>Feature sequence001 114 1211 gene locus_tag LOCUS_00010 114 1211 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_00010 1245 2567 gene locus_tag LOCUS_00020 1245 2567 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_00020 2578 3582 gene locus_tag LOCUS_00030 2578 3582 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_00030 4091 3636 gene locus_tag LOCUS_00040 4091 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4860 4102 gene locus_tag LOCUS_00050 4860 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6649 4865 gene locus_tag LOCUS_00060 6649 4865 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_00060 6756 7637 gene locus_tag LOCUS_00070 6756 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8000 7692 gene locus_tag LOCUS_00080 8000 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9790 7997 gene locus_tag LOCUS_00090 9790 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 >Feature sequence002 1363 29 gene locus_tag LOCUS_00100 1363 29 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_00100 2736 1360 gene locus_tag LOCUS_00110 gene scfB 2736 1360 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_00110 2953 2804 gene locus_tag LOCUS_00120 gene scfA 2953 2804 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_00120 3623 3021 gene locus_tag LOCUS_00130 3623 3021 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_00130 3881 3636 gene locus_tag LOCUS_00140 3881 3636 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_00140 4141 3896 gene locus_tag LOCUS_00150 4141 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 5050 4274 gene locus_tag LOCUS_00160 5050 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 5993 5052 gene locus_tag LOCUS_00170 gene cysK 5993 5052 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_00170 6181 6099 gene locus_tag LOCUS_t00010 6181 6099 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 <1 613 gene locus_tag LOCUS_00180 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458990.1:endonuclease MutS2 721 1404 gene locus_tag LOCUS_00190 721 1404 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_00190 1428 3071 gene locus_tag LOCUS_00200 1428 3071 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_00200 2889 2898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2977 4257 gene locus_tag LOCUS_00210 2977 4257 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943178.1 protein_id gnl|my_center|LOCUS_00210 4369 4980 gene locus_tag LOCUS_00220 4369 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 5075 5572 gene locus_tag LOCUS_00230 gene ruvC 5075 5572 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_00230 5602 6213 gene locus_tag LOCUS_00240 gene ruvA 5602 6213 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580335.1 protein_id gnl|my_center|LOCUS_00240 6220 7260 gene locus_tag LOCUS_00250 gene ruvB 6220 7260 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence004 <1 2089 gene locus_tag LOCUS_00260 <1 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963838.1:DNA polymerase III subunit alpha 2095 3057 gene locus_tag LOCUS_00270 gene pfkA 2095 3057 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_00270 3077 4732 gene locus_tag LOCUS_00280 gene rlmD 3077 4732 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_00280 5802 4783 gene locus_tag LOCUS_00290 5802 4783 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889821.1 protein_id gnl|my_center|LOCUS_00290 7355 5787 gene locus_tag LOCUS_00300 7355 5787 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 protein_id gnl|my_center|LOCUS_00300 >Feature sequence005 <1 679 gene locus_tag LOCUS_00310 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021373411.1:M20 family metallopeptidase 693 1787 gene locus_tag LOCUS_00320 gene alr 693 1787 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00320 3732 1894 gene locus_tag LOCUS_00330 3732 1894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_00330 5569 3725 gene locus_tag LOCUS_00340 5569 3725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_00340 5956 6723 gene locus_tag LOCUS_00350 5956 6723 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721616.1 protein_id gnl|my_center|LOCUS_00350 >Feature sequence006 573 106 gene locus_tag LOCUS_00360 573 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 2878 590 gene locus_tag LOCUS_00370 gene xdhA 2878 590 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_00370 4610 2913 gene locus_tag LOCUS_00380 gene ade 4610 2913 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439445.1 protein_id gnl|my_center|LOCUS_00380 5695 4628 gene locus_tag LOCUS_00390 5695 4628 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942743.1 protein_id gnl|my_center|LOCUS_00390 6264 5791 gene locus_tag LOCUS_00400 6264 5791 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence007 181 1512 gene locus_tag LOCUS_00410 gene rocR 181 1512 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 protein_id gnl|my_center|LOCUS_00410 1560 3140 gene locus_tag LOCUS_00420 1560 3140 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_00420 3183 4403 gene locus_tag LOCUS_00430 3183 4403 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_00430 4422 5810 gene locus_tag LOCUS_00440 4422 5810 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_00440 7036 5888 gene locus_tag LOCUS_00450 gene iadA 7036 5888 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568414.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence008 <1 740 gene locus_tag LOCUS_00460 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002358973.1:biotin--[acetyl-CoA-carboxylase] ligase 843 1409 gene locus_tag LOCUS_00470 843 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 1532 3169 gene locus_tag LOCUS_00480 1532 3169 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047966.1 protein_id gnl|my_center|LOCUS_00480 3195 4355 gene locus_tag LOCUS_00490 3195 4355 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_00490 5089 4472 gene locus_tag LOCUS_00500 5089 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 5829 5128 gene locus_tag LOCUS_00510 5829 5128 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 protein_id gnl|my_center|LOCUS_00510 6573 5938 gene locus_tag LOCUS_00520 gene plsY 6573 5938 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476008.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence009 6322 2636 gene locus_tag LOCUS_00530 gene rpoB 6322 2636 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence010 78 1124 gene locus_tag LOCUS_00540 78 1124 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_00540 1109 2131 gene locus_tag LOCUS_00550 1109 2131 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_00550 2135 3139 gene locus_tag LOCUS_00560 2135 3139 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_00560 3136 4923 gene locus_tag LOCUS_00570 3136 4923 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_00570 4976 5266 gene locus_tag LOCUS_00580 4976 5266 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462153.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence011 52 585 gene locus_tag LOCUS_00590 gene pgsA 52 585 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_00590 763 1404 gene locus_tag LOCUS_00600 gene pth 763 1404 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_00600 1397 4843 gene locus_tag LOCUS_00610 gene mfd 1397 4843 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence012 77 1588 gene locus_tag LOCUS_00620 77 1588 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_00620 1585 2007 gene locus_tag LOCUS_00630 1585 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2061 3509 gene locus_tag LOCUS_00640 2061 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 5219 3555 gene locus_tag LOCUS_00650 gene lonB 5219 3555 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357503.1 protein_id gnl|my_center|LOCUS_00650 6018 5326 gene locus_tag LOCUS_00660 6018 5326 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_00660 >Feature sequence013 <1 3331 gene locus_tag LOCUS_00670 <1 3331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966712.1:DNA polymerase III subunit alpha 3501 3959 gene locus_tag LOCUS_00680 3501 3959 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_00680 3983 5074 gene locus_tag LOCUS_00690 gene nusA 3983 5074 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_00690 5074 5349 gene locus_tag LOCUS_00700 5074 5349 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_00700 5336 5647 gene locus_tag LOCUS_00710 5336 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 >Feature sequence014 1071 4 gene locus_tag LOCUS_00720 1071 4 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_00720 2227 1076 gene locus_tag LOCUS_00730 2227 1076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974099.1 protein_id gnl|my_center|LOCUS_00730 3177 2224 gene locus_tag LOCUS_00740 3177 2224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470381.1 protein_id gnl|my_center|LOCUS_00740 5166 3310 gene locus_tag LOCUS_00750 5166 3310 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 protein_id gnl|my_center|LOCUS_00750 5496 5505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence015 2680 2024 gene locus_tag LOCUS_00760 2680 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 3744 2770 gene locus_tag LOCUS_00770 3744 2770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 protein_id gnl|my_center|LOCUS_00770 4825 3746 gene locus_tag LOCUS_00780 4825 3746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_00780 <5684 4815 gene locus_tag LOCUS_00790 <5684 4815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289202.1:ABC transporter ATP-binding protein >Feature sequence016 <1 822 gene locus_tag LOCUS_00800 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459711.1:ABC transporter permease 830 1933 gene locus_tag LOCUS_00810 830 1933 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_00810 1938 3347 gene locus_tag LOCUS_00820 1938 3347 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_00820 3358 3882 gene locus_tag LOCUS_00830 3358 3882 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297145.1 protein_id gnl|my_center|LOCUS_00830 3879 5321 gene locus_tag LOCUS_00840 3879 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence017 456 1157 gene locus_tag LOCUS_00850 456 1157 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 protein_id gnl|my_center|LOCUS_00850 1970 1254 gene locus_tag LOCUS_00860 1970 1254 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_00860 2272 3507 gene locus_tag LOCUS_00870 2272 3507 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_00870 3518 4816 gene locus_tag LOCUS_00880 gene grdB 3518 4816 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:4556..4558,aa:Sec) note codon on position 347 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00880 >Feature sequence018 359 988 gene locus_tag LOCUS_00890 359 988 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_00890 985 2205 gene locus_tag LOCUS_00900 985 2205 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_00900 2202 2900 gene locus_tag LOCUS_00910 gene cmk 2202 2900 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_00910 2900 3502 gene locus_tag LOCUS_00920 2900 3502 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence019 136 453 gene locus_tag LOCUS_00930 gene trxA 136 453 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_00930 1155 511 gene locus_tag LOCUS_00940 gene vanX 1155 511 CDS product D-Ala-D-Ala dipeptidase VanX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461308.1 protein_id gnl|my_center|LOCUS_00940 2255 1173 gene locus_tag LOCUS_00950 2255 1173 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_00950 3034 2255 gene locus_tag LOCUS_00960 3034 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 3236 4081 gene locus_tag LOCUS_00970 3236 4081 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_00970 4188 4886 gene locus_tag LOCUS_00980 4188 4886 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438319.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence020 29 337 gene locus_tag LOCUS_00990 gene rpsJ 29 337 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_00990 357 983 gene locus_tag LOCUS_01000 gene rplC 357 983 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_01000 1003 1623 gene locus_tag LOCUS_01010 gene rplD 1003 1623 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_01010 1623 1919 gene locus_tag LOCUS_01020 gene rplW 1623 1919 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_01020 1931 2764 gene locus_tag LOCUS_01030 gene rplB 1931 2764 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_01030 2784 3065 gene locus_tag LOCUS_01040 gene rpsS 2784 3065 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_01040 3079 3465 gene locus_tag LOCUS_01050 gene rplV 3079 3465 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_01050 3476 4120 gene locus_tag LOCUS_01060 gene rpsC 3476 4120 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_01060 4136 4573 gene locus_tag LOCUS_01070 gene rplP 4136 4573 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01070 4563 4763 gene locus_tag LOCUS_01080 gene rpmC 4563 4763 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_01080 4785 5048 gene locus_tag LOCUS_01090 gene rpsQ 4785 5048 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_01090 5067 5435 gene locus_tag LOCUS_01100 gene rplN 5067 5435 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence021 <1 745 gene locus_tag LOCUS_01110 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001282864.1:DNA gyrase subunit A 742 1515 gene locus_tag LOCUS_01120 742 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1516 3396 gene locus_tag LOCUS_01130 gene mnmG 1516 3396 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898858.1 protein_id gnl|my_center|LOCUS_01130 3393 4082 gene locus_tag LOCUS_01140 gene rsmG 3393 4082 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_01140 4186 5022 gene locus_tag LOCUS_01150 gene noc 4186 5022 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence022 <1 789 gene locus_tag LOCUS_01160 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939420.1:class II fructose-1,6-bisphosphate aldolase 796 1086 gene locus_tag LOCUS_01170 796 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 1095 2111 gene locus_tag LOCUS_01180 1095 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_01180 2131 3585 gene locus_tag LOCUS_01190 2131 3585 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_01190 4310 3993 gene locus_tag LOCUS_01200 4310 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01200 4889 4320 gene locus_tag LOCUS_01210 4889 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01210 >Feature sequence023 1021 83 gene locus_tag LOCUS_01220 1021 83 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566243.1 protein_id gnl|my_center|LOCUS_01220 3109 1127 gene locus_tag LOCUS_01230 3109 1127 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748903.1 protein_id gnl|my_center|LOCUS_01230 4049 4882 gene locus_tag LOCUS_01240 4049 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence024 950 270 gene locus_tag LOCUS_01250 950 270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_01250 1600 956 gene locus_tag LOCUS_01260 gene phoU 1600 956 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_01260 2367 1600 gene locus_tag LOCUS_01270 gene pstB 2367 1600 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_01270 3253 2393 gene locus_tag LOCUS_01280 gene pstA 3253 2393 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_01280 4145 3258 gene locus_tag LOCUS_01290 gene pstC 4145 3258 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_01290 5038 4223 gene locus_tag LOCUS_01300 5038 4223 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence025 1140 3776 gene locus_tag LOCUS_01310 1140 3776 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01310 3889 5172 gene locus_tag LOCUS_01320 3889 5172 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence026 1529 1206 gene locus_tag LOCUS_01330 1529 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 2331 1615 gene locus_tag LOCUS_01340 2331 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3316 2324 gene locus_tag LOCUS_01350 3316 2324 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_01350 3826 3323 gene locus_tag LOCUS_01360 gene lspA 3826 3323 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262002.1 protein_id gnl|my_center|LOCUS_01360 5277 3883 gene locus_tag LOCUS_01370 5277 3883 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence027 2720 1194 gene locus_tag LOCUS_01380 2720 1194 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_01380 3160 2759 gene locus_tag LOCUS_01390 gene mce 3160 2759 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_01390 3817 3284 gene locus_tag LOCUS_01400 3817 3284 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_01400 4620 3817 gene locus_tag LOCUS_01410 4620 3817 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence028 220 1386 gene locus_tag LOCUS_01420 gene thiI 220 1386 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_01420 1386 2195 gene locus_tag LOCUS_01430 1386 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2229 2471 gene locus_tag LOCUS_01440 2229 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 2492 3946 gene locus_tag LOCUS_01450 2492 3946 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_01450 4318 4025 gene locus_tag LOCUS_01460 4318 4025 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965971.1 protein_id gnl|my_center|LOCUS_01460 4565 4335 gene locus_tag LOCUS_01470 4565 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence029 1021 185 gene locus_tag LOCUS_01480 gene dapF 1021 185 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_01480 3246 1093 gene locus_tag LOCUS_01490 3246 1093 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288183.1 protein_id gnl|my_center|LOCUS_01490 3400 4506 gene locus_tag LOCUS_01500 3400 4506 CDS product G5 and 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966270.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence030 1504 362 gene locus_tag LOCUS_01510 gene pheA 1504 362 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_01510 1738 1526 gene locus_tag LOCUS_01520 1738 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 2577 1747 gene locus_tag LOCUS_01530 2577 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 1785 1794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3842 2574 gene locus_tag LOCUS_01540 gene aroA 3842 2574 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_01540 <4807 3839 gene locus_tag LOCUS_01550 <4807 3839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964212.1:3-dehydroquinate synthase >Feature sequence031 420 25 gene locus_tag LOCUS_01560 gene rpsI 420 25 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_01560 871 440 gene locus_tag LOCUS_01570 gene rplM 871 440 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966379.1 protein_id gnl|my_center|LOCUS_01570 1534 1073 gene locus_tag LOCUS_01580 gene trmL 1534 1073 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_01580 4001 1596 gene locus_tag LOCUS_01590 4001 1596 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_01590 <4742 4085 gene locus_tag LOCUS_01600 <4742 4085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232442.1:cell wall hydrolase >Feature sequence032 353 577 gene locus_tag LOCUS_01610 353 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 745 593 gene locus_tag LOCUS_01620 745 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1966 779 gene locus_tag LOCUS_01630 1966 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3062 1950 gene locus_tag LOCUS_01640 3062 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4654 3059 gene locus_tag LOCUS_01650 4654 3059 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence033 2150 1215 gene locus_tag LOCUS_01660 2150 1215 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_01660 3571 2225 gene locus_tag LOCUS_01670 3571 2225 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_01670 4547 3606 gene locus_tag LOCUS_01680 gene arcC 4547 3606 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence034 1028 66 gene locus_tag LOCUS_01690 1028 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3110 1095 gene locus_tag LOCUS_01700 3110 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4425 3292 gene locus_tag LOCUS_01710 4425 3292 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence035 13 429 gene locus_tag LOCUS_01720 13 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 472 1056 gene locus_tag LOCUS_01730 gene clpP 472 1056 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_01730 1061 2317 gene locus_tag LOCUS_01740 gene clpX 1061 2317 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_01740 3821 2442 gene locus_tag LOCUS_01750 3821 2442 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence036 303 37 gene locus_tag LOCUS_01760 gene rpsT 303 37 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_01760 460 1377 gene locus_tag LOCUS_01770 gene gpr 460 1377 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_01770 1420 2400 gene locus_tag LOCUS_01780 1420 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3415 2390 gene locus_tag LOCUS_01790 3415 2390 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_01790 4086 3412 gene locus_tag LOCUS_01800 4086 3412 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_01800 4505 4143 gene locus_tag LOCUS_01810 4505 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence037 65 973 gene locus_tag LOCUS_01820 65 973 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_01820 935 944 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2196 1015 gene locus_tag LOCUS_01830 2196 1015 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976354.1 protein_id gnl|my_center|LOCUS_01830 3256 2216 gene locus_tag LOCUS_01840 gene tdh 3256 2216 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_01840 <4616 3454 gene locus_tag LOCUS_01850 <4616 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358861.1:WG repeat-containing protein >Feature sequence038 <1 869 gene locus_tag LOCUS_01860 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393449.1:ABC transporter permease 866 1852 gene locus_tag LOCUS_01870 866 1852 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_01870 1859 2533 gene locus_tag LOCUS_01880 1859 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 2586 4082 gene locus_tag LOCUS_01890 2586 4082 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence039 1556 216 gene locus_tag LOCUS_01900 1556 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01900 1565 1574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2695 1928 gene locus_tag LOCUS_01910 2695 1928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_01910 3778 2795 gene locus_tag LOCUS_01920 3778 2795 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887954.1 protein_id gnl|my_center|LOCUS_01920 4440 3835 gene locus_tag LOCUS_01930 4440 3835 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_01930 3868 3877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence040 142 8 gene locus_tag LOCUS_01940 142 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 950 270 gene locus_tag LOCUS_01950 950 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1326 3290 gene locus_tag LOCUS_01960 1326 3290 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence041 1454 2050 gene locus_tag LOCUS_01970 1454 2050 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_01970 2047 2556 gene locus_tag LOCUS_01980 gene spmB 2047 2556 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 protein_id gnl|my_center|LOCUS_01980 2665 3378 gene locus_tag LOCUS_01990 2665 3378 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099545.1 protein_id gnl|my_center|LOCUS_01990 4311 3451 gene locus_tag LOCUS_02000 4311 3451 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557587.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence042 918 1919 gene locus_tag LOCUS_02010 918 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3081 2167 gene locus_tag LOCUS_02020 3081 2167 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_02020 3234 4379 gene locus_tag LOCUS_02030 3234 4379 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680415.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence043 <4487 11 gene locus_tag LOCUS_02040 <4487 11 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339463.1:glucoamylase family protein >Feature sequence044 711 67 gene locus_tag LOCUS_02050 711 67 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_02050 2530 728 gene locus_tag LOCUS_02060 gene pepF 2530 728 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_02060 2698 3009 gene locus_tag LOCUS_02070 2698 3009 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948668.1 protein_id gnl|my_center|LOCUS_02070 3012 3518 gene locus_tag LOCUS_02080 3012 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 3660 4163 gene locus_tag LOCUS_02090 3660 4163 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence045 572 1396 gene locus_tag LOCUS_02100 gene spo0A 572 1396 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_02100 1403 2566 gene locus_tag LOCUS_02110 1403 2566 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_02110 2639 3784 gene locus_tag LOCUS_02120 2639 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 >Feature sequence046 73 501 gene locus_tag LOCUS_02130 73 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 638 1474 gene locus_tag LOCUS_02140 gene murB 638 1474 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_02140 1485 2372 gene locus_tag LOCUS_02150 gene rapZ 1485 2372 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_02150 2372 3343 gene locus_tag LOCUS_02160 gene whiA 2372 3343 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence047 54 173 gene locus_tag LOCUS_02170 54 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 166 1500 gene locus_tag LOCUS_02180 gene mnmE 166 1500 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_02180 1595 2674 gene locus_tag LOCUS_02190 1595 2674 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_02190 2671 4221 gene locus_tag LOCUS_02200 2671 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence048 1355 63 gene locus_tag LOCUS_02210 1355 63 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_02210 2374 1367 gene locus_tag LOCUS_02220 gene galE 2374 1367 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence049 2783 2193 gene locus_tag LOCUS_02230 2783 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02230 4154 2820 gene locus_tag LOCUS_02240 4154 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02240 >Feature sequence050 475 1359 gene locus_tag LOCUS_02250 475 1359 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193500740.1 protein_id gnl|my_center|LOCUS_02250 1486 2280 gene locus_tag LOCUS_02260 1486 2280 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048211.1 protein_id gnl|my_center|LOCUS_02260 2297 2905 gene locus_tag LOCUS_02270 gene yedF 2297 2905 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_02270 2902 4035 gene locus_tag LOCUS_02280 2902 4035 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_02280 4032 4268 gene locus_tag LOCUS_02290 4032 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence051 1377 619 gene locus_tag LOCUS_02300 1377 619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 protein_id gnl|my_center|LOCUS_02300 2971 1367 gene locus_tag LOCUS_02310 2971 1367 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948803.1 protein_id gnl|my_center|LOCUS_02310 4177 3056 gene locus_tag LOCUS_02320 4177 3056 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence052 285 818 gene locus_tag LOCUS_02330 285 818 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_02330 842 1189 gene locus_tag LOCUS_02340 842 1189 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_02340 1176 1526 gene locus_tag LOCUS_02350 1176 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1573 1701 gene locus_tag LOCUS_02360 1573 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 1789 2781 gene locus_tag LOCUS_02370 1789 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2803 3342 gene locus_tag LOCUS_02380 2803 3342 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_02380 3457 4119 gene locus_tag LOCUS_02390 3457 4119 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_02390 4247 4172 gene locus_tag LOCUS_t00020 4247 4172 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 866 135 gene locus_tag LOCUS_02400 866 135 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974086.1 protein_id gnl|my_center|LOCUS_02400 1968 868 gene locus_tag LOCUS_02410 1968 868 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385593.1 protein_id gnl|my_center|LOCUS_02410 2690 2028 gene locus_tag LOCUS_02420 2690 2028 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_02420 <4245 2675 gene locus_tag LOCUS_02430 <4245 2675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097436.1:glutathione ABC transporter ATP-binding protein GsiA >Feature sequence054 477 229 gene locus_tag LOCUS_02440 477 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 743 546 gene locus_tag LOCUS_02450 743 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 921 1958 gene locus_tag LOCUS_02460 921 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3668 1938 gene locus_tag LOCUS_02470 3668 1938 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_02470 4222 3695 gene locus_tag LOCUS_02480 4222 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence055 1060 1707 gene locus_tag LOCUS_02490 1060 1707 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475993.1 protein_id gnl|my_center|LOCUS_02490 1723 2487 gene locus_tag LOCUS_02500 1723 2487 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_02500 2547 3260 gene locus_tag LOCUS_02510 2547 3260 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence056 390 1112 gene locus_tag LOCUS_02520 390 1112 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_02520 2462 1167 gene locus_tag LOCUS_02530 2462 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3710 2622 gene locus_tag LOCUS_02540 gene ychF 3710 2622 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence057 1229 570 gene locus_tag LOCUS_02550 1229 570 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_02550 1349 2881 gene locus_tag LOCUS_02560 1349 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence058 <1 569 gene locus_tag LOCUS_02570 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003594556.1:RsmF rRNA methyltransferase first C-terminal domain-containing protein 563 1084 gene locus_tag LOCUS_02580 563 1084 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_02580 1179 2681 gene locus_tag LOCUS_02590 1179 2681 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_02590 2697 3218 gene locus_tag LOCUS_02600 2697 3218 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_02600 3314 3559 gene locus_tag LOCUS_02610 3314 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4028 3648 gene locus_tag LOCUS_02620 4028 3648 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence059 1275 88 gene locus_tag LOCUS_02630 1275 88 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_02630 1590 1396 gene locus_tag LOCUS_02640 1590 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1671 2990 gene locus_tag LOCUS_02650 1671 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4158 2971 gene locus_tag LOCUS_02660 4158 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence060 142 2691 gene locus_tag LOCUS_02670 gene xdh 142 2691 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_02670 2711 3367 gene locus_tag LOCUS_02680 gene deoC 2711 3367 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_02680 3791 3432 gene locus_tag LOCUS_02690 3791 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence061 1925 183 gene locus_tag LOCUS_02700 1925 183 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_02700 2632 1922 gene locus_tag LOCUS_02710 gene radC 2632 1922 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_02710 3938 2634 gene locus_tag LOCUS_02720 3938 2634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence062 183 509 gene locus_tag LOCUS_02730 183 509 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948327.1 protein_id gnl|my_center|LOCUS_02730 496 1674 gene locus_tag LOCUS_02740 496 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1863 1678 gene locus_tag LOCUS_02750 1863 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1993 2751 gene locus_tag LOCUS_02760 1993 2751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_02760 2735 3559 gene locus_tag LOCUS_02770 2735 3559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence063 741 547 gene locus_tag LOCUS_02780 741 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1482 1258 gene locus_tag LOCUS_02790 1482 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1903 1454 gene locus_tag LOCUS_02800 1903 1454 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 protein_id gnl|my_center|LOCUS_02800 3367 2516 gene locus_tag LOCUS_02810 3367 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 <4084 3351 gene locus_tag LOCUS_02820 <4084 3351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964374.1:RHS repeat protein >Feature sequence064 <1 1457 gene locus_tag LOCUS_02830 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903185.1:C40 family peptidase 1750 3072 gene locus_tag LOCUS_02840 1750 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 3066 3782 gene locus_tag LOCUS_02850 3066 3782 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_02850 3896 4036 gene locus_tag LOCUS_02860 3896 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence065 495 49 gene locus_tag LOCUS_02870 gene dtd 495 49 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_02870 2802 511 gene locus_tag LOCUS_02880 2802 511 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_02880 3357 2842 gene locus_tag LOCUS_02890 3357 2842 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence066 572 1453 gene locus_tag LOCUS_02900 572 1453 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_02900 1483 2259 gene locus_tag LOCUS_02910 1483 2259 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851457.1 protein_id gnl|my_center|LOCUS_02910 2261 2962 gene locus_tag LOCUS_02920 gene pxpB 2261 2962 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_02920 2959 3993 gene locus_tag LOCUS_02930 2959 3993 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence067 975 1133 gene locus_tag LOCUS_02940 975 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 1078 2670 gene locus_tag LOCUS_02950 gene tndX 1078 2670 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_02950 2694 3533 gene locus_tag LOCUS_02960 2694 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence068 152 1513 gene locus_tag LOCUS_02970 152 1513 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_02970 1526 2593 gene locus_tag LOCUS_02980 gene orr 1526 2593 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_02980 2631 3623 gene locus_tag LOCUS_02990 gene argF 2631 3623 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence069 53 607 gene locus_tag LOCUS_03000 53 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1659 682 gene locus_tag LOCUS_03010 1659 682 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_03010 2585 1656 gene locus_tag LOCUS_03020 gene hprK 2585 1656 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127244.1 protein_id gnl|my_center|LOCUS_03020 3394 2591 gene locus_tag LOCUS_03030 3394 2591 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268135.1 protein_id gnl|my_center|LOCUS_03030 <3941 3391 gene locus_tag LOCUS_03040 <3941 3391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391800.1:excinuclease ABC subunit UvrC >Feature sequence070 3 839 gene locus_tag LOCUS_03050 3 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 836 2314 gene locus_tag LOCUS_03060 836 2314 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_03060 3447 2308 gene locus_tag LOCUS_03070 3447 2308 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence071 714 1619 gene locus_tag LOCUS_03080 714 1619 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_03080 2513 1740 gene locus_tag LOCUS_03090 2513 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3919 2534 gene locus_tag LOCUS_03100 3919 2534 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064778.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence072 987 220 gene locus_tag LOCUS_03110 gene cobS 987 220 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_03110 1508 984 gene locus_tag LOCUS_03120 gene cobU 1508 984 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_03120 2587 1505 gene locus_tag LOCUS_03130 gene cobT 2587 1505 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_03130 3333 2578 gene locus_tag LOCUS_03140 3333 2578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_03140 <3896 3326 gene locus_tag LOCUS_03150 <3896 3326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968147.1:iron ABC transporter permease >Feature sequence073 >Feature sequence074 <1 1668 gene locus_tag LOCUS_03160 <1 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964990.1:ribonuclease J 1688 2029 gene locus_tag LOCUS_03170 1688 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2048 3229 gene locus_tag LOCUS_03180 gene mltG 2048 3229 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_03180 3295 3304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence075 1449 910 gene locus_tag LOCUS_03190 1449 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2534 1446 gene locus_tag LOCUS_03200 2534 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3303 2560 gene locus_tag LOCUS_03210 3303 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3831 3403 gene locus_tag LOCUS_03220 3831 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence076 >Feature sequence077 2465 2115 gene locus_tag LOCUS_03230 2465 2115 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_03230 <3847 2558 gene locus_tag LOCUS_03240 <3847 2558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032507361.1:2-amino-4-oxopentanoate thiolase subunit OrtB >Feature sequence078 311 1333 gene locus_tag LOCUS_03250 311 1333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_03250 1293 2918 gene locus_tag LOCUS_03260 1293 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 2922 3131 gene locus_tag LOCUS_03270 2922 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence079 <1 516 gene locus_tag LOCUS_03280 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867268.1:ABC transporter permease 528 1535 gene locus_tag LOCUS_03290 528 1535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 protein_id gnl|my_center|LOCUS_03290 1535 2461 gene locus_tag LOCUS_03300 1535 2461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence080 24 1334 gene locus_tag LOCUS_03310 gene brnQ 24 1334 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861162.1 protein_id gnl|my_center|LOCUS_03310 1405 2115 gene locus_tag LOCUS_03320 1405 2115 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_03320 3368 2130 gene locus_tag LOCUS_03330 3368 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence081 763 53 gene locus_tag LOCUS_03340 763 53 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence082 731 2230 gene locus_tag LOCUS_03350 gene glpK 731 2230 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_03350 2235 3701 gene locus_tag LOCUS_03360 2235 3701 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence083 339 1106 gene locus_tag LOCUS_03370 339 1106 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_03370 1955 1155 gene locus_tag LOCUS_03380 1955 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2433 2026 gene locus_tag LOCUS_03390 2433 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 2600 3508 gene locus_tag LOCUS_03400 2600 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence084 1904 1197 gene locus_tag LOCUS_03410 1904 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03410 2449 1901 gene locus_tag LOCUS_03420 2449 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03420 1944 1953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3673 2542 gene locus_tag LOCUS_03430 <3673 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765038.1:phosphoribosylaminoimidazolecarboxamide formyltransferase >Feature sequence085 43 1740 gene locus_tag LOCUS_03440 43 1740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_03440 1737 3554 gene locus_tag LOCUS_03450 1737 3554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence086 <1 885 gene locus_tag LOCUS_03460 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002893621.1:ABC transporter permease 902 2917 gene locus_tag LOCUS_03470 902 2917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_03470 2988 3410 gene locus_tag LOCUS_03480 2988 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence087 1163 1414 gene locus_tag LOCUS_03490 1163 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 1429 1974 gene locus_tag LOCUS_03500 1429 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1979 3409 gene locus_tag LOCUS_03510 1979 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3410 3586 gene locus_tag LOCUS_03520 3410 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence088 834 232 gene locus_tag LOCUS_03530 gene yihA 834 232 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_03530 1214 843 gene locus_tag LOCUS_03540 1214 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 3218 1248 gene locus_tag LOCUS_03550 gene lon 3218 1248 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03550 >Feature sequence089 50 295 gene locus_tag LOCUS_03560 gene hfq 50 295 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428780.1 protein_id gnl|my_center|LOCUS_03560 292 1590 gene locus_tag LOCUS_03570 292 1590 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_03570 2219 1587 gene locus_tag LOCUS_03580 gene lexA 2219 1587 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_03580 2332 2706 gene locus_tag LOCUS_03590 2332 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 <3629 2703 gene locus_tag LOCUS_03600 <3629 2703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811557.1:tyrosine-type recombinase/integrase >Feature sequence090 348 1661 gene locus_tag LOCUS_03610 348 1661 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence091 457 1035 gene locus_tag LOCUS_03620 457 1035 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188471799.1 protein_id gnl|my_center|LOCUS_03620 1893 1081 gene locus_tag LOCUS_03630 1893 1081 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_03630 2366 1890 gene locus_tag LOCUS_03640 2366 1890 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_03640 2967 2431 gene locus_tag LOCUS_03650 2967 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 <3616 2974 gene locus_tag LOCUS_03660 <3616 2974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000656120.1:alpha,alpha-phosphotrehalase >Feature sequence092 54 1370 gene locus_tag LOCUS_03670 gene rho 54 1370 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_03670 1544 1873 gene locus_tag LOCUS_03680 1544 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1977 3452 gene locus_tag LOCUS_03690 1977 3452 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence093 1687 926 gene locus_tag LOCUS_03700 1687 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 1911 2726 gene locus_tag LOCUS_03710 1911 2726 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 protein_id gnl|my_center|LOCUS_03710 3561 2719 gene locus_tag LOCUS_03720 3561 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence094 2422 1760 gene locus_tag LOCUS_03730 2422 1760 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_03730 3131 2433 gene locus_tag LOCUS_03740 3131 2433 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence095 <1 3176 gene locus_tag LOCUS_03750 <1 3176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461425.1:cell wall-binding repeat-containing protein >Feature sequence096 357 55 gene locus_tag LOCUS_03760 357 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03760 1140 364 gene locus_tag LOCUS_03770 1140 364 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_03770 1934 1143 gene locus_tag LOCUS_03780 1934 1143 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_03780 3490 1931 gene locus_tag LOCUS_03790 3490 1931 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence097 >Feature sequence098 610 17 gene locus_tag LOCUS_03800 610 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541841.1 protein_id gnl|my_center|LOCUS_03800 765 607 gene locus_tag LOCUS_03810 765 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1820 777 gene locus_tag LOCUS_03820 1820 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2215 1817 gene locus_tag LOCUS_03830 2215 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2422 2225 gene locus_tag LOCUS_03840 gene spoIIIAC 2422 2225 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_03840 2940 2440 gene locus_tag LOCUS_03850 2940 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3545 2937 gene locus_tag LOCUS_03860 3545 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence099 <1 1348 gene locus_tag LOCUS_03870 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024196.1:PKD domain-containing protein 1377 1931 gene locus_tag LOCUS_03880 1377 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3431 2040 gene locus_tag LOCUS_03890 3431 2040 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence100 2970 1591 gene locus_tag LOCUS_03900 gene selA 2970 1591 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 protein_id gnl|my_center|LOCUS_03900 3294 3046 gene locus_tag LOCUS_03910 3294 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3494 3291 gene locus_tag LOCUS_03920 3494 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence101 2004 1093 gene locus_tag LOCUS_03930 2004 1093 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_03930 2298 2128 gene locus_tag LOCUS_03940 2298 2128 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_03940 3123 2422 gene locus_tag LOCUS_03950 3123 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence102 2827 842 gene locus_tag LOCUS_03960 2827 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 <3497 2833 gene locus_tag LOCUS_03970 <3497 2833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942799.1:ABC transporter ATP-binding protein >Feature sequence103 <1 640 gene locus_tag LOCUS_03980 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245717.1:pitrilysin family protein 662 1846 gene locus_tag LOCUS_03990 662 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 1843 2547 gene locus_tag LOCUS_04000 1843 2547 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_04000 2643 3092 gene locus_tag LOCUS_04010 2643 3092 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence104 <1 502 gene locus_tag LOCUS_04020 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:translational GTPase TypA 572 1717 gene locus_tag LOCUS_04030 572 1717 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_04030 1728 3083 gene locus_tag LOCUS_04040 1728 3083 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence105 <3443 186 gene locus_tag LOCUS_04050 <3443 186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence106 758 96 gene locus_tag LOCUS_04060 gene sdaAB 758 96 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_04060 1987 770 gene locus_tag LOCUS_04070 1987 770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_04070 2479 2117 gene locus_tag LOCUS_04080 2479 2117 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_04080 3439 2579 gene locus_tag LOCUS_04090 3439 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence107 833 534 gene locus_tag LOCUS_04100 gene spoIIID 833 534 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966143.1 protein_id gnl|my_center|LOCUS_04100 1557 907 gene locus_tag LOCUS_04110 1557 907 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966136.1 protein_id gnl|my_center|LOCUS_04110 <3439 1529 gene locus_tag LOCUS_04120 <3439 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947993.1:ATP-dependent RecD-like DNA helicase >Feature sequence108 3278 138 gene locus_tag LOCUS_04130 gene nifJ 3278 138 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence109 983 12 gene locus_tag LOCUS_04140 983 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1168 2778 gene locus_tag LOCUS_04150 1168 2778 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence110 937 2217 gene locus_tag LOCUS_04160 937 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence111 >Feature sequence112 1388 285 gene locus_tag LOCUS_04170 1388 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2798 1404 gene locus_tag LOCUS_04180 2798 1404 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence113 35 1876 gene locus_tag LOCUS_04190 gene infB 35 1876 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388357.1 protein_id gnl|my_center|LOCUS_04190 1954 2319 gene locus_tag LOCUS_04200 gene rbfA 1954 2319 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_04200 2312 3286 gene locus_tag LOCUS_04210 2312 3286 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence114 96 674 gene locus_tag LOCUS_04220 96 674 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678795.1 protein_id gnl|my_center|LOCUS_04220 689 2746 gene locus_tag LOCUS_04230 689 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2931 3140 gene locus_tag LOCUS_04240 2931 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence115 615 2042 gene locus_tag LOCUS_04250 615 2042 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_04250 2683 2105 gene locus_tag LOCUS_04260 2683 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 <3392 2776 gene locus_tag LOCUS_04270 <3392 2776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867389.1:SLC45 family MFS transporter >Feature sequence116 <1 573 gene locus_tag LOCUS_04280 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014462.1:tyramine oxidase subunit B 590 1384 gene locus_tag LOCUS_04290 590 1384 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_04290 1397 3235 gene locus_tag LOCUS_04300 1397 3235 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152985633.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence117 1253 405 gene locus_tag LOCUS_04310 1253 405 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063590.1 protein_id gnl|my_center|LOCUS_04310 2257 1337 gene locus_tag LOCUS_04320 2257 1337 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462918.1 protein_id gnl|my_center|LOCUS_04320 <3371 2254 gene locus_tag LOCUS_04330 <3371 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002380507.1:ABC transporter ATP-binding protein >Feature sequence118 1794 838 gene locus_tag LOCUS_04340 1794 838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_04340 2755 1811 gene locus_tag LOCUS_04350 2755 1811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915997.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence119 <1 1629 gene locus_tag LOCUS_04360 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963335.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence120 982 2064 gene locus_tag LOCUS_04370 gene buk 982 2064 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_04370 2091 3266 gene locus_tag LOCUS_04380 2091 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence121 1693 917 gene locus_tag LOCUS_04390 1693 917 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 protein_id gnl|my_center|LOCUS_04390 3207 1747 gene locus_tag LOCUS_04400 gene gltX 3207 1747 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence122 1309 1977 gene locus_tag LOCUS_04410 1309 1977 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_04410 2055 3263 gene locus_tag LOCUS_04420 2055 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence123 1474 1818 gene locus_tag LOCUS_04430 1474 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1886 2827 gene locus_tag LOCUS_04440 1886 2827 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence124 436 906 gene locus_tag LOCUS_04450 gene grdA 436 906 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345262.1 transl_except (pos:565..567,aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04450 1032 2570 gene locus_tag LOCUS_04460 gene grdC 1032 2570 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence125 924 10 gene locus_tag LOCUS_04470 gene pyrB 924 10 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_04470 1582 926 gene locus_tag LOCUS_04480 gene pyrE 1582 926 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_04480 2295 1597 gene locus_tag LOCUS_04490 gene pyrF 2295 1597 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_04490 3205 2288 gene locus_tag LOCUS_04500 3205 2288 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence126 1240 419 gene locus_tag LOCUS_04510 1240 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1852 1253 gene locus_tag LOCUS_04520 1852 1253 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_04520 2966 1854 gene locus_tag LOCUS_04530 2966 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence127 607 119 gene locus_tag LOCUS_04540 607 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1544 1005 gene locus_tag LOCUS_04550 1544 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1973 1632 gene locus_tag LOCUS_04560 1973 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2345 2136 gene locus_tag LOCUS_04570 2345 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2498 2845 gene locus_tag LOCUS_04580 2498 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3149 2838 gene locus_tag LOCUS_04590 3149 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence128 3239 2793 gene locus_tag LOCUS_04600 3239 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence129 1098 424 gene locus_tag LOCUS_04610 gene tsaB 1098 424 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_04610 1550 1095 gene locus_tag LOCUS_04620 gene tsaE 1550 1095 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_04620 2670 1552 gene locus_tag LOCUS_04630 gene tgt 2670 1552 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_04630 3011 2697 gene locus_tag LOCUS_04640 3011 2697 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113282.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence130 86 397 gene locus_tag LOCUS_04650 86 397 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_04650 410 775 gene locus_tag LOCUS_04660 gene spoIIAB 410 775 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04660 839 1588 gene locus_tag LOCUS_04670 gene sigF 839 1588 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_04670 2252 1638 gene locus_tag LOCUS_04680 2252 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 3276 2293 gene locus_tag LOCUS_04690 gene floA 3276 2293 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence131 2414 399 gene locus_tag LOCUS_04700 2414 399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077263.1 protein_id gnl|my_center|LOCUS_04700 <3295 2433 gene locus_tag LOCUS_04710 <3295 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921892.1:ABC transporter permease >Feature sequence132 469 1581 gene locus_tag LOCUS_04720 469 1581 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_04720 1578 1841 gene locus_tag LOCUS_04730 1578 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1873 2385 gene locus_tag LOCUS_04740 1873 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2690 2400 gene locus_tag LOCUS_04750 2690 2400 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944263.1 protein_id gnl|my_center|LOCUS_04750 <3290 2692 gene locus_tag LOCUS_04760 <3290 2692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435803.1:tRNA 2-thiocytidine(32) synthetase TtcA >Feature sequence133 1906 2139 gene locus_tag LOCUS_04770 1906 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2210 2944 gene locus_tag LOCUS_04780 2210 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence134 1221 937 gene locus_tag LOCUS_04790 1221 937 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_04790 1446 1913 gene locus_tag LOCUS_04800 1446 1913 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_04800 1915 2310 gene locus_tag LOCUS_04810 1915 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2565 3137 gene locus_tag LOCUS_04820 2565 3137 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382314.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence135 377 1564 gene locus_tag LOCUS_04830 377 1564 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_04830 1627 2673 gene locus_tag LOCUS_04840 gene spoVV 1627 2673 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_04840 <3283 2670 gene locus_tag LOCUS_04850 <3283 2670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949062.1:aspartate--ammonia ligase >Feature sequence136 1818 427 gene locus_tag LOCUS_04860 gene hslU 1818 427 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_04860 2354 1818 gene locus_tag LOCUS_04870 gene hslV 2354 1818 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_04870 <3278 2468 gene locus_tag LOCUS_04880 <3278 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989721.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO >Feature sequence137 326 1060 gene locus_tag LOCUS_04890 326 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2839 1268 gene locus_tag LOCUS_04900 gene pckA 2839 1268 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence138 <1 772 gene locus_tag LOCUS_04910 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000095595.1:class B sortase 778 1896 gene locus_tag LOCUS_04920 778 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1967 2407 gene locus_tag LOCUS_04930 1967 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2431 3198 gene locus_tag LOCUS_04940 gene thyX 2431 3198 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence139 <1 830 gene locus_tag LOCUS_04950 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965688.1:ABC transporter ATP-binding protein 918 1445 gene locus_tag LOCUS_04960 918 1445 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_04960 2965 1535 gene locus_tag LOCUS_04970 2965 1535 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence140 1203 676 gene locus_tag LOCUS_04980 gene rimM 1203 676 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_04980 1432 1205 gene locus_tag LOCUS_04990 1432 1205 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_04990 1701 1459 gene locus_tag LOCUS_05000 gene rpsP 1701 1459 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_05000 3119 1776 gene locus_tag LOCUS_05010 gene ffh 3119 1776 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence141 2504 951 gene locus_tag LOCUS_05020 gene citF 2504 951 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 protein_id gnl|my_center|LOCUS_05020 <3204 2507 gene locus_tag LOCUS_05030 <3204 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898727.1:citrate (pro-3S)-lyase subunit beta >Feature sequence142 238 1164 gene locus_tag LOCUS_05040 238 1164 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_05040 1157 1801 gene locus_tag LOCUS_05050 1157 1801 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_05050 1798 2412 gene locus_tag LOCUS_05060 1798 2412 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356420.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence143 152 1522 gene locus_tag LOCUS_05070 152 1522 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_05070 3183 1576 gene locus_tag LOCUS_05080 3183 1576 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence144 42 689 gene locus_tag LOCUS_05090 42 689 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_05090 692 2626 gene locus_tag LOCUS_05100 692 2626 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_05100 1689 1698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2709 2906 gene locus_tag LOCUS_05110 2709 2906 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence145 1231 92 gene locus_tag LOCUS_05120 gene galK 1231 92 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_05120 1673 1236 gene locus_tag LOCUS_05130 1673 1236 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_05130 3156 1687 gene locus_tag LOCUS_05140 gene thrC 3156 1687 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence146 1185 1379 gene locus_tag LOCUS_05150 1185 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1435 1857 gene locus_tag LOCUS_05160 1435 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1845 1854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1902 2168 gene locus_tag LOCUS_05170 1902 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2165 2440 gene locus_tag LOCUS_05180 2165 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3028 2501 gene locus_tag LOCUS_05190 3028 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 >Feature sequence147 1217 342 gene locus_tag LOCUS_05200 1217 342 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_05200 2200 1199 gene locus_tag LOCUS_05210 2200 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3018 2197 gene locus_tag LOCUS_05220 gene murQ 3018 2197 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815759.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence148 <1 854 gene locus_tag LOCUS_05230 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083000.1:ABC transporter ATP-binding protein 844 2652 gene locus_tag LOCUS_05240 844 2652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_05240 2995 2852 gene locus_tag LOCUS_05250 2995 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence149 2523 1507 gene locus_tag LOCUS_05260 gene mraY 2523 1507 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_05260 <3128 2560 gene locus_tag LOCUS_05270 <3128 2560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965428.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence150 1963 1682 gene locus_tag LOCUS_05280 1963 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05280 2263 2006 gene locus_tag LOCUS_05290 2263 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05290 2568 2293 gene locus_tag LOCUS_05300 2568 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2596 2898 gene locus_tag LOCUS_05310 2596 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence151 348 1484 gene locus_tag LOCUS_05320 348 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1481 2191 gene locus_tag LOCUS_05330 1481 2191 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_05330 <3050 2239 gene locus_tag LOCUS_05340 <3050 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003385506.1:arginine deiminase >Feature sequence152 572 1342 gene locus_tag LOCUS_05350 572 1342 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_05350 1329 2534 gene locus_tag LOCUS_05360 1329 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence153 <1 895 gene locus_tag LOCUS_05370 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836511.1:glutamate formimidoyltransferase 909 2150 gene locus_tag LOCUS_05380 gene hutI 909 2150 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_05380 2190 2819 gene locus_tag LOCUS_05390 2190 2819 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence154 <3028 329 gene locus_tag LOCUS_05400 <3028 329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA >Feature sequence155 270 2999 gene locus_tag LOCUS_05410 270 2999 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861128.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence156 2600 492 gene locus_tag LOCUS_05420 gene topA 2600 492 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence157 286 98 gene locus_tag LOCUS_05430 286 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 545 225 gene locus_tag LOCUS_05440 545 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 668 1300 gene locus_tag LOCUS_05450 668 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1318 2895 gene locus_tag LOCUS_05460 1318 2895 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence158 <1 753 gene locus_tag LOCUS_05470 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000759913.1:ABC transporter permease 755 1843 gene locus_tag LOCUS_05480 755 1843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_05480 1855 2925 gene locus_tag LOCUS_05490 1855 2925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921893.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence159 1247 189 gene locus_tag LOCUS_05500 1247 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_05500 1396 2328 gene locus_tag LOCUS_05510 1396 2328 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208118.1 protein_id gnl|my_center|LOCUS_05510 2477 2553 gene locus_tag LOCUS_t00030 2477 2553 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2562 2638 gene locus_tag LOCUS_t00040 2562 2638 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2671 2746 gene locus_tag LOCUS_t00050 2671 2746 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2752 2827 gene locus_tag LOCUS_t00060 2752 2827 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2851 2936 gene locus_tag LOCUS_t00070 2851 2936 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 99 446 gene locus_tag LOCUS_05520 99 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 551 1201 gene locus_tag LOCUS_05530 551 1201 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_05530 1206 2606 gene locus_tag LOCUS_05540 1206 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence161 <1 1078 gene locus_tag LOCUS_05550 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964657.1:transketolase 1766 1311 gene locus_tag LOCUS_05560 gene tadA 1766 1311 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_05560 1931 2449 gene locus_tag LOCUS_05570 1931 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence162 927 181 gene locus_tag LOCUS_05580 927 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 <2964 924 gene locus_tag LOCUS_05590 <2964 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925470.1:serine/threonine-protein kinase >Feature sequence163 357 1064 gene locus_tag LOCUS_05600 357 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1612 2349 gene locus_tag LOCUS_05610 1612 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence164 <1 1040 gene locus_tag LOCUS_05620 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510924.1:ATP-binding protein 1128 1811 gene locus_tag LOCUS_05630 1128 1811 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence165 3 1484 gene locus_tag LOCUS_05640 3 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1500 2015 gene locus_tag LOCUS_05650 1500 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2018 2950 gene locus_tag LOCUS_05660 2018 2950 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence166 1766 513 gene locus_tag LOCUS_05670 1766 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1873 2805 gene locus_tag LOCUS_05680 1873 2805 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence167 1124 96 gene locus_tag LOCUS_05690 1124 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 <2947 1143 gene locus_tag LOCUS_05700 <2947 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963882.1:glycoside hydrolase family 9 protein >Feature sequence168 1105 230 gene locus_tag LOCUS_05710 1105 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1995 1105 gene locus_tag LOCUS_05720 1995 1105 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_05720 2844 2056 gene locus_tag LOCUS_05730 2844 2056 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence169 56 532 gene locus_tag LOCUS_05740 56 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 558 1418 gene locus_tag LOCUS_05750 558 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 1852 1460 gene locus_tag LOCUS_05760 1852 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence170 1219 293 gene locus_tag LOCUS_05770 1219 293 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_05770 2845 1301 gene locus_tag LOCUS_05780 gene rny 2845 1301 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence171 979 341 gene locus_tag LOCUS_05790 979 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1375 1016 gene locus_tag LOCUS_05800 1375 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1663 2670 gene locus_tag LOCUS_05810 1663 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2682 2861 gene locus_tag LOCUS_05820 2682 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence172 2 514 gene locus_tag LOCUS_05830 2 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 631 1176 gene locus_tag LOCUS_05840 gene cas4 631 1176 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05840 1173 2204 gene locus_tag LOCUS_05850 gene cas1c 1173 2204 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_05850 2223 2513 gene locus_tag LOCUS_05860 gene cas2 2223 2513 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_05860 2671 2912 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccccctcgtggggagcgtggattgaaatg >Feature sequence173 970 695 gene locus_tag LOCUS_05870 970 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2422 986 gene locus_tag LOCUS_05880 2422 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 <2931 2400 gene locus_tag LOCUS_05890 <2931 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048141.1:Hsp33 family molecular chaperone HslO >Feature sequence174 31 255 gene locus_tag LOCUS_05900 31 255 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05900 301 2793 gene locus_tag LOCUS_05910 301 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence175 >Feature sequence176 2014 491 gene locus_tag LOCUS_05920 2014 491 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_05920 <2919 1995 gene locus_tag LOCUS_05930 <2919 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101299.1:CpsD/CapB family tyrosine-protein kinase >Feature sequence177 972 625 gene locus_tag LOCUS_05940 972 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2404 1565 gene locus_tag LOCUS_05950 2404 1565 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764673.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence178 360 767 gene locus_tag LOCUS_05960 gene rpsK 360 767 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_05960 780 1409 gene locus_tag LOCUS_05970 gene rpsD 780 1409 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05970 1466 2407 gene locus_tag LOCUS_05980 1466 2407 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966385.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence179 1096 2244 gene locus_tag LOCUS_05990 1096 2244 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460569.1 protein_id gnl|my_center|LOCUS_05990 <2893 2349 gene locus_tag LOCUS_06000 <2893 2349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989507.1:M20 family metallopeptidase >Feature sequence180 271 1548 gene locus_tag LOCUS_06010 gene rimO 271 1548 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_06010 1545 2084 gene locus_tag LOCUS_06020 gene pgsA 1545 2084 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence181 2359 899 gene locus_tag LOCUS_06030 2359 899 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_06030 <2860 2356 gene locus_tag LOCUS_06040 <2860 2356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001220338.1:Trk system potassium transporter TrkA >Feature sequence182 <1 1359 gene locus_tag LOCUS_06050 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015727.1:MATE family efflux transporter 1612 2199 gene locus_tag LOCUS_06060 1612 2199 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence183 1424 540 gene locus_tag LOCUS_06070 1424 540 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence184 50 1450 gene locus_tag LOCUS_06080 50 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence185 1058 2596 gene locus_tag LOCUS_06090 1058 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence186 460 80 gene locus_tag LOCUS_06100 460 80 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860888.1 protein_id gnl|my_center|LOCUS_06100 2342 606 gene locus_tag LOCUS_06110 2342 606 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence187 1145 39 gene locus_tag LOCUS_06120 1145 39 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_06120 1964 1164 gene locus_tag LOCUS_06130 gene etfB 1964 1164 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_06130 <2793 1975 gene locus_tag LOCUS_06140 <2793 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003418888.1:acyl-CoA dehydrogenase >Feature sequence188 3 1580 gene locus_tag LOCUS_06150 3 1580 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_06150 1728 2387 gene locus_tag LOCUS_06160 gene cssR 1728 2387 CDS product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence189 <1 1244 gene locus_tag LOCUS_06170 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682366.1:MATE family efflux transporter 2303 1866 gene locus_tag LOCUS_06180 2303 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence190 1342 230 gene locus_tag LOCUS_06190 gene dnaN 1342 230 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_06190 1590 1333 gene locus_tag LOCUS_06200 1590 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 <2757 1628 gene locus_tag LOCUS_06210 <2757 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947895.1:chromosomal replication initiator protein DnaA >Feature sequence191 3 2315 gene locus_tag LOCUS_06220 3 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence192 2590 1661 gene locus_tag LOCUS_06230 2590 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence193 1615 644 gene locus_tag LOCUS_06240 1615 644 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_06240 2376 1612 gene locus_tag LOCUS_06250 gene truA 2376 1612 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence194 <1 630 gene locus_tag LOCUS_06260 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964814.1:response regulator transcription factor 635 2023 gene locus_tag LOCUS_06270 635 2023 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_06270 2106 2453 gene locus_tag LOCUS_06280 2106 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence195 3 794 gene locus_tag LOCUS_06290 3 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 799 1839 gene locus_tag LOCUS_06300 799 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence196 66 914 gene locus_tag LOCUS_06310 66 914 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_06310 926 1561 gene locus_tag LOCUS_06320 926 1561 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811435.1 protein_id gnl|my_center|LOCUS_06320 1566 2279 gene locus_tag LOCUS_06330 1566 2279 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383563.1 protein_id gnl|my_center|LOCUS_06330 2356 2652 gene locus_tag LOCUS_06340 2356 2652 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence197 663 460 gene locus_tag LOCUS_06350 663 460 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355974.1 protein_id gnl|my_center|LOCUS_06350 1511 660 gene locus_tag LOCUS_06360 1511 660 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966986.1 protein_id gnl|my_center|LOCUS_06360 <2736 1586 gene locus_tag LOCUS_06370 <2736 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003724005.1:LCP family protein >Feature sequence198 830 1849 gene locus_tag LOCUS_06380 830 1849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence199 <1 982 gene locus_tag LOCUS_06390 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965265.1:bifunctional metallophosphatase/5'-nucleotidase 1001 1522 gene locus_tag LOCUS_06400 1001 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1465 1474 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1561 1989 gene locus_tag LOCUS_06410 1561 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 <2714 2165 gene locus_tag LOCUS_06420 <2714 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439379.1:ferrous iron transport protein B >Feature sequence200 672 169 gene locus_tag LOCUS_06430 gene rpsE 672 169 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_06430 1051 683 gene locus_tag LOCUS_06440 gene rplR 1051 683 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_06440 1614 1075 gene locus_tag LOCUS_06450 gene rplF 1614 1075 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_06450 2043 1645 gene locus_tag LOCUS_06460 gene rpsH 2043 1645 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_06460 2255 2070 gene locus_tag LOCUS_06470 2255 2070 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence201 970 101 gene locus_tag LOCUS_06480 970 101 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_06480 1209 2405 gene locus_tag LOCUS_06490 1209 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002688425.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence202 72 1703 gene locus_tag LOCUS_06500 72 1703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence203 929 1096 gene locus_tag LOCUS_06510 929 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1100 2599 gene locus_tag LOCUS_06520 1100 2599 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861384.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence204 1075 761 gene locus_tag LOCUS_06530 1075 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06530 1222 1097 gene locus_tag LOCUS_06540 1222 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06540 1525 1283 gene locus_tag LOCUS_06550 1525 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1667 2644 gene locus_tag LOCUS_06560 1667 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence205 1288 341 gene locus_tag LOCUS_06570 1288 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942807.1 protein_id gnl|my_center|LOCUS_06570 1509 1285 gene locus_tag LOCUS_06580 1509 1285 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809987.1 protein_id gnl|my_center|LOCUS_06580 2469 1519 gene locus_tag LOCUS_06590 2469 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809989.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence206 795 1328 gene locus_tag LOCUS_06600 795 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence207 1 2109 gene locus_tag LOCUS_06610 1 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence208 769 5 gene locus_tag LOCUS_06620 769 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 2057 816 gene locus_tag LOCUS_06630 2057 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence209 790 32 gene locus_tag LOCUS_06640 790 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2322 787 gene locus_tag LOCUS_06650 2322 787 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence210 <1 859 gene locus_tag LOCUS_06660 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510924.1:ATP-binding protein 856 1758 gene locus_tag LOCUS_06670 856 1758 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_06670 2064 2546 gene locus_tag LOCUS_06680 2064 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence211 2396 390 gene locus_tag LOCUS_06690 gene ligA 2396 390 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048227.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence212 <1 1316 gene locus_tag LOCUS_06700 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355146.1:extracellular solute-binding protein >Feature sequence213 1789 665 gene locus_tag LOCUS_06710 gene glgD 1789 665 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_06710 2640 1801 gene locus_tag LOCUS_06720 2640 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence214 1250 129 gene locus_tag LOCUS_06730 1250 129 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022270.1 protein_id gnl|my_center|LOCUS_06730 2388 1291 gene locus_tag LOCUS_06740 2388 1291 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence215 1537 965 gene locus_tag LOCUS_06750 gene sigM 1537 965 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180197.1 protein_id gnl|my_center|LOCUS_06750 2203 1661 gene locus_tag LOCUS_06760 2203 1661 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06760 >Feature sequence216 <1 805 gene locus_tag LOCUS_06770 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359343.1:ribose-phosphate diphosphokinase 2628 931 gene locus_tag LOCUS_06780 2628 931 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence217 111 854 gene locus_tag LOCUS_06790 111 854 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_06790 1744 944 gene locus_tag LOCUS_06800 1744 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2479 1796 gene locus_tag LOCUS_06810 gene yunB 2479 1796 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence218 1642 428 gene locus_tag LOCUS_06820 gene cdaR 1642 428 CDS product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 protein_id gnl|my_center|LOCUS_06820 2474 1626 gene locus_tag LOCUS_06830 gene cdaA 2474 1626 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence219 815 189 gene locus_tag LOCUS_06840 815 189 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06840 2132 834 gene locus_tag LOCUS_06850 gene secY 2132 834 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_06850 2572 2132 gene locus_tag LOCUS_06860 gene rplO 2572 2132 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence220 1004 1013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2615 1072 gene locus_tag LOCUS_06870 <2615 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258367.1:methylmalonyl-CoA mutase >Feature sequence221 1097 252 gene locus_tag LOCUS_06880 1097 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1377 2417 gene locus_tag LOCUS_06890 gene hrcA 1377 2417 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence222 1 411 gene locus_tag LOCUS_06900 1 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 411 1463 gene locus_tag LOCUS_06910 411 1463 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_06910 1460 2287 gene locus_tag LOCUS_06920 1460 2287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence223 2466 1075 gene locus_tag LOCUS_06930 2466 1075 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence224 156 28 gene locus_tag LOCUS_06940 156 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 823 143 gene locus_tag LOCUS_06950 gene nth 823 143 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_06950 962 1717 gene locus_tag LOCUS_06960 962 1717 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_06960 <2578 1728 gene locus_tag LOCUS_06970 <2578 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399687.1:DNA repair protein RadA >Feature sequence225 2526 832 gene locus_tag LOCUS_06980 gene argS 2526 832 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence226 86 1030 gene locus_tag LOCUS_06990 86 1030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293573.1 protein_id gnl|my_center|LOCUS_06990 1030 2010 gene locus_tag LOCUS_07000 1030 2010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence227 545 1594 gene locus_tag LOCUS_07010 gene trpX 545 1594 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836788.1 protein_id gnl|my_center|LOCUS_07010 1619 2557 gene locus_tag LOCUS_07020 1619 2557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence228 1710 409 gene locus_tag LOCUS_07030 1710 409 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_07030 2153 1734 gene locus_tag LOCUS_07040 2153 1734 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948883.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence229 <1 827 gene locus_tag LOCUS_07050 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963452.1:DNA polymerase III subunit gamma/tau note possible pseudo, frameshifted 810 819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 857 1537 gene locus_tag LOCUS_07060 857 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1606 1944 gene locus_tag LOCUS_07070 1606 1944 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence230 501 1379 gene locus_tag LOCUS_07080 gene rsgA 501 1379 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_07080 1372 2025 gene locus_tag LOCUS_07090 gene rpe 1372 2025 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_07090 2145 2221 gene locus_tag LOCUS_t00080 2145 2221 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2407 2480 gene locus_tag LOCUS_t00090 2407 2480 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 46 678 gene locus_tag LOCUS_07100 46 678 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_07100 730 2199 gene locus_tag LOCUS_07110 730 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence232 491 988 gene locus_tag LOCUS_07120 491 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1072 1145 gene locus_tag LOCUS_t00100 1072 1145 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1245 1829 gene locus_tag LOCUS_07130 1245 1829 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679755.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence233 2515 1418 gene locus_tag LOCUS_07140 2515 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence234 <1 780 gene locus_tag LOCUS_07150 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860647.1:amidohydrolase 2134 836 gene locus_tag LOCUS_07160 gene citG 2134 836 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence235 705 1007 gene locus_tag LOCUS_07170 705 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence236 19 600 gene locus_tag LOCUS_07180 19 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1435 590 gene locus_tag LOCUS_07190 1435 590 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921878.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence237 <1 1096 gene locus_tag LOCUS_07200 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964141.1:FtsX-like permease family protein >Feature sequence238 5 2104 gene locus_tag LOCUS_07210 5 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence239 1362 55 gene locus_tag LOCUS_07220 1362 55 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence240 43 474 gene locus_tag LOCUS_07230 43 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 487 1884 gene locus_tag LOCUS_07240 487 1884 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence241 488 1426 gene locus_tag LOCUS_07250 488 1426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986000.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence242 <1 819 gene locus_tag LOCUS_07260 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817222.1:methionine ABC transporter ATP-binding protein 812 1474 gene locus_tag LOCUS_07270 812 1474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 protein_id gnl|my_center|LOCUS_07270 1538 2353 gene locus_tag LOCUS_07280 1538 2353 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence243 2369 249 gene locus_tag LOCUS_07290 2369 249 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730166.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence244 >Feature sequence245 313 1074 gene locus_tag LOCUS_07300 313 1074 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence246 512 521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2434 593 gene locus_tag LOCUS_07310 <2434 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810412.1:ferrous iron transport protein B >Feature sequence247 1796 429 gene locus_tag LOCUS_07320 1796 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2001 1783 gene locus_tag LOCUS_07330 2001 1783 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence248 2338 203 gene locus_tag LOCUS_07340 2338 203 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748903.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence249 <1 1119 gene locus_tag LOCUS_07350 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396717.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein 1120 2280 gene locus_tag LOCUS_07360 1120 2280 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence250 42 1463 gene locus_tag LOCUS_07370 42 1463 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_07370 1852 1529 gene locus_tag LOCUS_07380 1852 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence251 <1 1996 gene locus_tag LOCUS_07390 <1 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391556.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence252 665 1996 gene locus_tag LOCUS_07400 665 1996 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence253 <1 1264 gene locus_tag LOCUS_07410 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861250.1:amino acid permease 1467 2345 gene locus_tag LOCUS_07420 1467 2345 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence254 721 545 gene locus_tag LOCUS_07430 721 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1735 1103 gene locus_tag LOCUS_07440 1735 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence255 <1 738 gene locus_tag LOCUS_07450 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393655.1:NAD(P)H-hydrate dehydratase 767 1933 gene locus_tag LOCUS_07460 767 1933 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964358.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence256 <1 610 gene locus_tag LOCUS_07470 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000534165.1:ABC transporter permease 607 1752 gene locus_tag LOCUS_07480 607 1752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence257 23 454 gene locus_tag LOCUS_07490 23 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 411 1451 gene locus_tag LOCUS_07500 411 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 414 423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1603 2193 gene locus_tag LOCUS_07510 1603 2193 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence258 >Feature sequence259 752 2308 gene locus_tag LOCUS_07520 752 2308 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence260 168 1001 gene locus_tag LOCUS_07530 168 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1005 1412 gene locus_tag LOCUS_07540 1005 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1428 1664 gene locus_tag LOCUS_07550 1428 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1721 1969 gene locus_tag LOCUS_07560 1721 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1966 2319 gene locus_tag LOCUS_07570 1966 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence261 949 23 gene locus_tag LOCUS_07580 949 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 <2343 942 gene locus_tag LOCUS_07590 <2343 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965689.1:ABC transporter ATP-binding protein >Feature sequence262 <2342 1076 gene locus_tag LOCUS_07600 <2342 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396717.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein >Feature sequence263 1208 69 gene locus_tag LOCUS_07610 1208 69 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_07610 2048 1209 gene locus_tag LOCUS_07620 gene holB 2048 1209 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence264 >Feature sequence265 222 428 gene locus_tag LOCUS_07630 222 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 433 1179 gene locus_tag LOCUS_07640 433 1179 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_07640 1176 1988 gene locus_tag LOCUS_07650 1176 1988 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence266 92 931 gene locus_tag LOCUS_07660 92 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1538 882 gene locus_tag LOCUS_07670 1538 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2216 1542 gene locus_tag LOCUS_07680 2216 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence267 1381 2238 gene locus_tag LOCUS_07690 1381 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence268 1680 1132 gene locus_tag LOCUS_07700 1680 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2263 1817 gene locus_tag LOCUS_07710 2263 1817 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence269 >Feature sequence270 1713 262 gene locus_tag LOCUS_07720 1713 262 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_07720 <2327 1710 gene locus_tag LOCUS_07730 <2327 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728735.1:MBL fold metallo-hydrolase >Feature sequence271 63 1907 gene locus_tag LOCUS_07740 63 1907 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_07740 241 250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence272 76 819 gene locus_tag LOCUS_07750 76 819 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_07750 816 2000 gene locus_tag LOCUS_07760 816 2000 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence273 1426 647 gene locus_tag LOCUS_07770 1426 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2218 1475 gene locus_tag LOCUS_07780 2218 1475 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence274 1120 140 gene locus_tag LOCUS_07790 1120 140 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989747.1 protein_id gnl|my_center|LOCUS_07790 2066 1122 gene locus_tag LOCUS_07800 2066 1122 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183386.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence275 >Feature sequence276 >Feature sequence277 <1 1303 gene locus_tag LOCUS_07810 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809868.1:hemolysin family protein 1432 1965 gene locus_tag LOCUS_07820 1432 1965 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055906.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence278 1464 133 gene locus_tag LOCUS_07830 gene ssnA 1464 133 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence279 371 661 gene locus_tag LOCUS_07840 371 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 661 1017 gene locus_tag LOCUS_07850 661 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1115 1396 gene locus_tag LOCUS_07860 1115 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence280 1577 948 gene locus_tag LOCUS_07870 1577 948 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_07870 2276 1584 gene locus_tag LOCUS_07880 2276 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence281 2167 1076 gene locus_tag LOCUS_07890 2167 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence282 533 9 gene locus_tag LOCUS_07900 533 9 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_07900 1884 523 gene locus_tag LOCUS_07910 1884 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence283 2204 39 gene locus_tag LOCUS_07920 2204 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence284 2257 1658 gene locus_tag LOCUS_07930 2257 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence285 369 2105 gene locus_tag LOCUS_07940 gene proS 369 2105 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence286 1053 73 gene locus_tag LOCUS_07950 1053 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <2241 1058 gene locus_tag LOCUS_07960 <2241 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229333.1:amidohydrolase >Feature sequence287 1367 660 gene locus_tag LOCUS_07970 1367 660 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_07970 2173 1364 gene locus_tag LOCUS_07980 2173 1364 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172731.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence288 >Feature sequence289 181 20 gene locus_tag LOCUS_07990 181 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 410 949 gene locus_tag LOCUS_08000 410 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence290 136 1980 gene locus_tag LOCUS_08010 gene ftsH 136 1980 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence291 341 1789 gene locus_tag LOCUS_08020 gene hydG 341 1789 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence292 <1 893 gene locus_tag LOCUS_08030 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016113.1:carboxypeptidase M32 925 2094 gene locus_tag LOCUS_08040 925 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence293 <1 872 gene locus_tag LOCUS_08050 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141484866.1:DUF2804 domain-containing protein 874 1371 gene locus_tag LOCUS_08060 874 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence294 221 355 gene locus_tag LOCUS_08070 221 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 381 971 gene locus_tag LOCUS_08080 381 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 <2179 1022 gene locus_tag LOCUS_08090 <2179 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494943.1:MATE family efflux transporter >Feature sequence295 1922 348 gene locus_tag LOCUS_08100 1922 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08100 519 528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence296 694 143 gene locus_tag LOCUS_08110 694 143 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904290.1 protein_id gnl|my_center|LOCUS_08110 834 924 gene locus_tag LOCUS_t00110 834 924 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1367 1020 gene locus_tag LOCUS_08120 1367 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1760 1383 gene locus_tag LOCUS_08130 1760 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1891 1748 gene locus_tag LOCUS_08140 1891 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2060 1881 gene locus_tag LOCUS_08150 2060 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence297 893 588 gene locus_tag LOCUS_08160 893 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2136 976 gene locus_tag LOCUS_08170 2136 976 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence298 1 486 gene locus_tag LOCUS_08180 1 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 492 983 gene locus_tag LOCUS_08190 492 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence299 39 911 gene locus_tag LOCUS_08200 39 911 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence300 526 1014 gene locus_tag LOCUS_08210 526 1014 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_08210 1027 1569 gene locus_tag LOCUS_08220 1027 1569 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_08220 1566 1937 gene locus_tag LOCUS_08230 1566 1937 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence301 569 1144 gene locus_tag LOCUS_08240 569 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence302 659 1966 gene locus_tag LOCUS_08250 gene dsdA 659 1966 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016476.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence303 <1 877 gene locus_tag LOCUS_08260 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969490.1:MurR/RpiR family transcriptional regulator 903 2060 gene locus_tag LOCUS_08270 gene iadA 903 2060 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568430.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence304 93 1112 gene locus_tag LOCUS_08280 gene gap 93 1112 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707358.1 protein_id gnl|my_center|LOCUS_08280 <2127 1205 gene locus_tag LOCUS_08290 <2127 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393496.1:pyridoxal-phosphate dependent enzyme >Feature sequence305 <1 826 gene locus_tag LOCUS_08300 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817208.1:FAD:protein FMN transferase 870 1844 gene locus_tag LOCUS_08310 870 1844 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence306 2031 1558 gene locus_tag LOCUS_08320 gene greA 2031 1558 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence307 1380 1069 gene locus_tag LOCUS_08330 1380 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence308 1 1017 gene locus_tag LOCUS_08340 1 1017 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_08340 1010 1804 gene locus_tag LOCUS_08350 1010 1804 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence309 <1 588 gene locus_tag LOCUS_08360 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393851.1:stage II sporulation protein D 601 1479 gene locus_tag LOCUS_08370 601 1479 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_08370 2030 1563 gene locus_tag LOCUS_08380 2030 1563 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948159.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence310 70 423 gene locus_tag LOCUS_08390 70 423 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence311 2089 1214 gene locus_tag LOCUS_08400 2089 1214 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence312 157 657 gene locus_tag LOCUS_08410 gene crtO 157 657 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_08410 654 1754 gene locus_tag LOCUS_08420 654 1754 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870487.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence313 290 1417 gene locus_tag LOCUS_08430 290 1417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence314 819 202 gene locus_tag LOCUS_08440 819 202 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence315 <1 1932 gene locus_tag LOCUS_08450 <1 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109251.1:transglutaminase domain-containing protein >Feature sequence316 336 1451 gene locus_tag LOCUS_08460 336 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence317 866 504 gene locus_tag LOCUS_08470 866 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2032 911 gene locus_tag LOCUS_08480 2032 911 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence318 1640 753 gene locus_tag LOCUS_08490 1640 753 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence319 63 926 gene locus_tag LOCUS_08500 63 926 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963968.1 protein_id gnl|my_center|LOCUS_08500 910 1536 gene locus_tag LOCUS_08510 910 1536 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence320 <1 1216 gene locus_tag LOCUS_08520 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776609.1:peptidoglycan-binding protein >Feature sequence321 >Feature sequence322 393 1166 gene locus_tag LOCUS_08530 393 1166 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_08530 1240 1434 gene locus_tag LOCUS_08540 1240 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence323 <2060 653 gene locus_tag LOCUS_08550 <2060 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948029.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence324 1975 326 gene locus_tag LOCUS_08560 1975 326 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence325 >Feature sequence326 >Feature sequence327 1897 698 gene locus_tag LOCUS_08570 1897 698 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence328 455 1249 gene locus_tag LOCUS_08580 gene phnC 455 1249 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence329 <1 712 gene locus_tag LOCUS_08590 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944354.1:nucleoside kinase 718 1479 gene locus_tag LOCUS_08600 718 1479 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence330 250 56 gene locus_tag LOCUS_08610 250 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 867 256 gene locus_tag LOCUS_08620 gene gmk 867 256 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_08620 1765 884 gene locus_tag LOCUS_08630 1765 884 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence331 840 1457 gene locus_tag LOCUS_08640 gene udk 840 1457 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence332 500 1282 gene locus_tag LOCUS_08650 gene aph(3')-IIIa 500 1282 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_08650 <2016 1286 gene locus_tag LOCUS_08660 <2016 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203438.1:alkaline phosphatase >Feature sequence333 735 76 gene locus_tag LOCUS_08670 735 76 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_08670 1559 732 gene locus_tag LOCUS_08680 1559 732 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_08680 1960 1559 gene locus_tag LOCUS_08690 1960 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence334 <1 1343 gene locus_tag LOCUS_08700 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867265.1:amidohydrolase family protein 1371 1859 gene locus_tag LOCUS_08710 1371 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence335 >Feature sequence336 957 79 gene locus_tag LOCUS_08720 957 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 <2002 936 gene locus_tag LOCUS_08730 <2002 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812452.1:ATP-binding cassette domain-containing protein >Feature sequence337 457 1008 gene locus_tag LOCUS_08740 457 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08740 1715 1170 gene locus_tag LOCUS_08750 1715 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence338 1050 478 gene locus_tag LOCUS_08760 1050 478 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_08760 <2001 1050 gene locus_tag LOCUS_08770 <2001 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869130.1:indolepyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence339 28 1194 gene locus_tag LOCUS_08780 28 1194 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence340 <1 1030 gene locus_tag LOCUS_08790 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001282986.1:tRNA 2-thiouridine(34) synthase MnmA 1027 1494 gene locus_tag LOCUS_08800 1027 1494 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027567.1 protein_id gnl|my_center|LOCUS_08800 1589 1864 gene locus_tag LOCUS_08810 1589 1864 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence341 <1992 684 gene locus_tag LOCUS_08820 <1992 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947975.1:germination protein YpeB >Feature sequence342 258 1637 gene locus_tag LOCUS_08830 258 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence343 <1 563 gene locus_tag LOCUS_08840 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679462.1:chromate transporter 560 1369 gene locus_tag LOCUS_08850 560 1369 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_08850 1379 1858 gene locus_tag LOCUS_08860 gene rlmH 1379 1858 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568165.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence344 <1 989 gene locus_tag LOCUS_08870 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102165.1:heavy metal translocating P-type ATPase 992 1198 gene locus_tag LOCUS_08880 992 1198 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272221.1 protein_id gnl|my_center|LOCUS_08880 1215 1460 gene locus_tag LOCUS_08890 1215 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence345 1538 306 gene locus_tag LOCUS_08900 1538 306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187289197.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence346 2 679 gene locus_tag LOCUS_08910 2 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 682 1653 gene locus_tag LOCUS_08920 682 1653 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence347 1381 311 gene locus_tag LOCUS_08930 1381 311 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817406.1 protein_id gnl|my_center|LOCUS_08930 1655 1579 gene locus_tag LOCUS_t00120 1655 1579 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1824 1899 gene locus_tag LOCUS_t00130 1824 1899 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence348 694 2 gene locus_tag LOCUS_08940 694 2 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_08940 <1971 888 gene locus_tag LOCUS_08950 <1971 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355994.1:oxaloacetate decarboxylase subunit alpha >Feature sequence349 1271 846 gene locus_tag LOCUS_08960 1271 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1894 1460 gene locus_tag LOCUS_08970 1894 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence350 1236 28 gene locus_tag LOCUS_08980 1236 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence351 1233 76 gene locus_tag LOCUS_08990 1233 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1844 1230 gene locus_tag LOCUS_09000 1844 1230 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963542.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence352 >Feature sequence353 1573 620 gene locus_tag LOCUS_09010 1573 620 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence354 1896 1066 gene locus_tag LOCUS_09020 1896 1066 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460205.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence355 <1 814 gene locus_tag LOCUS_09030 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392093.1:Rne/Rng family ribonuclease 903 978 gene locus_tag LOCUS_t00140 903 978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 981 1057 gene locus_tag LOCUS_t00150 981 1057 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <1943 1186 gene locus_tag LOCUS_09040 <1943 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837152.1:phosphotransferase >Feature sequence356 <1 691 gene locus_tag LOCUS_09050 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000020377.1:primosomal protein N' 753 1229 gene locus_tag LOCUS_09060 gene def 753 1229 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence357 <1934 1432 gene locus_tag LOCUS_09070 <1934 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814402.1:ABC transporter ATP-binding protein >Feature sequence358 41 1240 gene locus_tag LOCUS_09080 41 1240 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence359 >Feature sequence360 775 326 gene locus_tag LOCUS_09090 775 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1929 772 gene locus_tag LOCUS_09100 1929 772 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence361 <1929 773 gene locus_tag LOCUS_09110 <1929 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002986000.1:ABC transporter ATP-binding protein >Feature sequence362 >Feature sequence363 1630 98 gene locus_tag LOCUS_09120 gene guaA 1630 98 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence364 56 739 gene locus_tag LOCUS_09130 56 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1073 789 gene locus_tag LOCUS_09140 1073 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1255 1070 gene locus_tag LOCUS_09150 1255 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1855 1310 gene locus_tag LOCUS_09160 1855 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence365 176 1378 gene locus_tag LOCUS_09170 176 1378 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence366 24 1451 gene locus_tag LOCUS_09180 24 1451 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence367 519 166 gene locus_tag LOCUS_09190 519 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09190 898 509 gene locus_tag LOCUS_09200 898 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 560 569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1910 1343 gene locus_tag LOCUS_09210 <1910 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048332.1:phosphoglucosamine mutase >Feature sequence368 1840 962 gene locus_tag LOCUS_09220 1840 962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence369 1204 323 gene locus_tag LOCUS_09230 1204 323 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874373.1 protein_id gnl|my_center|LOCUS_09230 <1904 1212 gene locus_tag LOCUS_09240 <1904 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948262.1:fructose-1,6-bisphosphatase >Feature sequence370 780 262 gene locus_tag LOCUS_09250 780 262 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_09250 878 1237 gene locus_tag LOCUS_09260 878 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence371 887 108 gene locus_tag LOCUS_09270 887 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 <1892 971 gene locus_tag LOCUS_09280 <1892 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' >Feature sequence372 91 1452 gene locus_tag LOCUS_09290 gene hydA 91 1452 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence373 <1 753 gene locus_tag LOCUS_09300 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003564323.1:sugar ABC transporter permease 762 1655 gene locus_tag LOCUS_09310 762 1655 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence374 750 1250 gene locus_tag LOCUS_09320 750 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence375 797 279 gene locus_tag LOCUS_09330 797 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 <1878 1169 gene locus_tag LOCUS_09340 <1878 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836492.1:helix-turn-helix transcriptional regulator >Feature sequence376 <1 1031 gene locus_tag LOCUS_09350 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948912.1:sodium:alanine symporter family protein <1874 1118 gene locus_tag LOCUS_09360 <1874 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814361.1:TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein >Feature sequence377 <1 1198 gene locus_tag LOCUS_09370 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966001.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence378 >Feature sequence379 <1 989 gene locus_tag LOCUS_09380 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681807.1:MATE family efflux transporter 1016 1576 gene locus_tag LOCUS_09390 1016 1576 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence380 541 1581 gene locus_tag LOCUS_09400 gene recA 541 1581 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence381 >Feature sequence382 <1 917 gene locus_tag LOCUS_09410 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence383 >Feature sequence384 200 526 gene locus_tag LOCUS_09420 200 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence385 534 1163 gene locus_tag LOCUS_09430 534 1163 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_09430 1200 1745 gene locus_tag LOCUS_09440 1200 1745 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence386 1551 595 gene locus_tag LOCUS_09450 1551 595 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence387 <1 509 gene locus_tag LOCUS_09460 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011345263.1:glycine reductase complex selenoprotein B 537 770 gene locus_tag LOCUS_09470 537 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 865 1128 gene locus_tag LOCUS_09480 865 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09480 1300 1809 gene locus_tag LOCUS_09490 1300 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09490 >Feature sequence388 76 1617 gene locus_tag LOCUS_09500 76 1617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence389 944 363 gene locus_tag LOCUS_09510 944 363 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_09510 <1846 1197 gene locus_tag LOCUS_09520 <1846 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583621.1:energy-coupled thiamine transporter ThiT >Feature sequence390 311 387 gene locus_tag LOCUS_t00160 311 387 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 441 965 gene locus_tag LOCUS_09530 441 965 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880824.1 protein_id gnl|my_center|LOCUS_09530 1611 952 gene locus_tag LOCUS_09540 1611 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence391 180 1037 gene locus_tag LOCUS_09550 180 1037 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_09550 1542 1093 gene locus_tag LOCUS_09560 1542 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1805 1611 gene locus_tag LOCUS_09570 1805 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence392 >Feature sequence393 <1 604 gene locus_tag LOCUS_09580 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000895823.1:TatD family hydrolase 634 1377 gene locus_tag LOCUS_09590 634 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence394 >Feature sequence395 269 694 gene locus_tag LOCUS_09600 gene mraZ 269 694 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830185.1 protein_id gnl|my_center|LOCUS_09600 691 1629 gene locus_tag LOCUS_09610 gene rsmH 691 1629 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence396 940 686 gene locus_tag LOCUS_09620 940 686 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_09620 <1814 970 gene locus_tag LOCUS_09630 <1814 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434910.1:class I SAM-dependent methyltransferase >Feature sequence397 1179 136 gene locus_tag LOCUS_09640 1179 136 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_09640 <1813 1181 gene locus_tag LOCUS_09650 <1813 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228527.1:secretion stress-responsive two-component system sensor histidine kinase CssS >Feature sequence398 1099 197 gene locus_tag LOCUS_09660 1099 197 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_09660 <1803 1099 gene locus_tag LOCUS_09670 <1803 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004112931.1:sugar ABC transporter permease >Feature sequence399 258 1556 gene locus_tag LOCUS_09680 258 1556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_09680 1678 1442 gene locus_tag LOCUS_09690 1678 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence400 1166 510 gene locus_tag LOCUS_09700 1166 510 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_09700 1783 1169 gene locus_tag LOCUS_09710 1783 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence401 200 1159 gene locus_tag LOCUS_09720 200 1159 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_09720 <1784 1144 gene locus_tag LOCUS_09730 <1784 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681116.1:SAM-dependent methyltransferase >Feature sequence402 <1 525 gene locus_tag LOCUS_09740 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535402.1:8-oxoguanine deaminase >Feature sequence403 737 1495 gene locus_tag LOCUS_09750 737 1495 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence404 <1 571 gene locus_tag LOCUS_09760 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362247.1:YgeY family selenium metabolism-linked hydrolase >Feature sequence405 92 361 gene locus_tag LOCUS_09770 92 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 358 1479 gene locus_tag LOCUS_09780 358 1479 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence406 <1 905 gene locus_tag LOCUS_09790 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015945.1:TIM barrel protein <1761 877 gene locus_tag LOCUS_09800 <1761 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948925.1:DegV family protein >Feature sequence407 >Feature sequence408 155 529 gene locus_tag LOCUS_09810 155 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939314.1 protein_id gnl|my_center|LOCUS_09810 530 757 gene locus_tag LOCUS_09820 530 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 705 714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 768 905 gene locus_tag LOCUS_09830 768 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 902 1198 gene locus_tag LOCUS_09840 902 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1209 1463 gene locus_tag LOCUS_09850 1209 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1467 1691 gene locus_tag LOCUS_09860 1467 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence409 <1757 921 gene locus_tag LOCUS_09870 <1757 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947982.1:peptide chain release factor 1 >Feature sequence410 2 430 gene locus_tag LOCUS_09880 2 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 452 874 gene locus_tag LOCUS_09890 452 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence411 743 330 gene locus_tag LOCUS_09900 743 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 355 364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1745 839 gene locus_tag LOCUS_09910 <1745 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948022.1:VanW family protein >Feature sequence412 2 409 gene locus_tag LOCUS_09920 2 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 406 1053 gene locus_tag LOCUS_09930 406 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence413 1074 448 gene locus_tag LOCUS_09940 1074 448 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence414 >Feature sequence415 85 309 gene locus_tag LOCUS_09950 gene acpP 85 309 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_09950 379 1107 gene locus_tag LOCUS_09960 gene rnc 379 1107 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence416 >Feature sequence417 1218 229 gene locus_tag LOCUS_09970 1218 229 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902000.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence418 >Feature sequence419 1565 246 gene locus_tag LOCUS_09980 1565 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence420 1312 629 gene locus_tag LOCUS_09990 1312 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1568 1643 gene locus_tag LOCUS_t00170 1568 1643 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence421 753 1559 gene locus_tag LOCUS_10000 753 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence422 >Feature sequence423 1463 732 gene locus_tag LOCUS_10010 1463 732 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence424 <1683 1060 gene locus_tag LOCUS_10020 <1683 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002358005.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein >Feature sequence425 >Feature sequence426 1501 641 gene locus_tag LOCUS_10030 gene rsmI 1501 641 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence427 <1 1672 gene locus_tag LOCUS_10040 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680599.1:urocanate hydratase >Feature sequence428 >Feature sequence429 1540 362 gene locus_tag LOCUS_10050 1540 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence430 <1 1474 gene locus_tag LOCUS_10060 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence431 >Feature sequence432 <1 878 gene locus_tag LOCUS_10070 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964604.1:HD family phosphohydrolase 875 1312 gene locus_tag LOCUS_10080 gene ybeY 875 1312 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence433 >Feature sequence434 1552 131 gene locus_tag LOCUS_10090 1552 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence435 <1665 233 gene locus_tag LOCUS_10100 <1665 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987127.1:Lsa family ABC-F type ribosomal protection protein >Feature sequence436 >Feature sequence437 116 1045 gene locus_tag LOCUS_10110 116 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 <1665 1115 gene locus_tag LOCUS_10120 <1665 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948783.1:D-2-hydroxyacid dehydrogenase >Feature sequence438 888 1133 gene locus_tag LOCUS_10130 888 1133 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_10130 1407 1186 gene locus_tag LOCUS_10140 1407 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence439 >Feature sequence440 232 1485 gene locus_tag LOCUS_10150 232 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence441 >Feature sequence442 3 155 gene locus_tag LOCUS_10160 3 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 391 1257 gene locus_tag LOCUS_10170 391 1257 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037659.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence443 1476 466 gene locus_tag LOCUS_10180 1476 466 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence444 787 632 gene locus_tag LOCUS_10190 787 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1100 774 gene locus_tag LOCUS_10200 1100 774 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence445 <1 846 gene locus_tag LOCUS_10210 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001034779.1:BMP family protein >Feature sequence446 150 1592 gene locus_tag LOCUS_10220 150 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence447 >Feature sequence448 263 865 gene locus_tag LOCUS_10230 263 865 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419808.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence449 <1 783 gene locus_tag LOCUS_10240 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861555.1:50S ribosomal protein L11 methyltransferase 780 1517 gene locus_tag LOCUS_10250 780 1517 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence450 <1608 41 gene locus_tag LOCUS_10260 <1608 41 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000385090.1:chromosome condensation regulator >Feature sequence451 21 827 gene locus_tag LOCUS_10270 21 827 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence452 50 505 gene locus_tag LOCUS_10280 50 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence453 <1600 983 gene locus_tag LOCUS_10290 <1600 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002902452.1:ABC transporter permease >Feature sequence454 <1599 193 gene locus_tag LOCUS_10300 <1599 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986411.1:NADH-dependent [FeFe] hydrogenase, group A6 >Feature sequence455 659 84 gene locus_tag LOCUS_10310 659 84 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_10310 1540 671 gene locus_tag LOCUS_10320 1540 671 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667339.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence456 3 971 gene locus_tag LOCUS_10330 3 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence457 729 211 gene locus_tag LOCUS_10340 729 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1510 782 gene locus_tag LOCUS_10350 1510 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence458 <1584 743 gene locus_tag LOCUS_10360 <1584 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393494.1:threonine synthase >Feature sequence459 380 997 gene locus_tag LOCUS_10370 gene purN 380 997 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence460 393 728 gene locus_tag LOCUS_10380 393 728 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_10380 <1580 789 gene locus_tag LOCUS_10390 <1580 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392123.1:molecular chaperone DnaJ >Feature sequence461 878 630 gene locus_tag LOCUS_10400 878 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 <1575 993 gene locus_tag LOCUS_10410 <1575 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462031.1:cytochrome c biogenesis protein CcdA >Feature sequence462 >Feature sequence463 397 684 gene locus_tag LOCUS_10420 gene rpsF 397 684 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_10420 716 1144 gene locus_tag LOCUS_10430 gene ssb 716 1144 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_10430 1186 1431 gene locus_tag LOCUS_10440 gene rpsR 1186 1431 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359407.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence464 <1 747 gene locus_tag LOCUS_10450 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001048829.1:Na+/H+ antiporter NhaC family protein 892 1311 gene locus_tag LOCUS_10460 892 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence465 1490 402 gene locus_tag LOCUS_10470 gene serC 1490 402 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence466 80 286 gene locus_tag LOCUS_10480 80 286 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_10480 855 334 gene locus_tag LOCUS_10490 855 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence467 114 758 gene locus_tag LOCUS_10500 114 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1041 1535 gene locus_tag LOCUS_10510 1041 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence468 >Feature sequence469 >Feature sequence470 <1544 12 gene locus_tag LOCUS_10520 <1544 12 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289325.1:methionine--tRNA ligase >Feature sequence471 33 1262 gene locus_tag LOCUS_10530 gene pepT 33 1262 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682226.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence472 <1540 607 gene locus_tag LOCUS_10540 <1540 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009887855.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB >Feature sequence473 762 13 gene locus_tag LOCUS_10550 gene tpiA 762 13 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964030.1 protein_id gnl|my_center|LOCUS_10550 <1538 789 gene locus_tag LOCUS_10560 <1538 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964029.1:phosphoglycerate kinase >Feature sequence474 485 1507 gene locus_tag LOCUS_10570 gene queA 485 1507 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence475 362 9 gene locus_tag LOCUS_10580 362 9 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_10580 994 359 gene locus_tag LOCUS_10590 994 359 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_10590 <1524 1019 gene locus_tag LOCUS_10600 <1524 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861161.1:ribosome biogenesis GTPase YlqF >Feature sequence476 261 1283 gene locus_tag LOCUS_10610 261 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence477 1521 526 gene locus_tag LOCUS_10620 1521 526 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence478 >Feature sequence479 >Feature sequence480 >Feature sequence481 >Feature sequence482 >Feature sequence483 16 879 gene locus_tag LOCUS_10630 gene phnE 16 879 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence484 741 334 gene locus_tag LOCUS_10640 741 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 963 1451 gene locus_tag LOCUS_10650 963 1451 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence485 1398 82 gene locus_tag LOCUS_10660 1398 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10660 >Feature sequence486 368 198 gene locus_tag LOCUS_10670 368 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1014 382 gene locus_tag LOCUS_10680 1014 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence487 >Feature sequence488 1358 1026 gene locus_tag LOCUS_10690 1358 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence489 1409 372 gene locus_tag LOCUS_10700 1409 372 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence490 1289 342 gene locus_tag LOCUS_10710 1289 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence491 717 40 gene locus_tag LOCUS_10720 717 40 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_10720 1408 719 gene locus_tag LOCUS_10730 1408 719 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence492 278 742 gene locus_tag LOCUS_10740 278 742 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence493 <1 546 gene locus_tag LOCUS_10750 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388584.1:type I-C CRISPR-associated protein Cas5c >Feature sequence494 937 23 gene locus_tag LOCUS_10760 937 23 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_10760 1230 934 gene locus_tag LOCUS_10770 1230 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence495 >Feature sequence496 1019 477 gene locus_tag LOCUS_10780 1019 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1232 1038 gene locus_tag LOCUS_10790 1232 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10790 1044 1053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence497 1346 663 gene locus_tag LOCUS_10800 1346 663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence498 <1 861 gene locus_tag LOCUS_10810 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439427.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence499 >Feature sequence500 >Feature sequence501 <1456 664 gene locus_tag LOCUS_10820 <1456 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966899.1:ABC transporter ATP-binding protein >Feature sequence502 827 222 gene locus_tag LOCUS_10830 gene pcp 827 222 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250786.1 protein_id gnl|my_center|LOCUS_10830 <1453 833 gene locus_tag LOCUS_10840 <1453 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245023.1:peptidoglycan-N-acetylmuramic acid deacetylase PdaC >Feature sequence503 >Feature sequence504 245 163 gene locus_tag LOCUS_t00180 245 163 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 351 1211 gene locus_tag LOCUS_10850 351 1211 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence505 1432 1022 gene locus_tag LOCUS_10860 1432 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence506 <1434 174 gene locus_tag LOCUS_10870 <1434 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965058.1:chromosome segregation protein SMC >Feature sequence507 1228 656 gene locus_tag LOCUS_10880 1228 656 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887442.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence508 >Feature sequence509 >Feature sequence510 98 1393 gene locus_tag LOCUS_10890 98 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence511 >Feature sequence512 <1 532 gene locus_tag LOCUS_10900 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572570.1:GntR family transcriptional regulator 1026 571 gene locus_tag LOCUS_10910 1026 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence513 >Feature sequence514 95 20 gene locus_tag LOCUS_t00190 95 20 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1366 203 gene locus_tag LOCUS_10920 gene metK 1366 203 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence515 >Feature sequence516 1302 904 gene locus_tag LOCUS_10930 1302 904 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence517 530 75 gene locus_tag LOCUS_10940 530 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 923 543 gene locus_tag LOCUS_10950 923 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence518 288 1328 gene locus_tag LOCUS_10960 gene selD 288 1328 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence519 <1 576 gene locus_tag LOCUS_10970 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965410.1:NFACT RNA binding domain-containing protein 1059 589 gene locus_tag LOCUS_10980 1059 589 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965952.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence520 1408 116 gene locus_tag LOCUS_10990 1408 116 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence521 930 223 gene locus_tag LOCUS_11000 gene deoD 930 223 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence522 <1 659 gene locus_tag LOCUS_11010 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438549.1:MATE family efflux transporter >Feature sequence523 250 450 gene locus_tag LOCUS_11020 gene rpmE 250 450 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_11020 639 1172 gene locus_tag LOCUS_11030 639 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence524 <1 561 gene locus_tag LOCUS_11040 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048350.1:energy-coupling factor transporter ATPase 558 1364 gene locus_tag LOCUS_11050 558 1364 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence525 1372 530 gene locus_tag LOCUS_11060 1372 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence526 >Feature sequence527 1 1014 gene locus_tag LOCUS_11070 1 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence528 63 896 gene locus_tag LOCUS_11080 63 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1318 905 gene locus_tag LOCUS_11090 1318 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence529 >Feature sequence530 >Feature sequence531 330 1025 gene locus_tag LOCUS_11100 gene pyrH 330 1025 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence532 <1 1284 gene locus_tag LOCUS_11110 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432177.1:asparagine--tRNA ligase >Feature sequence533 1023 16 gene locus_tag LOCUS_11120 gene holA 1023 16 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence534 >Feature sequence535 >Feature sequence536 >Feature sequence537 1 837 gene locus_tag LOCUS_11130 1 837 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_11130 842 1282 gene locus_tag LOCUS_11140 842 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence538 41 955 gene locus_tag LOCUS_11150 41 955 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence539 >Feature sequence540 1257 922 gene locus_tag LOCUS_11160 1257 922 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence541 >Feature sequence542 <1348 583 gene locus_tag LOCUS_11170 <1348 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812740.1:ABC transporter substrate-binding protein >Feature sequence543 <1 538 gene locus_tag LOCUS_11180 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035887521.1:MBOAT family O-acyltransferase >Feature sequence544 86 886 gene locus_tag LOCUS_11190 gene spo0A 86 886 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence545 <1344 368 gene locus_tag LOCUS_11200 <1344 368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479516.1:M23 family metallopeptidase >Feature sequence546 1338 1132 gene locus_tag LOCUS_11210 1338 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence547 <1342 766 gene locus_tag LOCUS_11220 <1342 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949037.1:stage V sporulation protein E >Feature sequence548 1170 49 gene locus_tag LOCUS_11230 gene nagA 1170 49 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868992.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence549 1217 69 gene locus_tag LOCUS_11240 1217 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence550 737 141 gene locus_tag LOCUS_11250 737 141 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence551 55 207 gene locus_tag LOCUS_11260 55 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 450 286 gene locus_tag LOCUS_11270 450 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 <1332 470 gene locus_tag LOCUS_11280 <1332 470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356002.1:sodium ion-translocating decarboxylase subunit beta >Feature sequence552 >Feature sequence553 1206 748 gene locus_tag LOCUS_11290 gene rplI 1206 748 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence554 <1323 71 gene locus_tag LOCUS_11300 <1323 71 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051187.1:MATE family efflux transporter >Feature sequence555 <1 791 gene locus_tag LOCUS_11310 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963605.1:guanine deaminase 833 1084 gene locus_tag LOCUS_11320 833 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence556 338 517 gene locus_tag LOCUS_11330 338 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 <1315 564 gene locus_tag LOCUS_11340 <1315 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675966.1:aldehyde dehydrogenase >Feature sequence557 >Feature sequence558 2 1006 gene locus_tag LOCUS_11350 gene rodA 2 1006 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence559 115 933 gene locus_tag LOCUS_11360 115 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence560 239 66 gene locus_tag LOCUS_11370 239 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1273 323 gene locus_tag LOCUS_11380 1273 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence561 178 951 gene locus_tag LOCUS_11390 gene murI 178 951 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence562 <1 1007 gene locus_tag LOCUS_11400 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966358.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence563 >Feature sequence564 <1 680 gene locus_tag LOCUS_11410 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002665857.1:GNAT family N-acetyltransferase >Feature sequence565 <1287 545 gene locus_tag LOCUS_11420 <1287 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence566 >Feature sequence567 >Feature sequence568 1187 186 gene locus_tag LOCUS_11430 gene trpS 1187 186 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence569 344 493 gene locus_tag LOCUS_11440 gene rpmG 344 493 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_11440 518 805 gene locus_tag LOCUS_11450 518 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence570 >Feature sequence571 >Feature sequence572 19 927 gene locus_tag LOCUS_11460 19 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence573 <1 1241 gene locus_tag LOCUS_11470 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433873.1:AI-2E family transporter >Feature sequence574 556 1266 gene locus_tag LOCUS_11480 556 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence575 >Feature sequence576 <1276 389 gene locus_tag LOCUS_11490 <1276 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016650.1:histidine ammonia-lyase >Feature sequence577 920 672 gene locus_tag LOCUS_11500 920 672 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_11500 1263 940 gene locus_tag LOCUS_11510 1263 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence578 >Feature sequence579 82 1110 gene locus_tag LOCUS_11520 82 1110 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723230.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence580 <1 862 gene locus_tag LOCUS_11530 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966319.1:isoleucine--tRNA ligase 1053 1129 gene locus_tag LOCUS_t00200 1053 1129 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence581 403 867 gene locus_tag LOCUS_11540 403 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence582 >Feature sequence583 78 767 gene locus_tag LOCUS_11550 gene rplA 78 767 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 <1253 261 gene locus_tag LOCUS_11560 <1253 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004455004.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence588 <1 560 gene locus_tag LOCUS_11570 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365401.1:ATP-dependent chaperone ClpB 772 629 gene locus_tag LOCUS_11580 772 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1109 918 gene locus_tag LOCUS_11590 gene rpmB 1109 918 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence589 1167 133 gene locus_tag LOCUS_11600 1167 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence590 284 1126 gene locus_tag LOCUS_11610 284 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence591 <1250 580 gene locus_tag LOCUS_11620 <1250 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203784.1:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence592 51 1058 gene locus_tag LOCUS_11630 51 1058 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence593 1001 744 gene locus_tag LOCUS_11640 1001 744 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence594 358 708 gene locus_tag LOCUS_11650 358 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 428 437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 712 930 gene locus_tag LOCUS_11660 712 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence595 24 923 gene locus_tag LOCUS_11670 24 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence596 <1 554 gene locus_tag LOCUS_11680 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549977.1:asparaginase 712 1008 gene locus_tag LOCUS_11690 712 1008 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894075.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence597 <1 816 gene locus_tag LOCUS_11700 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232049.1:L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha >Feature sequence598 <1 846 gene locus_tag LOCUS_11710 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795164.1:fucose isomerase >Feature sequence599 <1 500 gene locus_tag LOCUS_11720 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964216.1:shikimate kinase 497 925 gene locus_tag LOCUS_11730 gene aroQ 497 925 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence600 >Feature sequence601 330 980 gene locus_tag LOCUS_11740 330 980 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence602 >Feature sequence603 >Feature sequence604 698 54 gene locus_tag LOCUS_11750 698 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence605 389 850 gene locus_tag LOCUS_11760 389 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869788.1 protein_id gnl|my_center|LOCUS_11760 1131 901 gene locus_tag LOCUS_11770 1131 901 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816044.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence606 >Feature sequence607 413 48 gene locus_tag LOCUS_11780 413 48 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_11780 <1214 415 gene locus_tag LOCUS_11790 <1214 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948740.1:FAD-dependent oxidoreductase >Feature sequence608 <1211 164 gene locus_tag LOCUS_11800 <1211 164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680887.1:ABC transporter ATP-binding protein >Feature sequence609 <1210 4 gene locus_tag LOCUS_11810 <1210 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986848.1:ribosome biogenesis GTPase Der >Feature sequence610 1059 16 gene locus_tag LOCUS_11820 1059 16 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence611 >Feature sequence612 >Feature sequence613 >Feature sequence614 <1 784 gene locus_tag LOCUS_11830 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003858869.1:maltodextrin phosphorylase MalP >Feature sequence615 <1 667 gene locus_tag LOCUS_11840 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545170.1:segregation/condensation protein A >Feature sequence616 <1 1108 gene locus_tag LOCUS_11850 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438014.1:ABC transporter ATP-binding protein >Feature sequence617 <1 897 gene locus_tag LOCUS_11860 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459514.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence618 >Feature sequence619 >Feature sequence620 <1 1003 gene locus_tag LOCUS_11870 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811141.1:DUF512 domain-containing protein >Feature sequence621 862 38 gene locus_tag LOCUS_11880 862 38 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence622 454 263 gene locus_tag LOCUS_11890 454 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 948 508 gene locus_tag LOCUS_11900 948 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 >Feature sequence623 <1191 679 gene locus_tag LOCUS_11910 <1191 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226473.1:undecaprenyl-diphosphate phosphatase >Feature sequence624 <1186 613 gene locus_tag LOCUS_11920 <1186 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964010.1:VanW family protein >Feature sequence625 >Feature sequence626 112 348 gene locus_tag LOCUS_11930 112 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 <1185 525 gene locus_tag LOCUS_11940 <1185 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291304.1:ATP-binding cassette domain-containing protein >Feature sequence627 225 905 gene locus_tag LOCUS_11950 gene sleB 225 905 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence628 360 932 gene locus_tag LOCUS_11960 360 932 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence629 <1 787 gene locus_tag LOCUS_11970 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029239.1:aspartate--tRNA ligase >Feature sequence630 <1177 51 gene locus_tag LOCUS_11980 <1177 51 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393020.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence631 >Feature sequence632 >Feature sequence633 <1 664 gene locus_tag LOCUS_11990 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000748873.1:peptide ABC transporter substrate-binding protein >Feature sequence634 1121 771 gene locus_tag LOCUS_12000 1121 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence635 >Feature sequence636 50 727 gene locus_tag LOCUS_12010 50 727 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence637 1106 654 gene locus_tag LOCUS_12020 1106 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence638 >Feature sequence639 <1 534 gene locus_tag LOCUS_12030 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067943.1:L,D-transpeptidase >Feature sequence640 >Feature sequence641 >Feature sequence642 1031 177 gene locus_tag LOCUS_12040 1031 177 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence643 1044 142 gene locus_tag LOCUS_12050 1044 142 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence644 >Feature sequence645 322 1095 gene locus_tag LOCUS_12060 gene sigG 322 1095 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774282.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence646 529 122 gene locus_tag LOCUS_12070 529 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1112 507 gene locus_tag LOCUS_12080 1112 507 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence647 >Feature sequence648 971 267 gene locus_tag LOCUS_12090 971 267 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence649 1026 10 gene locus_tag LOCUS_12100 1026 10 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence650 196 1077 gene locus_tag LOCUS_12110 196 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence651 <1125 98 gene locus_tag LOCUS_12120 <1125 98 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963484.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence652 >Feature sequence653 864 160 gene locus_tag LOCUS_12130 864 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence654 349 903 gene locus_tag LOCUS_12140 349 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence655 707 39 gene locus_tag LOCUS_12150 707 39 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence656 >Feature sequence657 >Feature sequence658 1010 45 gene locus_tag LOCUS_12160 1010 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence659 >Feature sequence660 <1097 410 gene locus_tag LOCUS_12170 <1097 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860977.1:glycogen synthase GlgA >Feature sequence661 <1 503 gene locus_tag LOCUS_12180 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000363049.1:AAA family ATPase <1096 573 gene locus_tag LOCUS_12190 <1096 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000008568.1:M3 family oligoendopeptidase >Feature sequence662 816 346 gene locus_tag LOCUS_12200 816 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence663 <1085 207 gene locus_tag LOCUS_12210 <1085 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681540.1:M20 family peptidase >Feature sequence664 42 434 gene locus_tag LOCUS_12220 42 434 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_12220 485 1024 gene locus_tag LOCUS_12230 485 1024 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence665 >Feature sequence666 >Feature sequence667 >Feature sequence668 <1076 199 gene locus_tag LOCUS_12240 <1076 199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530247.1:DMT family transporter >Feature sequence669 480 1 gene locus_tag LOCUS_12250 480 1 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence670 64 516 gene locus_tag LOCUS_12260 64 516 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence671 >Feature sequence672 36 1037 gene locus_tag LOCUS_12270 gene tsaD 36 1037 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence673 >Feature sequence674 >Feature sequence675 >Feature sequence676 947 321 gene locus_tag LOCUS_12280 947 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence677 >Feature sequence678 >Feature sequence679 <1 674 gene locus_tag LOCUS_12290 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359322.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence680 <1052 451 gene locus_tag LOCUS_12300 <1052 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358964.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase >Feature sequence681 214 705 gene locus_tag LOCUS_12310 214 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 883 791 gene locus_tag LOCUS_t00210 883 791 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence682 943 203 gene locus_tag LOCUS_12320 gene fabG 943 203 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence683 >Feature sequence684 >Feature sequence685 >Feature sequence686 6 803 gene locus_tag LOCUS_12330 gene mreC 6 803 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence687 <1038 394 gene locus_tag LOCUS_12340 <1038 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898600.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence688 >Feature sequence689 >Feature sequence690 1027 215 gene locus_tag LOCUS_12350 1027 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence691 165 905 gene locus_tag LOCUS_12360 165 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence692 696 256 gene locus_tag LOCUS_12370 696 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1024 707 gene locus_tag LOCUS_12380 1024 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence693 >Feature sequence694 249 467 gene locus_tag LOCUS_12390 249 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 558 791 gene locus_tag LOCUS_12400 558 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence695 >Feature sequence696 69 353 gene locus_tag LOCUS_12410 69 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence697 >Feature sequence698 <1016 458 gene locus_tag LOCUS_12420 <1016 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016558.1:amidohydrolase >Feature sequence699 >Feature sequence700 272 15 gene locus_tag LOCUS_12430 gene rpsO 272 15 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_12430 <1009 397 gene locus_tag LOCUS_12440 <1009 397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965112.1:bifunctional riboflavin kinase/FAD synthetase >Feature sequence701 3 962 gene locus_tag LOCUS_12450 3 962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_12450