470 17118 16462 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_05470 18867 17482 gene locus_tag LOCUS_05480 gene lpdA 18867 17482 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041217.1 protein_id gnl|my_center|LOCUS_05480 21342 19393 gene locus_tag LOCUS_05490 21342 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 23726 22044 gene locus_tag LOCUS_05500 23726 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 24325 26154 gene locus_tag LOCUS_05510 gene rpoD 24325 26154 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_05510 26292 26966 gene locus_tag LOCUS_05520 26292 26966 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_05520 26963 28381 gene locus_tag LOCUS_05530 26963 28381 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_05530 28661 29902 gene locus_tag LOCUS_05540 28661 29902 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545267.1 protein_id gnl|my_center|LOCUS_05540 30215 30646 gene locus_tag LOCUS_05550 gene arfB 30215 30646 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_05550 30677 32758 gene locus_tag LOCUS_05560 30677 32758 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_05560 33013 33729 gene locus_tag LOCUS_05570 33013 33729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 33870 35051 gene locus_tag LOCUS_05580 gene hemW 33870 35051 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_05580 35709 37142 gene locus_tag LOCUS_05590 35709 37142 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_05590 37292 37744 gene locus_tag LOCUS_05600 gene aroQ 37292 37744 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_05600 37784 38344 gene locus_tag LOCUS_05610 gene efp 37784 38344 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_05610 38387 38851 gene locus_tag LOCUS_05620 gene accB 38387 38851 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_05620 38943 40292 gene locus_tag LOCUS_05630 gene accC 38943 40292 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_05630 40289 40942 gene locus_tag LOCUS_05640 gene thiE 40289 40942 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_05640 41669 40923 gene locus_tag LOCUS_05650 gene bioD 41669 40923 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_05650 42284 41700 gene locus_tag LOCUS_05660 42284 41700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 42660 43655 gene locus_tag LOCUS_05670 42660 43655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 46538 43548 gene locus_tag LOCUS_05680 46538 43548 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_05680 47508 46621 gene locus_tag LOCUS_05690 47508 46621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 48691 47873 gene locus_tag LOCUS_05700 48691 47873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 49236 49718 gene locus_tag LOCUS_05710 49236 49718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 50052 49759 gene locus_tag LOCUS_05720 50052 49759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 50315 51337 gene locus_tag LOCUS_05730 50315 51337 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_05730 51838 52794 gene locus_tag LOCUS_05740 51838 52794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 53015 53103 gene locus_tag LOCUS_t00080 53015 53103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54141 53851 gene locus_tag LOCUS_05750 54141 53851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 54593 54180 gene locus_tag LOCUS_05760 54593 54180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 56113 55166 gene locus_tag LOCUS_05770 56113 55166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 56643 56410 gene locus_tag LOCUS_05780 56643 56410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 56925 56722 gene locus_tag LOCUS_05790 56925 56722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 57781 57368 gene locus_tag LOCUS_05800 57781 57368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 59504 59325 gene locus_tag LOCUS_05810 59504 59325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 59909 60199 gene locus_tag LOCUS_05820 59909 60199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 60276 60650 gene locus_tag LOCUS_05830 60276 60650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 61183 62283 gene locus_tag LOCUS_05840 61183 62283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527095.1 protein_id gnl|my_center|LOCUS_05840 62412 63140 gene locus_tag LOCUS_05850 62412 63140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_05850 63137 63934 gene locus_tag LOCUS_05860 63137 63934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05860 64083 65009 gene locus_tag LOCUS_05870 64083 65009 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_05870 64985 65914 gene locus_tag LOCUS_05880 64985 65914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 66030 66560 gene locus_tag LOCUS_05890 gene def 66030 66560 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_05890 66679 68403 gene locus_tag LOCUS_05900 66679 68403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_05900 68774 68965 gene locus_tag LOCUS_05910 68774 68965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 68987 69526 gene locus_tag LOCUS_05920 68987 69526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 70676 69546 gene locus_tag LOCUS_05930 gene lpxD 70676 69546 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_05930 71044 70673 gene locus_tag LOCUS_05940 71044 70673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 72294 71041 gene locus_tag LOCUS_05950 gene fabF 72294 71041 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_05950 72752 73204 gene locus_tag LOCUS_05960 gene cynS 72752 73204 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103774.1 protein_id gnl|my_center|LOCUS_05960 73959 73591 gene locus_tag LOCUS_05970 73959 73591 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_05970 74393 75526 gene locus_tag LOCUS_05980 74393 75526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence008 107 1237 gene locus_tag LOCUS_05990 107 1237 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_05990 1295 1474 gene locus_tag LOCUS_06000 1295 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1471 1851 gene locus_tag LOCUS_06010 1471 1851 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969671.1 protein_id gnl|my_center|LOCUS_06010 1918 3669 gene locus_tag LOCUS_06020 1918 3669 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533218.1 protein_id gnl|my_center|LOCUS_06020 4002 5105 gene locus_tag LOCUS_06030 4002 5105 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548064.1 protein_id gnl|my_center|LOCUS_06030 5183 8128 gene locus_tag LOCUS_06040 5183 8128 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_06040 8228 8431 gene locus_tag LOCUS_06050 8228 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8669 8514 gene locus_tag LOCUS_06060 8669 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9749 8712 gene locus_tag LOCUS_06070 9749 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10560 9898 gene locus_tag LOCUS_06080 10560 9898 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931060.1 protein_id gnl|my_center|LOCUS_06080 11194 10529 gene locus_tag LOCUS_06090 11194 10529 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040016.1 protein_id gnl|my_center|LOCUS_06090 12472 11951 gene locus_tag LOCUS_06100 12472 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12836 13759 gene locus_tag LOCUS_06110 12836 13759 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171431162.1 protein_id gnl|my_center|LOCUS_06110 14620 14054 gene locus_tag LOCUS_06120 gene ahpC 14620 14054 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761950.1 protein_id gnl|my_center|LOCUS_06120 14937 17063 gene locus_tag LOCUS_06130 14937 17063 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533213.1 protein_id gnl|my_center|LOCUS_06130 17237 18985 gene locus_tag LOCUS_06140 17237 18985 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251940.1 protein_id gnl|my_center|LOCUS_06140 19841 20710 gene locus_tag LOCUS_06150 19841 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 20970 21194 gene locus_tag LOCUS_06160 20970 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 21542 21204 gene locus_tag LOCUS_06170 21542 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 21723 25637 gene locus_tag LOCUS_06180 21723 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 25832 26980 gene locus_tag LOCUS_06190 25832 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_06190 27566 28081 gene locus_tag LOCUS_06200 27566 28081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 28132 28524 gene locus_tag LOCUS_06210 28132 28524 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227043.1 protein_id gnl|my_center|LOCUS_06210 28500 29378 gene locus_tag LOCUS_06220 28500 29378 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337447.1 protein_id gnl|my_center|LOCUS_06220 29561 30562 gene locus_tag LOCUS_06230 29561 30562 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 protein_id gnl|my_center|LOCUS_06230 30671 31282 gene locus_tag LOCUS_06240 30671 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 31887 32192 gene locus_tag LOCUS_06250 31887 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 34956 32257 gene locus_tag LOCUS_06260 gene ligD 34956 32257 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_06260 35844 34984 gene locus_tag LOCUS_06270 35844 34984 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958550.1 protein_id gnl|my_center|LOCUS_06270 36540 36046 gene locus_tag LOCUS_06280 36540 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 36760 36596 gene locus_tag LOCUS_06290 36760 36596 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_06290 37277 36885 gene locus_tag LOCUS_06300 37277 36885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 37934 37752 gene locus_tag LOCUS_06310 37934 37752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 38557 37982 gene locus_tag LOCUS_06320 38557 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 39370 38603 gene locus_tag LOCUS_06330 39370 38603 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_06330 40959 39583 gene locus_tag LOCUS_06340 40959 39583 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_06340 42196 41048 gene locus_tag LOCUS_06350 42196 41048 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_06350 43012 42347 gene locus_tag LOCUS_06360 43012 42347 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_06360 43301 43906 gene locus_tag LOCUS_06370 43301 43906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 44582 44193 gene locus_tag LOCUS_06380 44582 44193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 45073 44615 gene locus_tag LOCUS_06390 45073 44615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 45377 45820 gene locus_tag LOCUS_06400 45377 45820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 45903 46418 gene locus_tag LOCUS_06410 45903 46418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 46431 48626 gene locus_tag LOCUS_06420 46431 48626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 48626 49363 gene locus_tag LOCUS_06430 48626 49363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 49360 50688 gene locus_tag LOCUS_06440 gene nrfD 49360 50688 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_06440 50705 51220 gene locus_tag LOCUS_06450 50705 51220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 51233 51748 gene locus_tag LOCUS_06460 51233 51748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 51777 52952 gene locus_tag LOCUS_06470 51777 52952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 52949 54313 gene locus_tag LOCUS_06480 52949 54313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 54838 56187 gene locus_tag LOCUS_06490 gene mgtE 54838 56187 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259555.1 protein_id gnl|my_center|LOCUS_06490 56373 56846 gene locus_tag LOCUS_06500 56373 56846 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_06500 57345 58811 gene locus_tag LOCUS_06510 57345 58811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 58867 59220 gene locus_tag LOCUS_06520 58867 59220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 59585 60934 gene locus_tag LOCUS_06530 59585 60934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 61978 60998 gene locus_tag LOCUS_06540 61978 60998 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_06540 64080 62551 gene locus_tag LOCUS_06550 64080 62551 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_06550 64755 64378 gene locus_tag LOCUS_06560 64755 64378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06560 65004 64777 gene locus_tag LOCUS_06570 65004 64777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06570 66387 65449 gene locus_tag LOCUS_06580 66387 65449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 68047 66443 gene locus_tag LOCUS_06590 68047 66443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 69386 70051 gene locus_tag LOCUS_06600 69386 70051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 70216 70752 gene locus_tag LOCUS_06610 70216 70752 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057492.1 protein_id gnl|my_center|LOCUS_06610 70858 71994 gene locus_tag LOCUS_06620 70858 71994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 73200 72820 gene locus_tag LOCUS_06630 73200 72820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 73569 73360 gene locus_tag LOCUS_06640 73569 73360 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384941.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence009 1199 966 gene locus_tag LOCUS_06650 1199 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2893 2159 gene locus_tag LOCUS_06660 2893 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3522 4223 gene locus_tag LOCUS_06670 3522 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4345 4515 gene locus_tag LOCUS_06680 4345 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4551 5093 gene locus_tag LOCUS_06690 4551 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5351 5539 gene locus_tag LOCUS_06700 5351 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5768 6142 gene locus_tag LOCUS_06710 5768 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6400 7665 gene locus_tag LOCUS_06720 6400 7665 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_06720 7985 8404 gene locus_tag LOCUS_06730 7985 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8405 8590 gene locus_tag LOCUS_06740 8405 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 8584 8784 gene locus_tag LOCUS_06750 8584 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8766 9233 gene locus_tag LOCUS_06760 8766 9233 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336909.1 protein_id gnl|my_center|LOCUS_06760 9244 11829 gene locus_tag LOCUS_06770 9244 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 12038 11850 gene locus_tag LOCUS_06780 12038 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 12140 12292 gene locus_tag LOCUS_06790 12140 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 12294 12647 gene locus_tag LOCUS_06800 12294 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 12680 12928 gene locus_tag LOCUS_06810 12680 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 12931 14061 gene locus_tag LOCUS_06820 12931 14061 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_06820 14152 14076 gene locus_tag LOCUS_t00090 14152 14076 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14765 14130 gene locus_tag LOCUS_06830 14765 14130 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_06830 15523 14780 gene locus_tag LOCUS_06840 gene rph 15523 14780 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_06840 15891 17168 gene locus_tag LOCUS_06850 gene serS 15891 17168 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_06850 17179 18186 gene locus_tag LOCUS_06860 17179 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 18197 18284 gene locus_tag LOCUS_t00100 18197 18284 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19033 19896 gene locus_tag LOCUS_06870 19033 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 19896 20117 gene locus_tag LOCUS_06880 19896 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 20406 20498 gene locus_tag LOCUS_t00110 20406 20498 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 21736 20618 gene locus_tag LOCUS_06890 21736 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 29654 22128 gene locus_tag LOCUS_06900 29654 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 25116 25187 gene locus_tag LOCUS_t00120 25116 25187 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 31966 29666 gene locus_tag LOCUS_06910 31966 29666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 35331 32035 gene locus_tag LOCUS_06920 35331 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36262 35324 gene locus_tag LOCUS_06930 36262 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 36998 36624 gene locus_tag LOCUS_06940 gene tnpA 36998 36624 CDS product IS200/IS605-like element ISDra2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887312.1 protein_id gnl|my_center|LOCUS_06940 37291 36938 gene locus_tag LOCUS_06950 37291 36938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 37452 37664 gene locus_tag LOCUS_06960 37452 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 37661 37951 gene locus_tag LOCUS_06970 37661 37951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06970 38139 39782 gene locus_tag LOCUS_06980 38139 39782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 39982 39818 gene locus_tag LOCUS_06990 39982 39818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 40507 42270 gene locus_tag LOCUS_07000 40507 42270 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_07000 42807 42379 gene locus_tag LOCUS_07010 42807 42379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 43545 42865 gene locus_tag LOCUS_07020 gene queC 43545 42865 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545080.1 protein_id gnl|my_center|LOCUS_07020 44264 43749 gene locus_tag LOCUS_07030 44264 43749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 44889 44377 gene locus_tag LOCUS_07040 44889 44377 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_07040 45299 44973 gene locus_tag LOCUS_07050 45299 44973 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_07050 46832 45306 gene locus_tag LOCUS_07060 gene hemY 46832 45306 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 protein_id gnl|my_center|LOCUS_07060 48032 47079 gene locus_tag LOCUS_07070 gene hemE 48032 47079 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_07070 48714 48280 gene locus_tag LOCUS_07080 48714 48280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 48979 48776 gene locus_tag LOCUS_07090 48979 48776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 49212 49033 gene locus_tag LOCUS_07100 49212 49033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 49418 49711 gene locus_tag LOCUS_07110 49418 49711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 49897 50793 gene locus_tag LOCUS_07120 49897 50793 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_07120 50918 52336 gene locus_tag LOCUS_07130 50918 52336 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_07130 52388 54328 gene locus_tag LOCUS_07140 gene oadA 52388 54328 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545036.1 protein_id gnl|my_center|LOCUS_07140 54331 55284 gene locus_tag LOCUS_07150 54331 55284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_07150 55396 56049 gene locus_tag LOCUS_07160 gene tpx 55396 56049 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256026.1 protein_id gnl|my_center|LOCUS_07160 56091 56759 gene locus_tag LOCUS_07170 gene tenA 56091 56759 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144509.1 protein_id gnl|my_center|LOCUS_07170 56868 57575 gene locus_tag LOCUS_07180 56868 57575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 57635 58024 gene locus_tag LOCUS_07190 57635 58024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 58133 58738 gene locus_tag LOCUS_07200 58133 58738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 59059 61452 gene locus_tag LOCUS_07210 59059 61452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 61430 61969 gene locus_tag LOCUS_07220 61430 61969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 61963 62370 gene locus_tag LOCUS_07230 61963 62370 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_07230 62378 63307 gene locus_tag LOCUS_07240 62378 63307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 63307 64512 gene locus_tag LOCUS_07250 63307 64512 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_07250 64543 66270 gene locus_tag LOCUS_07260 64543 66270 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_07260 66270 67448 gene locus_tag LOCUS_07270 66270 67448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 67445 68056 gene locus_tag LOCUS_07280 67445 68056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 68053 68628 gene locus_tag LOCUS_07290 68053 68628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 68628 69227 gene locus_tag LOCUS_07300 68628 69227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 69348 70022 gene locus_tag LOCUS_07310 69348 70022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 71371 70307 gene locus_tag LOCUS_07320 71371 70307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 71524 72162 gene locus_tag LOCUS_07330 gene coaE 71524 72162 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_07330 72201 73124 gene locus_tag LOCUS_07340 gene trxB 72201 73124 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence010 1939 1043 gene locus_tag LOCUS_07350 1939 1043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097732.1 protein_id gnl|my_center|LOCUS_07350 3995 2001 gene locus_tag LOCUS_07360 3995 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4732 5085 gene locus_tag LOCUS_07370 4732 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6287 6451 gene locus_tag LOCUS_07380 6287 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6753 6965 gene locus_tag LOCUS_07390 6753 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7673 9925 gene locus_tag LOCUS_07400 7673 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11098 10196 gene locus_tag LOCUS_07410 11098 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 11641 11904 gene locus_tag LOCUS_07420 11641 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13635 12376 gene locus_tag LOCUS_07430 13635 12376 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_07430 15930 14851 gene locus_tag LOCUS_07440 15930 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 17981 15969 gene locus_tag LOCUS_07450 17981 15969 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_07450 18146 19045 gene locus_tag LOCUS_07460 18146 19045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 19157 21310 gene locus_tag LOCUS_07470 gene glgP 19157 21310 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_07470 21574 21999 gene locus_tag LOCUS_07480 21574 21999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 22149 22000 gene locus_tag LOCUS_07490 22149 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 23098 22226 gene locus_tag LOCUS_07500 23098 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 23340 23140 gene locus_tag LOCUS_07510 23340 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 24005 23544 gene locus_tag LOCUS_07520 24005 23544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 25412 24549 gene locus_tag LOCUS_07530 25412 24549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 26431 25517 gene locus_tag LOCUS_07540 26431 25517 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_07540 27357 26437 gene locus_tag LOCUS_07550 gene mtnP 27357 26437 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_07550 28543 27536 gene locus_tag LOCUS_07560 gene miaA 28543 27536 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_07560 30272 28557 gene locus_tag LOCUS_07570 gene mutL 30272 28557 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968841.1 protein_id gnl|my_center|LOCUS_07570 31305 30400 gene locus_tag LOCUS_07580 gene ybgF 31305 30400 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947758.1 protein_id gnl|my_center|LOCUS_07580 33125 31455 gene locus_tag LOCUS_07590 33125 31455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 34275 33286 gene locus_tag LOCUS_07600 34275 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 35678 34320 gene locus_tag LOCUS_07610 gene tolB 35678 34320 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_07610 36311 35697 gene locus_tag LOCUS_07620 36311 35697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 37642 37202 gene locus_tag LOCUS_07630 gene tolR 37642 37202 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_07630 38358 37639 gene locus_tag LOCUS_07640 gene tolQ 38358 37639 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_07640 38521 38443 gene locus_tag LOCUS_t00130 38521 38443 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 38714 38639 gene locus_tag LOCUS_t00140 38714 38639 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38897 39706 gene locus_tag LOCUS_07650 38897 39706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 41725 39740 gene locus_tag LOCUS_07660 41725 39740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 43857 41908 gene locus_tag LOCUS_07670 43857 41908 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_07670 44210 43866 gene locus_tag LOCUS_07680 44210 43866 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 protein_id gnl|my_center|LOCUS_07680 44657 45217 gene locus_tag LOCUS_07690 44657 45217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 45648 46241 gene locus_tag LOCUS_07700 45648 46241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 48006 46612 gene locus_tag LOCUS_07710 gene sthA 48006 46612 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175071.1 protein_id gnl|my_center|LOCUS_07710 48866 48003 gene locus_tag LOCUS_07720 48866 48003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 49402 49572 gene locus_tag LOCUS_07730 49402 49572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 49553 50272 gene locus_tag LOCUS_07740 49553 50272 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_07740 50610 50401 gene locus_tag LOCUS_07750 50610 50401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 51837 51541 gene locus_tag LOCUS_07760 51837 51541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 53466 52297 gene locus_tag LOCUS_07770 53466 52297 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_07770 54363 54013 gene locus_tag LOCUS_tm00010 54363 54013 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 54758 55078 gene locus_tag LOCUS_07780 gene sugE 54758 55078 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_07780 55439 58324 gene locus_tag LOCUS_07790 55439 58324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 60407 58605 gene locus_tag LOCUS_07800 60407 58605 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_07800 61276 60476 gene locus_tag LOCUS_07810 61276 60476 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_07810 62361 61273 gene locus_tag LOCUS_07820 gene trpD 62361 61273 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_07820 62789 62376 gene locus_tag LOCUS_07830 62789 62376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 63504 62866 gene locus_tag LOCUS_07840 63504 62866 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141655.1 protein_id gnl|my_center|LOCUS_07840 66099 63589 gene locus_tag LOCUS_07850 66099 63589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 66656 66198 gene locus_tag LOCUS_07860 66656 66198 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_07860 66946 67308 gene locus_tag LOCUS_07870 66946 67308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 68520 69311 gene locus_tag LOCUS_07880 68520 69311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 69324 69752 gene locus_tag LOCUS_07890 69324 69752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 69836 70543 gene locus_tag LOCUS_07900 69836 70543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 70969 70583 gene locus_tag LOCUS_07910 70969 70583 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence011 969 262 gene locus_tag LOCUS_07920 969 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1996 1085 gene locus_tag LOCUS_07930 1996 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3605 2454 gene locus_tag LOCUS_07940 3605 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4018 3686 gene locus_tag LOCUS_07950 4018 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4749 4408 gene locus_tag LOCUS_07960 4749 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6951 4978 gene locus_tag LOCUS_07970 6951 4978 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_07970 7652 7293 gene locus_tag LOCUS_07980 7652 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8009 8866 gene locus_tag LOCUS_07990 8009 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9009 10538 gene locus_tag LOCUS_08000 9009 10538 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_08000 11484 10696 gene locus_tag LOCUS_08010 11484 10696 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_08010 12285 12911 gene locus_tag LOCUS_08020 12285 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 13957 13223 gene locus_tag LOCUS_08030 gene truA 13957 13223 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_08030 15337 14102 gene locus_tag LOCUS_08040 15337 14102 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_08040 15482 16027 gene locus_tag LOCUS_08050 15482 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 16793 16011 gene locus_tag LOCUS_08060 16793 16011 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_08060 16897 17439 gene locus_tag LOCUS_08070 16897 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 18392 17436 gene locus_tag LOCUS_08080 gene czcD 18392 17436 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 protein_id gnl|my_center|LOCUS_08080 18848 18540 gene locus_tag LOCUS_08090 18848 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 19138 18881 gene locus_tag LOCUS_08100 19138 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 22041 19135 gene locus_tag LOCUS_08110 22041 19135 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942996.1 protein_id gnl|my_center|LOCUS_08110 23344 22052 gene locus_tag LOCUS_08120 gene glgC 23344 22052 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_08120 23632 23351 gene locus_tag LOCUS_08130 23632 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 23689 25893 gene locus_tag LOCUS_08140 gene glgB 23689 25893 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_08140 27915 26038 gene locus_tag LOCUS_08150 gene treZ 27915 26038 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_08150 28121 30256 gene locus_tag LOCUS_08160 gene glgX 28121 30256 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_08160 30631 30404 gene locus_tag LOCUS_08170 30631 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 31026 30700 gene locus_tag LOCUS_08180 31026 30700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 31573 33798 gene locus_tag LOCUS_08190 gene malQ 31573 33798 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389297.1 protein_id gnl|my_center|LOCUS_08190 34006 34854 gene locus_tag LOCUS_08200 34006 34854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 34858 35694 gene locus_tag LOCUS_08210 34858 35694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 35691 37025 gene locus_tag LOCUS_08220 gene mgtE 35691 37025 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_08220 37200 37967 gene locus_tag LOCUS_08230 37200 37967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 38271 39740 gene locus_tag LOCUS_08240 38271 39740 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_08240 40529 39894 gene locus_tag LOCUS_08250 40529 39894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 41053 40607 gene locus_tag LOCUS_08260 41053 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 41430 41050 gene locus_tag LOCUS_08270 41430 41050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 42041 43585 gene locus_tag LOCUS_08280 42041 43585 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_08280 44991 43957 gene locus_tag LOCUS_08290 gene cydB 44991 43957 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_08290 46346 45003 gene locus_tag LOCUS_08300 46346 45003 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598577.1 protein_id gnl|my_center|LOCUS_08300 46525 46782 gene locus_tag LOCUS_08310 46525 46782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 48294 46888 gene locus_tag LOCUS_08320 gene sthA 48294 46888 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_08320 50236 48704 gene locus_tag LOCUS_08330 50236 48704 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_08330 51608 50328 gene locus_tag LOCUS_08340 51608 50328 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_08340 54798 51613 gene locus_tag LOCUS_08350 54798 51613 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_08350 57462 56056 gene locus_tag LOCUS_08360 gene zwf 57462 56056 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_08360 58486 57464 gene locus_tag LOCUS_08370 gene gnd 58486 57464 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_08370 60614 58530 gene locus_tag LOCUS_08380 gene tkt 60614 58530 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_08380 63430 61442 gene locus_tag LOCUS_08390 63430 61442 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_08390 66904 63572 gene locus_tag LOCUS_08400 gene treS 66904 63572 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_08400 67952 67089 gene locus_tag LOCUS_08410 67952 67089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 68617 68198 gene locus_tag LOCUS_08420 68617 68198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence012 242 553 gene locus_tag LOCUS_08430 gene rpsJ 242 553 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_08430 559 1230 gene locus_tag LOCUS_08440 gene rplC 559 1230 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_08440 1230 1859 gene locus_tag LOCUS_08450 gene rplD 1230 1859 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_08450 1861 2148 gene locus_tag LOCUS_08460 gene rplW 1861 2148 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_08460 2240 3034 gene locus_tag LOCUS_08470 gene rplB 2240 3034 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_08470 3050 3337 gene locus_tag LOCUS_08480 gene rpsS 3050 3337 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_08480 3392 3730 gene locus_tag LOCUS_08490 gene rplV 3392 3730 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_08490 3779 4444 gene locus_tag LOCUS_08500 gene rpsC 3779 4444 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_08500 4482 4904 gene locus_tag LOCUS_08510 gene rplP 4482 4904 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_08510 4914 5102 gene locus_tag LOCUS_08520 gene rpmC 4914 5102 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_08520 5193 5402 gene locus_tag LOCUS_08530 5193 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5461 5829 gene locus_tag LOCUS_08540 gene rplN 5461 5829 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603030.1 protein_id gnl|my_center|LOCUS_08540 5841 6173 gene locus_tag LOCUS_08550 gene rplX 5841 6173 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459102.1 protein_id gnl|my_center|LOCUS_08550 6173 6799 gene locus_tag LOCUS_08560 gene rplE 6173 6799 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143903.1 protein_id gnl|my_center|LOCUS_08560 7066 7473 gene locus_tag LOCUS_08570 gene rpsH 7066 7473 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_08570 7519 8058 gene locus_tag LOCUS_08580 gene rplF 7519 8058 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_08580 8478 8972 gene locus_tag LOCUS_08590 gene rpsE 8478 8972 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545629.1 protein_id gnl|my_center|LOCUS_08590 9010 9195 gene locus_tag LOCUS_08600 gene rpmD 9010 9195 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_08600 9195 9644 gene locus_tag LOCUS_08610 gene rplO 9195 9644 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_08610 9637 10950 gene locus_tag LOCUS_08620 gene secY 9637 10950 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_08620 10943 11605 gene locus_tag LOCUS_08630 10943 11605 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_08630 11607 12353 gene locus_tag LOCUS_08640 gene map 11607 12353 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_08640 12384 12602 gene locus_tag LOCUS_08650 gene infA 12384 12602 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_08650 12787 13158 gene locus_tag LOCUS_08660 gene rpsM 12787 13158 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_08660 13179 13562 gene locus_tag LOCUS_08670 gene rpsK 13179 13562 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_08670 13627 14256 gene locus_tag LOCUS_08680 gene rpsD 13627 14256 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_08680 14336 15322 gene locus_tag LOCUS_08690 14336 15322 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_08690 15345 15743 gene locus_tag LOCUS_08700 15345 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 15931 16509 gene locus_tag LOCUS_08710 15931 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 16623 17030 gene locus_tag LOCUS_08720 16623 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 17240 17992 gene locus_tag LOCUS_08730 gene lptB 17240 17992 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_08730 18013 19530 gene locus_tag LOCUS_08740 gene rpoN 18013 19530 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_08740 19665 20582 gene locus_tag LOCUS_08750 gene rapZ 19665 20582 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_08750 21114 22184 gene locus_tag LOCUS_08760 21114 22184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 22162 22740 gene locus_tag LOCUS_08770 22162 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 22740 23330 gene locus_tag LOCUS_08780 22740 23330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 24162 25322 gene locus_tag LOCUS_08790 gene aroC 24162 25322 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_08790 25402 26568 gene locus_tag LOCUS_08800 gene aroB 25402 26568 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_08800 26570 27823 gene locus_tag LOCUS_08810 26570 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 27995 29788 gene locus_tag LOCUS_08820 27995 29788 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_08820 29832 32537 gene locus_tag LOCUS_08830 gene glnD 29832 32537 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_08830 33364 33173 gene locus_tag LOCUS_08840 33364 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 34526 33357 gene locus_tag LOCUS_08850 34526 33357 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942743.1 protein_id gnl|my_center|LOCUS_08850 35106 34579 gene locus_tag LOCUS_08860 35106 34579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 36465 36941 gene locus_tag LOCUS_08870 gene bfr 36465 36941 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_08870 37026 37502 gene locus_tag LOCUS_08880 gene bfr 37026 37502 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 protein_id gnl|my_center|LOCUS_08880 38591 38385 gene locus_tag LOCUS_08890 38591 38385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 38574 38670 gene locus_tag LOCUS_t00150 38574 38670 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39185 38634 gene locus_tag LOCUS_08900 39185 38634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 41417 39582 gene locus_tag LOCUS_08910 41417 39582 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929380.1 protein_id gnl|my_center|LOCUS_08910 42875 42363 gene locus_tag LOCUS_08920 42875 42363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 43578 42892 gene locus_tag LOCUS_08930 43578 42892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 43937 43560 gene locus_tag LOCUS_08940 43937 43560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 45704 44307 gene locus_tag LOCUS_08950 45704 44307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 46244 46798 gene locus_tag LOCUS_08960 46244 46798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 46864 47868 gene locus_tag LOCUS_08970 46864 47868 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_08970 48601 47942 gene locus_tag LOCUS_08980 48601 47942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 48821 49018 gene locus_tag LOCUS_08990 48821 49018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 49360 48926 gene locus_tag LOCUS_09000 49360 48926 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_09000 49474 50034 gene locus_tag LOCUS_09010 49474 50034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 50485 50159 gene locus_tag LOCUS_09020 50485 50159 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008572623.1 protein_id gnl|my_center|LOCUS_09020 52213 50651 gene locus_tag LOCUS_09030 52213 50651 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_09030 52496 53185 gene locus_tag LOCUS_09040 52496 53185 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_09040 53387 55363 gene locus_tag LOCUS_09050 53387 55363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 55450 56619 gene locus_tag LOCUS_09060 55450 56619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 56654 57781 gene locus_tag LOCUS_09070 56654 57781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 58592 57834 gene locus_tag LOCUS_09080 58592 57834 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087019.1 protein_id gnl|my_center|LOCUS_09080 60070 59882 gene locus_tag LOCUS_09090 60070 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 60203 60607 gene locus_tag LOCUS_09100 60203 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 60607 61545 gene locus_tag LOCUS_09110 60607 61545 CDS product CBASS oligonucleotide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393718.1 protein_id gnl|my_center|LOCUS_09110 62167 62808 gene locus_tag LOCUS_09120 62167 62808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 64038 63739 gene locus_tag LOCUS_09130 64038 63739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence013 476 1699 gene locus_tag LOCUS_09140 476 1699 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 protein_id gnl|my_center|LOCUS_09140 1843 3300 gene locus_tag LOCUS_09150 1843 3300 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479713.1 protein_id gnl|my_center|LOCUS_09150 3606 5972 gene locus_tag LOCUS_09160 3606 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6079 6831 gene locus_tag LOCUS_09170 6079 6831 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_09170 7048 7290 gene locus_tag LOCUS_09180 7048 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 7508 7831 gene locus_tag LOCUS_09190 7508 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7935 11096 gene locus_tag LOCUS_09200 7935 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 11114 11524 gene locus_tag LOCUS_09210 11114 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 11567 12514 gene locus_tag LOCUS_09220 gene mdh 11567 12514 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_09220 12787 14082 gene locus_tag LOCUS_09230 gene nuoF 12787 14082 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_09230 14095 14421 gene locus_tag LOCUS_09240 gene fdx 14095 14421 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417920.1 protein_id gnl|my_center|LOCUS_09240 14510 14989 gene locus_tag LOCUS_09250 14510 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 14989 15642 gene locus_tag LOCUS_09260 gene folE 14989 15642 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_09260 16753 15959 gene locus_tag LOCUS_09270 16753 15959 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_09270 16929 18266 gene locus_tag LOCUS_09280 16929 18266 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_09280 18697 19167 gene locus_tag LOCUS_09290 18697 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 21103 19241 gene locus_tag LOCUS_09300 21103 19241 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_09300 21264 21189 gene locus_tag LOCUS_t00160 21264 21189 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21449 22756 gene locus_tag LOCUS_09310 21449 22756 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_09310 22833 22908 gene locus_tag LOCUS_t00170 22833 22908 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23451 24155 gene locus_tag LOCUS_09320 23451 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 25908 24340 gene locus_tag LOCUS_09330 25908 24340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 26092 26853 gene locus_tag LOCUS_09340 26092 26853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 27939 27010 gene locus_tag LOCUS_09350 27939 27010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 28202 28681 gene locus_tag LOCUS_09360 28202 28681 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_09360 28754 29959 gene locus_tag LOCUS_09370 gene nusA 28754 29959 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_09370 29992 32601 gene locus_tag LOCUS_09380 29992 32601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 32627 32914 gene locus_tag LOCUS_09390 32627 32914 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_09390 32935 33354 gene locus_tag LOCUS_09400 gene rbfA 32935 33354 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_09400 33354 34343 gene locus_tag LOCUS_09410 gene truB 33354 34343 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546120.1 protein_id gnl|my_center|LOCUS_09410 34439 34708 gene locus_tag LOCUS_09420 gene rpsO 34439 34708 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_09420 34838 36943 gene locus_tag LOCUS_09430 gene pnp 34838 36943 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_09430 36964 38232 gene locus_tag LOCUS_09440 36964 38232 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_09440 38428 38967 gene locus_tag LOCUS_09450 38428 38967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 39025 39690 gene locus_tag LOCUS_09460 39025 39690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 42424 39779 gene locus_tag LOCUS_09470 gene mutS 42424 39779 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_09470 43119 42592 gene locus_tag LOCUS_09480 gene tsaE 43119 42592 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_09480 44655 43129 gene locus_tag LOCUS_09490 44655 43129 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_09490 45566 44853 gene locus_tag LOCUS_09500 45566 44853 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_09500 45819 47003 gene locus_tag LOCUS_09510 gene alaC 45819 47003 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_09510 47003 48313 gene locus_tag LOCUS_09520 47003 48313 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_09520 48355 49416 gene locus_tag LOCUS_09530 gene thrC 48355 49416 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_09530 49489 50724 gene locus_tag LOCUS_09540 49489 50724 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_09540 50730 51965 gene locus_tag LOCUS_09550 50730 51965 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_09550 51990 53588 gene locus_tag LOCUS_09560 gene cimA 51990 53588 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_09560 53763 54038 gene locus_tag LOCUS_09570 53763 54038 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_09570 54094 54456 gene locus_tag LOCUS_09580 54094 54456 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_09580 54506 54582 gene locus_tag LOCUS_t00180 54506 54582 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 54919 54665 gene locus_tag LOCUS_09590 54919 54665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 55158 55916 gene locus_tag LOCUS_09600 55158 55916 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_09600 56017 56352 gene locus_tag LOCUS_09610 56017 56352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 56345 58084 gene locus_tag LOCUS_09620 56345 58084 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_09620 58954 58412 gene locus_tag LOCUS_09630 58954 58412 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_09630 59061 59519 gene locus_tag LOCUS_09640 59061 59519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 60217 61017 gene locus_tag LOCUS_09650 60217 61017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 61037 61216 gene locus_tag LOCUS_09660 61037 61216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 62069 61380 gene locus_tag LOCUS_09670 62069 61380 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024490.1 protein_id gnl|my_center|LOCUS_09670 63054 63401 gene locus_tag LOCUS_09680 63054 63401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence014 111 701 gene locus_tag LOCUS_09690 111 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 752 1168 gene locus_tag LOCUS_09700 752 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1272 2771 gene locus_tag LOCUS_09710 1272 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3467 4126 gene locus_tag LOCUS_09720 3467 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4289 4774 gene locus_tag LOCUS_09730 4289 4774 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_09730 4843 7200 gene locus_tag LOCUS_09740 4843 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7494 8519 gene locus_tag LOCUS_09750 7494 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 8842 9666 gene locus_tag LOCUS_09760 8842 9666 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_09760 10135 11466 gene locus_tag LOCUS_09770 10135 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11827 13002 gene locus_tag LOCUS_09780 11827 13002 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_09780 13035 14720 gene locus_tag LOCUS_09790 13035 14720 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_09790 14708 15508 gene locus_tag LOCUS_09800 14708 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 15508 16494 gene locus_tag LOCUS_09810 15508 16494 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_09810 16716 17456 gene locus_tag LOCUS_09820 16716 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 17453 19003 gene locus_tag LOCUS_09830 17453 19003 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976176.1 protein_id gnl|my_center|LOCUS_09830 19025 19285 gene locus_tag LOCUS_09840 19025 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 19282 20391 gene locus_tag LOCUS_09850 19282 20391 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_09850 21629 23134 gene locus_tag LOCUS_09860 21629 23134 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_09860 23160 24236 gene locus_tag LOCUS_09870 23160 24236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 24457 24636 gene locus_tag LOCUS_09880 24457 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 25349 26107 gene locus_tag LOCUS_09890 25349 26107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 26241 27248 gene locus_tag LOCUS_09900 26241 27248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 28004 29083 gene locus_tag LOCUS_09910 28004 29083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 30353 31270 gene locus_tag LOCUS_09920 30353 31270 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_09920 31488 32486 gene locus_tag LOCUS_09930 31488 32486 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_09930 32564 33019 gene locus_tag LOCUS_09940 32564 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 33064 34203 gene locus_tag LOCUS_09950 33064 34203 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_09950 34220 34996 gene locus_tag LOCUS_09960 34220 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 35027 36064 gene locus_tag LOCUS_09970 35027 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 36267 38720 gene locus_tag LOCUS_09980 36267 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 38725 39900 gene locus_tag LOCUS_09990 38725 39900 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_09990 40167 41207 gene locus_tag LOCUS_10000 40167 41207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_10000 41228 42394 gene locus_tag LOCUS_10010 41228 42394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314820.1 protein_id gnl|my_center|LOCUS_10010 42458 42649 gene locus_tag LOCUS_10020 42458 42649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 42665 44557 gene locus_tag LOCUS_10030 gene asnB 42665 44557 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_10030 45219 45049 gene locus_tag LOCUS_10040 45219 45049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 45475 46764 gene locus_tag LOCUS_10050 45475 46764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 48919 49431 gene locus_tag LOCUS_10060 48919 49431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 49939 50073 gene locus_tag LOCUS_10070 49939 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 50700 51752 gene locus_tag LOCUS_10080 50700 51752 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_10080 51835 53316 gene locus_tag LOCUS_10090 51835 53316 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942607.1 protein_id gnl|my_center|LOCUS_10090 53867 54730 gene locus_tag LOCUS_10100 53867 54730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 54730 55845 gene locus_tag LOCUS_10110 54730 55845 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626518.1 protein_id gnl|my_center|LOCUS_10110 55955 56221 gene locus_tag LOCUS_10120 55955 56221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10120 56377 57081 gene locus_tag LOCUS_10130 56377 57081 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10130 58900 58676 gene locus_tag LOCUS_10140 58900 58676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 61316 60210 gene locus_tag LOCUS_10150 61316 60210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 62094 61930 gene locus_tag LOCUS_10160 62094 61930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence015 <1 1810 gene locus_tag LOCUS_10170 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941980.1:ATP-dependent DNA helicase RecG 1989 2075 gene locus_tag LOCUS_t00190 1989 2075 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2301 3056 gene locus_tag LOCUS_10180 2301 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3212 3436 gene locus_tag LOCUS_10190 3212 3436 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942005.1 protein_id gnl|my_center|LOCUS_10190 4164 3418 gene locus_tag LOCUS_10200 gene rsmI 4164 3418 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 protein_id gnl|my_center|LOCUS_10200 4712 5521 gene locus_tag LOCUS_10210 gene ccsB 4712 5521 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_10210 5518 6876 gene locus_tag LOCUS_10220 gene hemA 5518 6876 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_10220 6873 7823 gene locus_tag LOCUS_10230 gene hemC 6873 7823 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_10230 7820 9391 gene locus_tag LOCUS_10240 gene cobA 7820 9391 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_10240 9459 9851 gene locus_tag LOCUS_10250 9459 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 9860 10843 gene locus_tag LOCUS_10260 gene hemB 9860 10843 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_10260 10840 11811 gene locus_tag LOCUS_10270 10840 11811 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_10270 11812 13236 gene locus_tag LOCUS_10280 gene tilS 11812 13236 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_10280 13239 13802 gene locus_tag LOCUS_10290 gene hpt 13239 13802 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323640.1 protein_id gnl|my_center|LOCUS_10290 13911 15728 gene locus_tag LOCUS_10300 gene ftsH 13911 15728 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_10300 16175 16963 gene locus_tag LOCUS_10310 gene folP 16175 16963 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_10310 17153 18502 gene locus_tag LOCUS_10320 gene glmM 17153 18502 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_10320 18782 21325 gene locus_tag LOCUS_10330 18782 21325 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_10330 21570 22298 gene locus_tag LOCUS_10340 21570 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 23294 22533 gene locus_tag LOCUS_10350 23294 22533 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020646525.1 protein_id gnl|my_center|LOCUS_10350 27095 23385 gene locus_tag LOCUS_10360 27095 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 27691 27191 gene locus_tag LOCUS_10370 27691 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 27951 28571 gene locus_tag LOCUS_10380 27951 28571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 28958 28608 gene locus_tag LOCUS_10390 gene arsC 28958 28608 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_10390 29095 29457 gene locus_tag LOCUS_10400 29095 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 30533 29679 gene locus_tag LOCUS_10410 30533 29679 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_10410 30861 33290 gene locus_tag LOCUS_10420 30861 33290 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_10420 33398 34447 gene locus_tag LOCUS_10430 gene tsaD 33398 34447 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_10430 34523 36172 gene locus_tag LOCUS_10440 gene hflX 34523 36172 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_10440 36220 36873 gene locus_tag LOCUS_10450 gene nth 36220 36873 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_10450 36870 37748 gene locus_tag LOCUS_10460 36870 37748 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_10460 37778 38383 gene locus_tag LOCUS_10470 gene gmk 37778 38383 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_10470 38464 38832 gene locus_tag LOCUS_10480 38464 38832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 38854 40101 gene locus_tag LOCUS_10490 gene coaBC 38854 40101 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_10490 41924 40524 gene locus_tag LOCUS_10500 gene pyk 41924 40524 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_10500 42592 44907 gene locus_tag LOCUS_10510 42592 44907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 46644 45118 gene locus_tag LOCUS_10520 46644 45118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 46791 47897 gene locus_tag LOCUS_10530 gene iolG 46791 47897 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_10530 49099 47894 gene locus_tag LOCUS_10540 49099 47894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 54645 50053 gene locus_tag LOCUS_10550 54645 50053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 56194 56568 gene locus_tag LOCUS_10560 56194 56568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 56613 56993 gene locus_tag LOCUS_10570 56613 56993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 57433 57741 gene locus_tag LOCUS_10580 57433 57741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 57749 58858 gene locus_tag LOCUS_10590 57749 58858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 59422 59784 gene locus_tag LOCUS_10600 59422 59784 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 protein_id gnl|my_center|LOCUS_10600 59781 60122 gene locus_tag LOCUS_10610 59781 60122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 60623 60372 gene locus_tag LOCUS_10620 60623 60372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 61100 61249 gene locus_tag LOCUS_10630 61100 61249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence016 1878 34 gene locus_tag LOCUS_10640 gene asnB 1878 34 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_10640 3157 2120 gene locus_tag LOCUS_10650 3157 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4727 3387 gene locus_tag LOCUS_10660 4727 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6125 4728 gene locus_tag LOCUS_10670 6125 4728 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_10670 6822 6193 gene locus_tag LOCUS_10680 6822 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7446 7138 gene locus_tag LOCUS_10690 7446 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9319 7481 gene locus_tag LOCUS_10700 9319 7481 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_10700 10437 9319 gene locus_tag LOCUS_10710 10437 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10963 10887 gene locus_tag LOCUS_t00200 10963 10887 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11051 11689 gene locus_tag LOCUS_10720 11051 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12939 11752 gene locus_tag LOCUS_10730 12939 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 14929 12998 gene locus_tag LOCUS_10740 14929 12998 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_10740 15717 14980 gene locus_tag LOCUS_10750 15717 14980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_10750 16831 15875 gene locus_tag LOCUS_10760 16831 15875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_10760 18700 16919 gene locus_tag LOCUS_10770 18700 16919 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_10770 20625 18724 gene locus_tag LOCUS_10780 20625 18724 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_10780 21682 20627 gene locus_tag LOCUS_10790 21682 20627 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_10790 22176 21679 gene locus_tag LOCUS_10800 22176 21679 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_10800 23199 22192 gene locus_tag LOCUS_10810 23199 22192 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_10810 24157 23183 gene locus_tag LOCUS_10820 24157 23183 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_10820 25438 25746 gene locus_tag LOCUS_10830 25438 25746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 26041 25889 gene locus_tag LOCUS_10840 26041 25889 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_10840 26460 26056 gene locus_tag LOCUS_10850 26460 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 28347 26479 gene locus_tag LOCUS_10860 28347 26479 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_10860 29300 28509 gene locus_tag LOCUS_10870 29300 28509 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112467.1 protein_id gnl|my_center|LOCUS_10870 31183 29465 gene locus_tag LOCUS_10880 31183 29465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 31607 31531 gene locus_tag LOCUS_t00210 31607 31531 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31839 32150 gene locus_tag LOCUS_10890 31839 32150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 32927 32487 gene locus_tag LOCUS_10900 32927 32487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 33942 32971 gene locus_tag LOCUS_10910 33942 32971 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_10910 34408 33959 gene locus_tag LOCUS_10920 34408 33959 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_10920 35865 34408 gene locus_tag LOCUS_10930 gene atpD 35865 34408 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_10930 37693 36173 gene locus_tag LOCUS_10940 gene atpA 37693 36173 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_10940 38236 37697 gene locus_tag LOCUS_10950 38236 37697 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067136.1 protein_id gnl|my_center|LOCUS_10950 39520 38369 gene locus_tag LOCUS_10960 gene mnmA 39520 38369 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_10960 39996 39520 gene locus_tag LOCUS_10970 39996 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 40598 40098 gene locus_tag LOCUS_10980 40598 40098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 41614 40757 gene locus_tag LOCUS_10990 41614 40757 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_10990 42362 41592 gene locus_tag LOCUS_11000 gene soj 42362 41592 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_11000 43085 42417 gene locus_tag LOCUS_11010 43085 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 44962 43187 gene locus_tag LOCUS_11020 gene mnmG 44962 43187 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_11020 46555 45095 gene locus_tag LOCUS_11030 gene mnmE 46555 45095 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546495.1 protein_id gnl|my_center|LOCUS_11030 48312 46570 gene locus_tag LOCUS_11040 gene yidC 48312 46570 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_11040 49275 50525 gene locus_tag LOCUS_11050 gene hisS 49275 50525 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_11050 50697 51041 gene locus_tag LOCUS_11060 50697 51041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 51053 51310 gene locus_tag LOCUS_11070 51053 51310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 51553 52965 gene locus_tag LOCUS_11080 gene dnaA 51553 52965 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_11080 52988 54112 gene locus_tag LOCUS_11090 gene dnaN 52988 54112 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_11090 54169 56673 gene locus_tag LOCUS_11100 gene gyrB 54169 56673 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_11100 56776 59277 gene locus_tag LOCUS_11110 gene gyrA 56776 59277 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_11110 59538 60149 gene locus_tag LOCUS_11120 59538 60149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 60609 60073 gene locus_tag LOCUS_11130 60609 60073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence017 291 533 gene locus_tag LOCUS_11140 291 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2626 2291 gene locus_tag LOCUS_11150 2626 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3127 4179 gene locus_tag LOCUS_11160 3127 4179 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_11160 4193 5671 gene locus_tag LOCUS_11170 4193 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6104 6400 gene locus_tag LOCUS_11180 6104 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6973 7560 gene locus_tag LOCUS_11190 6973 7560 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_11190 8241 7588 gene locus_tag LOCUS_11200 8241 7588 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_11200 9265 8651 gene locus_tag LOCUS_11210 9265 8651 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_11210 9498 9983 gene locus_tag LOCUS_11220 9498 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10408 10962 gene locus_tag LOCUS_11230 10408 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11682 11284 gene locus_tag LOCUS_11240 11682 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 13341 11749 gene locus_tag LOCUS_11250 13341 11749 CDS product cytochrome C Snr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103259.1 protein_id gnl|my_center|LOCUS_11250 13880 13398 gene locus_tag LOCUS_11260 13880 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 14296 14111 gene locus_tag LOCUS_11270 14296 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 14676 16139 gene locus_tag LOCUS_11280 14676 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 16154 16597 gene locus_tag LOCUS_11290 16154 16597 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_11290 16594 18576 gene locus_tag LOCUS_11300 16594 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 19308 18586 gene locus_tag LOCUS_11310 19308 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 19692 19312 gene locus_tag LOCUS_11320 19692 19312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 20059 19748 gene locus_tag LOCUS_11330 20059 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 21662 20592 gene locus_tag LOCUS_11340 21662 20592 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_11340 26352 22132 gene locus_tag LOCUS_11350 26352 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 26318 26755 gene locus_tag LOCUS_11360 26318 26755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 27227 26793 gene locus_tag LOCUS_11370 27227 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 28954 27458 gene locus_tag LOCUS_11380 28954 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 33273 29089 gene locus_tag LOCUS_11390 33273 29089 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929092.1 protein_id gnl|my_center|LOCUS_11390 33639 34565 gene locus_tag LOCUS_11400 33639 34565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 34975 34589 gene locus_tag LOCUS_11410 34975 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 36972 36220 gene locus_tag LOCUS_11420 36972 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 37486 37193 gene locus_tag LOCUS_11430 37486 37193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 37785 37606 gene locus_tag LOCUS_11440 37785 37606 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813570.1 protein_id gnl|my_center|LOCUS_11440 38109 37840 gene locus_tag LOCUS_11450 38109 37840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 38384 39562 gene locus_tag LOCUS_11460 38384 39562 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_11460 39599 40489 gene locus_tag LOCUS_11470 39599 40489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 40557 41027 gene locus_tag LOCUS_11480 40557 41027 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 protein_id gnl|my_center|LOCUS_11480 42473 41046 gene locus_tag LOCUS_11490 gene zwf 42473 41046 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 protein_id gnl|my_center|LOCUS_11490 43374 42694 gene locus_tag LOCUS_11500 43374 42694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 44051 43575 gene locus_tag LOCUS_11510 44051 43575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 45175 45969 gene locus_tag LOCUS_11520 45175 45969 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_11520 46361 46011 gene locus_tag LOCUS_11530 46361 46011 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 protein_id gnl|my_center|LOCUS_11530 47351 48082 gene locus_tag LOCUS_11540 47351 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 48543 48184 gene locus_tag LOCUS_11550 48543 48184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 48757 50256 gene locus_tag LOCUS_11560 48757 50256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 50356 50685 gene locus_tag LOCUS_11570 50356 50685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 52451 51057 gene locus_tag LOCUS_11580 52451 51057 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_11580 52985 52494 gene locus_tag LOCUS_11590 52985 52494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 protein_id gnl|my_center|LOCUS_11590 53215 54132 gene locus_tag LOCUS_11600 53215 54132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 54129 54983 gene locus_tag LOCUS_11610 54129 54983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_11610 55301 57085 gene locus_tag LOCUS_11620 55301 57085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11620 57060 57602 gene locus_tag LOCUS_11630 57060 57602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11630 57784 58623 gene locus_tag LOCUS_11640 gene rbsK 57784 58623 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_11640 59049 58678 gene locus_tag LOCUS_11650 59049 58678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 59365 59553 gene locus_tag LOCUS_11660 59365 59553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence018 1798 401 gene locus_tag LOCUS_11670 1798 401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528747.1 protein_id gnl|my_center|LOCUS_11670 2468 1791 gene locus_tag LOCUS_11680 2468 1791 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_11680 3008 4846 gene locus_tag LOCUS_11690 gene typA 3008 4846 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_11690 5262 6131 gene locus_tag LOCUS_11700 gene dapF 5262 6131 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_11700 7615 6545 gene locus_tag LOCUS_11710 7615 6545 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_11710 7834 10356 gene locus_tag LOCUS_11720 gene hrpB 7834 10356 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_11720 11037 11843 gene locus_tag LOCUS_11730 11037 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 11840 12853 gene locus_tag LOCUS_11740 11840 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 13332 13895 gene locus_tag LOCUS_11750 13332 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 14359 13967 gene locus_tag LOCUS_11760 14359 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 15179 14736 gene locus_tag LOCUS_11770 15179 14736 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_11770 16942 15200 gene locus_tag LOCUS_11780 16942 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 19914 17590 gene locus_tag LOCUS_11790 19914 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 22370 20094 gene locus_tag LOCUS_11800 22370 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 23341 22451 gene locus_tag LOCUS_11810 23341 22451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 23560 24381 gene locus_tag LOCUS_11820 23560 24381 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_11820 24414 24845 gene locus_tag LOCUS_11830 24414 24845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 25822 24965 gene locus_tag LOCUS_11840 25822 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 26039 26614 gene locus_tag LOCUS_11850 gene pyrE 26039 26614 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_11850 26918 27337 gene locus_tag LOCUS_11860 26918 27337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 28239 27364 gene locus_tag LOCUS_11870 28239 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 28622 28239 gene locus_tag LOCUS_11880 28622 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 29541 28648 gene locus_tag LOCUS_11890 29541 28648 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_11890 29901 30590 gene locus_tag LOCUS_11900 29901 30590 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_11900 30999 32144 gene locus_tag LOCUS_11910 30999 32144 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545267.1 protein_id gnl|my_center|LOCUS_11910 32302 32667 gene locus_tag LOCUS_11920 32302 32667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 32869 33816 gene locus_tag LOCUS_11930 gene lpxC 32869 33816 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377651.1 protein_id gnl|my_center|LOCUS_11930 34148 34492 gene locus_tag LOCUS_11940 34148 34492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 35327 36100 gene locus_tag LOCUS_11950 35327 36100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 37638 36292 gene locus_tag LOCUS_11960 37638 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 37824 39719 gene locus_tag LOCUS_11970 gene cirA 37824 39719 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 protein_id gnl|my_center|LOCUS_11970 39907 40893 gene locus_tag LOCUS_11980 39907 40893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 42078 40921 gene locus_tag LOCUS_11990 42078 40921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 42639 43070 gene locus_tag LOCUS_12000 42639 43070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 43190 43444 gene locus_tag LOCUS_12010 43190 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 44100 43612 gene locus_tag LOCUS_12020 gene purE 44100 43612 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 protein_id gnl|my_center|LOCUS_12020 44349 44984 gene locus_tag LOCUS_12030 44349 44984 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_12030 45718 45374 gene locus_tag LOCUS_12040 45718 45374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 46252 45803 gene locus_tag LOCUS_12050 46252 45803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 46433 46245 gene locus_tag LOCUS_12060 46433 46245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 48213 46528 gene locus_tag LOCUS_12070 gene ettA 48213 46528 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_12070 48446 49096 gene locus_tag LOCUS_12080 48446 49096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 49859 49344 gene locus_tag LOCUS_12090 49859 49344 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_12090 49956 50423 gene locus_tag LOCUS_12100 49956 50423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 50883 50515 gene locus_tag LOCUS_12110 50883 50515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 52439 51195 gene locus_tag LOCUS_12120 52439 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 55327 52742 gene locus_tag LOCUS_12130 55327 52742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 56179 55439 gene locus_tag LOCUS_12140 56179 55439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 56439 56615 gene locus_tag LOCUS_12150 56439 56615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence019 1920 793 gene locus_tag LOCUS_12160 1920 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2331 2801 gene locus_tag LOCUS_12170 2331 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4124 2922 gene locus_tag LOCUS_12180 4124 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5696 4392 gene locus_tag LOCUS_12190 gene mgtE 5696 4392 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_12190 6556 5693 gene locus_tag LOCUS_12200 6556 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7394 6561 gene locus_tag LOCUS_12210 7394 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 8018 7542 gene locus_tag LOCUS_12220 8018 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9103 8471 gene locus_tag LOCUS_12230 9103 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12230 9352 9149 gene locus_tag LOCUS_12240 9352 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 10584 10267 gene locus_tag LOCUS_12250 10584 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 10754 11326 gene locus_tag LOCUS_12260 10754 11326 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_12260 11347 13164 gene locus_tag LOCUS_12270 11347 13164 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_12270 13189 14301 gene locus_tag LOCUS_12280 13189 14301 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_12280 14356 15588 gene locus_tag LOCUS_12290 14356 15588 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_12290 15629 16555 gene locus_tag LOCUS_12300 gene ispE 15629 16555 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_12300 16667 17608 gene locus_tag LOCUS_12310 16667 17608 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_12310 17654 18349 gene locus_tag LOCUS_12320 17654 18349 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_12320 18353 18931 gene locus_tag LOCUS_12330 gene pth 18353 18931 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_12330 19400 19747 gene locus_tag LOCUS_12340 gene rpsF 19400 19747 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545875.1 protein_id gnl|my_center|LOCUS_12340 19731 20141 gene locus_tag LOCUS_12350 gene ssb 19731 20141 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_12350 20165 20392 gene locus_tag LOCUS_12360 20165 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 21333 22328 gene locus_tag LOCUS_12370 gene plsX 21333 22328 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_12370 22350 23324 gene locus_tag LOCUS_12380 22350 23324 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_12380 23324 23488 gene locus_tag LOCUS_12390 23324 23488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 23446 24261 gene locus_tag LOCUS_12400 23446 24261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_12400 24336 25271 gene locus_tag LOCUS_12410 gene fabD 24336 25271 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097121.1 protein_id gnl|my_center|LOCUS_12410 25309 26055 gene locus_tag LOCUS_12420 gene fabG 25309 26055 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_12420 26112 26342 gene locus_tag LOCUS_12430 gene acpP 26112 26342 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_12430 26466 27719 gene locus_tag LOCUS_12440 gene fabF 26466 27719 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_12440 27891 28640 gene locus_tag LOCUS_12450 gene rnc 27891 28640 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_12450 28657 29283 gene locus_tag LOCUS_12460 28657 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 29995 29285 gene locus_tag LOCUS_12470 29995 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 30966 29992 gene locus_tag LOCUS_12480 30966 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 31178 32035 gene locus_tag LOCUS_12490 gene folD 31178 32035 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_12490 32064 32852 gene locus_tag LOCUS_12500 gene panB 32064 32852 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_12500 33595 37230 gene locus_tag LOCUS_12510 33595 37230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 37608 38558 gene locus_tag LOCUS_12520 37608 38558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 38714 39796 gene locus_tag LOCUS_12530 gene pheA 38714 39796 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_12530 39840 41009 gene locus_tag LOCUS_12540 gene hisC 39840 41009 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_12540 41032 42045 gene locus_tag LOCUS_12550 gene aroF 41032 42045 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_12550 42056 42970 gene locus_tag LOCUS_12560 42056 42970 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_12560 42967 44274 gene locus_tag LOCUS_12570 gene aroA 42967 44274 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_12570 44330 44989 gene locus_tag LOCUS_12580 gene cmk 44330 44989 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_12580 44986 45654 gene locus_tag LOCUS_12590 44986 45654 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_12590 45709 47412 gene locus_tag LOCUS_12600 45709 47412 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_12600 47509 48348 gene locus_tag LOCUS_12610 gene sppA 47509 48348 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_12610 48441 48734 gene locus_tag LOCUS_12620 48441 48734 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_12620 48744 49724 gene locus_tag LOCUS_12630 48744 49724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 50409 49789 gene locus_tag LOCUS_12640 50409 49789 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812143.1 protein_id gnl|my_center|LOCUS_12640 51689 50508 gene locus_tag LOCUS_12650 51689 50508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 51929 51855 gene locus_tag LOCUS_t00220 51929 51855 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 52067 52270 gene locus_tag LOCUS_12660 52067 52270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 52607 54781 gene locus_tag LOCUS_12670 52607 54781 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_12670 55686 55770 gene locus_tag LOCUS_t00230 55686 55770 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 55860 55934 gene locus_tag LOCUS_t00240 55860 55934 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 56004 56079 gene locus_tag LOCUS_t00250 56004 56079 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 150 641 gene locus_tag LOCUS_12680 gene fabZ 150 641 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_12680 713 1522 gene locus_tag LOCUS_12690 gene lpxA 713 1522 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_12690 1550 2419 gene locus_tag LOCUS_12700 gene lpxI 1550 2419 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_12700 2531 3463 gene locus_tag LOCUS_12710 2531 3463 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_12710 3512 4642 gene locus_tag LOCUS_12720 gene lpxB 3512 4642 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_12720 4690 6393 gene locus_tag LOCUS_12730 4690 6393 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_12730 6413 6928 gene locus_tag LOCUS_12740 6413 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 6937 7137 gene locus_tag LOCUS_12750 6937 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 7145 8506 gene locus_tag LOCUS_12760 7145 8506 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_12760 8751 9659 gene locus_tag LOCUS_12770 gene lpxK 8751 9659 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_12770 9773 10813 gene locus_tag LOCUS_12780 gene waaF 9773 10813 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_12780 10810 11412 gene locus_tag LOCUS_12790 gene gmhB 10810 11412 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769732.1 protein_id gnl|my_center|LOCUS_12790 11500 12600 gene locus_tag LOCUS_12800 gene waaC 11500 12600 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_12800 12632 13399 gene locus_tag LOCUS_12810 12632 13399 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_12810 13404 14609 gene locus_tag LOCUS_12820 13404 14609 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_12820 14667 15437 gene locus_tag LOCUS_12830 14667 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15916 16620 gene locus_tag LOCUS_12840 15916 16620 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_12840 16701 17804 gene locus_tag LOCUS_12850 16701 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 17818 18150 gene locus_tag LOCUS_12860 17818 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 18147 18878 gene locus_tag LOCUS_12870 18147 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 18928 19962 gene locus_tag LOCUS_12880 18928 19962 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_12880 21235 20174 gene locus_tag LOCUS_12890 21235 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 21457 21367 gene locus_tag LOCUS_t00260 21457 21367 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21715 21485 gene locus_tag LOCUS_12900 21715 21485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 21751 22269 gene locus_tag LOCUS_12910 21751 22269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 23197 22868 gene locus_tag LOCUS_12920 23197 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 23552 23337 gene locus_tag LOCUS_12930 23552 23337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 24242 23607 gene locus_tag LOCUS_12940 24242 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 24512 24832 gene locus_tag LOCUS_12950 24512 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 25154 24936 gene locus_tag LOCUS_12960 25154 24936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 25396 25593 gene locus_tag LOCUS_12970 25396 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 27092 25719 gene locus_tag LOCUS_12980 27092 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 28617 27094 gene locus_tag LOCUS_12990 28617 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 29378 28608 gene locus_tag LOCUS_13000 29378 28608 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679924.1 protein_id gnl|my_center|LOCUS_13000 30370 29405 gene locus_tag LOCUS_13010 30370 29405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_13010 30624 31226 gene locus_tag LOCUS_13020 gene pal 30624 31226 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_13020 31661 31428 gene locus_tag LOCUS_13030 31661 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 32145 32939 gene locus_tag LOCUS_13040 gene elyC 32145 32939 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899599.1 protein_id gnl|my_center|LOCUS_13040 33184 33471 gene locus_tag LOCUS_13050 33184 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 33725 33895 gene locus_tag LOCUS_13060 33725 33895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 34312 34893 gene locus_tag LOCUS_13070 34312 34893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 35034 36506 gene locus_tag LOCUS_13080 35034 36506 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_13080 36506 37903 gene locus_tag LOCUS_13090 36506 37903 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_13090 38155 39162 gene locus_tag LOCUS_13100 gene fbp 38155 39162 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_13100 39179 40204 gene locus_tag LOCUS_13110 39179 40204 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_13110 40197 40901 gene locus_tag LOCUS_13120 gene ispD 40197 40901 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_13120 40957 41439 gene locus_tag LOCUS_13130 gene ispF 40957 41439 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_13130 41487 42137 gene locus_tag LOCUS_13140 gene cysE 41487 42137 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_13140 42242 43183 gene locus_tag LOCUS_13150 42242 43183 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_13150 44491 43217 gene locus_tag LOCUS_13160 44491 43217 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_13160 45444 46853 gene locus_tag LOCUS_13170 gene ppnN 45444 46853 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_13170 47378 47635 gene locus_tag LOCUS_13180 47378 47635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 47520 47918 gene locus_tag LOCUS_13190 47520 47918 CDS product DUF4168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396403.1 protein_id gnl|my_center|LOCUS_13190 48041 48667 gene locus_tag LOCUS_13200 48041 48667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 49215 50192 gene locus_tag LOCUS_13210 49215 50192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 50855 51163 gene locus_tag LOCUS_13220 50855 51163 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_13220 51944 51567 gene locus_tag LOCUS_13230 51944 51567 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821665.1 protein_id gnl|my_center|LOCUS_13230 52969 53106 gene locus_tag LOCUS_13240 52969 53106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 53103 53627 gene locus_tag LOCUS_13250 gene vreI 53103 53627 CDS product RNA polymerase sigma factor VreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085329.1 protein_id gnl|my_center|LOCUS_13250 53937 54962 gene locus_tag LOCUS_13260 53937 54962 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence021 1009 1404 gene locus_tag LOCUS_13270 1009 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1770 5210 gene locus_tag LOCUS_13280 1770 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 5635 7884 gene locus_tag LOCUS_13290 5635 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 8574 9005 gene locus_tag LOCUS_13300 8574 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9214 10275 gene locus_tag LOCUS_13310 9214 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 10262 12733 gene locus_tag LOCUS_13320 10262 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 12730 13332 gene locus_tag LOCUS_13330 12730 13332 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_13330 13441 14934 gene locus_tag LOCUS_13340 13441 14934 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_13340 15768 15130 gene locus_tag LOCUS_13350 15768 15130 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_13350 16534 15878 gene locus_tag LOCUS_13360 16534 15878 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_13360 16840 18777 gene locus_tag LOCUS_13370 16840 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 19056 19757 gene locus_tag LOCUS_13380 19056 19757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 20784 20458 gene locus_tag LOCUS_13390 20784 20458 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_13390 22056 21124 gene locus_tag LOCUS_13400 22056 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 22501 23745 gene locus_tag LOCUS_13410 22501 23745 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 protein_id gnl|my_center|LOCUS_13410 25086 25559 gene locus_tag LOCUS_13420 25086 25559 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_13420 30255 26839 gene locus_tag LOCUS_13430 30255 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 30502 31293 gene locus_tag LOCUS_13440 gene thiD 30502 31293 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_13440 31301 32110 gene locus_tag LOCUS_13450 31301 32110 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224017.1 protein_id gnl|my_center|LOCUS_13450 32129 32605 gene locus_tag LOCUS_13460 32129 32605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 32661 33179 gene locus_tag LOCUS_13470 32661 33179 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_13470 33269 34102 gene locus_tag LOCUS_13480 33269 34102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_13480 35565 34099 gene locus_tag LOCUS_13490 35565 34099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 36244 35888 gene locus_tag LOCUS_13500 36244 35888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 36483 37964 gene locus_tag LOCUS_13510 36483 37964 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_13510 38811 38002 gene locus_tag LOCUS_13520 gene uppP 38811 38002 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_13520 39715 38879 gene locus_tag LOCUS_13530 gene rfbD 39715 38879 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_13530 40266 39712 gene locus_tag LOCUS_13540 gene rfbC 40266 39712 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_13540 41163 40273 gene locus_tag LOCUS_13550 gene rfbA 41163 40273 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922195.1 protein_id gnl|my_center|LOCUS_13550 42315 41221 gene locus_tag LOCUS_13560 gene rffG 42315 41221 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226604.1 protein_id gnl|my_center|LOCUS_13560 44221 42392 gene locus_tag LOCUS_13570 gene glmS 44221 42392 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_13570 45872 44361 gene locus_tag LOCUS_13580 45872 44361 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_13580 46584 45907 gene locus_tag LOCUS_13590 46584 45907 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_13590 46751 47536 gene locus_tag LOCUS_13600 gene tmk 46751 47536 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_13600 47508 48539 gene locus_tag LOCUS_13610 gene holB 47508 48539 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_13610 48625 50610 gene locus_tag LOCUS_13620 gene metG 48625 50610 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_13620 52225 50825 gene locus_tag LOCUS_13630 52225 50825 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_13630 53403 52219 gene locus_tag LOCUS_13640 53403 52219 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_13640 54492 53410 gene locus_tag LOCUS_13650 54492 53410 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_13650 54901 54542 gene locus_tag LOCUS_13660 54901 54542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence022 2108 732 gene locus_tag LOCUS_13670 2108 732 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_13670 2841 2584 gene locus_tag LOCUS_13680 2841 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2840 3856 gene locus_tag LOCUS_13690 2840 3856 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_13690 3869 4123 gene locus_tag LOCUS_13700 3869 4123 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247385.1 protein_id gnl|my_center|LOCUS_13700 4930 4274 gene locus_tag LOCUS_13710 4930 4274 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_13710 5114 5278 gene locus_tag LOCUS_13720 5114 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5763 5365 gene locus_tag LOCUS_13730 5763 5365 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_13730 6227 5823 gene locus_tag LOCUS_13740 6227 5823 CDS product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 protein_id gnl|my_center|LOCUS_13740 6849 6571 gene locus_tag LOCUS_13750 6849 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7081 6902 gene locus_tag LOCUS_13760 7081 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 8049 7606 gene locus_tag LOCUS_13770 8049 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9913 8450 gene locus_tag LOCUS_13780 9913 8450 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029723090.1 protein_id gnl|my_center|LOCUS_13780 10629 9910 gene locus_tag LOCUS_13790 10629 9910 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_13790 10995 12377 gene locus_tag LOCUS_13800 10995 12377 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_13800 12438 13628 gene locus_tag LOCUS_13810 12438 13628 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390560.1 protein_id gnl|my_center|LOCUS_13810 13618 16767 gene locus_tag LOCUS_13820 13618 16767 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_13820 17486 18739 gene locus_tag LOCUS_13830 17486 18739 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_13830 20835 19405 gene locus_tag LOCUS_13840 20835 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 21967 23700 gene locus_tag LOCUS_13850 21967 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 24320 23976 gene locus_tag LOCUS_13860 24320 23976 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022116.1 protein_id gnl|my_center|LOCUS_13860 24612 24307 gene locus_tag LOCUS_13870 24612 24307 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_13870 25505 24852 gene locus_tag LOCUS_13880 gene mtgA 25505 24852 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842177.1 protein_id gnl|my_center|LOCUS_13880 25967 25710 gene locus_tag LOCUS_13890 25967 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 26154 27155 gene locus_tag LOCUS_13900 26154 27155 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_13900 27606 27160 gene locus_tag LOCUS_13910 27606 27160 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_13910 29350 27674 gene locus_tag LOCUS_13920 gene ggt 29350 27674 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_13920 29762 31054 gene locus_tag LOCUS_13930 29762 31054 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_13930 31080 31760 gene locus_tag LOCUS_13940 31080 31760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 32241 31924 gene locus_tag LOCUS_13950 32241 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 32511 32344 gene locus_tag LOCUS_13960 32511 32344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 32831 33367 gene locus_tag LOCUS_13970 gene hsp20 32831 33367 CDS product small heat shock protein sHSP20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_13970 34002 34460 gene locus_tag LOCUS_13980 34002 34460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 34587 34718 gene locus_tag LOCUS_13990 34587 34718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 35752 34808 gene locus_tag LOCUS_14000 gene nhaR 35752 34808 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_14000 36472 36026 gene locus_tag LOCUS_14010 36472 36026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 37462 38997 gene locus_tag LOCUS_14020 37462 38997 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_14020 39409 40368 gene locus_tag LOCUS_14030 39409 40368 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_14030 40361 40687 gene locus_tag LOCUS_14040 40361 40687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 42038 42421 gene locus_tag LOCUS_14050 42038 42421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 42492 42857 gene locus_tag LOCUS_14060 42492 42857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 42983 43417 gene locus_tag LOCUS_14070 42983 43417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 43566 43931 gene locus_tag LOCUS_14080 43566 43931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 45644 44409 gene locus_tag LOCUS_14090 45644 44409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 48726 45841 gene locus_tag LOCUS_14100 48726 45841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 49634 49467 gene locus_tag LOCUS_14110 49634 49467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 50572 50796 gene locus_tag LOCUS_14120 50572 50796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 50799 52406 gene locus_tag LOCUS_14130 50799 52406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 52436 53293 gene locus_tag LOCUS_14140 gene ylqF 52436 53293 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence023 2 139 gene locus_tag LOCUS_14150 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 776 1411 gene locus_tag LOCUS_14160 776 1411 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532425.1 protein_id gnl|my_center|LOCUS_14160 1671 2468 gene locus_tag LOCUS_14170 1671 2468 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 protein_id gnl|my_center|LOCUS_14170 3732 2512 gene locus_tag LOCUS_14180 gene glgC 3732 2512 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_14180 4353 3853 gene locus_tag LOCUS_14190 4353 3853 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_14190 4676 5947 gene locus_tag LOCUS_14200 4676 5947 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_14200 7034 6597 gene locus_tag LOCUS_14210 7034 6597 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_14210 7033 7314 gene locus_tag LOCUS_14220 7033 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 7527 8171 gene locus_tag LOCUS_14230 7527 8171 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_14230 8346 9029 gene locus_tag LOCUS_14240 gene traT 8346 9029 CDS product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782438.1 protein_id gnl|my_center|LOCUS_14240 9275 10408 gene locus_tag LOCUS_14250 9275 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 10664 11776 gene locus_tag LOCUS_14260 10664 11776 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_14260 12068 13627 gene locus_tag LOCUS_14270 12068 13627 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_14270 13624 15111 gene locus_tag LOCUS_14280 13624 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 15185 16102 gene locus_tag LOCUS_14290 15185 16102 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_14290 16185 17216 gene locus_tag LOCUS_14300 16185 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 17339 18619 gene locus_tag LOCUS_14310 gene clpX 17339 18619 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 protein_id gnl|my_center|LOCUS_14310 18900 19223 gene locus_tag LOCUS_14320 18900 19223 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_14320 19642 21204 gene locus_tag LOCUS_14330 gene arc 19642 21204 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_14330 21232 22803 gene locus_tag LOCUS_14340 gene dop 21232 22803 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_14340 22809 23024 gene locus_tag LOCUS_14350 22809 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 23027 23821 gene locus_tag LOCUS_14360 gene prcB 23027 23821 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_14360 23814 24632 gene locus_tag LOCUS_14370 gene prcA 23814 24632 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_14370 24655 26154 gene locus_tag LOCUS_14380 gene dop 24655 26154 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_14380 27297 28391 gene locus_tag LOCUS_14390 27297 28391 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_14390 28424 31633 gene locus_tag LOCUS_14400 28424 31633 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_14400 31711 33138 gene locus_tag LOCUS_14410 31711 33138 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_14410 35334 34144 gene locus_tag LOCUS_14420 35334 34144 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_14420 36502 35486 gene locus_tag LOCUS_14430 36502 35486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_14430 36604 37635 gene locus_tag LOCUS_14440 36604 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 39407 37632 gene locus_tag LOCUS_14450 gene aspS 39407 37632 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_14450 40702 39476 gene locus_tag LOCUS_14460 40702 39476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 42261 40705 gene locus_tag LOCUS_14470 gene guaA 42261 40705 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_14470 43780 42320 gene locus_tag LOCUS_14480 gene guaB 43780 42320 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546759.1 protein_id gnl|my_center|LOCUS_14480 46999 44057 gene locus_tag LOCUS_14490 46999 44057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 47524 47303 gene locus_tag LOCUS_14500 47524 47303 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292860.1 protein_id gnl|my_center|LOCUS_14500 47764 48930 gene locus_tag LOCUS_14510 gene lptF 47764 48930 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_14510 48959 50047 gene locus_tag LOCUS_14520 gene lptG 48959 50047 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_14520 50526 51404 gene locus_tag LOCUS_14530 50526 51404 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_14530 51695 51405 gene locus_tag LOCUS_14540 51695 51405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 51844 52017 gene locus_tag LOCUS_14550 51844 52017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 52454 52972 gene locus_tag LOCUS_14560 52454 52972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 53135 53482 gene locus_tag LOCUS_14570 gene trxA 53135 53482 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence024 2675 1824 gene locus_tag LOCUS_14580 2675 1824 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_14580 3819 2947 gene locus_tag LOCUS_14590 gene sucD 3819 2947 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_14590 5045 3870 gene locus_tag LOCUS_14600 gene sucC 5045 3870 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_14600 6705 5128 gene locus_tag LOCUS_14610 6705 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7443 6727 gene locus_tag LOCUS_14620 7443 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 9763 7517 gene locus_tag LOCUS_14630 9763 7517 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_14630 11653 9827 gene locus_tag LOCUS_14640 11653 9827 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_14640 12885 11689 gene locus_tag LOCUS_14650 12885 11689 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_14650 14013 13339 gene locus_tag LOCUS_14660 14013 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 16357 14123 gene locus_tag LOCUS_14670 16357 14123 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_14670 17986 16718 gene locus_tag LOCUS_14680 17986 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 18639 18031 gene locus_tag LOCUS_14690 18639 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 19070 18654 gene locus_tag LOCUS_14700 19070 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 19516 19067 gene locus_tag LOCUS_14710 19516 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 20141 19611 gene locus_tag LOCUS_14720 20141 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 20495 20770 gene locus_tag LOCUS_14730 20495 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 21549 20785 gene locus_tag LOCUS_14740 gene rlmB 21549 20785 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_14740 23059 21524 gene locus_tag LOCUS_14750 gene cysS 23059 21524 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_14750 23674 23063 gene locus_tag LOCUS_14760 23674 23063 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_14760 24559 23723 gene locus_tag LOCUS_14770 gene surE 24559 23723 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_14770 26059 24707 gene locus_tag LOCUS_14780 26059 24707 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880731.1 protein_id gnl|my_center|LOCUS_14780 26864 26103 gene locus_tag LOCUS_14790 26864 26103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 27244 26921 gene locus_tag LOCUS_14800 27244 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 28011 27277 gene locus_tag LOCUS_14810 28011 27277 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880733.1 protein_id gnl|my_center|LOCUS_14810 28967 28077 gene locus_tag LOCUS_14820 28967 28077 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880732.1 protein_id gnl|my_center|LOCUS_14820 30393 29392 gene locus_tag LOCUS_14830 30393 29392 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_14830 30808 30482 gene locus_tag LOCUS_14840 30808 30482 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_14840 31784 31029 gene locus_tag LOCUS_14850 31784 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 32728 32108 gene locus_tag LOCUS_14860 gene thrH 32728 32108 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_14860 33588 32941 gene locus_tag LOCUS_14870 33588 32941 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_14870 34121 33585 gene locus_tag LOCUS_14880 34121 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 34699 34223 gene locus_tag LOCUS_14890 34699 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 35445 34762 gene locus_tag LOCUS_14900 35445 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 37823 35442 gene locus_tag LOCUS_14910 37823 35442 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_14910 38719 37904 gene locus_tag LOCUS_14920 gene rsmA 38719 37904 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 protein_id gnl|my_center|LOCUS_14920 39093 38779 gene locus_tag LOCUS_14930 39093 38779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 40164 39181 gene locus_tag LOCUS_14940 gene fmt 40164 39181 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_14940 40391 41146 gene locus_tag LOCUS_14950 40391 41146 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_14950 41429 42040 gene locus_tag LOCUS_14960 gene ruvA 41429 42040 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_14960 42777 42577 gene locus_tag LOCUS_14970 42777 42577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 44080 42896 gene locus_tag LOCUS_14980 44080 42896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 44344 44667 gene locus_tag LOCUS_14990 44344 44667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 46797 45256 gene locus_tag LOCUS_15000 46797 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 46991 48610 gene locus_tag LOCUS_15010 gene murJ 46991 48610 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_15010 48683 49186 gene locus_tag LOCUS_15020 gene dtd 48683 49186 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_15020 49242 49805 gene locus_tag LOCUS_15030 49242 49805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_15030 50254 51777 gene locus_tag LOCUS_15040 50254 51777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 51941 52756 gene locus_tag LOCUS_15050 51941 52756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 >Feature sequence025 530 111 gene locus_tag LOCUS_15060 530 111 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393883.1 protein_id gnl|my_center|LOCUS_15060 4140 703 gene locus_tag LOCUS_15070 4140 703 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_15070 4381 4193 gene locus_tag LOCUS_15080 4381 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6496 4520 gene locus_tag LOCUS_15090 6496 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 7557 6964 gene locus_tag LOCUS_15100 gene fsa 7557 6964 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_15100 8736 8206 gene locus_tag LOCUS_15110 8736 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 9359 8757 gene locus_tag LOCUS_15120 9359 8757 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_15120 11499 10726 gene locus_tag LOCUS_15130 11499 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11924 11571 gene locus_tag LOCUS_15140 11924 11571 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_15140 13255 11963 gene locus_tag LOCUS_15150 13255 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 14500 13856 gene locus_tag LOCUS_15160 14500 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 14820 14632 gene locus_tag LOCUS_15170 14820 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 15065 14802 gene locus_tag LOCUS_15180 15065 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 15966 15115 gene locus_tag LOCUS_15190 15966 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 17762 16227 gene locus_tag LOCUS_15200 17762 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 18024 18764 gene locus_tag LOCUS_15210 18024 18764 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 protein_id gnl|my_center|LOCUS_15210 20593 19046 gene locus_tag LOCUS_15220 20593 19046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 21683 21312 gene locus_tag LOCUS_15230 21683 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 22911 22534 gene locus_tag LOCUS_15240 22911 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 25390 23447 gene locus_tag LOCUS_15250 25390 23447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 27961 28710 gene locus_tag LOCUS_15260 27961 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 28721 30316 gene locus_tag LOCUS_15270 28721 30316 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_15270 30691 31674 gene locus_tag LOCUS_15280 gene egtD 30691 31674 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_15280 31767 32819 gene locus_tag LOCUS_15290 31767 32819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 34325 35866 gene locus_tag LOCUS_15300 gene mdoG 34325 35866 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300662.1 protein_id gnl|my_center|LOCUS_15300 35866 36114 gene locus_tag LOCUS_15310 35866 36114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 36111 38234 gene locus_tag LOCUS_15320 gene mdoH 36111 38234 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298322.1 protein_id gnl|my_center|LOCUS_15320 39625 38825 gene locus_tag LOCUS_15330 39625 38825 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_15330 40034 40498 gene locus_tag LOCUS_15340 40034 40498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 40834 41028 gene locus_tag LOCUS_15350 40834 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 41577 41302 gene locus_tag LOCUS_15360 41577 41302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 42059 42274 gene locus_tag LOCUS_15370 42059 42274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 43653 42553 gene locus_tag LOCUS_15380 43653 42553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 44615 43653 gene locus_tag LOCUS_15390 44615 43653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 46761 45913 gene locus_tag LOCUS_15400 46761 45913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 47316 46888 gene locus_tag LOCUS_15410 47316 46888 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_15410 48366 47449 gene locus_tag LOCUS_15420 gene ftcD 48366 47449 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_15420 48631 49161 gene locus_tag LOCUS_15430 48631 49161 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229885.1 protein_id gnl|my_center|LOCUS_15430 49185 49427 gene locus_tag LOCUS_15440 gene tusA 49185 49427 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_15440 50066 49809 gene locus_tag LOCUS_15450 50066 49809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 50648 50881 gene locus_tag LOCUS_15460 50648 50881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 52455 51052 gene locus_tag LOCUS_15470 gene fumC 52455 51052 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence026 2536 902 gene locus_tag LOCUS_15480 gene secD 2536 902 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_15480 2879 2556 gene locus_tag LOCUS_15490 gene yajC 2879 2556 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_15490 3967 2921 gene locus_tag LOCUS_15500 gene tgt 3967 2921 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_15500 5909 4128 gene locus_tag LOCUS_15510 gene argS 5909 4128 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_15510 7057 5978 gene locus_tag LOCUS_15520 7057 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 7682 7062 gene locus_tag LOCUS_15530 7682 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 9618 7747 gene locus_tag LOCUS_15540 9618 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 10600 9632 gene locus_tag LOCUS_15550 10600 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11959 10646 gene locus_tag LOCUS_15560 11959 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 13997 12027 gene locus_tag LOCUS_15570 13997 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 15579 14695 gene locus_tag LOCUS_15580 15579 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 16583 15666 gene locus_tag LOCUS_15590 16583 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 17005 16634 gene locus_tag LOCUS_15600 17005 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 17749 17015 gene locus_tag LOCUS_15610 17749 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 19620 17749 gene locus_tag LOCUS_15620 19620 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 20695 19622 gene locus_tag LOCUS_15630 20695 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 21241 20762 gene locus_tag LOCUS_15640 21241 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 21974 21249 gene locus_tag LOCUS_15650 21974 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 22974 21997 gene locus_tag LOCUS_15660 22974 21997 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393222.1 protein_id gnl|my_center|LOCUS_15660 23955 23161 gene locus_tag LOCUS_15670 23955 23161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 24234 23971 gene locus_tag LOCUS_15680 24234 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 26116 24248 gene locus_tag LOCUS_15690 26116 24248 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_15690 27685 26330 gene locus_tag LOCUS_15700 27685 26330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 28229 27726 gene locus_tag LOCUS_15710 28229 27726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 29317 28397 gene locus_tag LOCUS_15720 29317 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 30250 29333 gene locus_tag LOCUS_15730 30250 29333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 31525 30620 gene locus_tag LOCUS_15740 31525 30620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 37155 32278 gene locus_tag LOCUS_15750 37155 32278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 38287 37433 gene locus_tag LOCUS_15760 gene dat 38287 37433 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_15760 38618 38301 gene locus_tag LOCUS_15770 38618 38301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 39059 38667 gene locus_tag LOCUS_15780 39059 38667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 39566 39069 gene locus_tag LOCUS_15790 39566 39069 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173648.1 protein_id gnl|my_center|LOCUS_15790 39791 40123 gene locus_tag LOCUS_15800 39791 40123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 40707 40210 gene locus_tag LOCUS_15810 40707 40210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 41970 41332 gene locus_tag LOCUS_15820 41970 41332 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_15820 42298 43068 gene locus_tag LOCUS_15830 42298 43068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 44680 43163 gene locus_tag LOCUS_15840 44680 43163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 46356 44926 gene locus_tag LOCUS_15850 46356 44926 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_15850 50929 46349 gene locus_tag LOCUS_15860 gene gltB 50929 46349 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_15860 51490 51167 gene locus_tag LOCUS_15870 51490 51167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence027 <1 1078 gene locus_tag LOCUS_15880 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141277.1:FG-GAP-like repeat-containing protein 1198 1938 gene locus_tag LOCUS_15890 1198 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3467 2379 gene locus_tag LOCUS_15900 3467 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4645 5271 gene locus_tag LOCUS_15910 gene msrA 4645 5271 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_15910 5926 7095 gene locus_tag LOCUS_15920 5926 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7413 7195 gene locus_tag LOCUS_15930 7413 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7461 7901 gene locus_tag LOCUS_15940 7461 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 8012 9325 gene locus_tag LOCUS_15950 8012 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 10152 9442 gene locus_tag LOCUS_15960 10152 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 11140 11661 gene locus_tag LOCUS_15970 11140 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 13527 12514 gene locus_tag LOCUS_15980 gene ruvB 13527 12514 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_15980 14241 13684 gene locus_tag LOCUS_15990 14241 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 14404 16938 gene locus_tag LOCUS_16000 gene uvrA 14404 16938 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_16000 17124 16945 gene locus_tag LOCUS_16010 17124 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 17985 18875 gene locus_tag LOCUS_16020 17985 18875 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_16020 18979 19965 gene locus_tag LOCUS_16030 18979 19965 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_16030 20207 20034 gene locus_tag LOCUS_16040 20207 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 20782 21183 gene locus_tag LOCUS_16050 20782 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 21328 23130 gene locus_tag LOCUS_16060 21328 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 23314 23667 gene locus_tag LOCUS_16070 23314 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 23885 24886 gene locus_tag LOCUS_16080 23885 24886 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_16080 25260 25490 gene locus_tag LOCUS_16090 25260 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 26093 27907 gene locus_tag LOCUS_16100 26093 27907 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_16100 28064 29017 gene locus_tag LOCUS_16110 28064 29017 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524032.1 protein_id gnl|my_center|LOCUS_16110 29824 29036 gene locus_tag LOCUS_16120 29824 29036 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022242.1 protein_id gnl|my_center|LOCUS_16120 32905 31295 gene locus_tag LOCUS_16130 32905 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 34234 33008 gene locus_tag LOCUS_16140 34234 33008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 35169 34723 gene locus_tag LOCUS_16150 35169 34723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 37080 35428 gene locus_tag LOCUS_16160 37080 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 38526 37096 gene locus_tag LOCUS_16170 gene pyk 38526 37096 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080342.1 protein_id gnl|my_center|LOCUS_16170 39407 38742 gene locus_tag LOCUS_16180 39407 38742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 40472 39417 gene locus_tag LOCUS_16190 40472 39417 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_16190 41368 40961 gene locus_tag LOCUS_16200 41368 40961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 41955 41629 gene locus_tag LOCUS_16210 41955 41629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 42710 42180 gene locus_tag LOCUS_16220 42710 42180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 43663 43109 gene locus_tag LOCUS_16230 43663 43109 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_16230 45112 43682 gene locus_tag LOCUS_16240 45112 43682 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_16240 46763 45378 gene locus_tag LOCUS_16250 46763 45378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 48684 46921 gene locus_tag LOCUS_16260 48684 46921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 49198 48764 gene locus_tag LOCUS_16270 49198 48764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 49451 49663 gene locus_tag LOCUS_16280 49451 49663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 49856 50044 gene locus_tag LOCUS_16290 49856 50044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence028 225 1085 gene locus_tag LOCUS_16300 225 1085 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_16300 1201 1893 gene locus_tag LOCUS_16310 1201 1893 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024490.1 protein_id gnl|my_center|LOCUS_16310 2915 2166 gene locus_tag LOCUS_16320 2915 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4109 3063 gene locus_tag LOCUS_16330 4109 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4462 4106 gene locus_tag LOCUS_16340 4462 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5808 4600 gene locus_tag LOCUS_16350 5808 4600 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_16350 6104 5805 gene locus_tag LOCUS_16360 6104 5805 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388880.1 protein_id gnl|my_center|LOCUS_16360 6312 6836 gene locus_tag LOCUS_16370 6312 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 7455 6874 gene locus_tag LOCUS_16380 7455 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 11182 7604 gene locus_tag LOCUS_16390 11182 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 12123 11305 gene locus_tag LOCUS_16400 12123 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12583 12137 gene locus_tag LOCUS_16410 12583 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 13354 14037 gene locus_tag LOCUS_16420 13354 14037 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_16420 15479 14289 gene locus_tag LOCUS_16430 15479 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 15980 16465 gene locus_tag LOCUS_16440 15980 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 16917 17246 gene locus_tag LOCUS_16450 16917 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 19236 18190 gene locus_tag LOCUS_16460 19236 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 20403 19261 gene locus_tag LOCUS_16470 20403 19261 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_16470 20762 21244 gene locus_tag LOCUS_16480 20762 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21251 22225 gene locus_tag LOCUS_16490 21251 22225 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_16490 22269 23048 gene locus_tag LOCUS_16500 22269 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 23136 24008 gene locus_tag LOCUS_16510 23136 24008 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_16510 25151 24318 gene locus_tag LOCUS_16520 25151 24318 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085172.1 protein_id gnl|my_center|LOCUS_16520 25212 25862 gene locus_tag LOCUS_16530 25212 25862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 26510 25884 gene locus_tag LOCUS_16540 26510 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 26732 27970 gene locus_tag LOCUS_16550 26732 27970 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_16550 27983 28783 gene locus_tag LOCUS_16560 27983 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 29024 29353 gene locus_tag LOCUS_16570 29024 29353 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_16570 29723 29520 gene locus_tag LOCUS_16580 29723 29520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 30008 29775 gene locus_tag LOCUS_16590 30008 29775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 30497 30853 gene locus_tag LOCUS_16600 30497 30853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 31997 30939 gene locus_tag LOCUS_16610 31997 30939 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_16610 32954 32340 gene locus_tag LOCUS_16620 32954 32340 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_16620 33575 34468 gene locus_tag LOCUS_16630 33575 34468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 34465 36975 gene locus_tag LOCUS_16640 34465 36975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 37281 37021 gene locus_tag LOCUS_16650 37281 37021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 37763 38122 gene locus_tag LOCUS_16660 37763 38122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 38173 38493 gene locus_tag LOCUS_16670 38173 38493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 38553 40037 gene locus_tag LOCUS_16680 38553 40037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 41114 41407 gene locus_tag LOCUS_16690 41114 41407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 42113 41433 gene locus_tag LOCUS_16700 42113 41433 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404657.1 protein_id gnl|my_center|LOCUS_16700 42431 42285 gene locus_tag LOCUS_16710 42431 42285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 42612 42845 gene locus_tag LOCUS_16720 42612 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 42842 43273 gene locus_tag LOCUS_16730 42842 43273 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_16730 44098 43415 gene locus_tag LOCUS_16740 44098 43415 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228280.1 protein_id gnl|my_center|LOCUS_16740 45005 44217 gene locus_tag LOCUS_16750 45005 44217 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119475.1 protein_id gnl|my_center|LOCUS_16750 46551 45082 gene locus_tag LOCUS_16760 46551 45082 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105279.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence029 35 223 gene locus_tag LOCUS_16770 35 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 806 1459 gene locus_tag LOCUS_16780 806 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5864 1917 gene locus_tag LOCUS_16790 5864 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6858 10394 gene locus_tag LOCUS_16800 6858 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 11933 11013 gene locus_tag LOCUS_16810 11933 11013 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_16810 13319 12852 gene locus_tag LOCUS_16820 13319 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 13992 13750 gene locus_tag LOCUS_16830 13992 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 14338 15423 gene locus_tag LOCUS_16840 14338 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 18197 15705 gene locus_tag LOCUS_16850 18197 15705 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_16850 18776 20317 gene locus_tag LOCUS_16860 18776 20317 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_16860 20376 21572 gene locus_tag LOCUS_16870 20376 21572 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_16870 21615 21830 gene locus_tag LOCUS_16880 21615 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16880 21837 21992 gene locus_tag LOCUS_16890 21837 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16890 23461 22013 gene locus_tag LOCUS_16900 23461 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 24961 23525 gene locus_tag LOCUS_16910 24961 23525 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_16910 28608 25414 gene locus_tag LOCUS_16920 28608 25414 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_16920 29316 28825 gene locus_tag LOCUS_16930 29316 28825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 31319 29466 gene locus_tag LOCUS_16940 gene glgP 31319 29466 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_16940 31843 31634 gene locus_tag LOCUS_16950 31843 31634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 32690 32013 gene locus_tag LOCUS_16960 32690 32013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 33158 32727 gene locus_tag LOCUS_16970 33158 32727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 36301 33155 gene locus_tag LOCUS_16980 36301 33155 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_16980 37722 36385 gene locus_tag LOCUS_16990 37722 36385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 39005 37737 gene locus_tag LOCUS_17000 39005 37737 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_17000 40466 39747 gene locus_tag LOCUS_17010 40466 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 42526 40652 gene locus_tag LOCUS_17020 42526 40652 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_17020 42883 42578 gene locus_tag LOCUS_17030 42883 42578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 44218 45471 gene locus_tag LOCUS_17040 44218 45471 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence030 <1 1154 gene locus_tag LOCUS_17050 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197873.1:TolC family protein 1227 1409 gene locus_tag LOCUS_17060 1227 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2082 1465 gene locus_tag LOCUS_17070 2082 1465 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_17070 2125 2316 gene locus_tag LOCUS_17080 2125 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3553 2477 gene locus_tag LOCUS_17090 3553 2477 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930782.1 protein_id gnl|my_center|LOCUS_17090 4058 4291 gene locus_tag LOCUS_17100 4058 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5207 4602 gene locus_tag LOCUS_17110 gene napC 5207 4602 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_17110 6773 5241 gene locus_tag LOCUS_17120 6773 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 8206 7496 gene locus_tag LOCUS_17130 8206 7496 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070846.1 protein_id gnl|my_center|LOCUS_17130 9178 9933 gene locus_tag LOCUS_17140 9178 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 11053 10181 gene locus_tag LOCUS_17150 gene atpG 11053 10181 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_17150 13006 11489 gene locus_tag LOCUS_17160 13006 11489 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_17160 16247 13008 gene locus_tag LOCUS_17170 16247 13008 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268123.1 protein_id gnl|my_center|LOCUS_17170 17500 16253 gene locus_tag LOCUS_17180 17500 16253 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_17180 18031 19410 gene locus_tag LOCUS_17190 gene zwf 18031 19410 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_17190 19885 19697 gene locus_tag LOCUS_17200 19885 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 21594 20245 gene locus_tag LOCUS_17210 21594 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 21855 22460 gene locus_tag LOCUS_17220 21855 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17220 22476 22850 gene locus_tag LOCUS_17230 22476 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 24882 23269 gene locus_tag LOCUS_17240 24882 23269 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_17240 25992 26156 gene locus_tag LOCUS_17250 25992 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 26497 28128 gene locus_tag LOCUS_17260 gene pgi 26497 28128 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_17260 28249 28524 gene locus_tag LOCUS_17270 28249 28524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 29688 28942 gene locus_tag LOCUS_17280 29688 28942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 29805 30071 gene locus_tag LOCUS_17290 29805 30071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 31204 30395 gene locus_tag LOCUS_17300 gene ppk2 31204 30395 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086264.1 protein_id gnl|my_center|LOCUS_17300 33825 31354 gene locus_tag LOCUS_17310 33825 31354 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_17310 35971 33887 gene locus_tag LOCUS_17320 gene glgX 35971 33887 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_17320 38399 35991 gene locus_tag LOCUS_17330 38399 35991 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209289.1 protein_id gnl|my_center|LOCUS_17330 39826 38573 gene locus_tag LOCUS_17340 39826 38573 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_17340 42233 39840 gene locus_tag LOCUS_17350 42233 39840 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_17350 43097 42339 gene locus_tag LOCUS_17360 43097 42339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 44304 43237 gene locus_tag LOCUS_17370 44304 43237 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_17370 44577 45164 gene locus_tag LOCUS_17380 44577 45164 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence031 563 1858 gene locus_tag LOCUS_17390 563 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2105 3466 gene locus_tag LOCUS_17400 2105 3466 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_17400 3562 3350 gene locus_tag LOCUS_17410 3562 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4406 3600 gene locus_tag LOCUS_17420 4406 3600 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_17420 4688 4431 gene locus_tag LOCUS_17430 4688 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7328 4899 gene locus_tag LOCUS_17440 7328 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 7919 10588 gene locus_tag LOCUS_17450 7919 10588 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_17450 10592 12673 gene locus_tag LOCUS_17460 10592 12673 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_17460 14058 12967 gene locus_tag LOCUS_17470 14058 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 14493 14308 gene locus_tag LOCUS_17480 14493 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14961 14743 gene locus_tag LOCUS_17490 14961 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15028 15735 gene locus_tag LOCUS_17500 15028 15735 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_17500 15732 16220 gene locus_tag LOCUS_17510 15732 16220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_17510 16566 16760 gene locus_tag LOCUS_17520 16566 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 16928 17068 gene locus_tag LOCUS_17530 16928 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 17187 17597 gene locus_tag LOCUS_17540 17187 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 17839 18327 gene locus_tag LOCUS_17550 17839 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 19004 19153 gene locus_tag LOCUS_17560 19004 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 19231 19782 gene locus_tag LOCUS_17570 19231 19782 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_17570 21064 19925 gene locus_tag LOCUS_17580 21064 19925 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104138.1 protein_id gnl|my_center|LOCUS_17580 21481 22020 gene locus_tag LOCUS_17590 21481 22020 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_17590 22024 22611 gene locus_tag LOCUS_17600 22024 22611 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174793.1 protein_id gnl|my_center|LOCUS_17600 23475 22657 gene locus_tag LOCUS_17610 23475 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 24065 25897 gene locus_tag LOCUS_17620 24065 25897 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_17620 26060 26317 gene locus_tag LOCUS_17630 26060 26317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 26838 27050 gene locus_tag LOCUS_17640 26838 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 27050 27751 gene locus_tag LOCUS_17650 27050 27751 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_17650 27938 28354 gene locus_tag LOCUS_17660 gene nikR 27938 28354 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_17660 28666 30630 gene locus_tag LOCUS_17670 28666 30630 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_17670 31252 30779 gene locus_tag LOCUS_17680 gene bfr 31252 30779 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_17680 31796 31476 gene locus_tag LOCUS_17690 31796 31476 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706400.1 protein_id gnl|my_center|LOCUS_17690 32126 31881 gene locus_tag LOCUS_17700 32126 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 32419 32237 gene locus_tag LOCUS_17710 32419 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 32393 35755 gene locus_tag LOCUS_17720 gene dnaE 32393 35755 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_17720 35781 36770 gene locus_tag LOCUS_17730 35781 36770 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_17730 37451 37047 gene locus_tag LOCUS_17740 37451 37047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 37493 38458 gene locus_tag LOCUS_17750 37493 38458 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_17750 38731 38591 gene locus_tag LOCUS_17760 38731 38591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 38756 40174 gene locus_tag LOCUS_17770 gene sthA 38756 40174 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_17770 41983 40193 gene locus_tag LOCUS_17780 41983 40193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 42501 41983 gene locus_tag LOCUS_17790 42501 41983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 44219 42603 gene locus_tag LOCUS_17800 44219 42603 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_17800 <45089 44272 gene locus_tag LOCUS_17810 <45089 44272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948640.1:formate/nitrite transporter family protein >Feature sequence032 994 1260 gene locus_tag LOCUS_17820 994 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1260 1613 gene locus_tag LOCUS_17830 1260 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3106 1727 gene locus_tag LOCUS_17840 3106 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3657 3106 gene locus_tag LOCUS_17850 3657 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4748 3912 gene locus_tag LOCUS_17860 4748 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 5425 4946 gene locus_tag LOCUS_17870 5425 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5574 6257 gene locus_tag LOCUS_17880 5574 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6390 7907 gene locus_tag LOCUS_17890 6390 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8140 8421 gene locus_tag LOCUS_17900 8140 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 8491 8829 gene locus_tag LOCUS_17910 8491 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 9425 9177 gene locus_tag LOCUS_17920 9425 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 10738 9812 gene locus_tag LOCUS_17930 10738 9812 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_17930 10982 11254 gene locus_tag LOCUS_17940 10982 11254 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 protein_id gnl|my_center|LOCUS_17940 11676 12236 gene locus_tag LOCUS_17950 11676 12236 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_17950 12325 13599 gene locus_tag LOCUS_17960 12325 13599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_17960 14128 13709 gene locus_tag LOCUS_17970 14128 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 14554 14135 gene locus_tag LOCUS_17980 14554 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 15360 14569 gene locus_tag LOCUS_17990 15360 14569 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_17990 18400 15440 gene locus_tag LOCUS_18000 18400 15440 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263656.1 protein_id gnl|my_center|LOCUS_18000 18789 20177 gene locus_tag LOCUS_18010 gene ffh 18789 20177 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_18010 20238 20516 gene locus_tag LOCUS_18020 gene rpsP 20238 20516 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268761.1 protein_id gnl|my_center|LOCUS_18020 20611 21153 gene locus_tag LOCUS_18030 20611 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 21143 21907 gene locus_tag LOCUS_18040 gene trmD 21143 21907 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_18040 21923 22381 gene locus_tag LOCUS_18050 gene rplS 21923 22381 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_18050 22407 23060 gene locus_tag LOCUS_18060 22407 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 23057 23443 gene locus_tag LOCUS_18070 23057 23443 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_18070 23585 24253 gene locus_tag LOCUS_18080 gene ftsE 23585 24253 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_18080 24250 25149 gene locus_tag LOCUS_18090 gene ftsX 24250 25149 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056458.1 protein_id gnl|my_center|LOCUS_18090 25146 26342 gene locus_tag LOCUS_18100 25146 26342 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_18100 26370 27683 gene locus_tag LOCUS_18110 26370 27683 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_18110 27947 27711 gene locus_tag LOCUS_18120 27947 27711 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250282.1 protein_id gnl|my_center|LOCUS_18120 28545 28069 gene locus_tag LOCUS_18130 28545 28069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 28790 28999 gene locus_tag LOCUS_18140 gene thiS 28790 28999 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_18140 29019 29792 gene locus_tag LOCUS_18150 29019 29792 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_18150 29805 30431 gene locus_tag LOCUS_18160 gene thiE 29805 30431 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_18160 30629 32311 gene locus_tag LOCUS_18170 gene arc 30629 32311 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_18170 32342 33820 gene locus_tag LOCUS_18180 gene dop 32342 33820 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_18180 33863 34705 gene locus_tag LOCUS_18190 gene prcB 33863 34705 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_18190 34709 35392 gene locus_tag LOCUS_18200 gene prcA 34709 35392 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_18200 36196 35717 gene locus_tag LOCUS_18210 36196 35717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 36311 37045 gene locus_tag LOCUS_18220 36311 37045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 37042 37953 gene locus_tag LOCUS_18230 37042 37953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 38130 38627 gene locus_tag LOCUS_18240 38130 38627 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_18240 39368 38640 gene locus_tag LOCUS_18250 39368 38640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967367.1 protein_id gnl|my_center|LOCUS_18250 39600 39280 gene locus_tag LOCUS_18260 39600 39280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 39825 41420 gene locus_tag LOCUS_18270 39825 41420 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_18270 41720 42859 gene locus_tag LOCUS_18280 gene macA 41720 42859 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367497.1 protein_id gnl|my_center|LOCUS_18280 42880 43581 gene locus_tag LOCUS_18290 42880 43581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence033 884 1435 gene locus_tag LOCUS_18300 884 1435 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_18300 1524 2447 gene locus_tag LOCUS_18310 1524 2447 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_18310 2520 4103 gene locus_tag LOCUS_18320 2520 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5535 4222 gene locus_tag LOCUS_18330 5535 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5804 7486 gene locus_tag LOCUS_18340 5804 7486 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018013007.1 protein_id gnl|my_center|LOCUS_18340 7978 7538 gene locus_tag LOCUS_18350 7978 7538 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_18350 8118 10124 gene locus_tag LOCUS_18360 gene uvrB 8118 10124 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_18360 10517 10254 gene locus_tag LOCUS_18370 10517 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 11370 10717 gene locus_tag LOCUS_18380 11370 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 11631 13067 gene locus_tag LOCUS_18390 11631 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 13324 13629 gene locus_tag LOCUS_18400 13324 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 13748 14035 gene locus_tag LOCUS_18410 13748 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 14531 16000 gene locus_tag LOCUS_18420 14531 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 17758 16649 gene locus_tag LOCUS_18430 17758 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 18015 17812 gene locus_tag LOCUS_18440 18015 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 18254 18886 gene locus_tag LOCUS_18450 18254 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 18891 19574 gene locus_tag LOCUS_18460 18891 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 20085 19588 gene locus_tag LOCUS_18470 20085 19588 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_18470 22071 20122 gene locus_tag LOCUS_18480 22071 20122 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941238.1 protein_id gnl|my_center|LOCUS_18480 22584 22144 gene locus_tag LOCUS_18490 22584 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 22726 23220 gene locus_tag LOCUS_18500 22726 23220 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920750.1 protein_id gnl|my_center|LOCUS_18500 23561 23274 gene locus_tag LOCUS_18510 23561 23274 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980782.1 protein_id gnl|my_center|LOCUS_18510 24145 23729 gene locus_tag LOCUS_18520 24145 23729 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_18520 24654 25904 gene locus_tag LOCUS_18530 gene rho 24654 25904 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_18530 25981 26202 gene locus_tag LOCUS_18540 gene rpmE 25981 26202 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_18540 26477 27556 gene locus_tag LOCUS_18550 gene prfA 26477 27556 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_18550 27606 28502 gene locus_tag LOCUS_18560 gene prmC 27606 28502 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_18560 28519 29778 gene locus_tag LOCUS_18570 gene murA 28519 29778 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_18570 29775 30437 gene locus_tag LOCUS_18580 gene hisG 29775 30437 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_18580 30434 31717 gene locus_tag LOCUS_18590 gene hisD 30434 31717 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_18590 31708 32316 gene locus_tag LOCUS_18600 gene hisB 31708 32316 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_18600 32361 32984 gene locus_tag LOCUS_18610 gene hisH 32361 32984 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_18610 32990 33790 gene locus_tag LOCUS_18620 32990 33790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 33794 34540 gene locus_tag LOCUS_18630 gene hisA 33794 34540 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_18630 34534 35331 gene locus_tag LOCUS_18640 gene hisF 34534 35331 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_18640 35338 36033 gene locus_tag LOCUS_18650 gene hisIE 35338 36033 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887378.1 protein_id gnl|my_center|LOCUS_18650 36026 36370 gene locus_tag LOCUS_18660 36026 36370 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_18660 36469 38295 gene locus_tag LOCUS_18670 gene dnaG 36469 38295 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_18670 38387 38463 gene locus_tag LOCUS_t00270 38387 38463 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38526 39254 gene locus_tag LOCUS_18680 38526 39254 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_18680 39986 40063 gene locus_tag LOCUS_t00280 39986 40063 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 40512 41351 gene locus_tag LOCUS_18690 40512 41351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 41737 41393 gene locus_tag LOCUS_18700 41737 41393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 42259 43164 gene locus_tag LOCUS_18710 42259 43164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 43077 43334 gene locus_tag LOCUS_18720 43077 43334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence034 116 33 gene locus_tag LOCUS_t00290 116 33 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 228 923 gene locus_tag LOCUS_18730 228 923 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_18730 1169 1822 gene locus_tag LOCUS_18740 gene queE 1169 1822 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_18740 1878 3383 gene locus_tag LOCUS_18750 1878 3383 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_18750 3399 4487 gene locus_tag LOCUS_18760 gene nagZ 3399 4487 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_18760 4747 5148 gene locus_tag LOCUS_18770 4747 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5164 5643 gene locus_tag LOCUS_18780 5164 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5999 6406 gene locus_tag LOCUS_18790 5999 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7231 6479 gene locus_tag LOCUS_18800 7231 6479 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_18800 7662 7270 gene locus_tag LOCUS_18810 7662 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 8255 7785 gene locus_tag LOCUS_18820 8255 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8470 8276 gene locus_tag LOCUS_18830 8470 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 8433 9221 gene locus_tag LOCUS_18840 8433 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 9229 10002 gene locus_tag LOCUS_18850 9229 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 10577 10945 gene locus_tag LOCUS_18860 10577 10945 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_18860 11219 11473 gene locus_tag LOCUS_18870 11219 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 12543 12334 gene locus_tag LOCUS_18880 12543 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 12813 13964 gene locus_tag LOCUS_18890 12813 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 14079 14594 gene locus_tag LOCUS_18900 14079 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 14654 16558 gene locus_tag LOCUS_18910 14654 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 17281 16628 gene locus_tag LOCUS_18920 17281 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 17521 17778 gene locus_tag LOCUS_18930 17521 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 18347 18030 gene locus_tag LOCUS_18940 18347 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 18678 19529 gene locus_tag LOCUS_18950 18678 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 19580 20710 gene locus_tag LOCUS_18960 19580 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 20825 22228 gene locus_tag LOCUS_18970 20825 22228 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_18970 22554 22426 gene locus_tag LOCUS_18980 22554 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 23871 22723 gene locus_tag LOCUS_18990 gene der 23871 22723 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_18990 25074 24547 gene locus_tag LOCUS_19000 25074 24547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 26456 25074 gene locus_tag LOCUS_19010 26456 25074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 28548 26449 gene locus_tag LOCUS_19020 28548 26449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 29264 30415 gene locus_tag LOCUS_19030 gene metK 29264 30415 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_19030 30512 31894 gene locus_tag LOCUS_19040 gene ahcY 30512 31894 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_19040 32343 33197 gene locus_tag LOCUS_19050 32343 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 33408 34559 gene locus_tag LOCUS_19060 33408 34559 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_19060 34620 35558 gene locus_tag LOCUS_19070 gene argF 34620 35558 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_19070 35555 37045 gene locus_tag LOCUS_19080 gene argH 35555 37045 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_19080 37138 37302 gene locus_tag LOCUS_19090 37138 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 37388 39265 gene locus_tag LOCUS_19100 37388 39265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 39258 40520 gene locus_tag LOCUS_19110 gene lysA 39258 40520 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_19110 40616 41488 gene locus_tag LOCUS_19120 gene dapA 40616 41488 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_19120 41502 42305 gene locus_tag LOCUS_19130 gene dapB 41502 42305 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence035 155 886 gene locus_tag LOCUS_19140 155 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2685 1327 gene locus_tag LOCUS_19150 2685 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4219 3428 gene locus_tag LOCUS_19160 4219 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4614 5243 gene locus_tag LOCUS_19170 4614 5243 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_19170 5395 5973 gene locus_tag LOCUS_19180 5395 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 9247 6134 gene locus_tag LOCUS_19190 gene dnaE 9247 6134 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206523.1 protein_id gnl|my_center|LOCUS_19190 10778 9573 gene locus_tag LOCUS_19200 gene dinB 10778 9573 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_19200 11328 10786 gene locus_tag LOCUS_19210 gene lexA 11328 10786 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074200.1 protein_id gnl|my_center|LOCUS_19210 11709 12452 gene locus_tag LOCUS_19220 11709 12452 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819827.1 protein_id gnl|my_center|LOCUS_19220 13137 12571 gene locus_tag LOCUS_19230 13137 12571 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_19230 13248 13490 gene locus_tag LOCUS_19240 13248 13490 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_19240 13578 14036 gene locus_tag LOCUS_19250 13578 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 14214 15083 gene locus_tag LOCUS_19260 14214 15083 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_19260 15351 15929 gene locus_tag LOCUS_19270 15351 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 16387 17325 gene locus_tag LOCUS_19280 16387 17325 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_19280 18646 17612 gene locus_tag LOCUS_19290 18646 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 19669 18860 gene locus_tag LOCUS_19300 19669 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 20411 20100 gene locus_tag LOCUS_19310 20411 20100 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040743.1 protein_id gnl|my_center|LOCUS_19310 21500 20481 gene locus_tag LOCUS_19320 21500 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 22144 21668 gene locus_tag LOCUS_19330 22144 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 24286 22928 gene locus_tag LOCUS_19340 24286 22928 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447204.1 protein_id gnl|my_center|LOCUS_19340 25680 24283 gene locus_tag LOCUS_19350 25680 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 27365 29395 gene locus_tag LOCUS_19360 gene hyfB 27365 29395 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_19360 29405 30358 gene locus_tag LOCUS_19370 29405 30358 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_19370 30360 31028 gene locus_tag LOCUS_19380 30360 31028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_19380 31034 32518 gene locus_tag LOCUS_19390 31034 32518 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_19390 32568 32723 gene locus_tag LOCUS_19400 32568 32723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 32772 32999 gene locus_tag LOCUS_19410 32772 32999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 33006 34604 gene locus_tag LOCUS_19420 33006 34604 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_19420 34753 35304 gene locus_tag LOCUS_19430 34753 35304 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_19430 35426 36331 gene locus_tag LOCUS_19440 35426 36331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 36461 38191 gene locus_tag LOCUS_19450 36461 38191 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_19450 38448 39599 gene locus_tag LOCUS_19460 38448 39599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 40868 40050 gene locus_tag LOCUS_19470 40868 40050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 <42292 41077 gene locus_tag LOCUS_19480 <42292 41077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173822.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence036 1554 526 gene locus_tag LOCUS_19490 1554 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2245 1616 gene locus_tag LOCUS_19500 2245 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4573 2297 gene locus_tag LOCUS_19510 4573 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4948 5220 gene locus_tag LOCUS_19520 4948 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19520 5245 6492 gene locus_tag LOCUS_19530 gene ilvA 5245 6492 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19530 9947 8406 gene locus_tag LOCUS_19540 9947 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 11296 10325 gene locus_tag LOCUS_19550 11296 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 12263 12682 gene locus_tag LOCUS_19560 12263 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 12941 13195 gene locus_tag LOCUS_19570 12941 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 14345 13764 gene locus_tag LOCUS_19580 14345 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 14843 14361 gene locus_tag LOCUS_19590 14843 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 15697 17880 gene locus_tag LOCUS_19600 15697 17880 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_19600 18889 17897 gene locus_tag LOCUS_19610 18889 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 20615 20490 gene locus_tag LOCUS_19620 20615 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 21405 21070 gene locus_tag LOCUS_19630 21405 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 21762 21544 gene locus_tag LOCUS_19640 21762 21544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 22064 21804 gene locus_tag LOCUS_19650 22064 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 24749 22146 gene locus_tag LOCUS_19660 24749 22146 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_19660 25271 24879 gene locus_tag LOCUS_19670 25271 24879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 25606 25301 gene locus_tag LOCUS_19680 25606 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 25864 25625 gene locus_tag LOCUS_19690 25864 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 26770 26093 gene locus_tag LOCUS_19700 26770 26093 CDS product low-co2 inducible protein lcib inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544972.1 protein_id gnl|my_center|LOCUS_19700 27895 26828 gene locus_tag LOCUS_19710 gene cax 27895 26828 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_19710 28719 28904 gene locus_tag LOCUS_19720 28719 28904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 28837 30060 gene locus_tag LOCUS_19730 28837 30060 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_19730 30169 31437 gene locus_tag LOCUS_19740 30169 31437 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_19740 31567 32343 gene locus_tag LOCUS_19750 31567 32343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_19750 32378 32791 gene locus_tag LOCUS_19760 32378 32791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 33318 33139 gene locus_tag LOCUS_19770 33318 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 33461 34039 gene locus_tag LOCUS_19780 33461 34039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 34049 34222 gene locus_tag LOCUS_19790 34049 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 34764 34429 gene locus_tag LOCUS_19800 34764 34429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 35214 34777 gene locus_tag LOCUS_19810 35214 34777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 35879 35259 gene locus_tag LOCUS_19820 35879 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 36382 36564 gene locus_tag LOCUS_19830 36382 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 37917 36880 gene locus_tag LOCUS_19840 37917 36880 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_19840 39642 38386 gene locus_tag LOCUS_19850 39642 38386 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_19850 40532 39819 gene locus_tag LOCUS_19860 40532 39819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 41659 40946 gene locus_tag LOCUS_19870 41659 40946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence037 <1 1597 gene locus_tag LOCUS_19880 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265970.1:TonB-dependent receptor 1777 2187 gene locus_tag LOCUS_19890 1777 2187 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_19890 2201 2563 gene locus_tag LOCUS_19900 2201 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2804 3010 gene locus_tag LOCUS_19910 2804 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3776 4333 gene locus_tag LOCUS_19920 3776 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 4530 5081 gene locus_tag LOCUS_19930 4530 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 5189 5004 gene locus_tag LOCUS_19940 5189 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5738 6379 gene locus_tag LOCUS_19950 5738 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6706 7518 gene locus_tag LOCUS_19960 6706 7518 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928939.1 protein_id gnl|my_center|LOCUS_19960 7723 8112 gene locus_tag LOCUS_19970 7723 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 8891 8235 gene locus_tag LOCUS_19980 8891 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 10750 9530 gene locus_tag LOCUS_19990 10750 9530 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_19990 11903 11349 gene locus_tag LOCUS_20000 11903 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 13325 12939 gene locus_tag LOCUS_20010 13325 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 13513 16677 gene locus_tag LOCUS_20020 13513 16677 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_20020 17026 18390 gene locus_tag LOCUS_20030 17026 18390 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_20030 18620 18417 gene locus_tag LOCUS_20040 18620 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 18567 19544 gene locus_tag LOCUS_20050 18567 19544 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_20050 20530 21813 gene locus_tag LOCUS_20060 20530 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 21855 22337 gene locus_tag LOCUS_20070 21855 22337 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_20070 22861 25176 gene locus_tag LOCUS_20080 22861 25176 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_20080 26037 26531 gene locus_tag LOCUS_20090 26037 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 26817 27893 gene locus_tag LOCUS_20100 26817 27893 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883331.1 protein_id gnl|my_center|LOCUS_20100 28373 29692 gene locus_tag LOCUS_20110 28373 29692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 29770 30303 gene locus_tag LOCUS_20120 29770 30303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 30300 30878 gene locus_tag LOCUS_20130 30300 30878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 32916 31396 gene locus_tag LOCUS_20140 32916 31396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_20140 33176 33781 gene locus_tag LOCUS_20150 33176 33781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 33807 34130 gene locus_tag LOCUS_20160 33807 34130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 34603 35214 gene locus_tag LOCUS_20170 34603 35214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 36062 35442 gene locus_tag LOCUS_20180 36062 35442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 37220 36735 gene locus_tag LOCUS_20190 37220 36735 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_20190 38021 37353 gene locus_tag LOCUS_20200 38021 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 38813 38241 gene locus_tag LOCUS_20210 38813 38241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 39717 40634 gene locus_tag LOCUS_20220 39717 40634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 40845 41177 gene locus_tag LOCUS_20230 40845 41177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 <42224 41273 gene locus_tag LOCUS_20240 <42224 41273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119568.1:NAD(P)-dependent oxidoreductase >Feature sequence038 552 235 gene locus_tag LOCUS_20250 552 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1389 943 gene locus_tag LOCUS_20260 1389 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1975 1589 gene locus_tag LOCUS_20270 1975 1589 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_20270 2119 2310 gene locus_tag LOCUS_20280 2119 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2676 2242 gene locus_tag LOCUS_20290 2676 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2857 3828 gene locus_tag LOCUS_20300 2857 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4750 3866 gene locus_tag LOCUS_20310 4750 3866 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_20310 5792 4833 gene locus_tag LOCUS_20320 5792 4833 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_20320 7623 5908 gene locus_tag LOCUS_20330 7623 5908 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_20330 8832 7693 gene locus_tag LOCUS_20340 8832 7693 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_20340 9045 9620 gene locus_tag LOCUS_20350 9045 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 9793 9656 gene locus_tag LOCUS_20360 9793 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 10016 10357 gene locus_tag LOCUS_20370 10016 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 11428 10826 gene locus_tag LOCUS_20380 11428 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 13189 11957 gene locus_tag LOCUS_20390 13189 11957 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_20390 15522 13690 gene locus_tag LOCUS_20400 15522 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 18286 15746 gene locus_tag LOCUS_20410 18286 15746 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117769.1 protein_id gnl|my_center|LOCUS_20410 24048 18286 gene locus_tag LOCUS_20420 24048 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 24837 26513 gene locus_tag LOCUS_20430 24837 26513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 26510 27367 gene locus_tag LOCUS_20440 26510 27367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 27418 28860 gene locus_tag LOCUS_20450 27418 28860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 28860 30989 gene locus_tag LOCUS_20460 28860 30989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 32778 31912 gene locus_tag LOCUS_20470 32778 31912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 34427 33075 gene locus_tag LOCUS_20480 34427 33075 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 protein_id gnl|my_center|LOCUS_20480 34489 34668 gene locus_tag LOCUS_20490 34489 34668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 35540 34650 gene locus_tag LOCUS_20500 35540 34650 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20500 35656 35781 gene locus_tag LOCUS_20510 35656 35781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 35927 36469 gene locus_tag LOCUS_20520 35927 36469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 37147 36620 gene locus_tag LOCUS_20530 37147 36620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 37701 37438 gene locus_tag LOCUS_20540 37701 37438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 38157 38834 gene locus_tag LOCUS_20550 38157 38834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence039 1114 302 gene locus_tag LOCUS_20560 1114 302 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902591.1 protein_id gnl|my_center|LOCUS_20560 1226 1399 gene locus_tag LOCUS_20570 1226 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3361 1907 gene locus_tag LOCUS_20580 3361 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 5092 3905 gene locus_tag LOCUS_20590 5092 3905 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338153.1 protein_id gnl|my_center|LOCUS_20590 7241 5592 gene locus_tag LOCUS_20600 gene pgm 7241 5592 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967369.1 protein_id gnl|my_center|LOCUS_20600 7590 8645 gene locus_tag LOCUS_20610 7590 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 10314 11675 gene locus_tag LOCUS_20620 10314 11675 CDS product AGCS family amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447623.1 protein_id gnl|my_center|LOCUS_20620 11999 11757 gene locus_tag LOCUS_20630 11999 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 14511 12151 gene locus_tag LOCUS_20640 14511 12151 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_20640 15403 14426 gene locus_tag LOCUS_20650 gene fdhD 15403 14426 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_20650 15669 15484 gene locus_tag LOCUS_20660 15669 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 15731 17164 gene locus_tag LOCUS_20670 15731 17164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_20670 18595 17333 gene locus_tag LOCUS_20680 18595 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 18989 18741 gene locus_tag LOCUS_20690 18989 18741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 19139 23572 gene locus_tag LOCUS_20700 19139 23572 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_20700 23584 24594 gene locus_tag LOCUS_20710 23584 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 25081 25638 gene locus_tag LOCUS_20720 25081 25638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 25817 26047 gene locus_tag LOCUS_20730 25817 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 28079 26187 gene locus_tag LOCUS_20740 28079 26187 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_20740 28247 29167 gene locus_tag LOCUS_20750 28247 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 29520 29125 gene locus_tag LOCUS_20760 29520 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 29791 29624 gene locus_tag LOCUS_20770 29791 29624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 30038 31303 gene locus_tag LOCUS_20780 30038 31303 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_20780 31528 32178 gene locus_tag LOCUS_20790 31528 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 32374 32937 gene locus_tag LOCUS_20800 gene mug 32374 32937 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_20800 33087 34154 gene locus_tag LOCUS_20810 33087 34154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 34513 34851 gene locus_tag LOCUS_20820 34513 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 35412 36623 gene locus_tag LOCUS_20830 35412 36623 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_20830 36927 38735 gene locus_tag LOCUS_20840 36927 38735 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723429.1 protein_id gnl|my_center|LOCUS_20840 38825 39424 gene locus_tag LOCUS_20850 38825 39424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence040 1155 1430 gene locus_tag LOCUS_20860 1155 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2458 1667 gene locus_tag LOCUS_20870 2458 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3414 2746 gene locus_tag LOCUS_20880 gene crp 3414 2746 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 protein_id gnl|my_center|LOCUS_20880 3756 3681 gene locus_tag LOCUS_t00300 3756 3681 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4124 3861 gene locus_tag LOCUS_20890 4124 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 4519 4241 gene locus_tag LOCUS_20900 4519 4241 CDS product ferredoxin oxidoreductase 2 subunit ForD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880734.1 protein_id gnl|my_center|LOCUS_20900 5260 4556 gene locus_tag LOCUS_20910 5260 4556 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880758.1 protein_id gnl|my_center|LOCUS_20910 6197 5289 gene locus_tag LOCUS_20920 6197 5289 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880757.1 protein_id gnl|my_center|LOCUS_20920 7467 6256 gene locus_tag LOCUS_20930 7467 6256 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880756.1 protein_id gnl|my_center|LOCUS_20930 8227 7601 gene locus_tag LOCUS_20940 8227 7601 CDS product carbon monoxide dehydrogenase beta subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930681.1 protein_id gnl|my_center|LOCUS_20940 9073 8594 gene locus_tag LOCUS_20950 9073 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 9170 9994 gene locus_tag LOCUS_20960 9170 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 10107 11390 gene locus_tag LOCUS_20970 gene trmFO 10107 11390 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_20970 11390 12337 gene locus_tag LOCUS_20980 gene xerC 11390 12337 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_20980 12334 12870 gene locus_tag LOCUS_20990 gene hslV 12334 12870 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_20990 12874 14277 gene locus_tag LOCUS_21000 gene hslU 12874 14277 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_21000 14361 15254 gene locus_tag LOCUS_21010 gene argB 14361 15254 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 protein_id gnl|my_center|LOCUS_21010 15260 15913 gene locus_tag LOCUS_21020 15260 15913 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_21020 17785 16958 gene locus_tag LOCUS_21030 17785 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 17921 18097 gene locus_tag LOCUS_21040 17921 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 20434 18293 gene locus_tag LOCUS_21050 20434 18293 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089694.1 protein_id gnl|my_center|LOCUS_21050 21528 20926 gene locus_tag LOCUS_21060 21528 20926 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_21060 22107 23147 gene locus_tag LOCUS_21070 gene hflK 22107 23147 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_21070 23144 24001 gene locus_tag LOCUS_21080 23144 24001 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_21080 24073 24738 gene locus_tag LOCUS_21090 24073 24738 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055879.1 protein_id gnl|my_center|LOCUS_21090 27099 24964 gene locus_tag LOCUS_21100 27099 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 27335 27165 gene locus_tag LOCUS_21110 27335 27165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 27395 27574 gene locus_tag LOCUS_21120 27395 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 27838 27560 gene locus_tag LOCUS_21130 27838 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 29349 28420 gene locus_tag LOCUS_21140 29349 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 30168 29410 gene locus_tag LOCUS_21150 30168 29410 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_21150 31650 30424 gene locus_tag LOCUS_21160 31650 30424 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_21160 32325 32014 gene locus_tag LOCUS_21170 32325 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 34268 32379 gene locus_tag LOCUS_21180 34268 32379 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_21180 34771 34337 gene locus_tag LOCUS_21190 34771 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 35035 37323 gene locus_tag LOCUS_21200 gene recQ 35035 37323 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_21200 38346 37570 gene locus_tag LOCUS_21210 38346 37570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence041 2716 86 gene locus_tag LOCUS_21220 2716 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3501 3271 gene locus_tag LOCUS_21230 3501 3271 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_21230 4122 3676 gene locus_tag LOCUS_21240 4122 3676 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_21240 5742 4261 gene locus_tag LOCUS_21250 5742 4261 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_21250 6775 5753 gene locus_tag LOCUS_21260 6775 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 7516 6776 gene locus_tag LOCUS_21270 7516 6776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525001.1 protein_id gnl|my_center|LOCUS_21270 8654 7521 gene locus_tag LOCUS_21280 8654 7521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_21280 9325 8651 gene locus_tag LOCUS_21290 9325 8651 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943368.1 protein_id gnl|my_center|LOCUS_21290 9473 9234 gene locus_tag LOCUS_21300 9473 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 9724 12165 gene locus_tag LOCUS_21310 gene lon 9724 12165 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_21310 12680 12225 gene locus_tag LOCUS_21320 12680 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 13364 14200 gene locus_tag LOCUS_21330 13364 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 14296 15396 gene locus_tag LOCUS_21340 14296 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 15639 16055 gene locus_tag LOCUS_21350 15639 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 16602 16312 gene locus_tag LOCUS_21360 16602 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 17307 16678 gene locus_tag LOCUS_21370 17307 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 17785 17333 gene locus_tag LOCUS_21380 17785 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 18637 18374 gene locus_tag LOCUS_21390 18637 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 19548 18775 gene locus_tag LOCUS_21400 19548 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 20994 20197 gene locus_tag LOCUS_21410 20994 20197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 23210 21642 gene locus_tag LOCUS_21420 23210 21642 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_21420 25236 23203 gene locus_tag LOCUS_21430 25236 23203 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_21430 26886 25375 gene locus_tag LOCUS_21440 26886 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 27151 26891 gene locus_tag LOCUS_21450 27151 26891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 27272 27496 gene locus_tag LOCUS_21460 27272 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 28250 27924 gene locus_tag LOCUS_21470 28250 27924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 28883 28668 gene locus_tag LOCUS_21480 28883 28668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 29119 28925 gene locus_tag LOCUS_21490 29119 28925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 29369 30403 gene locus_tag LOCUS_21500 29369 30403 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_21500 31439 30411 gene locus_tag LOCUS_21510 31439 30411 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_21510 31912 33345 gene locus_tag LOCUS_21520 31912 33345 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_21520 33429 35843 gene locus_tag LOCUS_21530 33429 35843 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 protein_id gnl|my_center|LOCUS_21530 35912 37855 gene locus_tag LOCUS_21540 35912 37855 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence042 417 166 gene locus_tag LOCUS_21550 417 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 773 1267 gene locus_tag LOCUS_21560 773 1267 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_21560 1395 1937 gene locus_tag LOCUS_21570 1395 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2050 2733 gene locus_tag LOCUS_21580 2050 2733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063813.1 protein_id gnl|my_center|LOCUS_21580 2815 3162 gene locus_tag LOCUS_21590 2815 3162 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_21590 3277 3576 gene locus_tag LOCUS_21600 3277 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3592 4464 gene locus_tag LOCUS_21610 3592 4464 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_21610 4736 6010 gene locus_tag LOCUS_21620 4736 6010 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_21620 6007 9177 gene locus_tag LOCUS_21630 6007 9177 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_21630 9179 10615 gene locus_tag LOCUS_21640 gene oprM 9179 10615 CDS product multidrug efflux RND transporter outer membrane channel subunit OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084633.1 protein_id gnl|my_center|LOCUS_21640 11665 13116 gene locus_tag LOCUS_21650 11665 13116 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_21650 13152 14198 gene locus_tag LOCUS_21660 gene gmd 13152 14198 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_21660 14349 15290 gene locus_tag LOCUS_21670 14349 15290 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_21670 15287 16123 gene locus_tag LOCUS_21680 15287 16123 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340251.1 protein_id gnl|my_center|LOCUS_21680 16412 17389 gene locus_tag LOCUS_21690 16412 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 18108 18680 gene locus_tag LOCUS_21700 18108 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 19103 18936 gene locus_tag LOCUS_21710 19103 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 20393 21181 gene locus_tag LOCUS_21720 20393 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 21234 22583 gene locus_tag LOCUS_21730 21234 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 23589 24842 gene locus_tag LOCUS_21740 23589 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 24988 26190 gene locus_tag LOCUS_21750 24988 26190 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119434.1 protein_id gnl|my_center|LOCUS_21750 26241 27581 gene locus_tag LOCUS_21760 26241 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 29492 27822 gene locus_tag LOCUS_21770 29492 27822 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920642.1 protein_id gnl|my_center|LOCUS_21770 31362 30031 gene locus_tag LOCUS_21780 31362 30031 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920642.1 protein_id gnl|my_center|LOCUS_21780 32757 31999 gene locus_tag LOCUS_21790 32757 31999 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966321.1 protein_id gnl|my_center|LOCUS_21790 34409 32949 gene locus_tag LOCUS_21800 34409 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 36903 34633 gene locus_tag LOCUS_21810 36903 34633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 37177 37341 gene locus_tag LOCUS_21820 37177 37341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence043 1528 173 gene locus_tag LOCUS_21830 1528 173 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_21830 2856 1975 gene locus_tag LOCUS_21840 2856 1975 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_21840 4046 3261 gene locus_tag LOCUS_21850 4046 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 5373 4108 gene locus_tag LOCUS_21860 5373 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 7056 5584 gene locus_tag LOCUS_21870 7056 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 7111 7794 gene locus_tag LOCUS_21880 7111 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 8057 9241 gene locus_tag LOCUS_21890 8057 9241 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_21890 9294 12002 gene locus_tag LOCUS_21900 9294 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 12455 12195 gene locus_tag LOCUS_21910 12455 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 14143 13031 gene locus_tag LOCUS_21920 14143 13031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939402.1 protein_id gnl|my_center|LOCUS_21920 15161 14208 gene locus_tag LOCUS_21930 15161 14208 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 protein_id gnl|my_center|LOCUS_21930 16148 15171 gene locus_tag LOCUS_21940 16148 15171 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_21940 17564 16239 gene locus_tag LOCUS_21950 17564 16239 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_21950 18854 17601 gene locus_tag LOCUS_21960 18854 17601 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_21960 19284 18856 gene locus_tag LOCUS_21970 19284 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 20774 19311 gene locus_tag LOCUS_21980 20774 19311 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_21980 21699 20857 gene locus_tag LOCUS_21990 21699 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 22406 21879 gene locus_tag LOCUS_22000 22406 21879 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_22000 23576 23385 gene locus_tag LOCUS_22010 23576 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 23992 23789 gene locus_tag LOCUS_22020 23992 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 24320 24147 gene locus_tag LOCUS_22030 24320 24147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 24594 24358 gene locus_tag LOCUS_22040 24594 24358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 25670 26584 gene locus_tag LOCUS_22050 25670 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 27344 28144 gene locus_tag LOCUS_22060 27344 28144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 28162 29187 gene locus_tag LOCUS_22070 28162 29187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 30618 29476 gene locus_tag LOCUS_22080 30618 29476 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402810.1 protein_id gnl|my_center|LOCUS_22080 32360 30930 gene locus_tag LOCUS_22090 32360 30930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 33164 32412 gene locus_tag LOCUS_22100 33164 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 35738 33795 gene locus_tag LOCUS_22110 35738 33795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 <36622 35953 gene locus_tag LOCUS_22120 <36622 35953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143692.1:NDP-sugar synthase >Feature sequence044 597 25 gene locus_tag LOCUS_22130 597 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2988 652 gene locus_tag LOCUS_22140 gene bamA 2988 652 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_22140 3548 6022 gene locus_tag LOCUS_22150 gene lon 3548 6022 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_22150 6032 7075 gene locus_tag LOCUS_22160 gene thiL 6032 7075 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_22160 7097 7546 gene locus_tag LOCUS_22170 7097 7546 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941058.1 protein_id gnl|my_center|LOCUS_22170 7669 9093 gene locus_tag LOCUS_22180 7669 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 10603 9149 gene locus_tag LOCUS_22190 10603 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 11429 10824 gene locus_tag LOCUS_22200 11429 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 11766 11515 gene locus_tag LOCUS_22210 11766 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 12063 11809 gene locus_tag LOCUS_22220 12063 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 12394 12080 gene locus_tag LOCUS_22230 12394 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 12800 12408 gene locus_tag LOCUS_22240 gene fliS 12800 12408 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_22240 14231 12816 gene locus_tag LOCUS_22250 gene fliD 14231 12816 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146762.1 protein_id gnl|my_center|LOCUS_22250 14696 14361 gene locus_tag LOCUS_22260 14696 14361 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_22260 15655 14828 gene locus_tag LOCUS_22270 15655 14828 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_22270 16504 15956 gene locus_tag LOCUS_22280 16504 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 18140 16485 gene locus_tag LOCUS_22290 18140 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 19997 18180 gene locus_tag LOCUS_22300 19997 18180 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044916.1 protein_id gnl|my_center|LOCUS_22300 21304 20069 gene locus_tag LOCUS_22310 21304 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 26533 21338 gene locus_tag LOCUS_22320 26533 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 27570 26557 gene locus_tag LOCUS_22330 27570 26557 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143781.1 protein_id gnl|my_center|LOCUS_22330 28120 27563 gene locus_tag LOCUS_22340 28120 27563 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858190.1 protein_id gnl|my_center|LOCUS_22340 29108 28080 gene locus_tag LOCUS_22350 29108 28080 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_22350 29899 29138 gene locus_tag LOCUS_22360 29899 29138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 30870 29899 gene locus_tag LOCUS_22370 30870 29899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 32004 30889 gene locus_tag LOCUS_22380 32004 30889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 32487 32020 gene locus_tag LOCUS_22390 32487 32020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 33469 32459 gene locus_tag LOCUS_22400 33469 32459 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_22400 34445 33501 gene locus_tag LOCUS_22410 34445 33501 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_22410 35301 34435 gene locus_tag LOCUS_22420 35301 34435 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_22420 35803 35303 gene locus_tag LOCUS_22430 35803 35303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence045 389 216 gene locus_tag LOCUS_22440 389 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 638 1981 gene locus_tag LOCUS_22450 gene chrA 638 1981 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_22450 2065 2562 gene locus_tag LOCUS_22460 gene sixA 2065 2562 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_22460 3066 2674 gene locus_tag LOCUS_22470 3066 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4949 3390 gene locus_tag LOCUS_22480 4949 3390 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933376.1 protein_id gnl|my_center|LOCUS_22480 5363 5043 gene locus_tag LOCUS_22490 5363 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6426 5629 gene locus_tag LOCUS_22500 6426 5629 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_22500 6880 8322 gene locus_tag LOCUS_22510 6880 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8450 10609 gene locus_tag LOCUS_22520 gene ppk1 8450 10609 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870306.1 protein_id gnl|my_center|LOCUS_22520 10874 10668 gene locus_tag LOCUS_22530 10874 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 12099 11032 gene locus_tag LOCUS_22540 12099 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 12861 13400 gene locus_tag LOCUS_22550 12861 13400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 14343 13489 gene locus_tag LOCUS_22560 14343 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 15736 16362 gene locus_tag LOCUS_22570 15736 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 17250 16588 gene locus_tag LOCUS_22580 gene phoU 17250 16588 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_22580 18188 17280 gene locus_tag LOCUS_22590 gene pstB 18188 17280 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_22590 19833 18202 gene locus_tag LOCUS_22600 gene pstA 19833 18202 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_22600 22100 19845 gene locus_tag LOCUS_22610 22100 19845 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_22610 23273 22263 gene locus_tag LOCUS_22620 gene pstS 23273 22263 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_22620 23662 23351 gene locus_tag LOCUS_22630 23662 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 26119 24227 gene locus_tag LOCUS_22640 26119 24227 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_22640 27870 26488 gene locus_tag LOCUS_22650 27870 26488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_22650 28592 27900 gene locus_tag LOCUS_22660 28592 27900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_22660 30361 28871 gene locus_tag LOCUS_22670 30361 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 30871 33165 gene locus_tag LOCUS_22680 30871 33165 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390989.1 protein_id gnl|my_center|LOCUS_22680 33284 35251 gene locus_tag LOCUS_22690 33284 35251 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence046 947 2203 gene locus_tag LOCUS_22700 947 2203 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_22700 2648 2800 gene locus_tag LOCUS_22710 2648 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3138 4406 gene locus_tag LOCUS_22720 3138 4406 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_22720 4863 6065 gene locus_tag LOCUS_22730 4863 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 6222 6941 gene locus_tag LOCUS_22740 6222 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 7828 8244 gene locus_tag LOCUS_22750 7828 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 8515 9693 gene locus_tag LOCUS_22760 8515 9693 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_22760 9707 10843 gene locus_tag LOCUS_22770 9707 10843 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_22770 11403 11185 gene locus_tag LOCUS_22780 11403 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 12251 14431 gene locus_tag LOCUS_22790 12251 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 15586 16794 gene locus_tag LOCUS_22800 15586 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 18130 19164 gene locus_tag LOCUS_22810 18130 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 19282 19992 gene locus_tag LOCUS_22820 19282 19992 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 protein_id gnl|my_center|LOCUS_22820 20037 21110 gene locus_tag LOCUS_22830 gene exoA 20037 21110 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061866.1 protein_id gnl|my_center|LOCUS_22830 21680 23305 gene locus_tag LOCUS_22840 21680 23305 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_22840 23314 24477 gene locus_tag LOCUS_22850 23314 24477 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_22850 24477 25634 gene locus_tag LOCUS_22860 gene pseC 24477 25634 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_22860 25804 28338 gene locus_tag LOCUS_22870 25804 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 28748 29443 gene locus_tag LOCUS_22880 28748 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 29744 30832 gene locus_tag LOCUS_22890 29744 30832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 30836 32314 gene locus_tag LOCUS_22900 30836 32314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 32424 33695 gene locus_tag LOCUS_22910 32424 33695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 33705 34481 gene locus_tag LOCUS_22920 33705 34481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence047 2854 542 gene locus_tag LOCUS_22930 2854 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3584 3207 gene locus_tag LOCUS_22940 3584 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4825 4043 gene locus_tag LOCUS_22950 4825 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5319 5092 gene locus_tag LOCUS_22960 5319 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5592 5347 gene locus_tag LOCUS_22970 5592 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7420 5834 gene locus_tag LOCUS_22980 7420 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7696 8691 gene locus_tag LOCUS_22990 7696 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 9923 9090 gene locus_tag LOCUS_23000 9923 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 10473 12230 gene locus_tag LOCUS_23010 10473 12230 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_23010 12357 13100 gene locus_tag LOCUS_23020 12357 13100 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_23020 13185 13385 gene locus_tag LOCUS_23030 gene thiS 13185 13385 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_23030 13382 14311 gene locus_tag LOCUS_23040 gene cysK 13382 14311 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_23040 14530 15360 gene locus_tag LOCUS_23050 gene moeB 14530 15360 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_23050 15392 16630 gene locus_tag LOCUS_23060 gene thrC 15392 16630 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_23060 16627 16902 gene locus_tag LOCUS_23070 16627 16902 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_23070 16902 17141 gene locus_tag LOCUS_23080 16902 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 17156 17956 gene locus_tag LOCUS_23090 gene thiF 17156 17956 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_23090 17961 18470 gene locus_tag LOCUS_23100 17961 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 18582 18932 gene locus_tag LOCUS_23110 18582 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 20309 19110 gene locus_tag LOCUS_23120 20309 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 21100 20405 gene locus_tag LOCUS_23130 21100 20405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 21602 21078 gene locus_tag LOCUS_23140 21602 21078 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_23140 22765 21626 gene locus_tag LOCUS_23150 22765 21626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 23549 22749 gene locus_tag LOCUS_23160 gene tatC 23549 22749 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_23160 23832 23587 gene locus_tag LOCUS_23170 23832 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 24434 23826 gene locus_tag LOCUS_23180 24434 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 25176 24481 gene locus_tag LOCUS_23190 gene tsaB 25176 24481 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_23190 26017 25232 gene locus_tag LOCUS_23200 26017 25232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 27427 26045 gene locus_tag LOCUS_23210 gene radA 27427 26045 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_23210 28406 27537 gene locus_tag LOCUS_23220 28406 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 28701 28435 gene locus_tag LOCUS_23230 28701 28435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 29126 28806 gene locus_tag LOCUS_23240 29126 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23240 29421 29140 gene locus_tag LOCUS_23250 29421 29140 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256489.1 protein_id gnl|my_center|LOCUS_23250 29816 29421 gene locus_tag LOCUS_23260 29816 29421 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545617.1 protein_id gnl|my_center|LOCUS_23260 29926 30699 gene locus_tag LOCUS_23270 29926 30699 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545335.1 protein_id gnl|my_center|LOCUS_23270 30696 31475 gene locus_tag LOCUS_23280 30696 31475 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_23280 32237 31497 gene locus_tag LOCUS_23290 32237 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525542.1 protein_id gnl|my_center|LOCUS_23290 32466 33134 gene locus_tag LOCUS_23300 32466 33134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 34945 33215 gene locus_tag LOCUS_23310 gene recN 34945 33215 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence048 995 795 gene locus_tag LOCUS_23320 995 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1847 996 gene locus_tag LOCUS_23330 1847 996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176150.1 protein_id gnl|my_center|LOCUS_23330 2173 1883 gene locus_tag LOCUS_23340 2173 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2948 2409 gene locus_tag LOCUS_23350 2948 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3415 3032 gene locus_tag LOCUS_23360 3415 3032 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_23360 5713 3650 gene locus_tag LOCUS_23370 5713 3650 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388079.1 protein_id gnl|my_center|LOCUS_23370 7289 6462 gene locus_tag LOCUS_23380 7289 6462 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_23380 8277 7303 gene locus_tag LOCUS_23390 8277 7303 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_23390 9465 8467 gene locus_tag LOCUS_23400 9465 8467 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_23400 9891 10244 gene locus_tag LOCUS_23410 9891 10244 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_23410 10262 10456 gene locus_tag LOCUS_23420 10262 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 11492 10479 gene locus_tag LOCUS_23430 11492 10479 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971319.1 protein_id gnl|my_center|LOCUS_23430 12182 11643 gene locus_tag LOCUS_23440 12182 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 12741 14243 gene locus_tag LOCUS_23450 12741 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 14841 14341 gene locus_tag LOCUS_23460 14841 14341 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389113.1 protein_id gnl|my_center|LOCUS_23460 15961 14930 gene locus_tag LOCUS_23470 15961 14930 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202064.1 protein_id gnl|my_center|LOCUS_23470 17989 16619 gene locus_tag LOCUS_23480 17989 16619 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_23480 18178 19803 gene locus_tag LOCUS_23490 18178 19803 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 protein_id gnl|my_center|LOCUS_23490 19985 20806 gene locus_tag LOCUS_23500 19985 20806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_23500 21030 21839 gene locus_tag LOCUS_23510 21030 21839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_23510 22570 21938 gene locus_tag LOCUS_23520 22570 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 23652 22732 gene locus_tag LOCUS_23530 23652 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 28668 23785 gene locus_tag LOCUS_23540 28668 23785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 30535 29117 gene locus_tag LOCUS_23550 30535 29117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 30990 30568 gene locus_tag LOCUS_23560 30990 30568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_23560 32078 31596 gene locus_tag LOCUS_23570 32078 31596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 33530 32529 gene locus_tag LOCUS_23580 33530 32529 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence049 738 968 gene locus_tag LOCUS_23590 738 968 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_23590 1592 1819 gene locus_tag LOCUS_23600 1592 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3007 1736 gene locus_tag LOCUS_23610 3007 1736 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_23610 4289 3351 gene locus_tag LOCUS_23620 4289 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180941789.1 protein_id gnl|my_center|LOCUS_23620 4276 4479 gene locus_tag LOCUS_23630 4276 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 5631 5239 gene locus_tag LOCUS_23640 5631 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 5882 5628 gene locus_tag LOCUS_23650 5882 5628 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_23650 7084 6353 gene locus_tag LOCUS_23660 7084 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 7790 7975 gene locus_tag LOCUS_23670 7790 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 9264 8743 gene locus_tag LOCUS_23680 9264 8743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392328.1 protein_id gnl|my_center|LOCUS_23680 9715 9299 gene locus_tag LOCUS_23690 9715 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 10365 11435 gene locus_tag LOCUS_23700 10365 11435 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_23700 11582 11860 gene locus_tag LOCUS_23710 11582 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 11970 12620 gene locus_tag LOCUS_23720 11970 12620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 12960 13184 gene locus_tag LOCUS_23730 12960 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 13174 16320 gene locus_tag LOCUS_23740 13174 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 19000 16400 gene locus_tag LOCUS_23750 gene clpB 19000 16400 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_23750 20824 19190 gene locus_tag LOCUS_23760 20824 19190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 20897 23143 gene locus_tag LOCUS_23770 20897 23143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 24657 23248 gene locus_tag LOCUS_23780 gene glnA 24657 23248 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_23780 26113 24800 gene locus_tag LOCUS_23790 26113 24800 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_23790 26496 26158 gene locus_tag LOCUS_23800 26496 26158 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_23800 27925 26612 gene locus_tag LOCUS_23810 27925 26612 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_23810 29173 27950 gene locus_tag LOCUS_23820 29173 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 29720 30649 gene locus_tag LOCUS_23830 29720 30649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 31078 30656 gene locus_tag LOCUS_23840 31078 30656 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_23840 31334 31113 gene locus_tag LOCUS_23850 31334 31113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 31896 31387 gene locus_tag LOCUS_23860 31896 31387 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_23860 32985 33248 gene locus_tag LOCUS_23870 32985 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence050 698 1063 gene locus_tag LOCUS_23880 698 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1201 2298 gene locus_tag LOCUS_23890 1201 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23890 2314 3405 gene locus_tag LOCUS_23900 2314 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3420 4190 gene locus_tag LOCUS_23910 3420 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 4248 4916 gene locus_tag LOCUS_23920 4248 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 6384 5053 gene locus_tag LOCUS_23930 6384 5053 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_23930 6537 6611 gene locus_tag LOCUS_t00310 6537 6611 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7047 7250 gene locus_tag LOCUS_23940 7047 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 7898 9487 gene locus_tag LOCUS_23950 7898 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 9609 10535 gene locus_tag LOCUS_23960 9609 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10619 13621 gene locus_tag LOCUS_23970 10619 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 13837 15186 gene locus_tag LOCUS_23980 13837 15186 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_23980 15345 18632 gene locus_tag LOCUS_23990 15345 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 19139 18987 gene locus_tag LOCUS_24000 19139 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 20508 19297 gene locus_tag LOCUS_24010 20508 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 20844 21863 gene locus_tag LOCUS_24020 20844 21863 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_24020 21910 22155 gene locus_tag LOCUS_24030 21910 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 22444 22635 gene locus_tag LOCUS_24040 22444 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 23381 22719 gene locus_tag LOCUS_24050 23381 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 23630 24304 gene locus_tag LOCUS_24060 23630 24304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_24060 24301 26961 gene locus_tag LOCUS_24070 24301 26961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_24070 27280 27468 gene locus_tag LOCUS_24080 27280 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 27580 28017 gene locus_tag LOCUS_24090 27580 28017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 29915 28065 gene locus_tag LOCUS_24100 29915 28065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 30078 32936 gene locus_tag LOCUS_24110 gene polA 30078 32936 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_24110 32979 33266 gene locus_tag LOCUS_24120 32979 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence051 1946 2476 gene locus_tag LOCUS_24130 1946 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 3399 2590 gene locus_tag LOCUS_24140 3399 2590 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_24140 4228 3704 gene locus_tag LOCUS_24150 4228 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4792 5913 gene locus_tag LOCUS_24160 gene rlmN 4792 5913 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_24160 5900 6727 gene locus_tag LOCUS_24170 gene larE 5900 6727 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_24170 7437 6931 gene locus_tag LOCUS_24180 gene atpF 7437 6931 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732516.1 protein_id gnl|my_center|LOCUS_24180 7679 7452 gene locus_tag LOCUS_24190 7679 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 8478 7753 gene locus_tag LOCUS_24200 8478 7753 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_24200 8805 8506 gene locus_tag LOCUS_24210 8805 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 8898 9482 gene locus_tag LOCUS_24220 8898 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 9639 10994 gene locus_tag LOCUS_24230 gene pabB 9639 10994 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 protein_id gnl|my_center|LOCUS_24230 11015 11902 gene locus_tag LOCUS_24240 gene ilvE 11015 11902 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_24240 13552 11906 gene locus_tag LOCUS_24250 gene nadB 13552 11906 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_24250 14081 13587 gene locus_tag LOCUS_24260 14081 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 14417 14656 gene locus_tag LOCUS_24270 14417 14656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 14764 16530 gene locus_tag LOCUS_24280 14764 16530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_24280 17313 16648 gene locus_tag LOCUS_24290 17313 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 17680 18348 gene locus_tag LOCUS_24300 17680 18348 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_24300 18488 19168 gene locus_tag LOCUS_24310 18488 19168 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_24310 19304 20479 gene locus_tag LOCUS_24320 19304 20479 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_24320 20500 21066 gene locus_tag LOCUS_24330 gene folK 20500 21066 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_24330 21127 21930 gene locus_tag LOCUS_24340 gene panC 21127 21930 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_24340 22251 22006 gene locus_tag LOCUS_24350 22251 22006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 22379 22182 gene locus_tag LOCUS_24360 22379 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 22436 22633 gene locus_tag LOCUS_24370 22436 22633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 23242 22856 gene locus_tag LOCUS_24380 23242 22856 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888860.1 protein_id gnl|my_center|LOCUS_24380 24666 23299 gene locus_tag LOCUS_24390 24666 23299 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_24390 27297 24874 gene locus_tag LOCUS_24400 27297 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 27591 28277 gene locus_tag LOCUS_24410 27591 28277 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_24410 28964 28311 gene locus_tag LOCUS_24420 gene fsa 28964 28311 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_24420 29304 29615 gene locus_tag LOCUS_24430 29304 29615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 29735 30526 gene locus_tag LOCUS_24440 gene pgl 29735 30526 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_24440 30513 30908 gene locus_tag LOCUS_24450 30513 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 31009 31761 gene locus_tag LOCUS_24460 31009 31761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 32342 31800 gene locus_tag LOCUS_24470 32342 31800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence052 287 688 gene locus_tag LOCUS_24480 gene queF 287 688 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_24480 1214 900 gene locus_tag LOCUS_24490 1214 900 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_24490 1451 1218 gene locus_tag LOCUS_24500 1451 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2635 2216 gene locus_tag LOCUS_24510 2635 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 3986 2871 gene locus_tag LOCUS_24520 3986 2871 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_24520 4802 4350 gene locus_tag LOCUS_24530 4802 4350 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704675.1 protein_id gnl|my_center|LOCUS_24530 5029 4799 gene locus_tag LOCUS_24540 5029 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 5250 6038 gene locus_tag LOCUS_24550 5250 6038 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_24550 6408 6860 gene locus_tag LOCUS_24560 6408 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 8040 6853 gene locus_tag LOCUS_24570 8040 6853 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224938.1 protein_id gnl|my_center|LOCUS_24570 8461 8150 gene locus_tag LOCUS_24580 8461 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 9677 8571 gene locus_tag LOCUS_24590 9677 8571 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_24590 10736 9732 gene locus_tag LOCUS_24600 10736 9732 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816877.1 protein_id gnl|my_center|LOCUS_24600 11687 10896 gene locus_tag LOCUS_24610 11687 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 11865 12359 gene locus_tag LOCUS_24620 gene tadA 11865 12359 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_24620 12373 12461 gene locus_tag LOCUS_t00320 12373 12461 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12900 12655 gene locus_tag LOCUS_24630 12900 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 14067 12985 gene locus_tag LOCUS_24640 14067 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 16124 15837 gene locus_tag LOCUS_24650 16124 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 16373 16606 gene locus_tag LOCUS_24660 16373 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 17017 18189 gene locus_tag LOCUS_24670 17017 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 20432 18906 gene locus_tag LOCUS_24680 20432 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 21141 21893 gene locus_tag LOCUS_24690 21141 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 22829 22092 gene locus_tag LOCUS_24700 22829 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 23335 23493 gene locus_tag LOCUS_24710 23335 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 25988 23487 gene locus_tag LOCUS_24720 25988 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 29339 26220 gene locus_tag LOCUS_24730 29339 26220 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 protein_id gnl|my_center|LOCUS_24730 30463 29339 gene locus_tag LOCUS_24740 gene ugpC 30463 29339 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199035.1 protein_id gnl|my_center|LOCUS_24740 31844 30465 gene locus_tag LOCUS_24750 31844 30465 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence053 1058 369 gene locus_tag LOCUS_24760 gene phoU 1058 369 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_24760 1924 1091 gene locus_tag LOCUS_24770 gene pstB 1924 1091 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880655.1 protein_id gnl|my_center|LOCUS_24770 2905 1967 gene locus_tag LOCUS_24780 gene pstA 2905 1967 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_24780 3741 2905 gene locus_tag LOCUS_24790 gene pstC 3741 2905 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_24790 3674 3862 gene locus_tag LOCUS_24800 3674 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4942 3944 gene locus_tag LOCUS_24810 4942 3944 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_24810 5348 5166 gene locus_tag LOCUS_24820 5348 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6636 5263 gene locus_tag LOCUS_24830 6636 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 6707 6886 gene locus_tag LOCUS_24840 6707 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 8518 7136 gene locus_tag LOCUS_24850 8518 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 9465 8605 gene locus_tag LOCUS_24860 gene pstB 9465 8605 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641003.1 protein_id gnl|my_center|LOCUS_24860 10232 9444 gene locus_tag LOCUS_24870 gene pstA 10232 9444 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262178.1 protein_id gnl|my_center|LOCUS_24870 11106 10282 gene locus_tag LOCUS_24880 gene pstC 11106 10282 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_24880 11836 11126 gene locus_tag LOCUS_24890 11836 11126 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_24890 12305 12006 gene locus_tag LOCUS_24900 12305 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 12640 13719 gene locus_tag LOCUS_24910 gene pstS 12640 13719 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_24910 15087 14527 gene locus_tag LOCUS_24920 15087 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 17014 16124 gene locus_tag LOCUS_24930 17014 16124 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_24930 19542 17011 gene locus_tag LOCUS_24940 19542 17011 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_24940 23009 19677 gene locus_tag LOCUS_24950 23009 19677 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973386.1 protein_id gnl|my_center|LOCUS_24950 23307 24767 gene locus_tag LOCUS_24960 23307 24767 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142067.1 protein_id gnl|my_center|LOCUS_24960 24771 25760 gene locus_tag LOCUS_24970 24771 25760 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_24970 25954 28158 gene locus_tag LOCUS_24980 25954 28158 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_24980 28624 29061 gene locus_tag LOCUS_24990 28624 29061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 29570 29127 gene locus_tag LOCUS_25000 29570 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 29959 32082 gene locus_tag LOCUS_25010 29959 32082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence054 1670 681 gene locus_tag LOCUS_25020 1670 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2302 1769 gene locus_tag LOCUS_25030 2302 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2919 2626 gene locus_tag LOCUS_25040 2919 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3190 5910 gene locus_tag LOCUS_25050 gene secA 3190 5910 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_25050 6147 7349 gene locus_tag LOCUS_25060 6147 7349 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_25060 7419 7790 gene locus_tag LOCUS_25070 7419 7790 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_25070 7908 8387 gene locus_tag LOCUS_25080 7908 8387 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_25080 8447 10198 gene locus_tag LOCUS_25090 gene nuoD 8447 10198 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880837.1 protein_id gnl|my_center|LOCUS_25090 10285 10809 gene locus_tag LOCUS_25100 gene nuoE 10285 10809 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_25100 10890 12197 gene locus_tag LOCUS_25110 gene nuoF 10890 12197 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_25110 12209 14899 gene locus_tag LOCUS_25120 gene fdhF 12209 14899 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_25120 14951 16012 gene locus_tag LOCUS_25130 gene nuoH 14951 16012 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_25130 16027 16566 gene locus_tag LOCUS_25140 gene nuoI 16027 16566 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017376.1 protein_id gnl|my_center|LOCUS_25140 16641 17162 gene locus_tag LOCUS_25150 16641 17162 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_25150 17162 17467 gene locus_tag LOCUS_25160 gene nuoK 17162 17467 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_25160 17472 19373 gene locus_tag LOCUS_25170 gene nuoL 17472 19373 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_25170 19449 21032 gene locus_tag LOCUS_25180 19449 21032 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_25180 21029 22510 gene locus_tag LOCUS_25190 21029 22510 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_25190 23435 22566 gene locus_tag LOCUS_25200 23435 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 24426 23641 gene locus_tag LOCUS_25210 24426 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 25638 24982 gene locus_tag LOCUS_25220 25638 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 26201 27757 gene locus_tag LOCUS_25230 gene purH 26201 27757 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_25230 28164 27991 gene locus_tag LOCUS_25240 28164 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 28111 29256 gene locus_tag LOCUS_25250 gene purD 28111 29256 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_25250 29274 29921 gene locus_tag LOCUS_25260 29274 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 30059 30490 gene locus_tag LOCUS_25270 30059 30490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 31123 31548 gene locus_tag LOCUS_25280 31123 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 31595 31735 gene locus_tag LOCUS_25290 31595 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence055 1454 246 gene locus_tag LOCUS_25300 1454 246 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389740.1 protein_id gnl|my_center|LOCUS_25300 3264 1480 gene locus_tag LOCUS_25310 gene ngg 3264 1480 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389741.1 protein_id gnl|my_center|LOCUS_25310 5026 3254 gene locus_tag LOCUS_25320 5026 3254 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_25320 6017 6841 gene locus_tag LOCUS_25330 6017 6841 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 protein_id gnl|my_center|LOCUS_25330 7307 7882 gene locus_tag LOCUS_25340 7307 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 8107 8511 gene locus_tag LOCUS_25350 8107 8511 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968175.1 protein_id gnl|my_center|LOCUS_25350 9205 9654 gene locus_tag LOCUS_25360 9205 9654 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119010463.1 protein_id gnl|my_center|LOCUS_25360 9718 10977 gene locus_tag LOCUS_25370 9718 10977 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143936.1 protein_id gnl|my_center|LOCUS_25370 11302 11469 gene locus_tag LOCUS_25380 11302 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 11698 12369 gene locus_tag LOCUS_25390 11698 12369 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040854.1 protein_id gnl|my_center|LOCUS_25390 12664 13035 gene locus_tag LOCUS_25400 12664 13035 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_25400 13233 13658 gene locus_tag LOCUS_25410 13233 13658 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_25410 13738 14337 gene locus_tag LOCUS_25420 13738 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 14462 14818 gene locus_tag LOCUS_25430 14462 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 15127 16314 gene locus_tag LOCUS_25440 15127 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_25440 16311 16613 gene locus_tag LOCUS_25450 16311 16613 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_25450 17422 16673 gene locus_tag LOCUS_25460 17422 16673 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_25460 18498 17419 gene locus_tag LOCUS_25470 gene ada 18498 17419 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_25470 18779 19222 gene locus_tag LOCUS_25480 18779 19222 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 protein_id gnl|my_center|LOCUS_25480 20336 19338 gene locus_tag LOCUS_25490 20336 19338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_25490 21726 20443 gene locus_tag LOCUS_25500 21726 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 22378 23499 gene locus_tag LOCUS_25510 22378 23499 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384035.1 protein_id gnl|my_center|LOCUS_25510 23512 23766 gene locus_tag LOCUS_25520 23512 23766 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247385.1 protein_id gnl|my_center|LOCUS_25520 24575 23919 gene locus_tag LOCUS_25530 24575 23919 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_25530 25260 25808 gene locus_tag LOCUS_25540 25260 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 26293 25895 gene locus_tag LOCUS_25550 26293 25895 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_25550 27156 26527 gene locus_tag LOCUS_25560 27156 26527 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_25560 29056 28058 gene locus_tag LOCUS_25570 29056 28058 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_25570 30082 29522 gene locus_tag LOCUS_25580 30082 29522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 31365 30910 gene locus_tag LOCUS_25590 31365 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence056 405 70 gene locus_tag LOCUS_25600 405 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1367 1026 gene locus_tag LOCUS_25610 1367 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1805 2143 gene locus_tag LOCUS_25620 1805 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2785 2216 gene locus_tag LOCUS_25630 2785 2216 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254123.1 protein_id gnl|my_center|LOCUS_25630 3070 3867 gene locus_tag LOCUS_25640 3070 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 4458 4075 gene locus_tag LOCUS_25650 4458 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 4622 4428 gene locus_tag LOCUS_25660 4622 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4840 5097 gene locus_tag LOCUS_25670 4840 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 5167 5589 gene locus_tag LOCUS_25680 5167 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 7760 6039 gene locus_tag LOCUS_25690 7760 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 8202 7774 gene locus_tag LOCUS_25700 8202 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 9466 8285 gene locus_tag LOCUS_25710 9466 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 10182 9463 gene locus_tag LOCUS_25720 10182 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 10956 10186 gene locus_tag LOCUS_25730 10956 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 13029 11386 gene locus_tag LOCUS_25740 13029 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 13941 13537 gene locus_tag LOCUS_25750 13941 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 14215 15549 gene locus_tag LOCUS_25760 14215 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 15772 16476 gene locus_tag LOCUS_25770 15772 16476 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_25770 16473 16865 gene locus_tag LOCUS_25780 16473 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 16974 18056 gene locus_tag LOCUS_25790 16974 18056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 19350 19787 gene locus_tag LOCUS_25800 19350 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 19874 20089 gene locus_tag LOCUS_25810 19874 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 20173 20361 gene locus_tag LOCUS_25820 20173 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 20385 20606 gene locus_tag LOCUS_25830 20385 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 20816 23254 gene locus_tag LOCUS_25840 20816 23254 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170304.1 protein_id gnl|my_center|LOCUS_25840 23378 24229 gene locus_tag LOCUS_25850 23378 24229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 24553 24260 gene locus_tag LOCUS_25860 24553 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 25853 24624 gene locus_tag LOCUS_25870 25853 24624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912135.1 protein_id gnl|my_center|LOCUS_25870 26460 25924 gene locus_tag LOCUS_25880 26460 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 26994 26755 gene locus_tag LOCUS_25890 26994 26755 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082903.1 protein_id gnl|my_center|LOCUS_25890 27191 27030 gene locus_tag LOCUS_25900 27191 27030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 27361 28011 gene locus_tag LOCUS_25910 27361 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 28004 28459 gene locus_tag LOCUS_25920 28004 28459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 28467 29258 gene locus_tag LOCUS_25930 28467 29258 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_25930 29706 29395 gene locus_tag LOCUS_25940 29706 29395 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095863.1 protein_id gnl|my_center|LOCUS_25940 30038 29703 gene locus_tag LOCUS_25950 30038 29703 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_25950 30260 30045 gene locus_tag LOCUS_25960 30260 30045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 30516 30869 gene locus_tag LOCUS_25970 30516 30869 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence057 1244 660 gene locus_tag LOCUS_25980 1244 660 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 protein_id gnl|my_center|LOCUS_25980 1652 1410 gene locus_tag LOCUS_25990 1652 1410 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_25990 2373 2191 gene locus_tag LOCUS_26000 2373 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2541 3167 gene locus_tag LOCUS_26010 2541 3167 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 protein_id gnl|my_center|LOCUS_26010 3955 4707 gene locus_tag LOCUS_26020 3955 4707 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_26020 6374 4812 gene locus_tag LOCUS_26030 6374 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 8054 6471 gene locus_tag LOCUS_26040 8054 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 9101 9667 gene locus_tag LOCUS_26050 9101 9667 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943434.1 protein_id gnl|my_center|LOCUS_26050 10389 10910 gene locus_tag LOCUS_26060 gene qcrA 10389 10910 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 protein_id gnl|my_center|LOCUS_26060 10913 12235 gene locus_tag LOCUS_26070 10913 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 13820 12351 gene locus_tag LOCUS_26080 13820 12351 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009922704.1 protein_id gnl|my_center|LOCUS_26080 14716 14255 gene locus_tag LOCUS_26090 gene mscL 14716 14255 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_26090 15701 15267 gene locus_tag LOCUS_26100 15701 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 18512 16725 gene locus_tag LOCUS_26110 18512 16725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 19112 18615 gene locus_tag LOCUS_26120 19112 18615 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_26120 20905 19109 gene locus_tag LOCUS_26130 20905 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 21652 21023 gene locus_tag LOCUS_26140 21652 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 22554 22342 gene locus_tag LOCUS_26150 22554 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 22937 22578 gene locus_tag LOCUS_26160 22937 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 23237 24067 gene locus_tag LOCUS_26170 gene mutM 23237 24067 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114579.1 protein_id gnl|my_center|LOCUS_26170 24161 25207 gene locus_tag LOCUS_26180 24161 25207 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_26180 25214 25693 gene locus_tag LOCUS_26190 25214 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 25712 26638 gene locus_tag LOCUS_26200 gene ftsY 25712 26638 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_26200 26715 28880 gene locus_tag LOCUS_26210 26715 28880 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_26210 28890 29999 gene locus_tag LOCUS_26220 28890 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 30323 30168 gene locus_tag LOCUS_26230 30323 30168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence058 1226 1014 gene locus_tag LOCUS_26240 1226 1014 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_26240 1911 1618 gene locus_tag LOCUS_26250 1911 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26250 2550 2341 gene locus_tag LOCUS_26260 2550 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 4726 2945 gene locus_tag LOCUS_26270 4726 2945 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 protein_id gnl|my_center|LOCUS_26270 6608 4914 gene locus_tag LOCUS_26280 6608 4914 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_26280 11007 6613 gene locus_tag LOCUS_26290 11007 6613 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_26290 13877 11004 gene locus_tag LOCUS_26300 13877 11004 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256729.1 protein_id gnl|my_center|LOCUS_26300 18991 13874 gene locus_tag LOCUS_26310 18991 13874 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_26310 19239 19057 gene locus_tag LOCUS_26320 19239 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 20340 20005 gene locus_tag LOCUS_26330 20340 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20530 20330 gene locus_tag LOCUS_26340 20530 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 21425 21201 gene locus_tag LOCUS_26350 21425 21201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 21991 21773 gene locus_tag LOCUS_26360 21991 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 22974 22756 gene locus_tag LOCUS_26370 22974 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 23213 22971 gene locus_tag LOCUS_26380 23213 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 23610 23392 gene locus_tag LOCUS_26390 23610 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 23839 23648 gene locus_tag LOCUS_26400 23839 23648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 24609 24268 gene locus_tag LOCUS_26410 24609 24268 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_26410 24914 24621 gene locus_tag LOCUS_26420 24914 24621 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_26420 25574 25335 gene locus_tag LOCUS_26430 25574 25335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 26133 25927 gene locus_tag LOCUS_26440 26133 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 26628 26311 gene locus_tag LOCUS_26450 26628 26311 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_26450 27013 26762 gene locus_tag LOCUS_26460 27013 26762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 27405 27139 gene locus_tag LOCUS_26470 27405 27139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 27726 27532 gene locus_tag LOCUS_26480 27726 27532 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_26480 28037 27723 gene locus_tag LOCUS_26490 28037 27723 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928542.1 protein_id gnl|my_center|LOCUS_26490 28842 29129 gene locus_tag LOCUS_26500 28842 29129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 29450 29184 gene locus_tag LOCUS_26510 29450 29184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 29819 30052 gene locus_tag LOCUS_26520 29819 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence059 657 1643 gene locus_tag LOCUS_26530 657 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1643 1924 gene locus_tag LOCUS_26540 1643 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1866 2105 gene locus_tag LOCUS_26550 1866 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2206 2724 gene locus_tag LOCUS_26560 2206 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2851 3360 gene locus_tag LOCUS_26570 2851 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3544 3873 gene locus_tag LOCUS_26580 3544 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3997 4431 gene locus_tag LOCUS_26590 3997 4431 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_26590 4436 4591 gene locus_tag LOCUS_26600 4436 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 4874 4608 gene locus_tag LOCUS_26610 4874 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 5497 5970 gene locus_tag LOCUS_26620 5497 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 6163 6801 gene locus_tag LOCUS_26630 6163 6801 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_26630 6878 8392 gene locus_tag LOCUS_26640 6878 8392 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_26640 8664 9212 gene locus_tag LOCUS_26650 8664 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 9673 10239 gene locus_tag LOCUS_26660 9673 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 10374 11921 gene locus_tag LOCUS_26670 gene malQ 10374 11921 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_26670 11961 12905 gene locus_tag LOCUS_26680 11961 12905 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664024.1 protein_id gnl|my_center|LOCUS_26680 13046 15772 gene locus_tag LOCUS_26690 13046 15772 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_26690 16024 16236 gene locus_tag LOCUS_26700 16024 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 16563 16736 gene locus_tag LOCUS_26710 16563 16736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 16903 17325 gene locus_tag LOCUS_26720 gene rnk 16903 17325 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_26720 17727 19265 gene locus_tag LOCUS_26730 17727 19265 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_26730 19989 19570 gene locus_tag LOCUS_26740 19989 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 20481 20056 gene locus_tag LOCUS_26750 20481 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 20761 20570 gene locus_tag LOCUS_26760 20761 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 21210 21836 gene locus_tag LOCUS_26770 21210 21836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_26770 21849 23063 gene locus_tag LOCUS_26780 21849 23063 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583286.1 protein_id gnl|my_center|LOCUS_26780 23149 24528 gene locus_tag LOCUS_26790 23149 24528 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_26790 24525 25304 gene locus_tag LOCUS_26800 24525 25304 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_26800 27186 25333 gene locus_tag LOCUS_26810 27186 25333 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_26810 27863 27357 gene locus_tag LOCUS_26820 27863 27357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 28206 28015 gene locus_tag LOCUS_26830 28206 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 28438 29577 gene locus_tag LOCUS_26840 28438 29577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 29997 29581 gene locus_tag LOCUS_26850 29997 29581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence060 731 2128 gene locus_tag LOCUS_26860 731 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2493 2750 gene locus_tag LOCUS_26870 2493 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3736 4155 gene locus_tag LOCUS_26880 3736 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4296 5150 gene locus_tag LOCUS_26890 4296 5150 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 protein_id gnl|my_center|LOCUS_26890 5270 5728 gene locus_tag LOCUS_26900 5270 5728 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_26900 7674 5962 gene locus_tag LOCUS_26910 7674 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 8906 7830 gene locus_tag LOCUS_26920 8906 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 9322 8903 gene locus_tag LOCUS_26930 9322 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 10153 11523 gene locus_tag LOCUS_26940 10153 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 12216 11740 gene locus_tag LOCUS_26950 12216 11740 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_26950 14619 12382 gene locus_tag LOCUS_26960 14619 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 15174 15662 gene locus_tag LOCUS_26970 15174 15662 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_26970 16189 15797 gene locus_tag LOCUS_26980 16189 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 16505 16858 gene locus_tag LOCUS_26990 16505 16858 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941868.1 protein_id gnl|my_center|LOCUS_26990 16939 17355 gene locus_tag LOCUS_27000 16939 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 17631 17912 gene locus_tag LOCUS_27010 17631 17912 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615953.1 protein_id gnl|my_center|LOCUS_27010 18213 19796 gene locus_tag LOCUS_27020 gene aepX 18213 19796 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_27020 19998 20201 gene locus_tag LOCUS_27030 19998 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 20208 20495 gene locus_tag LOCUS_27040 20208 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 20492 20833 gene locus_tag LOCUS_27050 20492 20833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 21025 21846 gene locus_tag LOCUS_27060 21025 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 21986 22738 gene locus_tag LOCUS_27070 21986 22738 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126919401.1 protein_id gnl|my_center|LOCUS_27070 24006 22834 gene locus_tag LOCUS_27080 24006 22834 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_27080 24973 24509 gene locus_tag LOCUS_27090 24973 24509 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925817.1 protein_id gnl|my_center|LOCUS_27090 25785 25519 gene locus_tag LOCUS_27100 25785 25519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27100 27161 25917 gene locus_tag LOCUS_27110 27161 25917 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_27110 27663 27349 gene locus_tag LOCUS_27120 27663 27349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27120 27874 28077 gene locus_tag LOCUS_27130 27874 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 28740 28147 gene locus_tag LOCUS_27140 28740 28147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 29226 28750 gene locus_tag LOCUS_27150 29226 28750 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174550.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence061 1916 894 gene locus_tag LOCUS_27160 1916 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2305 2862 gene locus_tag LOCUS_27170 2305 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2894 3349 gene locus_tag LOCUS_27180 2894 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3352 3762 gene locus_tag LOCUS_27190 3352 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4773 4270 gene locus_tag LOCUS_27200 4773 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 4753 5007 gene locus_tag LOCUS_27210 4753 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 5331 4891 gene locus_tag LOCUS_27220 gene mraZ 5331 4891 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_27220 5615 5427 gene locus_tag LOCUS_27230 5615 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 6576 6079 gene locus_tag LOCUS_27240 6576 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 6977 7639 gene locus_tag LOCUS_27250 6977 7639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_27250 7646 8575 gene locus_tag LOCUS_27260 7646 8575 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254063.1 protein_id gnl|my_center|LOCUS_27260 8966 8676 gene locus_tag LOCUS_27270 8966 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 9039 11615 gene locus_tag LOCUS_27280 9039 11615 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_27280 12681 11665 gene locus_tag LOCUS_27290 gene bioB 12681 11665 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920732.1 protein_id gnl|my_center|LOCUS_27290 13193 12756 gene locus_tag LOCUS_27300 gene rsfS 13193 12756 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_27300 13852 13181 gene locus_tag LOCUS_27310 gene nadD 13852 13181 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_27310 15204 14113 gene locus_tag LOCUS_27320 gene proB 15204 14113 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_27320 16250 15231 gene locus_tag LOCUS_27330 gene obgE 16250 15231 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_27330 16583 16329 gene locus_tag LOCUS_27340 gene rpmA 16583 16329 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_27340 16938 16621 gene locus_tag LOCUS_27350 gene rplU 16938 16621 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_27350 17106 18020 gene locus_tag LOCUS_27360 17106 18020 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_27360 18477 18106 gene locus_tag LOCUS_27370 gene secG 18477 18106 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_27370 19267 18509 gene locus_tag LOCUS_27380 gene tpiA 19267 18509 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880184.1 protein_id gnl|my_center|LOCUS_27380 20519 19311 gene locus_tag LOCUS_27390 20519 19311 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_27390 21590 20589 gene locus_tag LOCUS_27400 gene gap 21590 20589 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546818.1 protein_id gnl|my_center|LOCUS_27400 22857 21874 gene locus_tag LOCUS_27410 gene trpS 22857 21874 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_27410 23600 22878 gene locus_tag LOCUS_27420 23600 22878 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_27420 25549 23606 gene locus_tag LOCUS_27430 25549 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 25802 26731 gene locus_tag LOCUS_27440 gene xerD 25802 26731 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 protein_id gnl|my_center|LOCUS_27440 26851 27036 gene locus_tag LOCUS_27450 26851 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 27178 27759 gene locus_tag LOCUS_27460 27178 27759 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258430.1 protein_id gnl|my_center|LOCUS_27460 27770 28474 gene locus_tag LOCUS_27470 27770 28474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence062 1866 1150 gene locus_tag LOCUS_27480 1866 1150 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_27480 2772 1900 gene locus_tag LOCUS_27490 2772 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3938 2850 gene locus_tag LOCUS_27500 3938 2850 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_27500 4058 5290 gene locus_tag LOCUS_27510 4058 5290 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287490.1 protein_id gnl|my_center|LOCUS_27510 5291 5929 gene locus_tag LOCUS_27520 5291 5929 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_27520 6799 6020 gene locus_tag LOCUS_27530 6799 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 7769 6849 gene locus_tag LOCUS_27540 7769 6849 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846190.1 protein_id gnl|my_center|LOCUS_27540 8251 7958 gene locus_tag LOCUS_27550 8251 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8704 8315 gene locus_tag LOCUS_27560 8704 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 9397 8792 gene locus_tag LOCUS_27570 gene gpmA 9397 8792 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_27570 9527 10381 gene locus_tag LOCUS_27580 9527 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 11079 10378 gene locus_tag LOCUS_27590 11079 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 12703 12569 gene locus_tag LOCUS_27600 12703 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 14459 12837 gene locus_tag LOCUS_27610 gene rpoD 14459 12837 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_27610 15144 15923 gene locus_tag LOCUS_27620 15144 15923 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_27620 16317 17234 gene locus_tag LOCUS_27630 16317 17234 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_27630 17687 18952 gene locus_tag LOCUS_27640 17687 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 18959 20401 gene locus_tag LOCUS_27650 18959 20401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 22644 21238 gene locus_tag LOCUS_27660 22644 21238 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_27660 22944 25649 gene locus_tag LOCUS_27670 22944 25649 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_27670 26632 25871 gene locus_tag LOCUS_27680 26632 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 27641 26679 gene locus_tag LOCUS_27690 27641 26679 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334794.1 protein_id gnl|my_center|LOCUS_27690 28516 27653 gene locus_tag LOCUS_27700 28516 27653 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124026.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence063 1530 565 gene locus_tag LOCUS_27710 1530 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 3344 1887 gene locus_tag LOCUS_27720 3344 1887 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_27720 4051 3479 gene locus_tag LOCUS_27730 4051 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4845 4402 gene locus_tag LOCUS_27740 4845 4402 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_27740 6926 4875 gene locus_tag LOCUS_27750 gene flhA 6926 4875 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 protein_id gnl|my_center|LOCUS_27750 7418 6993 gene locus_tag LOCUS_27760 7418 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 8458 7436 gene locus_tag LOCUS_27770 8458 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 9036 8590 gene locus_tag LOCUS_27780 9036 8590 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_27780 9985 9434 gene locus_tag LOCUS_27790 9985 9434 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971406.1 protein_id gnl|my_center|LOCUS_27790 10746 10090 gene locus_tag LOCUS_27800 10746 10090 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109549.1 protein_id gnl|my_center|LOCUS_27800 12294 10990 gene locus_tag LOCUS_27810 12294 10990 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_27810 13353 12385 gene locus_tag LOCUS_27820 13353 12385 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_27820 14429 13452 gene locus_tag LOCUS_27830 gene pdhA 14429 13452 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_27830 15937 14777 gene locus_tag LOCUS_27840 15937 14777 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873776.1 protein_id gnl|my_center|LOCUS_27840 16970 16671 gene locus_tag LOCUS_27850 16970 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 17654 17067 gene locus_tag LOCUS_27860 17654 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 17933 18376 gene locus_tag LOCUS_27870 17933 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 19479 18577 gene locus_tag LOCUS_27880 19479 18577 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732449.1 protein_id gnl|my_center|LOCUS_27880 19571 19864 gene locus_tag LOCUS_27890 19571 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 19876 20178 gene locus_tag LOCUS_27900 19876 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 21156 20443 gene locus_tag LOCUS_27910 21156 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 23339 21339 gene locus_tag LOCUS_27920 23339 21339 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_27920 23989 23360 gene locus_tag LOCUS_27930 23989 23360 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_27930 24200 24484 gene locus_tag LOCUS_27940 24200 24484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 24695 27007 gene locus_tag LOCUS_27950 24695 27007 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_27950 28413 27097 gene locus_tag LOCUS_27960 28413 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence064 3085 1787 gene locus_tag LOCUS_27970 gene proP 3085 1787 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198608.1 protein_id gnl|my_center|LOCUS_27970 4051 3230 gene locus_tag LOCUS_27980 4051 3230 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260128.1 protein_id gnl|my_center|LOCUS_27980 4164 4322 gene locus_tag LOCUS_27990 4164 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 5400 4507 gene locus_tag LOCUS_28000 5400 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 5673 6539 gene locus_tag LOCUS_28010 5673 6539 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941416.1 protein_id gnl|my_center|LOCUS_28010 6763 6557 gene locus_tag LOCUS_28020 6763 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 7065 7511 gene locus_tag LOCUS_28030 7065 7511 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 protein_id gnl|my_center|LOCUS_28030 7610 8560 gene locus_tag LOCUS_28040 7610 8560 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_28040 9786 9124 gene locus_tag LOCUS_28050 9786 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 10225 11487 gene locus_tag LOCUS_28060 10225 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 13415 11823 gene locus_tag LOCUS_28070 13415 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 13616 15214 gene locus_tag LOCUS_28080 13616 15214 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 protein_id gnl|my_center|LOCUS_28080 16289 15237 gene locus_tag LOCUS_28090 16289 15237 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188711.1 protein_id gnl|my_center|LOCUS_28090 17468 16542 gene locus_tag LOCUS_28100 17468 16542 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_28100 18408 18145 gene locus_tag LOCUS_28110 18408 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 19589 18759 gene locus_tag LOCUS_28120 19589 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 21251 19923 gene locus_tag LOCUS_28130 21251 19923 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_28130 21489 22055 gene locus_tag LOCUS_28140 21489 22055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 22907 22098 gene locus_tag LOCUS_28150 22907 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 24119 22977 gene locus_tag LOCUS_28160 24119 22977 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815218.1 protein_id gnl|my_center|LOCUS_28160 25448 25053 gene locus_tag LOCUS_28170 25448 25053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 26306 26127 gene locus_tag LOCUS_28180 26306 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 26557 27423 gene locus_tag LOCUS_28190 26557 27423 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_28190 27532 28221 gene locus_tag LOCUS_28200 27532 28221 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024490.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence065 520 9456 gene locus_tag LOCUS_28210 520 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 9469 13437 gene locus_tag LOCUS_28220 9469 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 13612 15333 gene locus_tag LOCUS_28230 13612 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 15413 16861 gene locus_tag LOCUS_28240 15413 16861 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_28240 16858 18129 gene locus_tag LOCUS_28250 16858 18129 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_28250 18184 21303 gene locus_tag LOCUS_28260 18184 21303 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_28260 23509 21695 gene locus_tag LOCUS_28270 23509 21695 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_28270 24598 24825 gene locus_tag LOCUS_28280 24598 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28280 24835 25059 gene locus_tag LOCUS_28290 24835 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 25466 25254 gene locus_tag LOCUS_28300 25466 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 26231 25773 gene locus_tag LOCUS_28310 26231 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 27487 26324 gene locus_tag LOCUS_28320 27487 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 27858 27484 gene locus_tag LOCUS_28330 27858 27484 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_28330 28273 27848 gene locus_tag LOCUS_28340 gene exbB 28273 27848 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881140.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence066 41 1030 gene locus_tag LOCUS_28350 41 1030 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950414.1 protein_id gnl|my_center|LOCUS_28350 1465 1767 gene locus_tag LOCUS_28360 1465 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2000 3358 gene locus_tag LOCUS_28370 2000 3358 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_28370 3358 4335 gene locus_tag LOCUS_28380 gene floA 3358 4335 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_28380 4343 4696 gene locus_tag LOCUS_28390 4343 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4986 5738 gene locus_tag LOCUS_28400 4986 5738 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_28400 6577 7116 gene locus_tag LOCUS_28410 6577 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 8246 7680 gene locus_tag LOCUS_28420 8246 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 8919 9338 gene locus_tag LOCUS_28430 8919 9338 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_28430 10317 9775 gene locus_tag LOCUS_28440 10317 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 10662 11021 gene locus_tag LOCUS_28450 10662 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 11928 12845 gene locus_tag LOCUS_28460 11928 12845 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123124.1 protein_id gnl|my_center|LOCUS_28460 12904 14160 gene locus_tag LOCUS_28470 gene pfp 12904 14160 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_28470 14709 14356 gene locus_tag LOCUS_28480 14709 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 15435 14791 gene locus_tag LOCUS_28490 15435 14791 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466471.1 protein_id gnl|my_center|LOCUS_28490 16858 15530 gene locus_tag LOCUS_28500 16858 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 17867 16959 gene locus_tag LOCUS_28510 17867 16959 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921782.1 protein_id gnl|my_center|LOCUS_28510 18254 18826 gene locus_tag LOCUS_28520 18254 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 19259 20449 gene locus_tag LOCUS_28530 19259 20449 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_28530 20774 22252 gene locus_tag LOCUS_28540 gene atpD 20774 22252 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_28540 22291 22695 gene locus_tag LOCUS_28550 22291 22695 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_28550 22688 23026 gene locus_tag LOCUS_28560 22688 23026 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_28560 23019 23330 gene locus_tag LOCUS_28570 23019 23330 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_28570 23320 24021 gene locus_tag LOCUS_28580 23320 24021 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_28580 24053 24334 gene locus_tag LOCUS_28590 24053 24334 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_28590 24339 25148 gene locus_tag LOCUS_28600 24339 25148 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_28600 25141 26694 gene locus_tag LOCUS_28610 25141 26694 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence067 1676 639 gene locus_tag LOCUS_28620 gene queA 1676 639 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037521.1 protein_id gnl|my_center|LOCUS_28620 2886 1690 gene locus_tag LOCUS_28630 2886 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3135 2896 gene locus_tag LOCUS_28640 3135 2896 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_28640 4164 3151 gene locus_tag LOCUS_28650 4164 3151 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_28650 5553 4339 gene locus_tag LOCUS_28660 5553 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 6631 5558 gene locus_tag LOCUS_28670 gene leuB 6631 5558 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_28670 8328 6781 gene locus_tag LOCUS_28680 8328 6781 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_28680 9163 8393 gene locus_tag LOCUS_28690 gene pssA 9163 8393 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_28690 9825 9160 gene locus_tag LOCUS_28700 9825 9160 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_28700 10872 9859 gene locus_tag LOCUS_28710 gene ilvC 10872 9859 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_28710 11491 10970 gene locus_tag LOCUS_28720 gene ilvN 11491 10970 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_28720 13289 11514 gene locus_tag LOCUS_28730 gene ilvB 13289 11514 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_28730 13542 14702 gene locus_tag LOCUS_28740 gene bioF 13542 14702 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_28740 14981 16867 gene locus_tag LOCUS_28750 14981 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 17079 18605 gene locus_tag LOCUS_28760 17079 18605 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_28760 18615 18830 gene locus_tag LOCUS_28770 18615 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 19086 19523 gene locus_tag LOCUS_28780 19086 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 19797 19591 gene locus_tag LOCUS_28790 19797 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 20098 19850 gene locus_tag LOCUS_28800 20098 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 21206 20166 gene locus_tag LOCUS_28810 gene ltaE 21206 20166 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_28810 21298 22167 gene locus_tag LOCUS_28820 21298 22167 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_28820 22514 22332 gene locus_tag LOCUS_28830 22514 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 22851 23645 gene locus_tag LOCUS_28840 22851 23645 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_28840 23826 24083 gene locus_tag LOCUS_28850 23826 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 24086 24475 gene locus_tag LOCUS_28860 24086 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 25218 24925 gene locus_tag LOCUS_28870 25218 24925 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140812.1 protein_id gnl|my_center|LOCUS_28870 25403 25215 gene locus_tag LOCUS_28880 25403 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 25687 25460 gene locus_tag LOCUS_28890 25687 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 26039 25722 gene locus_tag LOCUS_28900 26039 25722 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_28900 26243 26052 gene locus_tag LOCUS_28910 26243 26052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 27131 26415 gene locus_tag LOCUS_28920 27131 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence068 1841 3376 gene locus_tag LOCUS_28930 1841 3376 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_28930 3395 3637 gene locus_tag LOCUS_28940 3395 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 4604 3729 gene locus_tag LOCUS_28950 4604 3729 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_28950 5282 4725 gene locus_tag LOCUS_28960 5282 4725 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142243.1 protein_id gnl|my_center|LOCUS_28960 6398 5574 gene locus_tag LOCUS_28970 6398 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 7565 7233 gene locus_tag LOCUS_28980 7565 7233 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_28980 10844 7593 gene locus_tag LOCUS_28990 10844 7593 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880525.1 protein_id gnl|my_center|LOCUS_28990 11975 10884 gene locus_tag LOCUS_29000 11975 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 11920 12108 gene locus_tag LOCUS_29010 11920 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 13830 12136 gene locus_tag LOCUS_29020 13830 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 14621 14545 gene locus_tag LOCUS_t00330 14621 14545 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 14858 15130 gene locus_tag LOCUS_29030 gene rpsT 14858 15130 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385126.1 protein_id gnl|my_center|LOCUS_29030 16245 15154 gene locus_tag LOCUS_29040 gene holA 16245 15154 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_29040 16966 16295 gene locus_tag LOCUS_29050 16966 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 19640 17010 gene locus_tag LOCUS_29060 gene leuS 19640 17010 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546871.1 protein_id gnl|my_center|LOCUS_29060 20206 19907 gene locus_tag LOCUS_29070 20206 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 22232 20475 gene locus_tag LOCUS_29080 gene uvrC 22232 20475 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_29080 22658 22260 gene locus_tag LOCUS_29090 gene gloA 22658 22260 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_29090 22894 24261 gene locus_tag LOCUS_29100 22894 24261 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_29100 24356 26716 gene locus_tag LOCUS_29110 24356 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence069 827 120 gene locus_tag LOCUS_29120 827 120 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_29120 1632 934 gene locus_tag LOCUS_29130 1632 934 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_29130 3212 1629 gene locus_tag LOCUS_29140 3212 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 4328 3237 gene locus_tag LOCUS_29150 4328 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 5811 4423 gene locus_tag LOCUS_29160 5811 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 8255 5877 gene locus_tag LOCUS_29170 8255 5877 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070981653.1 protein_id gnl|my_center|LOCUS_29170 9602 8373 gene locus_tag LOCUS_29180 9602 8373 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524972.1 protein_id gnl|my_center|LOCUS_29180 9850 9605 gene locus_tag LOCUS_29190 9850 9605 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248104.1 protein_id gnl|my_center|LOCUS_29190 10768 9893 gene locus_tag LOCUS_29200 10768 9893 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_29200 12639 10870 gene locus_tag LOCUS_29210 12639 10870 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_29210 13302 12859 gene locus_tag LOCUS_29220 13302 12859 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_29220 13847 14509 gene locus_tag LOCUS_29230 13847 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 14701 15435 gene locus_tag LOCUS_29240 14701 15435 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832147.1 protein_id gnl|my_center|LOCUS_29240 15535 16659 gene locus_tag LOCUS_29250 gene yghO 15535 16659 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331688.1 protein_id gnl|my_center|LOCUS_29250 16687 17496 gene locus_tag LOCUS_29260 16687 17496 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_29260 18315 17596 gene locus_tag LOCUS_29270 18315 17596 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_29270 18375 19433 gene locus_tag LOCUS_29280 gene lptF 18375 19433 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779633.1 protein_id gnl|my_center|LOCUS_29280 19521 20591 gene locus_tag LOCUS_29290 gene lptG 19521 20591 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948329.1 protein_id gnl|my_center|LOCUS_29290 20889 22094 gene locus_tag LOCUS_29300 20889 22094 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_29300 22202 23167 gene locus_tag LOCUS_29310 22202 23167 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_29310 23170 24126 gene locus_tag LOCUS_29320 23170 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_29320 24290 24102 gene locus_tag LOCUS_29330 24290 24102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 24629 25372 gene locus_tag LOCUS_29340 24629 25372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 <26484 25881 gene locus_tag LOCUS_29350 <26484 25881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941971.1:polyprenyl synthetase family protein >Feature sequence070 32 988 gene locus_tag LOCUS_29360 32 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1241 3013 gene locus_tag LOCUS_29370 1241 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 3079 4191 gene locus_tag LOCUS_29380 3079 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 4206 5021 gene locus_tag LOCUS_29390 4206 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 5044 5367 gene locus_tag LOCUS_29400 5044 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5461 6714 gene locus_tag LOCUS_29410 5461 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 6938 7816 gene locus_tag LOCUS_29420 6938 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 7897 8286 gene locus_tag LOCUS_29430 7897 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 8329 9633 gene locus_tag LOCUS_29440 8329 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 9985 10944 gene locus_tag LOCUS_29450 9985 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 12645 10972 gene locus_tag LOCUS_29460 gene ilvD 12645 10972 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_29460 14447 14899 gene locus_tag LOCUS_29470 14447 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 15879 14911 gene locus_tag LOCUS_29480 gene iolG 15879 14911 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_29480 16630 15935 gene locus_tag LOCUS_29490 16630 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 16847 16656 gene locus_tag LOCUS_29500 16847 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 17063 18028 gene locus_tag LOCUS_29510 17063 18028 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371239.1 protein_id gnl|my_center|LOCUS_29510 18233 19534 gene locus_tag LOCUS_29520 18233 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 20425 19985 gene locus_tag LOCUS_29530 20425 19985 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213035039.1 protein_id gnl|my_center|LOCUS_29530 20408 20566 gene locus_tag LOCUS_29540 20408 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 20890 20684 gene locus_tag LOCUS_29550 20890 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 21316 21044 gene locus_tag LOCUS_29560 21316 21044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 22436 23995 gene locus_tag LOCUS_29570 22436 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 24984 25181 gene locus_tag LOCUS_29580 24984 25181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 25417 25674 gene locus_tag LOCUS_29590 25417 25674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29590 >Feature sequence071 158 760 gene locus_tag LOCUS_29600 158 760 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_29600 1055 1534 gene locus_tag LOCUS_29610 1055 1534 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_29610 2228 1992 gene locus_tag LOCUS_29620 2228 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2488 3414 gene locus_tag LOCUS_29630 2488 3414 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_29630 3564 4067 gene locus_tag LOCUS_29640 3564 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 4051 4479 gene locus_tag LOCUS_29650 4051 4479 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_29650 4575 5849 gene locus_tag LOCUS_29660 4575 5849 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_29660 5846 6427 gene locus_tag LOCUS_29670 5846 6427 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_29670 6595 6915 gene locus_tag LOCUS_29680 gene erpA 6595 6915 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 protein_id gnl|my_center|LOCUS_29680 7011 7802 gene locus_tag LOCUS_29690 7011 7802 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_29690 8246 7908 gene locus_tag LOCUS_29700 8246 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 8797 8324 gene locus_tag LOCUS_29710 8797 8324 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869368.1 protein_id gnl|my_center|LOCUS_29710 9251 11590 gene locus_tag LOCUS_29720 9251 11590 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_29720 11850 11632 gene locus_tag LOCUS_29730 gene iscX 11850 11632 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_29730 13728 11911 gene locus_tag LOCUS_29740 gene dnaK 13728 11911 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_29740 14518 13754 gene locus_tag LOCUS_29750 14518 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 14920 14561 gene locus_tag LOCUS_29760 14920 14561 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_29760 15372 14956 gene locus_tag LOCUS_29770 gene iscU 15372 14956 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 protein_id gnl|my_center|LOCUS_29770 16665 15451 gene locus_tag LOCUS_29780 16665 15451 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_29780 17147 16662 gene locus_tag LOCUS_29790 17147 16662 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_29790 17349 17762 gene locus_tag LOCUS_29800 17349 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 18250 19788 gene locus_tag LOCUS_29810 18250 19788 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_29810 20470 19883 gene locus_tag LOCUS_29820 20470 19883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 21954 21091 gene locus_tag LOCUS_29830 21954 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 22479 24719 gene locus_tag LOCUS_29840 22479 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence072 372 19 gene locus_tag LOCUS_29850 372 19 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941198.1 protein_id gnl|my_center|LOCUS_29850 769 1578 gene locus_tag LOCUS_29860 769 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2315 1623 gene locus_tag LOCUS_29870 2315 1623 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 protein_id gnl|my_center|LOCUS_29870 3095 2367 gene locus_tag LOCUS_29880 3095 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3712 3221 gene locus_tag LOCUS_29890 3712 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4378 3764 gene locus_tag LOCUS_29900 4378 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 4824 4441 gene locus_tag LOCUS_29910 4824 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 5554 4856 gene locus_tag LOCUS_29920 5554 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 6099 5584 gene locus_tag LOCUS_29930 6099 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6794 6198 gene locus_tag LOCUS_29940 6794 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 7355 6888 gene locus_tag LOCUS_29950 7355 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 9145 7859 gene locus_tag LOCUS_29960 9145 7859 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_29960 9697 9227 gene locus_tag LOCUS_29970 9697 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 9870 10562 gene locus_tag LOCUS_29980 9870 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 10673 11263 gene locus_tag LOCUS_29990 10673 11263 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_29990 11628 11308 gene locus_tag LOCUS_30000 11628 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30000 12113 12466 gene locus_tag LOCUS_30010 12113 12466 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_30010 12840 13292 gene locus_tag LOCUS_30020 12840 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 13319 14590 gene locus_tag LOCUS_30030 13319 14590 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_30030 14590 15375 gene locus_tag LOCUS_30040 14590 15375 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928799.1 protein_id gnl|my_center|LOCUS_30040 15782 16240 gene locus_tag LOCUS_30050 15782 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 16551 17504 gene locus_tag LOCUS_30060 16551 17504 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_30060 17994 17581 gene locus_tag LOCUS_30070 17994 17581 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979840.1 protein_id gnl|my_center|LOCUS_30070 19083 18316 gene locus_tag LOCUS_30080 19083 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 19879 20190 gene locus_tag LOCUS_30090 19879 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 21068 20514 gene locus_tag LOCUS_30100 21068 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 21139 23106 gene locus_tag LOCUS_30110 21139 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence073 6364 5309 gene locus_tag LOCUS_30120 6364 5309 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_30120 7164 6361 gene locus_tag LOCUS_30130 7164 6361 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_30130 7403 7176 gene locus_tag LOCUS_30140 7403 7176 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_30140 9211 7787 gene locus_tag LOCUS_30150 9211 7787 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_30150 10935 9268 gene locus_tag LOCUS_30160 10935 9268 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_30160 13843 11267 gene locus_tag LOCUS_30170 13843 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 15052 15246 gene locus_tag LOCUS_30180 15052 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 16313 15243 gene locus_tag LOCUS_30190 16313 15243 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_30190 17479 16967 gene locus_tag LOCUS_30200 gene fpvI 17479 16967 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_30200 18321 18929 gene locus_tag LOCUS_30210 18321 18929 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_30210 19240 19091 gene locus_tag LOCUS_30220 19240 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 19534 19340 gene locus_tag LOCUS_30230 19534 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 19430 20311 gene locus_tag LOCUS_30240 gene dmeF 19430 20311 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969625.1 protein_id gnl|my_center|LOCUS_30240 20838 20479 gene locus_tag LOCUS_30250 20838 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30250 21461 22741 gene locus_tag LOCUS_30260 21461 22741 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_30260 22983 23597 gene locus_tag LOCUS_30270 gene cysC 22983 23597 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence074 817 458 gene locus_tag LOCUS_30280 817 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1018 830 gene locus_tag LOCUS_30290 1018 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1571 1248 gene locus_tag LOCUS_30300 1571 1248 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329069.1 protein_id gnl|my_center|LOCUS_30300 2140 1769 gene locus_tag LOCUS_30310 2140 1769 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975801.1 protein_id gnl|my_center|LOCUS_30310 2999 2241 gene locus_tag LOCUS_30320 2999 2241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383595.1 protein_id gnl|my_center|LOCUS_30320 4018 3083 gene locus_tag LOCUS_30330 4018 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 4643 4098 gene locus_tag LOCUS_30340 4643 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 5430 4939 gene locus_tag LOCUS_30350 5430 4939 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 protein_id gnl|my_center|LOCUS_30350 6428 5538 gene locus_tag LOCUS_30360 6428 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 7581 6430 gene locus_tag LOCUS_30370 7581 6430 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_30370 9116 7578 gene locus_tag LOCUS_30380 9116 7578 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_30380 10045 9152 gene locus_tag LOCUS_30390 10045 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 10662 10045 gene locus_tag LOCUS_30400 10662 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 13143 10768 gene locus_tag LOCUS_30410 13143 10768 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_30410 15066 13360 gene locus_tag LOCUS_30420 15066 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 15520 15359 gene locus_tag LOCUS_30430 15520 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30430 16603 15575 gene locus_tag LOCUS_30440 16603 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 17795 16725 gene locus_tag LOCUS_30450 gene arsB 17795 16725 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_30450 18154 17792 gene locus_tag LOCUS_30460 18154 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 18686 18207 gene locus_tag LOCUS_30470 18686 18207 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_30470 19060 18683 gene locus_tag LOCUS_30480 19060 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 19985 19347 gene locus_tag LOCUS_30490 19985 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 20955 19990 gene locus_tag LOCUS_30500 20955 19990 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_30500 21746 20952 gene locus_tag LOCUS_30510 21746 20952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_30510 22843 21749 gene locus_tag LOCUS_30520 22843 21749 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence075 1250 1873 gene locus_tag LOCUS_30530 1250 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2116 3024 gene locus_tag LOCUS_30540 2116 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 4483 5094 gene locus_tag LOCUS_30550 4483 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 5250 6413 gene locus_tag LOCUS_30560 5250 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 6497 7561 gene locus_tag LOCUS_30570 gene wecB 6497 7561 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_30570 7587 8522 gene locus_tag LOCUS_30580 7587 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 9418 8585 gene locus_tag LOCUS_30590 9418 8585 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_30590 9967 10530 gene locus_tag LOCUS_30600 9967 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 11297 10845 gene locus_tag LOCUS_30610 11297 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212745304.1 protein_id gnl|my_center|LOCUS_30610 12601 11297 gene locus_tag LOCUS_30620 12601 11297 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183193.1 protein_id gnl|my_center|LOCUS_30620 13551 12946 gene locus_tag LOCUS_30630 13551 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 13847 17275 gene locus_tag LOCUS_30640 13847 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 protein_id gnl|my_center|LOCUS_30640 17824 17618 gene locus_tag LOCUS_30650 17824 17618 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048036534.1 protein_id gnl|my_center|LOCUS_30650 18081 18356 gene locus_tag LOCUS_30660 18081 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 19752 20249 gene locus_tag LOCUS_30670 19752 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 20537 20971 gene locus_tag LOCUS_30680 20537 20971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 21358 22377 gene locus_tag LOCUS_30690 21358 22377 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_30690 <23011 22511 gene locus_tag LOCUS_30700 <23011 22511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001019306.1:hypoxanthine phosphoribosyltransferase >Feature sequence076 1981 2547 gene locus_tag LOCUS_30710 1981 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2667 3914 gene locus_tag LOCUS_30720 2667 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3907 5901 gene locus_tag LOCUS_30730 3907 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 5936 6115 gene locus_tag LOCUS_30740 5936 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 6283 7470 gene locus_tag LOCUS_30750 6283 7470 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_30750 7586 8839 gene locus_tag LOCUS_30760 7586 8839 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_30760 9825 8905 gene locus_tag LOCUS_30770 9825 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 13306 9827 gene locus_tag LOCUS_30780 gene mfd 13306 9827 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_30780 13844 13347 gene locus_tag LOCUS_30790 13844 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 14041 15528 gene locus_tag LOCUS_30800 14041 15528 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_30800 15623 16240 gene locus_tag LOCUS_30810 15623 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 16319 16393 gene locus_tag LOCUS_t00340 16319 16393 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16511 18454 gene locus_tag LOCUS_30820 gene thrS 16511 18454 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_30820 18451 18969 gene locus_tag LOCUS_30830 gene infC 18451 18969 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_30830 19026 19229 gene locus_tag LOCUS_30840 gene rpmI 19026 19229 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_30840 19257 19625 gene locus_tag LOCUS_30850 gene rplT 19257 19625 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_30850 21316 19622 gene locus_tag LOCUS_30860 gene pheT 21316 19622 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_30860 <22570 21326 gene locus_tag LOCUS_30870 <22570 21326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680967.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence077 297 842 gene locus_tag LOCUS_30880 297 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 880 1350 gene locus_tag LOCUS_30890 880 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 1391 1915 gene locus_tag LOCUS_30900 1391 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 2910 3470 gene locus_tag LOCUS_30910 2910 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 5135 3828 gene locus_tag LOCUS_30920 5135 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 6161 5319 gene locus_tag LOCUS_30930 6161 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_30930 6831 8141 gene locus_tag LOCUS_30940 6831 8141 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704053.1 protein_id gnl|my_center|LOCUS_30940 9106 8408 gene locus_tag LOCUS_30950 9106 8408 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940507.1 protein_id gnl|my_center|LOCUS_30950 10152 9562 gene locus_tag LOCUS_30960 10152 9562 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_30960 12430 10589 gene locus_tag LOCUS_30970 12430 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 13269 14000 gene locus_tag LOCUS_30980 13269 14000 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462636.1 protein_id gnl|my_center|LOCUS_30980 14025 14525 gene locus_tag LOCUS_30990 14025 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 14639 15124 gene locus_tag LOCUS_31000 14639 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 15722 15114 gene locus_tag LOCUS_31010 15722 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 16116 17414 gene locus_tag LOCUS_31020 16116 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 17533 21210 gene locus_tag LOCUS_31030 17533 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence078 2205 1021 gene locus_tag LOCUS_31040 2205 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 5258 2655 gene locus_tag LOCUS_31050 5258 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 6828 5428 gene locus_tag LOCUS_31060 gene noeA 6828 5428 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_31060 7064 6828 gene locus_tag LOCUS_31070 7064 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 7993 7190 gene locus_tag LOCUS_31080 7993 7190 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_31080 8743 8027 gene locus_tag LOCUS_31090 8743 8027 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_31090 10021 8993 gene locus_tag LOCUS_31100 10021 8993 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_31100 10774 10037 gene locus_tag LOCUS_31110 10774 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 11584 10808 gene locus_tag LOCUS_31120 11584 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 13011 11707 gene locus_tag LOCUS_31130 13011 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 14205 13270 gene locus_tag LOCUS_31140 14205 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 15150 14296 gene locus_tag LOCUS_31150 15150 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 18395 15153 gene locus_tag LOCUS_31160 18395 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 19945 18593 gene locus_tag LOCUS_31170 19945 18593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 protein_id gnl|my_center|LOCUS_31170 20693 19935 gene locus_tag LOCUS_31180 20693 19935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705991.1 protein_id gnl|my_center|LOCUS_31180 22164 21448 gene locus_tag LOCUS_31190 22164 21448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 22261 22130 gene locus_tag LOCUS_31200 22261 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence079 1974 982 gene locus_tag LOCUS_31210 1974 982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_31210 2965 2003 gene locus_tag LOCUS_31220 2965 2003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_31220 5159 3009 gene locus_tag LOCUS_31230 5159 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 5973 5665 gene locus_tag LOCUS_31240 5973 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 6900 6004 gene locus_tag LOCUS_31250 6900 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 7308 7105 gene locus_tag LOCUS_31260 7308 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012648007.1 protein_id gnl|my_center|LOCUS_31260 8951 7572 gene locus_tag LOCUS_31270 8951 7572 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_31270 9290 10108 gene locus_tag LOCUS_31280 gene lgt 9290 10108 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_31280 10627 10163 gene locus_tag LOCUS_31290 10627 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 14094 10645 gene locus_tag LOCUS_31300 14094 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 17191 14087 gene locus_tag LOCUS_31310 17191 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 17568 17392 gene locus_tag LOCUS_31320 17568 17392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 17937 17653 gene locus_tag LOCUS_31330 17937 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 18756 18079 gene locus_tag LOCUS_31340 18756 18079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_31340 19888 18749 gene locus_tag LOCUS_31350 19888 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 20480 20016 gene locus_tag LOCUS_31360 gene nrdR 20480 20016 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_31360 21788 20526 gene locus_tag LOCUS_31370 21788 20526 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_31370 22301 21792 gene locus_tag LOCUS_31380 gene rplI 22301 21792 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence080 1540 1923 gene locus_tag LOCUS_31390 1540 1923 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910112.1 protein_id gnl|my_center|LOCUS_31390 1914 2429 gene locus_tag LOCUS_31400 1914 2429 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769074.1 protein_id gnl|my_center|LOCUS_31400 2449 2943 gene locus_tag LOCUS_31410 2449 2943 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_31410 2996 4240 gene locus_tag LOCUS_31420 gene nuoD 2996 4240 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_31420 4302 6992 gene locus_tag LOCUS_31430 4302 6992 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_31430 7016 7585 gene locus_tag LOCUS_31440 gene nuoI 7016 7585 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_31440 7593 8135 gene locus_tag LOCUS_31450 7593 8135 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_31450 8150 8452 gene locus_tag LOCUS_31460 gene nuoK 8150 8452 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_31460 8454 10451 gene locus_tag LOCUS_31470 gene nuoL 8454 10451 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_31470 10461 12014 gene locus_tag LOCUS_31480 10461 12014 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_31480 12020 13615 gene locus_tag LOCUS_31490 12020 13615 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_31490 13661 15148 gene locus_tag LOCUS_31500 13661 15148 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_31500 16315 17520 gene locus_tag LOCUS_31510 16315 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 17575 18585 gene locus_tag LOCUS_31520 gene arsS 17575 18585 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_31520 18874 18626 gene locus_tag LOCUS_31530 18874 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 19123 19845 gene locus_tag LOCUS_31540 19123 19845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 19934 20209 gene locus_tag LOCUS_31550 19934 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 20828 20421 gene locus_tag LOCUS_31560 20828 20421 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_31560 21350 20889 gene locus_tag LOCUS_31570 21350 20889 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence081 2204 207 gene locus_tag LOCUS_31580 2204 207 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_31580 2271 2516 gene locus_tag LOCUS_31590 2271 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3078 2443 gene locus_tag LOCUS_31600 gene leuD 3078 2443 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 protein_id gnl|my_center|LOCUS_31600 4555 3149 gene locus_tag LOCUS_31610 gene leuC 4555 3149 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_31610 4967 6010 gene locus_tag LOCUS_31620 4967 6010 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_31620 6153 6908 gene locus_tag LOCUS_31630 6153 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 6918 7427 gene locus_tag LOCUS_31640 6918 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 7438 9270 gene locus_tag LOCUS_31650 gene mrdA 7438 9270 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_31650 9312 10436 gene locus_tag LOCUS_31660 gene rodA 9312 10436 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_31660 10765 12318 gene locus_tag LOCUS_31670 gene rng 10765 12318 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_31670 12561 13697 gene locus_tag LOCUS_31680 gene dprA 12561 13697 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_31680 14317 16935 gene locus_tag LOCUS_31690 14317 16935 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_31690 18542 17283 gene locus_tag LOCUS_31700 gene clpX 18542 17283 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_31700 19192 18563 gene locus_tag LOCUS_31710 gene clpP 19192 18563 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_31710 20599 19274 gene locus_tag LOCUS_31720 gene tig 20599 19274 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_31720 20734 20653 gene locus_tag LOCUS_t00350 20734 20653 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence082 583 1356 gene locus_tag LOCUS_31730 583 1356 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_31730 1688 1491 gene locus_tag LOCUS_31740 1688 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 1823 2092 gene locus_tag LOCUS_31750 1823 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2364 2203 gene locus_tag LOCUS_31760 2364 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2800 2372 gene locus_tag LOCUS_31770 2800 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31770 3074 4810 gene locus_tag LOCUS_31780 3074 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 5017 5652 gene locus_tag LOCUS_31790 5017 5652 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254123.1 protein_id gnl|my_center|LOCUS_31790 5738 6568 gene locus_tag LOCUS_31800 5738 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 6906 6622 gene locus_tag LOCUS_31810 6906 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 7151 7735 gene locus_tag LOCUS_31820 7151 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 7942 9210 gene locus_tag LOCUS_31830 7942 9210 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964746.1 protein_id gnl|my_center|LOCUS_31830 9842 9543 gene locus_tag LOCUS_31840 9842 9543 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968628.1 protein_id gnl|my_center|LOCUS_31840 9991 10203 gene locus_tag LOCUS_31850 9991 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 10469 10272 gene locus_tag LOCUS_31860 10469 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 10588 10743 gene locus_tag LOCUS_31870 10588 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 11274 11053 gene locus_tag LOCUS_31880 11274 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 11644 13071 gene locus_tag LOCUS_31890 11644 13071 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_31890 13755 13477 gene locus_tag LOCUS_31900 13755 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 14109 13879 gene locus_tag LOCUS_31910 14109 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 14804 14427 gene locus_tag LOCUS_31920 14804 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 15094 15579 gene locus_tag LOCUS_31930 gene msrB 15094 15579 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327110.1 protein_id gnl|my_center|LOCUS_31930 18151 15545 gene locus_tag LOCUS_31940 18151 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 20251 18215 gene locus_tag LOCUS_31950 20251 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 20944 20321 gene locus_tag LOCUS_31960 20944 20321 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence083 1129 455 gene locus_tag LOCUS_31970 gene ccmA 1129 455 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_31970 1864 2178 gene locus_tag LOCUS_31980 1864 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 2186 2935 gene locus_tag LOCUS_31990 2186 2935 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_31990 3395 4414 gene locus_tag LOCUS_32000 gene galE 3395 4414 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_32000 4633 4824 gene locus_tag LOCUS_32010 4633 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 5751 4870 gene locus_tag LOCUS_32020 5751 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 6157 7149 gene locus_tag LOCUS_32030 6157 7149 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_32030 7298 8236 gene locus_tag LOCUS_32040 gene ispH 7298 8236 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_32040 8559 12233 gene locus_tag LOCUS_32050 gene smc 8559 12233 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_32050 12703 12356 gene locus_tag LOCUS_32060 12703 12356 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037531.1 protein_id gnl|my_center|LOCUS_32060 13113 13313 gene locus_tag LOCUS_32070 13113 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 13798 14694 gene locus_tag LOCUS_32080 13798 14694 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929974.1 protein_id gnl|my_center|LOCUS_32080 14732 15124 gene locus_tag LOCUS_32090 14732 15124 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_32090 15491 15270 gene locus_tag LOCUS_32100 15491 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 15736 16212 gene locus_tag LOCUS_32110 15736 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 17352 16258 gene locus_tag LOCUS_32120 gene gcvT 17352 16258 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228001.1 protein_id gnl|my_center|LOCUS_32120 17732 17349 gene locus_tag LOCUS_32130 17732 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 18270 17755 gene locus_tag LOCUS_32140 18270 17755 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_32140 19124 18324 gene locus_tag LOCUS_32150 19124 18324 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_32150 20765 19245 gene locus_tag LOCUS_32160 gene thiC 20765 19245 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038764.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence084 1139 465 gene locus_tag LOCUS_32170 gene rpe 1139 465 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_32170 2590 1142 gene locus_tag LOCUS_32180 gene rsmB 2590 1142 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_32180 3632 2607 gene locus_tag LOCUS_32190 gene pdxA 3632 2607 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_32190 4821 3640 gene locus_tag LOCUS_32200 gene larC 4821 3640 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_32200 5197 4874 gene locus_tag LOCUS_32210 5197 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 5358 5933 gene locus_tag LOCUS_32220 5358 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 6205 5984 gene locus_tag LOCUS_32230 6205 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 7115 7966 gene locus_tag LOCUS_32240 7115 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 8702 7932 gene locus_tag LOCUS_32250 gene larB 8702 7932 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_32250 9766 8699 gene locus_tag LOCUS_32260 9766 8699 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_32260 10131 10397 gene locus_tag LOCUS_32270 10131 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 11470 10547 gene locus_tag LOCUS_32280 11470 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 11928 11782 gene locus_tag LOCUS_32290 11928 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 13482 12310 gene locus_tag LOCUS_32300 13482 12310 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405391.1 protein_id gnl|my_center|LOCUS_32300 13832 13641 gene locus_tag LOCUS_32310 13832 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 14396 14148 gene locus_tag LOCUS_32320 14396 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 14830 15753 gene locus_tag LOCUS_32330 14830 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 15923 16453 gene locus_tag LOCUS_32340 15923 16453 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_32340 17904 16966 gene locus_tag LOCUS_32350 17904 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 18577 17879 gene locus_tag LOCUS_32360 18577 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 19020 19541 gene locus_tag LOCUS_32370 19020 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence085 3035 345 gene locus_tag LOCUS_32380 3035 345 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_32380 3542 3054 gene locus_tag LOCUS_32390 3542 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3842 4375 gene locus_tag LOCUS_32400 gene porC 3842 4375 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_32400 4402 5655 gene locus_tag LOCUS_32410 gene porA 4402 5655 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_32410 5676 6671 gene locus_tag LOCUS_32420 5676 6671 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 protein_id gnl|my_center|LOCUS_32420 6673 8301 gene locus_tag LOCUS_32430 6673 8301 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_32430 8411 9277 gene locus_tag LOCUS_32440 8411 9277 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021757.1 protein_id gnl|my_center|LOCUS_32440 9437 9198 gene locus_tag LOCUS_32450 9437 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 9818 10501 gene locus_tag LOCUS_32460 9818 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 12797 11733 gene locus_tag LOCUS_32470 gene hypE 12797 11733 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_32470 13912 12794 gene locus_tag LOCUS_32480 gene hypD 13912 12794 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_32480 14157 13909 gene locus_tag LOCUS_32490 14157 13909 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_32490 16458 14176 gene locus_tag LOCUS_32500 gene hypF 16458 14176 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_32500 16898 16536 gene locus_tag LOCUS_32510 16898 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 17371 16880 gene locus_tag LOCUS_32520 17371 16880 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948168.1 protein_id gnl|my_center|LOCUS_32520 18679 17375 gene locus_tag LOCUS_32530 18679 17375 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_32530 19379 18663 gene locus_tag LOCUS_32540 19379 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 <20394 19587 gene locus_tag LOCUS_32550 <20394 19587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948171.1:FAD/NAD(P)-binding protein >Feature sequence086 355 1755 gene locus_tag LOCUS_32560 gene lpdA 355 1755 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_32560 1902 2351 gene locus_tag LOCUS_32570 1902 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2383 3606 gene locus_tag LOCUS_32580 gene tyrS 2383 3606 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_32580 3729 3803 gene locus_tag LOCUS_t00360 3729 3803 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4302 4634 gene locus_tag LOCUS_32590 4302 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 5660 4776 gene locus_tag LOCUS_32600 gene htpX 5660 4776 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633091.1 protein_id gnl|my_center|LOCUS_32600 5947 6303 gene locus_tag LOCUS_32610 5947 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 6307 7350 gene locus_tag LOCUS_32620 6307 7350 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_32620 8061 7627 gene locus_tag LOCUS_32630 8061 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 8480 8136 gene locus_tag LOCUS_32640 8480 8136 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_32640 8683 9789 gene locus_tag LOCUS_32650 gene ald 8683 9789 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_32650 9809 9885 gene locus_tag LOCUS_t00370 9809 9885 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10105 10728 gene locus_tag LOCUS_32660 10105 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 10761 11168 gene locus_tag LOCUS_32670 10761 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 11878 11249 gene locus_tag LOCUS_32680 11878 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 12795 11908 gene locus_tag LOCUS_32690 12795 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 12923 13324 gene locus_tag LOCUS_32700 12923 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 13639 15816 gene locus_tag LOCUS_32710 13639 15816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_32710 15919 17292 gene locus_tag LOCUS_32720 15919 17292 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_32720 17267 18682 gene locus_tag LOCUS_32730 gene rlmD 17267 18682 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_32730 18692 19729 gene locus_tag LOCUS_32740 gene purM 18692 19729 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence087 536 2047 gene locus_tag LOCUS_32750 536 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2194 2280 gene locus_tag LOCUS_t00380 2194 2280 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2416 2724 gene locus_tag LOCUS_32760 2416 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3005 3184 gene locus_tag LOCUS_32770 3005 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 5300 3378 gene locus_tag LOCUS_32780 5300 3378 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_32780 5765 5352 gene locus_tag LOCUS_32790 5765 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 6256 5759 gene locus_tag LOCUS_32800 6256 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 7664 6360 gene locus_tag LOCUS_32810 7664 6360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_32810 8580 7975 gene locus_tag LOCUS_32820 8580 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 9194 9790 gene locus_tag LOCUS_32830 9194 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 9777 10736 gene locus_tag LOCUS_32840 9777 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 10850 11284 gene locus_tag LOCUS_32850 10850 11284 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_32850 12174 11311 gene locus_tag LOCUS_32860 12174 11311 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921869.1 protein_id gnl|my_center|LOCUS_32860 12457 13053 gene locus_tag LOCUS_32870 12457 13053 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_32870 13080 13646 gene locus_tag LOCUS_32880 gene msrA 13080 13646 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_32880 14116 13682 gene locus_tag LOCUS_32890 14116 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 14288 14605 gene locus_tag LOCUS_32900 14288 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 15105 14626 gene locus_tag LOCUS_32910 15105 14626 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978442.1 protein_id gnl|my_center|LOCUS_32910 16037 15216 gene locus_tag LOCUS_32920 gene ttcA 16037 15216 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_32920 16840 16283 gene locus_tag LOCUS_32930 16840 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 17199 17390 gene locus_tag LOCUS_32940 17199 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 19350 17533 gene locus_tag LOCUS_32950 19350 17533 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_32950 <20187 19432 gene locus_tag LOCUS_32960 <20187 19432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975326.1:osmoprotectant NAGGN system M42 family peptidase >Feature sequence088 654 1166 gene locus_tag LOCUS_32970 654 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1318 1899 gene locus_tag LOCUS_32980 gene comE 1318 1899 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_32980 1963 3051 gene locus_tag LOCUS_32990 1963 3051 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_32990 3048 3809 gene locus_tag LOCUS_33000 3048 3809 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_33000 3820 5304 gene locus_tag LOCUS_33010 3820 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5297 6295 gene locus_tag LOCUS_33020 5297 6295 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_33020 6402 6836 gene locus_tag LOCUS_33030 6402 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 6796 7047 gene locus_tag LOCUS_33040 6796 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 8017 7082 gene locus_tag LOCUS_33050 8017 7082 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_33050 8216 8022 gene locus_tag LOCUS_33060 8216 8022 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584018.1 protein_id gnl|my_center|LOCUS_33060 8476 10566 gene locus_tag LOCUS_33070 gene tkt 8476 10566 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_33070 10595 13456 gene locus_tag LOCUS_33080 10595 13456 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_33080 15225 13675 gene locus_tag LOCUS_33090 gene zwf 15225 13675 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_33090 16140 15247 gene locus_tag LOCUS_33100 gene gnd 16140 15247 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400683.1 protein_id gnl|my_center|LOCUS_33100 18054 16183 gene locus_tag LOCUS_33110 18054 16183 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_33110 18852 19964 gene locus_tag LOCUS_33120 18852 19964 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence089 2237 852 gene locus_tag LOCUS_33130 2237 852 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_33130 3009 2227 gene locus_tag LOCUS_33140 3009 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3995 3012 gene locus_tag LOCUS_33150 3995 3012 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_33150 5098 3992 gene locus_tag LOCUS_33160 5098 3992 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_33160 5693 5142 gene locus_tag LOCUS_33170 5693 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 6010 6777 gene locus_tag LOCUS_33180 6010 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 6862 8601 gene locus_tag LOCUS_33190 6862 8601 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_33190 8705 9688 gene locus_tag LOCUS_33200 8705 9688 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_33200 9685 10677 gene locus_tag LOCUS_33210 9685 10677 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_33210 10697 11878 gene locus_tag LOCUS_33220 10697 11878 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406838.1 protein_id gnl|my_center|LOCUS_33220 11875 13065 gene locus_tag LOCUS_33230 11875 13065 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967761.1 protein_id gnl|my_center|LOCUS_33230 13170 13985 gene locus_tag LOCUS_33240 13170 13985 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816050.1 protein_id gnl|my_center|LOCUS_33240 14009 15676 gene locus_tag LOCUS_33250 14009 15676 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_33250 15823 16677 gene locus_tag LOCUS_33260 15823 16677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_33260 16674 17075 gene locus_tag LOCUS_33270 16674 17075 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_33270 17072 18355 gene locus_tag LOCUS_33280 17072 18355 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_33280 18363 18860 gene locus_tag LOCUS_33290 18363 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 18898 19605 gene locus_tag LOCUS_33300 gene meaB 18898 19605 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence090 1296 637 gene locus_tag LOCUS_33310 1296 637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226222.1 protein_id gnl|my_center|LOCUS_33310 2725 1283 gene locus_tag LOCUS_33320 2725 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3881 3252 gene locus_tag LOCUS_33330 3881 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 6519 4690 gene locus_tag LOCUS_33340 6519 4690 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_33340 6815 7792 gene locus_tag LOCUS_33350 6815 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 8374 8015 gene locus_tag LOCUS_33360 8374 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 9318 8665 gene locus_tag LOCUS_33370 gene elbB 9318 8665 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940751.1 protein_id gnl|my_center|LOCUS_33370 9617 9943 gene locus_tag LOCUS_33380 9617 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 9960 11213 gene locus_tag LOCUS_33390 9960 11213 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092007.1 protein_id gnl|my_center|LOCUS_33390 11542 12075 gene locus_tag LOCUS_33400 11542 12075 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_33400 13568 12300 gene locus_tag LOCUS_33410 13568 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 14324 13695 gene locus_tag LOCUS_33420 14324 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 16121 14463 gene locus_tag LOCUS_33430 16121 14463 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_33430 16805 16509 gene locus_tag LOCUS_33440 16805 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 16978 16793 gene locus_tag LOCUS_33450 16978 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 17331 18353 gene locus_tag LOCUS_33460 17331 18353 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_33460 19728 18733 gene locus_tag LOCUS_33470 19728 18733 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence091 2074 860 gene locus_tag LOCUS_33480 2074 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 2978 2400 gene locus_tag LOCUS_33490 2978 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4410 3214 gene locus_tag LOCUS_33500 gene rffA 4410 3214 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 protein_id gnl|my_center|LOCUS_33500 5436 5699 gene locus_tag LOCUS_33510 5436 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 5686 5871 gene locus_tag LOCUS_33520 5686 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 5937 7034 gene locus_tag LOCUS_33530 gene nadA 5937 7034 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_33530 7255 10086 gene locus_tag LOCUS_33540 gene ileS 7255 10086 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_33540 10083 10604 gene locus_tag LOCUS_33550 gene lspA 10083 10604 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_33550 10741 11199 gene locus_tag LOCUS_33560 10741 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 12632 11499 gene locus_tag LOCUS_33570 12632 11499 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_33570 13815 12787 gene locus_tag LOCUS_33580 13815 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 14090 14905 gene locus_tag LOCUS_33590 14090 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 15656 14943 gene locus_tag LOCUS_33600 15656 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 16424 15681 gene locus_tag LOCUS_33610 gene gpmA 16424 15681 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942257.1 protein_id gnl|my_center|LOCUS_33610 16757 17695 gene locus_tag LOCUS_33620 16757 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 18093 18710 gene locus_tag LOCUS_33630 18093 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 19632 18796 gene locus_tag LOCUS_33640 19632 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence092 1329 325 gene locus_tag LOCUS_33650 1329 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 2733 3233 gene locus_tag LOCUS_33660 gene rfaH 2733 3233 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 protein_id gnl|my_center|LOCUS_33660 3733 4035 gene locus_tag LOCUS_33670 3733 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 5124 5897 gene locus_tag LOCUS_33680 gene rfbF 5124 5897 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_33680 5894 6889 gene locus_tag LOCUS_33690 5894 6889 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_33690 7061 8299 gene locus_tag LOCUS_33700 7061 8299 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_33700 8296 8844 gene locus_tag LOCUS_33710 gene rfbC 8296 8844 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_33710 8859 10205 gene locus_tag LOCUS_33720 8859 10205 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_33720 10312 11280 gene locus_tag LOCUS_33730 10312 11280 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_33730 11423 12634 gene locus_tag LOCUS_33740 11423 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 12890 13924 gene locus_tag LOCUS_33750 12890 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_33750 14440 14634 gene locus_tag LOCUS_33760 14440 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 14618 15730 gene locus_tag LOCUS_33770 14618 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 16053 16919 gene locus_tag LOCUS_33780 16053 16919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_33780 16946 18295 gene locus_tag LOCUS_33790 16946 18295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence093 1661 3 gene locus_tag LOCUS_33800 1661 3 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_33800 3374 2220 gene locus_tag LOCUS_33810 3374 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 3681 3995 gene locus_tag LOCUS_33820 3681 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 5254 4163 gene locus_tag LOCUS_33830 5254 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6544 5489 gene locus_tag LOCUS_33840 6544 5489 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066795.1 protein_id gnl|my_center|LOCUS_33840 7443 6595 gene locus_tag LOCUS_33850 7443 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 7884 7528 gene locus_tag LOCUS_33860 7884 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 8510 8055 gene locus_tag LOCUS_33870 8510 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 8852 9823 gene locus_tag LOCUS_33880 8852 9823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_33880 10079 10483 gene locus_tag LOCUS_33890 10079 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 10837 11100 gene locus_tag LOCUS_33900 10837 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 11221 11895 gene locus_tag LOCUS_33910 gene deoC 11221 11895 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_33910 12001 12237 gene locus_tag LOCUS_33920 12001 12237 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798187.1 protein_id gnl|my_center|LOCUS_33920 12678 13280 gene locus_tag LOCUS_33930 12678 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 13840 14040 gene locus_tag LOCUS_33940 13840 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 14037 14399 gene locus_tag LOCUS_33950 14037 14399 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_33950 14958 15287 gene locus_tag LOCUS_33960 14958 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 15361 15681 gene locus_tag LOCUS_33970 15361 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 16584 16423 gene locus_tag LOCUS_33980 16584 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 16856 16581 gene locus_tag LOCUS_33990 16856 16581 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_33990 17919 19247 gene locus_tag LOCUS_34000 17919 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence094 1624 425 gene locus_tag LOCUS_34010 1624 425 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_34010 2000 2386 gene locus_tag LOCUS_34020 2000 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3681 2563 gene locus_tag LOCUS_34030 3681 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144331.1 protein_id gnl|my_center|LOCUS_34030 4206 3856 gene locus_tag LOCUS_34040 4206 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 4468 4193 gene locus_tag LOCUS_34050 4468 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 5310 4465 gene locus_tag LOCUS_34060 5310 4465 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_34060 5527 6252 gene locus_tag LOCUS_34070 5527 6252 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_34070 6603 7364 gene locus_tag LOCUS_34080 6603 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 7848 8267 gene locus_tag LOCUS_34090 7848 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 8692 8357 gene locus_tag LOCUS_34100 8692 8357 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_34100 9236 9042 gene locus_tag LOCUS_34110 9236 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 12405 9289 gene locus_tag LOCUS_34120 12405 9289 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140385.1 protein_id gnl|my_center|LOCUS_34120 13742 12540 gene locus_tag LOCUS_34130 13742 12540 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_34130 15225 13795 gene locus_tag LOCUS_34140 15225 13795 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_34140 15906 15229 gene locus_tag LOCUS_34150 15906 15229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_34150 16605 16318 gene locus_tag LOCUS_34160 16605 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 17987 16917 gene locus_tag LOCUS_34170 gene ychF 17987 16917 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence095 1309 2298 gene locus_tag LOCUS_34180 1309 2298 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_34180 2499 3521 gene locus_tag LOCUS_34190 2499 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 4138 5076 gene locus_tag LOCUS_34200 4138 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 7137 5545 gene locus_tag LOCUS_34210 7137 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 7280 7125 gene locus_tag LOCUS_34220 7280 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 8690 7701 gene locus_tag LOCUS_34230 8690 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 9396 8668 gene locus_tag LOCUS_34240 9396 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 10818 10651 gene locus_tag LOCUS_34250 10818 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 11191 12141 gene locus_tag LOCUS_34260 11191 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 12436 13608 gene locus_tag LOCUS_34270 12436 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 14623 13766 gene locus_tag LOCUS_34280 14623 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 15241 16386 gene locus_tag LOCUS_34290 15241 16386 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_34290 16507 17475 gene locus_tag LOCUS_34300 16507 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 17646 18593 gene locus_tag LOCUS_34310 17646 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence096 3654 217 gene locus_tag LOCUS_34320 3654 217 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935282.1 protein_id gnl|my_center|LOCUS_34320 5183 4989 gene locus_tag LOCUS_34330 5183 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 6756 5365 gene locus_tag LOCUS_34340 6756 5365 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_34340 7040 6762 gene locus_tag LOCUS_34350 7040 6762 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_34350 8223 7066 gene locus_tag LOCUS_34360 8223 7066 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_34360 9090 8494 gene locus_tag LOCUS_34370 9090 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 10024 11076 gene locus_tag LOCUS_34380 10024 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 11057 11530 gene locus_tag LOCUS_34390 11057 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 11556 12944 gene locus_tag LOCUS_34400 11556 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 14689 13007 gene locus_tag LOCUS_34410 14689 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 15209 16648 gene locus_tag LOCUS_34420 gene opuD 15209 16648 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230127.1 protein_id gnl|my_center|LOCUS_34420 16770 17219 gene locus_tag LOCUS_34430 16770 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 17524 17775 gene locus_tag LOCUS_34440 17524 17775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 17765 18190 gene locus_tag LOCUS_34450 17765 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 18846 18397 gene locus_tag LOCUS_34460 18846 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence097 1541 1179 gene locus_tag LOCUS_34470 1541 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 1902 2417 gene locus_tag LOCUS_34480 1902 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_34480 2414 3691 gene locus_tag LOCUS_34490 2414 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3678 4769 gene locus_tag LOCUS_34500 3678 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 5337 4723 gene locus_tag LOCUS_34510 5337 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 5782 5540 gene locus_tag LOCUS_34520 5782 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 6486 5839 gene locus_tag LOCUS_34530 6486 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 7198 6623 gene locus_tag LOCUS_34540 7198 6623 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_34540 7616 7209 gene locus_tag LOCUS_34550 7616 7209 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922241.1 protein_id gnl|my_center|LOCUS_34550 8435 9250 gene locus_tag LOCUS_34560 8435 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 10031 9843 gene locus_tag LOCUS_34570 10031 9843 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_34570 10240 10028 gene locus_tag LOCUS_34580 10240 10028 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_34580 12416 10356 gene locus_tag LOCUS_34590 12416 10356 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339547.1 protein_id gnl|my_center|LOCUS_34590 12843 13217 gene locus_tag LOCUS_34600 12843 13217 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_34600 13310 14695 gene locus_tag LOCUS_34610 gene zwf 13310 14695 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_34610 15039 16337 gene locus_tag LOCUS_34620 gene chrA 15039 16337 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_34620 16922 16380 gene locus_tag LOCUS_34630 16922 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 17070 16858 gene locus_tag LOCUS_34640 17070 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 17351 17761 gene locus_tag LOCUS_34650 17351 17761 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425026.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence098 1211 321 gene locus_tag LOCUS_34660 1211 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3659 1434 gene locus_tag LOCUS_34670 3659 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 4650 3748 gene locus_tag LOCUS_34680 4650 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 6772 5966 gene locus_tag LOCUS_34690 6772 5966 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_34690 6874 7650 gene locus_tag LOCUS_34700 6874 7650 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_34700 7662 8225 gene locus_tag LOCUS_34710 7662 8225 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_34710 8225 8884 gene locus_tag LOCUS_34720 8225 8884 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_34720 8938 9011 gene locus_tag LOCUS_t00390 8938 9011 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11697 10864 gene locus_tag LOCUS_34730 11697 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 12501 13295 gene locus_tag LOCUS_34740 gene pyrF 12501 13295 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528590.1 protein_id gnl|my_center|LOCUS_34740 13642 13836 gene locus_tag LOCUS_34750 13642 13836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 13901 15868 gene locus_tag LOCUS_34760 13901 15868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 16154 16525 gene locus_tag LOCUS_34770 16154 16525 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_34770 16555 17136 gene locus_tag LOCUS_34780 16555 17136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 17185 17784 gene locus_tag LOCUS_34790 17185 17784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence099 209 1255 gene locus_tag LOCUS_34800 209 1255 CDS product IS5-like element ISMac22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022661.1 protein_id gnl|my_center|LOCUS_34800 1859 2701 gene locus_tag LOCUS_34810 1859 2701 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_34810 3876 2950 gene locus_tag LOCUS_34820 3876 2950 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258605.1 protein_id gnl|my_center|LOCUS_34820 4517 4071 gene locus_tag LOCUS_34830 4517 4071 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_34830 5307 4921 gene locus_tag LOCUS_34840 5307 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 5888 5436 gene locus_tag LOCUS_34850 5888 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 6385 7035 gene locus_tag LOCUS_34860 6385 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 7261 7518 gene locus_tag LOCUS_34870 7261 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 7488 8057 gene locus_tag LOCUS_34880 7488 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 8123 8956 gene locus_tag LOCUS_34890 gene rfbD 8123 8956 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403367.1 protein_id gnl|my_center|LOCUS_34890 10406 9888 gene locus_tag LOCUS_34900 10406 9888 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460247.1 protein_id gnl|my_center|LOCUS_34900 11545 10448 gene locus_tag LOCUS_34910 gene gcvT 11545 10448 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_34910 12006 11545 gene locus_tag LOCUS_34920 12006 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 13247 12003 gene locus_tag LOCUS_34930 13247 12003 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_34930 14663 13377 gene locus_tag LOCUS_34940 14663 13377 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_34940 15198 14731 gene locus_tag LOCUS_34950 15198 14731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_34950 15891 15253 gene locus_tag LOCUS_34960 15891 15253 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_34960 16087 16401 gene locus_tag LOCUS_34970 16087 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 16686 16456 gene locus_tag LOCUS_34980 16686 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 17131 16763 gene locus_tag LOCUS_34990 17131 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 17589 17254 gene locus_tag LOCUS_35000 17589 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence100 888 433 gene locus_tag LOCUS_35010 888 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 2054 1155 gene locus_tag LOCUS_35020 2054 1155 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_35020 2647 3477 gene locus_tag LOCUS_35030 2647 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3546 4658 gene locus_tag LOCUS_35040 3546 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 4669 5085 gene locus_tag LOCUS_35050 4669 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 5082 5909 gene locus_tag LOCUS_35060 5082 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 5927 6517 gene locus_tag LOCUS_35070 5927 6517 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_35070 6626 7540 gene locus_tag LOCUS_35080 6626 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 7551 8483 gene locus_tag LOCUS_35090 7551 8483 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_35090 8519 9103 gene locus_tag LOCUS_35100 gene tpx 8519 9103 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547331.1 protein_id gnl|my_center|LOCUS_35100 9115 9600 gene locus_tag LOCUS_35110 9115 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 9612 10100 gene locus_tag LOCUS_35120 9612 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 10309 11343 gene locus_tag LOCUS_35130 10309 11343 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_35130 11336 12304 gene locus_tag LOCUS_35140 11336 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 12317 12826 gene locus_tag LOCUS_35150 12317 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 12886 13242 gene locus_tag LOCUS_35160 12886 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 13312 14562 gene locus_tag LOCUS_35170 13312 14562 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_35170 16119 17003 gene locus_tag LOCUS_35180 16119 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence101 1433 2857 gene locus_tag LOCUS_35190 1433 2857 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_35190 3104 3664 gene locus_tag LOCUS_35200 3104 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 4015 4380 gene locus_tag LOCUS_35210 4015 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 4652 5110 gene locus_tag LOCUS_35220 4652 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35220 5080 5307 gene locus_tag LOCUS_35230 5080 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35230 5358 5573 gene locus_tag LOCUS_35240 5358 5573 CDS product DUF3565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922503.1 protein_id gnl|my_center|LOCUS_35240 5905 5624 gene locus_tag LOCUS_35250 5905 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 8798 5991 gene locus_tag LOCUS_35260 8798 5991 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_35260 9660 8905 gene locus_tag LOCUS_35270 gene scpB 9660 8905 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_35270 10600 9782 gene locus_tag LOCUS_35280 10600 9782 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_35280 11797 10706 gene locus_tag LOCUS_35290 11797 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 12795 12016 gene locus_tag LOCUS_35300 12795 12016 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_35300 13813 12950 gene locus_tag LOCUS_35310 13813 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 13994 16732 gene locus_tag LOCUS_35320 13994 16732 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence102 204 1223 gene locus_tag LOCUS_35330 204 1223 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_35330 1539 2771 gene locus_tag LOCUS_35340 1539 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3793 4971 gene locus_tag LOCUS_35350 3793 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 5317 6174 gene locus_tag LOCUS_35360 5317 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 6187 6576 gene locus_tag LOCUS_35370 6187 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 7207 6611 gene locus_tag LOCUS_35380 7207 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 8742 7222 gene locus_tag LOCUS_35390 8742 7222 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_35390 9885 8776 gene locus_tag LOCUS_35400 9885 8776 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213649.1 protein_id gnl|my_center|LOCUS_35400 10591 11832 gene locus_tag LOCUS_35410 10591 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 12181 11927 gene locus_tag LOCUS_35420 12181 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 12581 14551 gene locus_tag LOCUS_35430 12581 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 15374 15739 gene locus_tag LOCUS_35440 15374 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 16298 15852 gene locus_tag LOCUS_35450 16298 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence103 576 6143 gene locus_tag LOCUS_35460 576 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 6648 7421 gene locus_tag LOCUS_35470 6648 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 7442 8953 gene locus_tag LOCUS_35480 7442 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 9481 10794 gene locus_tag LOCUS_35490 9481 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 10937 11923 gene locus_tag LOCUS_35500 10937 11923 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_35500 12427 12173 gene locus_tag LOCUS_35510 12427 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 12675 13274 gene locus_tag LOCUS_35520 12675 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 13832 13611 gene locus_tag LOCUS_35530 13832 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 14531 14076 gene locus_tag LOCUS_35540 14531 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 14895 15626 gene locus_tag LOCUS_35550 14895 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 15960 16307 gene locus_tag LOCUS_35560 15960 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence104 522 85 gene locus_tag LOCUS_35570 522 85 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_35570 784 975 gene locus_tag LOCUS_35580 784 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1203 1376 gene locus_tag LOCUS_35590 1203 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2000 2332 gene locus_tag LOCUS_35600 2000 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35600 2356 4833 gene locus_tag LOCUS_35610 2356 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35610 5075 7204 gene locus_tag LOCUS_35620 5075 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 7818 10622 gene locus_tag LOCUS_35630 7818 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 10823 11470 gene locus_tag LOCUS_35640 10823 11470 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_35640 11669 12289 gene locus_tag LOCUS_35650 11669 12289 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_35650 12466 13503 gene locus_tag LOCUS_35660 12466 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 13730 13452 gene locus_tag LOCUS_35670 13730 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 13800 14174 gene locus_tag LOCUS_35680 13800 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 14340 14585 gene locus_tag LOCUS_35690 14340 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 14896 15873 gene locus_tag LOCUS_35700 14896 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence105 458 973 gene locus_tag LOCUS_35710 458 973 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142243.1 protein_id gnl|my_center|LOCUS_35710 1119 2552 gene locus_tag LOCUS_35720 1119 2552 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 protein_id gnl|my_center|LOCUS_35720 3059 4111 gene locus_tag LOCUS_35730 3059 4111 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_35730 4123 4662 gene locus_tag LOCUS_35740 4123 4662 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 protein_id gnl|my_center|LOCUS_35740 4659 5465 gene locus_tag LOCUS_35750 4659 5465 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_35750 5462 6133 gene locus_tag LOCUS_35760 5462 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 6146 6682 gene locus_tag LOCUS_35770 6146 6682 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_35770 6855 8147 gene locus_tag LOCUS_35780 6855 8147 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_35780 8101 8895 gene locus_tag LOCUS_35790 8101 8895 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_35790 8892 10181 gene locus_tag LOCUS_35800 8892 10181 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_35800 10199 11491 gene locus_tag LOCUS_35810 10199 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 11587 12924 gene locus_tag LOCUS_35820 11587 12924 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_35820 12924 13928 gene locus_tag LOCUS_35830 12924 13928 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_35830 13937 14371 gene locus_tag LOCUS_35840 13937 14371 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123244.1 protein_id gnl|my_center|LOCUS_35840 14708 15115 gene locus_tag LOCUS_35850 14708 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 16038 15259 gene locus_tag LOCUS_35860 gene nhaR 16038 15259 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence106 <1 782 gene locus_tag LOCUS_35870 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932760.1:polyphosphate kinase 2 family protein 1280 1891 gene locus_tag LOCUS_35880 1280 1891 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_35880 1955 2824 gene locus_tag LOCUS_35890 1955 2824 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_35890 4882 2927 gene locus_tag LOCUS_35900 4882 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 6411 5044 gene locus_tag LOCUS_35910 6411 5044 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_35910 6880 7743 gene locus_tag LOCUS_35920 6880 7743 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664024.1 protein_id gnl|my_center|LOCUS_35920 7977 8432 gene locus_tag LOCUS_35930 7977 8432 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_35930 8625 8978 gene locus_tag LOCUS_35940 8625 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 9085 10047 gene locus_tag LOCUS_35950 9085 10047 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_35950 10065 11432 gene locus_tag LOCUS_35960 10065 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 11447 12568 gene locus_tag LOCUS_35970 11447 12568 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268647.1 protein_id gnl|my_center|LOCUS_35970 12907 12620 gene locus_tag LOCUS_35980 12907 12620 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_35980 13903 13427 gene locus_tag LOCUS_35990 13903 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 14434 14132 gene locus_tag LOCUS_36000 14434 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 15394 14957 gene locus_tag LOCUS_36010 15394 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence107 148 624 gene locus_tag LOCUS_36020 148 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1153 1016 gene locus_tag LOCUS_36030 1153 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 1145 2176 gene locus_tag LOCUS_36040 1145 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3382 2258 gene locus_tag LOCUS_36050 3382 2258 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_36050 3491 3703 gene locus_tag LOCUS_36060 3491 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3791 5710 gene locus_tag LOCUS_36070 3791 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 5722 6435 gene locus_tag LOCUS_36080 5722 6435 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_36080 7629 7994 gene locus_tag LOCUS_36090 7629 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 8139 8936 gene locus_tag LOCUS_36100 8139 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 9552 9869 gene locus_tag LOCUS_36110 9552 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 10265 10113 gene locus_tag LOCUS_36120 10265 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 10616 11074 gene locus_tag LOCUS_36130 10616 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 12003 11440 gene locus_tag LOCUS_36140 12003 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 13002 12238 gene locus_tag LOCUS_36150 13002 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 13245 13730 gene locus_tag LOCUS_36160 13245 13730 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_36160 14616 13753 gene locus_tag LOCUS_36170 14616 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 <15681 14812 gene locus_tag LOCUS_36180 <15681 14812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922574.1:zinc-dependent peptidase >Feature sequence108 3688 29 gene locus_tag LOCUS_36190 3688 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4197 5423 gene locus_tag LOCUS_36200 4197 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 5420 6106 gene locus_tag LOCUS_36210 5420 6106 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435381.1 protein_id gnl|my_center|LOCUS_36210 7125 6136 gene locus_tag LOCUS_36220 7125 6136 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_36220 7687 7157 gene locus_tag LOCUS_36230 7687 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 8647 8027 gene locus_tag LOCUS_36240 8647 8027 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_36240 9793 8681 gene locus_tag LOCUS_36250 9793 8681 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816376.1 protein_id gnl|my_center|LOCUS_36250 10875 9853 gene locus_tag LOCUS_36260 10875 9853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_36260 11641 10958 gene locus_tag LOCUS_36270 11641 10958 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_36270 12046 11681 gene locus_tag LOCUS_36280 12046 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 12661 12113 gene locus_tag LOCUS_36290 12661 12113 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_36290 12928 14499 gene locus_tag LOCUS_36300 12928 14499 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169351683.1 protein_id gnl|my_center|LOCUS_36300 14612 14893 gene locus_tag LOCUS_36310 14612 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 14886 15146 gene locus_tag LOCUS_36320 14886 15146 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_36320 15231 15488 gene locus_tag LOCUS_36330 15231 15488 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_36330 >Feature sequence109 628 422 gene locus_tag LOCUS_36340 628 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1704 4190 gene locus_tag LOCUS_36350 1704 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 5173 4586 gene locus_tag LOCUS_36360 5173 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 5912 9610 gene locus_tag LOCUS_36370 5912 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 11545 9755 gene locus_tag LOCUS_36380 11545 9755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_36380 12570 11542 gene locus_tag LOCUS_36390 12570 11542 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 protein_id gnl|my_center|LOCUS_36390 12582 12770 gene locus_tag LOCUS_36400 12582 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 13241 14059 gene locus_tag LOCUS_36410 13241 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence110 2272 191 gene locus_tag LOCUS_36420 gene fusA 2272 191 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_36420 2855 2385 gene locus_tag LOCUS_36430 gene rpsG 2855 2385 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_36430 7579 3422 gene locus_tag LOCUS_36440 gene rpoC 7579 3422 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_36440 11598 7633 gene locus_tag LOCUS_36450 gene rpoB 11598 7633 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_36450 12628 11693 gene locus_tag LOCUS_36460 12628 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 13351 12659 gene locus_tag LOCUS_36470 gene rplA 13351 12659 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_36470 13815 13384 gene locus_tag LOCUS_36480 gene rplK 13815 13384 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546433.1 protein_id gnl|my_center|LOCUS_36480 14417 13881 gene locus_tag LOCUS_36490 gene nusG 14417 13881 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_36490 14804 14729 gene locus_tag LOCUS_t00400 14804 14729 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence111 <1 934 gene locus_tag LOCUS_36500 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974940.1:NAD-dependent epimerase/dehydratase family protein 2001 1474 gene locus_tag LOCUS_36510 2001 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 2590 2045 gene locus_tag LOCUS_36520 2590 2045 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_36520 4017 3340 gene locus_tag LOCUS_36530 4017 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 6261 6578 gene locus_tag LOCUS_36540 6261 6578 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_36540 6553 6816 gene locus_tag LOCUS_36550 6553 6816 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_36550 7599 7396 gene locus_tag LOCUS_36560 7599 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 7811 7596 gene locus_tag LOCUS_36570 7811 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 8665 9534 gene locus_tag LOCUS_36580 8665 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 9635 11752 gene locus_tag LOCUS_36590 9635 11752 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_36590 11770 12318 gene locus_tag LOCUS_36600 11770 12318 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_36600 12961 12488 gene locus_tag LOCUS_36610 12961 12488 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_36610 14692 13103 gene locus_tag LOCUS_36620 14692 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence112 84 1691 gene locus_tag LOCUS_36630 84 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1678 2139 gene locus_tag LOCUS_36640 1678 2139 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_36640 2156 5212 gene locus_tag LOCUS_36650 2156 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 5685 5242 gene locus_tag LOCUS_36660 5685 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 7036 7950 gene locus_tag LOCUS_36670 7036 7950 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314081.1 protein_id gnl|my_center|LOCUS_36670 10126 8012 gene locus_tag LOCUS_36680 10126 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 10487 10140 gene locus_tag LOCUS_36690 10487 10140 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259116.1 protein_id gnl|my_center|LOCUS_36690 10852 10484 gene locus_tag LOCUS_36700 10852 10484 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_36700 12395 10929 gene locus_tag LOCUS_36710 gene kaiC 12395 10929 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_36710 12915 13496 gene locus_tag LOCUS_36720 12915 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 14369 13575 gene locus_tag LOCUS_36730 14369 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence113 157 420 gene locus_tag LOCUS_36740 157 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2348 933 gene locus_tag LOCUS_36750 2348 933 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_36750 3817 3509 gene locus_tag LOCUS_36760 3817 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 3828 4100 gene locus_tag LOCUS_36770 3828 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 4524 4213 gene locus_tag LOCUS_36780 4524 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 4863 8450 gene locus_tag LOCUS_36790 4863 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 9443 9075 gene locus_tag LOCUS_36800 9443 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688254.1 protein_id gnl|my_center|LOCUS_36800 10676 9849 gene locus_tag LOCUS_36810 10676 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 10951 11103 gene locus_tag LOCUS_36820 10951 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 11162 11425 gene locus_tag LOCUS_36830 11162 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 12097 13500 gene locus_tag LOCUS_36840 12097 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_36840 13899 13824 gene locus_tag LOCUS_t00410 13899 13824 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 769 395 gene locus_tag LOCUS_36850 769 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 1146 766 gene locus_tag LOCUS_36860 1146 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 2933 1143 gene locus_tag LOCUS_36870 2933 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3756 5519 gene locus_tag LOCUS_36880 3756 5519 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_36880 5785 9822 gene locus_tag LOCUS_36890 5785 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 11793 10126 gene locus_tag LOCUS_36900 gene ubiB 11793 10126 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_36900 12279 13295 gene locus_tag LOCUS_36910 12279 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 13457 14008 gene locus_tag LOCUS_36920 13457 14008 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_36920 >Feature sequence115 424 2106 gene locus_tag LOCUS_36930 424 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 2118 5249 gene locus_tag LOCUS_36940 2118 5249 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444632.1 protein_id gnl|my_center|LOCUS_36940 5704 5420 gene locus_tag LOCUS_36950 5704 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 6005 5793 gene locus_tag LOCUS_36960 6005 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 6109 6306 gene locus_tag LOCUS_36970 6109 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 6846 6607 gene locus_tag LOCUS_36980 6846 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 7303 6977 gene locus_tag LOCUS_36990 7303 6977 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919842.1 protein_id gnl|my_center|LOCUS_36990 7919 7485 gene locus_tag LOCUS_37000 7919 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 8833 8081 gene locus_tag LOCUS_37010 8833 8081 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546694.1 protein_id gnl|my_center|LOCUS_37010 12075 8947 gene locus_tag LOCUS_37020 12075 8947 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_37020 <13369 12123 gene locus_tag LOCUS_37030 <13369 12123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942781.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence116 201 58 gene locus_tag LOCUS_37040 201 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 424 2052 gene locus_tag LOCUS_37050 gene lnt 424 2052 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_37050 2506 3195 gene locus_tag LOCUS_37060 2506 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3316 4803 gene locus_tag LOCUS_37070 gene lysS 3316 4803 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_37070 4800 6086 gene locus_tag LOCUS_37080 4800 6086 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_37080 6079 6828 gene locus_tag LOCUS_37090 6079 6828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_37090 7809 7048 gene locus_tag LOCUS_37100 7809 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 8774 7974 gene locus_tag LOCUS_37110 8774 7974 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_37110 9202 8846 gene locus_tag LOCUS_37120 9202 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 10147 9278 gene locus_tag LOCUS_37130 10147 9278 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_37130 11445 10159 gene locus_tag LOCUS_37140 11445 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 12436 11486 gene locus_tag LOCUS_37150 12436 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence117 126 1487 gene locus_tag LOCUS_37160 126 1487 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050421597.1 protein_id gnl|my_center|LOCUS_37160 1915 2424 gene locus_tag LOCUS_37170 1915 2424 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_37170 2443 3288 gene locus_tag LOCUS_37180 2443 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 3301 4161 gene locus_tag LOCUS_37190 3301 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 4177 4362 gene locus_tag LOCUS_37200 4177 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 4395 5255 gene locus_tag LOCUS_37210 4395 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 6020 6457 gene locus_tag LOCUS_37220 6020 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 6820 7110 gene locus_tag LOCUS_37230 6820 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 7103 7378 gene locus_tag LOCUS_37240 7103 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 7957 8109 gene locus_tag LOCUS_37250 7957 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 9110 8367 gene locus_tag LOCUS_37260 9110 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 10574 11047 gene locus_tag LOCUS_37270 10574 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_37270 11953 11315 gene locus_tag LOCUS_37280 11953 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 12356 12033 gene locus_tag LOCUS_37290 12356 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence118 994 1206 gene locus_tag LOCUS_37300 994 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 2739 3683 gene locus_tag LOCUS_37310 2739 3683 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664024.1 protein_id gnl|my_center|LOCUS_37310 3861 6560 gene locus_tag LOCUS_37320 3861 6560 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_37320 6672 7442 gene locus_tag LOCUS_37330 6672 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 7509 8213 gene locus_tag LOCUS_37340 7509 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 8226 9680 gene locus_tag LOCUS_37350 8226 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 10423 11151 gene locus_tag LOCUS_37360 10423 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 11208 11450 gene locus_tag LOCUS_37370 11208 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 11447 12217 gene locus_tag LOCUS_37380 11447 12217 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37380 >Feature sequence119 267 85 gene locus_tag LOCUS_37390 267 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 1109 531 gene locus_tag LOCUS_37400 1109 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 1176 1487 gene locus_tag LOCUS_37410 1176 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 2155 2325 gene locus_tag LOCUS_37420 2155 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37420 3221 2442 gene locus_tag LOCUS_37430 3221 2442 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933394.1 protein_id gnl|my_center|LOCUS_37430 3968 3654 gene locus_tag LOCUS_37440 3968 3654 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_37440 4394 4149 gene locus_tag LOCUS_37450 4394 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 4818 4600 gene locus_tag LOCUS_37460 4818 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 5799 5452 gene locus_tag LOCUS_37470 5799 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 6035 6586 gene locus_tag LOCUS_37480 6035 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 6998 7396 gene locus_tag LOCUS_37490 6998 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 7974 7420 gene locus_tag LOCUS_37500 7974 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 8229 8648 gene locus_tag LOCUS_37510 8229 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 9414 8863 gene locus_tag LOCUS_37520 9414 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 10100 9738 gene locus_tag LOCUS_37530 10100 9738 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810814.1 protein_id gnl|my_center|LOCUS_37530 11194 10625 gene locus_tag LOCUS_37540 gene pncA 11194 10625 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_37540 <12266 11212 gene locus_tag LOCUS_37550 <12266 11212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403007.1:nicotinate phosphoribosyltransferase >Feature sequence120 750 1262 gene locus_tag LOCUS_37560 750 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 2574 1615 gene locus_tag LOCUS_37570 2574 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 4350 2971 gene locus_tag LOCUS_37580 gene miaB 4350 2971 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_37580 5743 4358 gene locus_tag LOCUS_37590 gene mtaB 5743 4358 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_37590 6041 7420 gene locus_tag LOCUS_37600 6041 7420 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_37600 7717 7427 gene locus_tag LOCUS_37610 7717 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 8471 12001 gene locus_tag LOCUS_37620 8471 12001 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence121 204 1553 gene locus_tag LOCUS_37630 204 1553 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_37630 1681 2193 gene locus_tag LOCUS_37640 1681 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2793 3443 gene locus_tag LOCUS_37650 gene fadR 2793 3443 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_37650 3448 4545 gene locus_tag LOCUS_37660 3448 4545 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_37660 4542 7793 gene locus_tag LOCUS_37670 4542 7793 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_37670 7816 9159 gene locus_tag LOCUS_37680 7816 9159 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_37680 9190 10791 gene locus_tag LOCUS_37690 9190 10791 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_37690 >Feature sequence122 632 2503 gene locus_tag LOCUS_37700 632 2503 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_37700 2749 3444 gene locus_tag LOCUS_37710 2749 3444 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940507.1 protein_id gnl|my_center|LOCUS_37710 4363 6720 gene locus_tag LOCUS_37720 4363 6720 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 protein_id gnl|my_center|LOCUS_37720 7543 6755 gene locus_tag LOCUS_37730 7543 6755 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940507.1 protein_id gnl|my_center|LOCUS_37730 7859 8089 gene locus_tag LOCUS_37740 7859 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 8184 10337 gene locus_tag LOCUS_37750 8184 10337 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_37750 10742 10545 gene locus_tag LOCUS_37760 10742 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37760 11230 10958 gene locus_tag LOCUS_37770 11230 10958 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_37770 >Feature sequence123 233 6 gene locus_tag LOCUS_37780 233 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 1144 962 gene locus_tag LOCUS_37790 1144 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 1185 2900 gene locus_tag LOCUS_37800 1185 2900 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_37800 4460 3447 gene locus_tag LOCUS_37810 4460 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 5288 4767 gene locus_tag LOCUS_37820 5288 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 6121 5486 gene locus_tag LOCUS_37830 6121 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 7793 6132 gene locus_tag LOCUS_37840 7793 6132 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_37840 8425 7790 gene locus_tag LOCUS_37850 8425 7790 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_37850 8928 8422 gene locus_tag LOCUS_37860 8928 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 10080 9703 gene locus_tag LOCUS_37870 10080 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 10235 10429 gene locus_tag LOCUS_37880 10235 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 10596 11273 gene locus_tag LOCUS_37890 10596 11273 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence124 1168 962 gene locus_tag LOCUS_37900 1168 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1167 1724 gene locus_tag LOCUS_37910 1167 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480904.1 protein_id gnl|my_center|LOCUS_37910 2816 1779 gene locus_tag LOCUS_37920 2816 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 4608 2902 gene locus_tag LOCUS_37930 4608 2902 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_37930 6562 5150 gene locus_tag LOCUS_37940 6562 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 8295 6739 gene locus_tag LOCUS_37950 8295 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947929.1 protein_id gnl|my_center|LOCUS_37950 8984 9133 gene locus_tag LOCUS_37960 8984 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 10506 10294 gene locus_tag LOCUS_37970 10506 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 10625 10996 gene locus_tag LOCUS_37980 10625 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence125 950 15 gene locus_tag LOCUS_37990 950 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 1715 954 gene locus_tag LOCUS_38000 1715 954 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 protein_id gnl|my_center|LOCUS_38000 2213 4015 gene locus_tag LOCUS_38010 2213 4015 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_38010 4165 5097 gene locus_tag LOCUS_38020 4165 5097 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_38020 5432 5749 gene locus_tag LOCUS_38030 5432 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 6974 6591 gene locus_tag LOCUS_38040 6974 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 8175 7633 gene locus_tag LOCUS_38050 8175 7633 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941761.1 protein_id gnl|my_center|LOCUS_38050 8563 8180 gene locus_tag LOCUS_38060 8563 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 8720 9481 gene locus_tag LOCUS_38070 8720 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 10270 9581 gene locus_tag LOCUS_38080 gene phoU 10270 9581 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_38080 11137 10304 gene locus_tag LOCUS_38090 gene pstB 11137 10304 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880655.1 protein_id gnl|my_center|LOCUS_38090 >Feature sequence126 2015 915 gene locus_tag LOCUS_38100 gene fbp 2015 915 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_38100 2441 2214 gene locus_tag LOCUS_38110 2441 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3424 3657 gene locus_tag LOCUS_38120 3424 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3747 4085 gene locus_tag LOCUS_38130 3747 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 4718 5482 gene locus_tag LOCUS_38140 4718 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 6735 6514 gene locus_tag LOCUS_38150 6735 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 8095 7181 gene locus_tag LOCUS_38160 8095 7181 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_38160 8624 10609 gene locus_tag LOCUS_38170 8624 10609 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087420.1 protein_id gnl|my_center|LOCUS_38170 >Feature sequence127 361 585 gene locus_tag LOCUS_38180 361 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 567 791 gene locus_tag LOCUS_38190 567 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38190 1049 1246 gene locus_tag LOCUS_38200 1049 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 9135 1984 gene locus_tag LOCUS_38210 9135 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 10303 9827 gene locus_tag LOCUS_38220 10303 9827 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_38220 >Feature sequence128 384 1301 gene locus_tag LOCUS_38230 gene glyQ 384 1301 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_38230 1417 3528 gene locus_tag LOCUS_38240 gene glyS 1417 3528 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_38240 3598 4083 gene locus_tag LOCUS_38250 3598 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 4305 7406 gene locus_tag LOCUS_38260 gene ppdK 4305 7406 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_38260 7403 8533 gene locus_tag LOCUS_38270 gene ribD 7403 8533 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_38270 8642 9436 gene locus_tag LOCUS_38280 8642 9436 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994141.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence129 225 428 gene locus_tag LOCUS_38290 225 428 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_38290 425 742 gene locus_tag LOCUS_38300 425 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1594 2334 gene locus_tag LOCUS_38310 1594 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 2331 3200 gene locus_tag LOCUS_38320 2331 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 4689 4510 gene locus_tag LOCUS_38330 4689 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 4937 5269 gene locus_tag LOCUS_38340 4937 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 5809 6399 gene locus_tag LOCUS_38350 5809 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 6680 7000 gene locus_tag LOCUS_38360 6680 7000 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816713.1 protein_id gnl|my_center|LOCUS_38360 6997 7830 gene locus_tag LOCUS_38370 6997 7830 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011326545.1 protein_id gnl|my_center|LOCUS_38370 8218 8703 gene locus_tag LOCUS_38380 8218 8703 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 protein_id gnl|my_center|LOCUS_38380 9945 10190 gene locus_tag LOCUS_38390 9945 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 10187 10504 gene locus_tag LOCUS_38400 10187 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence130 <1 613 gene locus_tag LOCUS_38410 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544924.1:ATP synthase F1 subunit gamma 682 2139 gene locus_tag LOCUS_38420 gene atpD 682 2139 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_38420 2139 2576 gene locus_tag LOCUS_38430 2139 2576 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_38430 2717 2580 gene locus_tag LOCUS_38440 2717 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 2913 4223 gene locus_tag LOCUS_38450 2913 4223 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_38450 4432 5475 gene locus_tag LOCUS_38460 4432 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 5554 6708 gene locus_tag LOCUS_38470 5554 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 7011 7973 gene locus_tag LOCUS_38480 7011 7973 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_38480 8007 8447 gene locus_tag LOCUS_38490 8007 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 9459 8632 gene locus_tag LOCUS_38500 9459 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 10431 9781 gene locus_tag LOCUS_38510 10431 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 10642 10717 gene locus_tag LOCUS_t00420 10642 10717 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 1250 21 gene locus_tag LOCUS_38520 1250 21 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 protein_id gnl|my_center|LOCUS_38520 1215 1379 gene locus_tag LOCUS_38530 1215 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 1695 1360 gene locus_tag LOCUS_38540 1695 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 1975 2931 gene locus_tag LOCUS_38550 1975 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3295 3666 gene locus_tag LOCUS_38560 3295 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 3724 3939 gene locus_tag LOCUS_38570 3724 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4069 5460 gene locus_tag LOCUS_38580 4069 5460 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 protein_id gnl|my_center|LOCUS_38580 5539 5889 gene locus_tag LOCUS_38590 5539 5889 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969438.1 protein_id gnl|my_center|LOCUS_38590 5889 6470 gene locus_tag LOCUS_38600 5889 6470 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096519.1 protein_id gnl|my_center|LOCUS_38600 6590 6808 gene locus_tag LOCUS_38610 6590 6808 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123298.1 protein_id gnl|my_center|LOCUS_38610 6838 7695 gene locus_tag LOCUS_38620 6838 7695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143210.1 protein_id gnl|my_center|LOCUS_38620 8001 8966 gene locus_tag LOCUS_38630 8001 8966 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190574.1 protein_id gnl|my_center|LOCUS_38630 9418 9897 gene locus_tag LOCUS_38640 9418 9897 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence132 1325 762 gene locus_tag LOCUS_38650 1325 762 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 protein_id gnl|my_center|LOCUS_38650 1884 3521 gene locus_tag LOCUS_38660 gene groL 1884 3521 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_38660 4813 3569 gene locus_tag LOCUS_38670 4813 3569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331457.1 protein_id gnl|my_center|LOCUS_38670 5431 5114 gene locus_tag LOCUS_38680 5431 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 7607 5481 gene locus_tag LOCUS_38690 gene pnp 7607 5481 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_38690 8408 8575 gene locus_tag LOCUS_38700 8408 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 8645 10249 gene locus_tag LOCUS_38710 8645 10249 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_38710 >Feature sequence133 45 3536 gene locus_tag LOCUS_38720 45 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3583 3915 gene locus_tag LOCUS_38730 3583 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4044 5525 gene locus_tag LOCUS_38740 4044 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 5760 6008 gene locus_tag LOCUS_38750 5760 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 6214 6026 gene locus_tag LOCUS_38760 6214 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 6391 6591 gene locus_tag LOCUS_38770 6391 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 6588 6986 gene locus_tag LOCUS_38780 6588 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 7975 7631 gene locus_tag LOCUS_38790 7975 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 8511 8756 gene locus_tag LOCUS_38800 8511 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 9560 9048 gene locus_tag LOCUS_38810 9560 9048 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_38810 9752 10678 gene locus_tag LOCUS_38820 9752 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence134 781 86 gene locus_tag LOCUS_38830 781 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 1025 1831 gene locus_tag LOCUS_38840 1025 1831 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_38840 2038 1826 gene locus_tag LOCUS_38850 2038 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 2563 2171 gene locus_tag LOCUS_38860 2563 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2845 3873 gene locus_tag LOCUS_38870 2845 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 3877 5568 gene locus_tag LOCUS_38880 3877 5568 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_38880 6003 5755 gene locus_tag LOCUS_38890 6003 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 6036 9464 gene locus_tag LOCUS_38900 6036 9464 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence135 3074 1683 gene locus_tag LOCUS_38910 gene rseP 3074 1683 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_38910 4261 3092 gene locus_tag LOCUS_38920 4261 3092 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_38920 5104 4298 gene locus_tag LOCUS_38930 5104 4298 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_38930 5970 5185 gene locus_tag LOCUS_38940 5970 5185 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_38940 6391 7818 gene locus_tag LOCUS_38950 gene tldD 6391 7818 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_38950 7856 9226 gene locus_tag LOCUS_38960 gene pmbA 7856 9226 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_38960 9320 9820 gene locus_tag LOCUS_38970 9320 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence136 389 2878 gene locus_tag LOCUS_38980 389 2878 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 protein_id gnl|my_center|LOCUS_38980 3536 3180 gene locus_tag LOCUS_38990 3536 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 5109 3559 gene locus_tag LOCUS_39000 5109 3559 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463402.1 protein_id gnl|my_center|LOCUS_39000 5489 5157 gene locus_tag LOCUS_39010 5489 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 6402 7010 gene locus_tag LOCUS_39020 6402 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 7399 8484 gene locus_tag LOCUS_39030 7399 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 9596 8796 gene locus_tag LOCUS_39040 9596 8796 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463526.1 protein_id gnl|my_center|LOCUS_39040 >Feature sequence137 120 521 gene locus_tag LOCUS_39050 120 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 592 795 gene locus_tag LOCUS_39060 592 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 1039 1419 gene locus_tag LOCUS_39070 1039 1419 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_39070 1505 2935 gene locus_tag LOCUS_39080 1505 2935 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_39080 3010 3393 gene locus_tag LOCUS_39090 3010 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3446 5881 gene locus_tag LOCUS_39100 gene ppsA 3446 5881 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_39100 6092 6406 gene locus_tag LOCUS_39110 6092 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 7110 6787 gene locus_tag LOCUS_39120 7110 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 9717 7684 gene locus_tag LOCUS_39130 9717 7684 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226130.1 protein_id gnl|my_center|LOCUS_39130 >Feature sequence138 608 6 gene locus_tag LOCUS_39140 608 6 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088483.1 protein_id gnl|my_center|LOCUS_39140 842 1303 gene locus_tag LOCUS_39150 842 1303 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444234.1 protein_id gnl|my_center|LOCUS_39150 1383 1997 gene locus_tag LOCUS_39160 1383 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 2255 2043 gene locus_tag LOCUS_39170 2255 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 2658 3344 gene locus_tag LOCUS_39180 2658 3344 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704726.1 protein_id gnl|my_center|LOCUS_39180 3872 3438 gene locus_tag LOCUS_39190 3872 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 5167 5499 gene locus_tag LOCUS_39200 5167 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 5629 5787 gene locus_tag LOCUS_39210 5629 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 6932 5739 gene locus_tag LOCUS_39220 6932 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 7681 7064 gene locus_tag LOCUS_39230 7681 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 8165 7671 gene locus_tag LOCUS_39240 8165 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 8546 9634 gene locus_tag LOCUS_39250 8546 9634 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_39250 >Feature sequence139 437 3622 gene locus_tag LOCUS_39260 437 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 3619 5073 gene locus_tag LOCUS_39270 3619 5073 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_39270 5804 5148 gene locus_tag LOCUS_39280 5804 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 6498 7496 gene locus_tag LOCUS_39290 6498 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 8512 9483 gene locus_tag LOCUS_39300 8512 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence140 3178 1148 gene locus_tag LOCUS_39310 gene prsK 3178 1148 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_39310 3383 3129 gene locus_tag LOCUS_39320 3383 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 5514 4081 gene locus_tag LOCUS_39330 gene glrR 5514 4081 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_39330 6316 5492 gene locus_tag LOCUS_39340 6316 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 7797 6313 gene locus_tag LOCUS_39350 7797 6313 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_39350 >Feature sequence141 3863 621 gene locus_tag LOCUS_39360 3863 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4443 4042 gene locus_tag LOCUS_39370 4443 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 5676 4747 gene locus_tag LOCUS_39380 5676 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 6437 5739 gene locus_tag LOCUS_39390 6437 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 9148 7583 gene locus_tag LOCUS_39400 9148 7583 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546159.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence142 2039 1044 gene locus_tag LOCUS_39410 2039 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 3502 2756 gene locus_tag LOCUS_39420 3502 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4809 3502 gene locus_tag LOCUS_39430 4809 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 6728 5379 gene locus_tag LOCUS_39440 6728 5379 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_39440 8629 6740 gene locus_tag LOCUS_39450 gene asnB 8629 6740 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_39450 >Feature sequence143 1536 763 gene locus_tag LOCUS_39460 1536 763 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_39460 2218 1520 gene locus_tag LOCUS_39470 2218 1520 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_39470 2702 2271 gene locus_tag LOCUS_39480 2702 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 3865 2705 gene locus_tag LOCUS_39490 3865 2705 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651478.1 protein_id gnl|my_center|LOCUS_39490 4989 3865 gene locus_tag LOCUS_39500 4989 3865 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_39500 5304 4993 gene locus_tag LOCUS_39510 5304 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 6713 5388 gene locus_tag LOCUS_39520 6713 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 7074 7697 gene locus_tag LOCUS_39530 7074 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 7753 8709 gene locus_tag LOCUS_39540 7753 8709 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_39540 >Feature sequence144 623 3085 gene locus_tag LOCUS_39550 623 3085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_39550 3268 3705 gene locus_tag LOCUS_39560 3268 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 3705 4439 gene locus_tag LOCUS_39570 3705 4439 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_39570 4544 4795 gene locus_tag LOCUS_39580 4544 4795 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 protein_id gnl|my_center|LOCUS_39580 5215 5060 gene locus_tag LOCUS_39590 5215 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 5214 8690 gene locus_tag LOCUS_39600 5214 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 >Feature sequence145 2 373 gene locus_tag LOCUS_39610 2 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 2757 724 gene locus_tag LOCUS_39620 2757 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 3299 3036 gene locus_tag LOCUS_39630 3299 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 3460 3927 gene locus_tag LOCUS_39640 3460 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 4577 3939 gene locus_tag LOCUS_39650 gene recR 4577 3939 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_39650 4924 4598 gene locus_tag LOCUS_39660 4924 4598 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_39660 6756 4924 gene locus_tag LOCUS_39670 gene dnaX 6756 4924 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_39670 7129 7040 gene locus_tag LOCUS_t00430 7129 7040 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8196 7390 gene locus_tag LOCUS_39680 8196 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 8467 8222 gene locus_tag LOCUS_39690 8467 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence146 89 289 gene locus_tag LOCUS_39700 89 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1612 224 gene locus_tag LOCUS_39710 1612 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2528 2127 gene locus_tag LOCUS_39720 2528 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 2725 2498 gene locus_tag LOCUS_39730 2725 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 3520 3266 gene locus_tag LOCUS_39740 3520 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 5741 3855 gene locus_tag LOCUS_39750 5741 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 6147 5770 gene locus_tag LOCUS_39760 6147 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 6405 6539 gene locus_tag LOCUS_39770 6405 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 8042 7767 gene locus_tag LOCUS_39780 8042 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 >Feature sequence147 4317 3094 gene locus_tag LOCUS_39790 4317 3094 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_39790 5727 4345 gene locus_tag LOCUS_39800 5727 4345 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_39800 6093 6812 gene locus_tag LOCUS_39810 6093 6812 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_39810 >Feature sequence148 436 361 gene locus_tag LOCUS_t00440 436 361 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1719 505 gene locus_tag LOCUS_39820 gene ispG 1719 505 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_39820 3618 1723 gene locus_tag LOCUS_39830 gene dxs 3618 1723 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_39830 4573 3773 gene locus_tag LOCUS_39840 4573 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 5838 4630 gene locus_tag LOCUS_39850 5838 4630 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_39850 6479 5853 gene locus_tag LOCUS_39860 6479 5853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_39860 7603 6782 gene locus_tag LOCUS_39870 7603 6782 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_39870 <8123 7619 gene locus_tag LOCUS_39880 <8123 7619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943686.1:squalene--hopene cyclase >Feature sequence149 1939 554 gene locus_tag LOCUS_39890 1939 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 2826 1936 gene locus_tag LOCUS_39900 gene hpnD 2826 1936 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_39900 2880 3080 gene locus_tag LOCUS_39910 2880 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 3805 3263 gene locus_tag LOCUS_39920 3805 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4138 4551 gene locus_tag LOCUS_39930 4138 4551 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_39930 4653 5675 gene locus_tag LOCUS_39940 4653 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 6568 5693 gene locus_tag LOCUS_39950 6568 5693 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_39950 7495 6584 gene locus_tag LOCUS_39960 7495 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 >Feature sequence150 7285 5003 gene locus_tag LOCUS_39970 7285 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 >Feature sequence151 2574 607 gene locus_tag LOCUS_39980 2574 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 3169 3354 gene locus_tag LOCUS_39990 3169 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 4325 5599 gene locus_tag LOCUS_40000 4325 5599 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_40000 6671 6880 gene locus_tag LOCUS_40010 6671 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 7105 7296 gene locus_tag LOCUS_40020 7105 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence152 45 341 gene locus_tag LOCUS_40030 45 341 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_40030 3233 411 gene locus_tag LOCUS_40040 gene uvrA 3233 411 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545482.1 protein_id gnl|my_center|LOCUS_40040 3771 3382 gene locus_tag LOCUS_40050 gene crcB 3771 3382 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_40050 4696 3863 gene locus_tag LOCUS_40060 4696 3863 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_40060 5229 4741 gene locus_tag LOCUS_40070 5229 4741 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40070 5925 6713 gene locus_tag LOCUS_40080 5925 6713 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_40080 7669 6734 gene locus_tag LOCUS_40090 7669 6734 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_40090 >Feature sequence153 1639 2265 gene locus_tag LOCUS_40100 1639 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2471 2728 gene locus_tag LOCUS_40110 2471 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 2841 3542 gene locus_tag LOCUS_40120 2841 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 3600 4091 gene locus_tag LOCUS_40130 3600 4091 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_40130 4455 4715 gene locus_tag LOCUS_40140 4455 4715 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_40140 4847 5041 gene locus_tag LOCUS_40150 4847 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 5038 5445 gene locus_tag LOCUS_40160 5038 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 5471 5680 gene locus_tag LOCUS_40170 5471 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 6169 6948 gene locus_tag LOCUS_40180 6169 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence154 360 596 gene locus_tag LOCUS_40190 360 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 1414 617 gene locus_tag LOCUS_40200 1414 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 3037 1529 gene locus_tag LOCUS_40210 gene dhaS 3037 1529 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_40210 4881 3727 gene locus_tag LOCUS_40220 gene hemL 4881 3727 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_40220 5515 5871 gene locus_tag LOCUS_40230 5515 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 7259 7150 gene locus_tag LOCUS_r00010 7259 7150 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence155 236 18 gene locus_tag LOCUS_40240 236 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 790 398 gene locus_tag LOCUS_40250 790 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 1019 1537 gene locus_tag LOCUS_40260 1019 1537 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_40260 1612 2607 gene locus_tag LOCUS_40270 1612 2607 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_40270 2700 5294 gene locus_tag LOCUS_40280 2700 5294 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928491.1 protein_id gnl|my_center|LOCUS_40280 5385 5660 gene locus_tag LOCUS_40290 5385 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 6333 6142 gene locus_tag LOCUS_40300 6333 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 6595 7032 gene locus_tag LOCUS_40310 6595 7032 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_40310 >Feature sequence156 1075 263 gene locus_tag LOCUS_40320 1075 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 1097 1255 gene locus_tag LOCUS_40330 1097 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 1367 1894 gene locus_tag LOCUS_40340 1367 1894 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_40340 1911 2144 gene locus_tag LOCUS_40350 1911 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 2284 2577 gene locus_tag LOCUS_40360 2284 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 3002 2784 gene locus_tag LOCUS_40370 3002 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 4399 4806 gene locus_tag LOCUS_40380 4399 4806 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_40380 <7114 5127 gene locus_tag LOCUS_40390 <7114 5127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948005.1:RNA polymerase-associated protein RapA >Feature sequence157 966 1616 gene locus_tag LOCUS_40400 966 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 1655 1957 gene locus_tag LOCUS_40410 1655 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 2252 2542 gene locus_tag LOCUS_40420 2252 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 3567 3295 gene locus_tag LOCUS_40430 3567 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 3834 3568 gene locus_tag LOCUS_40440 3834 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 4416 3865 gene locus_tag LOCUS_40450 4416 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 5006 4416 gene locus_tag LOCUS_40460 5006 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 5220 5438 gene locus_tag LOCUS_40470 5220 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 5488 5778 gene locus_tag LOCUS_40480 5488 5778 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_40480 5775 6620 gene locus_tag LOCUS_40490 5775 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40490 >Feature sequence158 1749 283 gene locus_tag LOCUS_40500 1749 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 2393 1977 gene locus_tag LOCUS_40510 gene ndk 2393 1977 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_40510 3788 2493 gene locus_tag LOCUS_40520 3788 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 5157 3799 gene locus_tag LOCUS_40530 5157 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 5838 5374 gene locus_tag LOCUS_40540 gene trmL 5838 5374 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932347.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence159 209 2158 gene locus_tag LOCUS_40550 209 2158 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 protein_id gnl|my_center|LOCUS_40550 2155 2718 gene locus_tag LOCUS_40560 2155 2718 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 protein_id gnl|my_center|LOCUS_40560 2718 3182 gene locus_tag LOCUS_40570 2718 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 3199 4122 gene locus_tag LOCUS_40580 3199 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4282 4527 gene locus_tag LOCUS_40590 4282 4527 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_40590 4524 4910 gene locus_tag LOCUS_40600 4524 4910 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_40600 <6389 5013 gene locus_tag LOCUS_40610 <6389 5013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:VIT domain-containing protein >Feature sequence160 1474 1019 gene locus_tag LOCUS_40620 gene ccmE 1474 1019 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_40620 1970 1458 gene locus_tag LOCUS_40630 1970 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 2701 1967 gene locus_tag LOCUS_40640 2701 1967 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_40640 2971 4011 gene locus_tag LOCUS_40650 2971 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 6038 4266 gene locus_tag LOCUS_40660 6038 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 5937 6167 gene locus_tag LOCUS_40670 5937 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence161 39 401 gene locus_tag LOCUS_40680 39 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 570 1190 gene locus_tag LOCUS_40690 570 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence162 647 1165 gene locus_tag LOCUS_40700 647 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 1751 3055 gene locus_tag LOCUS_40710 1751 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 3315 4256 gene locus_tag LOCUS_40720 3315 4256 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 protein_id gnl|my_center|LOCUS_40720 4499 5338 gene locus_tag LOCUS_40730 4499 5338 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_40730 >Feature sequence163 1823 1521 gene locus_tag LOCUS_40740 1823 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 2824 2369 gene locus_tag LOCUS_40750 2824 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 3269 2799 gene locus_tag LOCUS_40760 3269 2799 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 protein_id gnl|my_center|LOCUS_40760 3561 3767 gene locus_tag LOCUS_40770 3561 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 4511 4212 gene locus_tag LOCUS_40780 4511 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4986 5333 gene locus_tag LOCUS_40790 4986 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021271.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence164 526 3045 gene locus_tag LOCUS_40800 gene gyrA 526 3045 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_40800 4216 3227 gene locus_tag LOCUS_40810 4216 3227 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_40810 4844 5401 gene locus_tag LOCUS_40820 4844 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 5991 5671 gene locus_tag LOCUS_40830 5991 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence165 353 550 gene locus_tag LOCUS_40840 353 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 1610 624 gene locus_tag LOCUS_40850 1610 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 2234 1785 gene locus_tag LOCUS_40860 2234 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_40860 3438 2506 gene locus_tag LOCUS_40870 3438 2506 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_40870 3912 4136 gene locus_tag LOCUS_40880 3912 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 5189 4302 gene locus_tag LOCUS_40890 5189 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence166 2226 667 gene locus_tag LOCUS_40900 2226 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 2426 2256 gene locus_tag LOCUS_40910 2426 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2738 2511 gene locus_tag LOCUS_40920 2738 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 2842 3282 gene locus_tag LOCUS_40930 2842 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4204 3710 gene locus_tag LOCUS_40940 4204 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 4708 4520 gene locus_tag LOCUS_40950 4708 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence167 2804 663 gene locus_tag LOCUS_40960 2804 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 3163 3666 gene locus_tag LOCUS_40970 3163 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 3747 4445 gene locus_tag LOCUS_40980 3747 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4675 5151 gene locus_tag LOCUS_40990 4675 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence168 84 1412 gene locus_tag LOCUS_41000 84 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 1561 1704 gene locus_tag LOCUS_41010 1561 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 1996 3276 gene locus_tag LOCUS_41020 1996 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 3434 5404 gene locus_tag LOCUS_41030 3434 5404 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_41030 >Feature sequence169 248 919 gene locus_tag LOCUS_41040 248 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 1604 1314 gene locus_tag LOCUS_41050 1604 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 2314 1808 gene locus_tag LOCUS_41060 2314 1808 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_41060 3124 2324 gene locus_tag LOCUS_41070 gene thiF 3124 2324 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_41070 3375 3136 gene locus_tag LOCUS_41080 3375 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 3650 3375 gene locus_tag LOCUS_41090 3650 3375 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_41090 4885 3647 gene locus_tag LOCUS_41100 gene thrC 4885 3647 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_41100 <5733 4921 gene locus_tag LOCUS_41110 <5733 4921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942003.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence170 532 2025 gene locus_tag LOCUS_41120 532 2025 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950927.1 protein_id gnl|my_center|LOCUS_41120 2022 3038 gene locus_tag LOCUS_41130 2022 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 3080 4102 gene locus_tag LOCUS_41140 3080 4102 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435274.1 protein_id gnl|my_center|LOCUS_41140 4230 5108 gene locus_tag LOCUS_41150 4230 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071996.1 protein_id gnl|my_center|LOCUS_41150 >Feature sequence171 <1 564 gene locus_tag LOCUS_41160 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922598.1:pilus assembly protein 561 1586 gene locus_tag LOCUS_41170 561 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 1654 2883 gene locus_tag LOCUS_41180 1654 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 2898 4118 gene locus_tag LOCUS_41190 2898 4118 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124024.1 protein_id gnl|my_center|LOCUS_41190 >Feature sequence172 466 17 gene locus_tag LOCUS_41200 466 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 1401 841 gene locus_tag LOCUS_41210 1401 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 1818 2519 gene locus_tag LOCUS_41220 1818 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 2535 4037 gene locus_tag LOCUS_41230 2535 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 5001 4066 gene locus_tag LOCUS_41240 5001 4066 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence173 1377 130 gene locus_tag LOCUS_41250 1377 130 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_41250 4303 1451 gene locus_tag LOCUS_41260 gene gcvP 4303 1451 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_41260 >Feature sequence174 718 1569 gene locus_tag LOCUS_41270 718 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 1623 2672 gene locus_tag LOCUS_41280 1623 2672 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_41280 2810 4216 gene locus_tag LOCUS_41290 2810 4216 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_41290 <5080 4439 gene locus_tag LOCUS_41300 <5080 4439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392835.1:ribosome biogenesis GTPase Der >Feature sequence175 2024 2665 gene locus_tag LOCUS_41310 2024 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 2665 3681 gene locus_tag LOCUS_41320 2665 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 3699 4019 gene locus_tag LOCUS_41330 3699 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4016 4600 gene locus_tag LOCUS_41340 4016 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence176 158 27 gene locus_tag LOCUS_41350 158 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 2044 470 gene locus_tag LOCUS_41360 2044 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 2672 4036 gene locus_tag LOCUS_41370 gene nhaA 2672 4036 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_41370 4676 4825 gene locus_tag LOCUS_41380 4676 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 >Feature sequence177 1274 66 gene locus_tag LOCUS_41390 gene argJ 1274 66 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_41390 2394 1318 gene locus_tag LOCUS_41400 gene argC 2394 1318 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_41400 2984 2592 gene locus_tag LOCUS_41410 gene rpsI 2984 2592 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720163.1 protein_id gnl|my_center|LOCUS_41410 3460 3032 gene locus_tag LOCUS_41420 gene rplM 3460 3032 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_41420 3983 3498 gene locus_tag LOCUS_41430 3983 3498 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_41430 4479 4024 gene locus_tag LOCUS_41440 4479 4024 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_41440 >Feature sequence178 1405 308 gene locus_tag LOCUS_41450 gene modC 1405 308 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267945.1 protein_id gnl|my_center|LOCUS_41450 2085 1402 gene locus_tag LOCUS_41460 gene modB 2085 1402 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_41460 2914 2153 gene locus_tag LOCUS_41470 gene modA 2914 2153 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_41470 4496 2997 gene locus_tag LOCUS_41480 4496 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence179 3514 497 gene locus_tag LOCUS_41490 3514 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 4254 3601 gene locus_tag LOCUS_41500 4254 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence180 893 3568 gene locus_tag LOCUS_41510 gene pepN 893 3568 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193826.1 protein_id gnl|my_center|LOCUS_41510 4167 4400 gene locus_tag LOCUS_41520 4167 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence181 268 741 gene locus_tag LOCUS_41530 268 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 801 1328 gene locus_tag LOCUS_41540 801 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 3112 2876 gene locus_tag LOCUS_41550 3112 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 3767 3543 gene locus_tag LOCUS_41560 3767 3543 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_41560 4235 3972 gene locus_tag LOCUS_41570 4235 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 >Feature sequence182 1429 668 gene locus_tag LOCUS_41580 1429 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 2114 1824 gene locus_tag LOCUS_41590 2114 1824 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_41590 2448 3050 gene locus_tag LOCUS_41600 2448 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 4393 3086 gene locus_tag LOCUS_41610 4393 3086 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence183 2005 1034 gene locus_tag LOCUS_41620 2005 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 4151 2310 gene locus_tag LOCUS_41630 gene asnB 4151 2310 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence184 627 1262 gene locus_tag LOCUS_41640 627 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 3292 1661 gene locus_tag LOCUS_41650 3292 1661 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_41650 4046 3297 gene locus_tag LOCUS_41660 gene ubiE 4046 3297 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 protein_id gnl|my_center|LOCUS_41660 >Feature sequence185 1731 529 gene locus_tag LOCUS_41670 1731 529 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_41670 733 641 gene locus_tag LOCUS_t00450 733 641 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2820 2152 gene locus_tag LOCUS_41680 gene yihA 2820 2152 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_41680 3768 2857 gene locus_tag LOCUS_41690 3768 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence186 <1 3007 gene locus_tag LOCUS_41700 <1 3007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein 3252 3779 gene locus_tag LOCUS_41710 3252 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence187 2290 1208 gene locus_tag LOCUS_41720 2290 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 >Feature sequence188 323 2128 gene locus_tag LOCUS_41730 323 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2918 3454 gene locus_tag LOCUS_41740 2918 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 3456 3758 gene locus_tag LOCUS_41750 3456 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 >Feature sequence189 125 1192 gene locus_tag LOCUS_41760 125 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 1648 1824 gene locus_tag LOCUS_41770 1648 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 1821 2219 gene locus_tag LOCUS_41780 1821 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41780 2577 3356 gene locus_tag LOCUS_41790 2577 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 3716 3868 gene locus_tag LOCUS_41800 3716 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence190 482 2095 gene locus_tag LOCUS_41810 482 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence191 181 1254 gene locus_tag LOCUS_41820 181 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 3032 1428 gene locus_tag LOCUS_41830 3032 1428 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 protein_id gnl|my_center|LOCUS_41830 3272 3637 gene locus_tag LOCUS_41840 3272 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 >Feature sequence192 <1 1099 gene locus_tag LOCUS_41850 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225751.1:glycoside hydrolase family 15 protein 1162 2055 gene locus_tag LOCUS_41860 gene gnd 1162 2055 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_41860 >Feature sequence193 313 422 gene locus_tag LOCUS_r00020 313 422 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 968 591 gene locus_tag LOCUS_41870 968 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 1579 2865 gene locus_tag LOCUS_41880 gene hemL 1579 2865 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 protein_id gnl|my_center|LOCUS_41880 3301 3059 gene locus_tag LOCUS_41890 3301 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 >Feature sequence194 >Feature sequence195 426 501 gene locus_tag LOCUS_t00460 426 501 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 508 580 gene locus_tag LOCUS_t00470 508 580 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence196 834 1802 gene locus_tag LOCUS_41900 834 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 2161 3327 gene locus_tag LOCUS_41910 gene pdxB 2161 3327 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699116.1 protein_id gnl|my_center|LOCUS_41910 >Feature sequence197 304 95 gene locus_tag LOCUS_41920 304 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41920 974 501 gene locus_tag LOCUS_41930 974 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2850 1582 gene locus_tag LOCUS_41940 2850 1582 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_41940 >Feature sequence198 789 1184 gene locus_tag LOCUS_41950 789 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 1461 1907 gene locus_tag LOCUS_41960 1461 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 2049 2891 gene locus_tag LOCUS_41970 2049 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 >Feature sequence199 <1 3034 gene locus_tag LOCUS_41980 <1 3034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525117.1:GAF domain-containing protein >Feature sequence200 750 1604 gene locus_tag LOCUS_41990 750 1604 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_41990 1839 2345 gene locus_tag LOCUS_42000 gene aroL 1839 2345 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 protein_id gnl|my_center|LOCUS_42000 >Feature sequence201 2354 2278 gene locus_tag LOCUS_t00480 2354 2278 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2592 2517 gene locus_tag LOCUS_t00490 2592 2517 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3114 2863 gene locus_tag LOCUS_42010 3114 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 >Feature sequence202 >Feature sequence203 337 786 gene locus_tag LOCUS_42020 337 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 1316 1185 gene locus_tag LOCUS_42030 1316 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 1908 1684 gene locus_tag LOCUS_42040 1908 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 <3160 2173 gene locus_tag LOCUS_42050 <3160 2173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942321.1:cation-translocating P-type ATPase >Feature sequence204 <1 1628 gene locus_tag LOCUS_42060 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141062.1:VCBS repeat-containing protein 1855 2073 gene locus_tag LOCUS_42070 1855 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 2517 2915 gene locus_tag LOCUS_42080 2517 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42080 2909 3046 gene locus_tag LOCUS_42090 2909 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence205 >Feature sequence206 382 2601 gene locus_tag LOCUS_42100 382 2601 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence207 117 926 gene locus_tag LOCUS_42110 117 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 1075 1245 gene locus_tag LOCUS_42120 1075 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1295 1645 gene locus_tag LOCUS_42130 1295 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 1642 2364 gene locus_tag LOCUS_42140 1642 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 2439 2573 gene locus_tag LOCUS_42150 2439 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 >Feature sequence208 85 11 gene locus_tag LOCUS_t00500 85 11 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 261 186 gene locus_tag LOCUS_t00510 261 186 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1998 472 gene locus_tag LOCUS_r00030 1998 472 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence209 749 144 gene locus_tag LOCUS_42160 749 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42160 1045 746 gene locus_tag LOCUS_42170 1045 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42170 2100 1264 gene locus_tag LOCUS_42180 2100 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 >Feature sequence210 35 223 gene locus_tag LOCUS_42190 35 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 1705 1780 gene locus_tag LOCUS_t00520 1705 1780 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2681 1743 gene locus_tag LOCUS_42200 2681 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 >Feature sequence211 2072 1803 gene locus_tag LOCUS_42210 2072 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 >Feature sequence212 913 2334 gene locus_tag LOCUS_42220 913 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 >Feature sequence213 256 2142 gene locus_tag LOCUS_42230 256 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 >Feature sequence214 <1 1315 gene locus_tag LOCUS_42240 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817438.1:histidine kinase 1312 2091 gene locus_tag LOCUS_42250 1312 2091 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_42250 >Feature sequence215 1075 1800 gene locus_tag LOCUS_42260 1075 1800 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815014.1 protein_id gnl|my_center|LOCUS_42260 2100 2519 gene locus_tag LOCUS_42270 2100 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 >Feature sequence216 >Feature sequence217 <2558 1751 gene locus_tag LOCUS_42280 <2558 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_039644929.1:membrane protein >Feature sequence218 80 409 gene locus_tag LOCUS_42290 80 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 414 794 gene locus_tag LOCUS_42300 gene tnpB 414 794 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_42300 978 2504 gene locus_tag LOCUS_42310 978 2504 CDS product IS66-like element ISBthe6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_42310