>Feature sequence001 642 202 gene locus_tag LOCUS_00010 642 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1501 713 gene locus_tag LOCUS_00020 1501 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3232 1655 gene locus_tag LOCUS_00030 gene malQ 3232 1655 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_00030 3439 4629 gene locus_tag LOCUS_00040 3439 4629 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_00040 4626 5393 gene locus_tag LOCUS_00050 gene trmB 4626 5393 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355768.1 protein_id gnl|my_center|LOCUS_00050 5386 5565 gene locus_tag LOCUS_00060 5386 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5581 6666 gene locus_tag LOCUS_00070 5581 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6854 9520 gene locus_tag LOCUS_00080 6854 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9936 10679 gene locus_tag LOCUS_00090 gene azlC 9936 10679 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_00090 10676 11005 gene locus_tag LOCUS_00100 gene azlD 10676 11005 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_00100 12023 11016 gene locus_tag LOCUS_00110 gene ansA 12023 11016 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_00110 12191 13048 gene locus_tag LOCUS_00120 12191 13048 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_00120 13054 13740 gene locus_tag LOCUS_00130 13054 13740 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_00130 14817 13798 gene locus_tag LOCUS_00140 gene ydjG 14817 13798 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723698.1 protein_id gnl|my_center|LOCUS_00140 16521 14917 gene locus_tag LOCUS_00150 16521 14917 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_00150 17512 16646 gene locus_tag LOCUS_00160 17512 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17718 19100 gene locus_tag LOCUS_00170 17718 19100 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815222.1 protein_id gnl|my_center|LOCUS_00170 19728 19201 gene locus_tag LOCUS_00180 19728 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22133 20166 gene locus_tag LOCUS_00190 gene pulA 22133 20166 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_00190 24161 22404 gene locus_tag LOCUS_00200 24161 22404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 25207 24479 gene locus_tag LOCUS_00210 gene nagB 25207 24479 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_00210 25945 25409 gene locus_tag LOCUS_00220 25945 25409 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_00220 26357 27208 gene locus_tag LOCUS_00230 26357 27208 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_00230 27210 28157 gene locus_tag LOCUS_00240 27210 28157 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_00240 28665 30368 gene locus_tag LOCUS_00250 28665 30368 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 protein_id gnl|my_center|LOCUS_00250 30504 31439 gene locus_tag LOCUS_00260 30504 31439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_00260 31440 32543 gene locus_tag LOCUS_00270 31440 32543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974099.1 protein_id gnl|my_center|LOCUS_00270 32557 33654 gene locus_tag LOCUS_00280 32557 33654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_00280 33655 34587 gene locus_tag LOCUS_00290 33655 34587 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476523.1 protein_id gnl|my_center|LOCUS_00290 34901 34826 gene locus_tag LOCUS_t00010 34901 34826 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35632 35006 gene locus_tag LOCUS_00300 35632 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 protein_id gnl|my_center|LOCUS_00300 36291 35890 gene locus_tag LOCUS_00310 36291 35890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36801 38405 gene locus_tag LOCUS_00320 gene pckA 36801 38405 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_00320 38596 39258 gene locus_tag LOCUS_00330 38596 39258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39642 39334 gene locus_tag LOCUS_00340 gene trxA 39642 39334 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_00340 41206 39851 gene locus_tag LOCUS_00350 gene gntU 41206 39851 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_00350 43092 41305 gene locus_tag LOCUS_00360 43092 41305 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_00360 44276 43536 gene locus_tag LOCUS_00370 44276 43536 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_00370 44956 44315 gene locus_tag LOCUS_00380 44956 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45146 46060 gene locus_tag LOCUS_00390 gene prmA 45146 46060 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_00390 46092 46835 gene locus_tag LOCUS_00400 46092 46835 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370972.1 protein_id gnl|my_center|LOCUS_00400 48702 47071 gene locus_tag LOCUS_00410 gene ptsP 48702 47071 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_00410 49870 48689 gene locus_tag LOCUS_00420 49870 48689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 50050 50700 gene locus_tag LOCUS_00430 50050 50700 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_00430 50804 51826 gene locus_tag LOCUS_00440 50804 51826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52596 51877 gene locus_tag LOCUS_00450 52596 51877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54576 52777 gene locus_tag LOCUS_00460 54576 52777 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679150.1 protein_id gnl|my_center|LOCUS_00460 54858 56108 gene locus_tag LOCUS_00470 54858 56108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56145 57107 gene locus_tag LOCUS_00480 56145 57107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57136 57588 gene locus_tag LOCUS_00490 57136 57588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57715 59766 gene locus_tag LOCUS_00500 57715 59766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60785 59829 gene locus_tag LOCUS_00510 60785 59829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61671 60808 gene locus_tag LOCUS_00520 61671 60808 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_00520 62938 61664 gene locus_tag LOCUS_00530 gene aroA 62938 61664 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_00530 64048 63032 gene locus_tag LOCUS_00540 gene aroF 64048 63032 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_00540 64539 64075 gene locus_tag LOCUS_00550 gene aroQ 64539 64075 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_00550 65782 64520 gene locus_tag LOCUS_00560 65782 64520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66926 65784 gene locus_tag LOCUS_00570 gene aroC 66926 65784 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_00570 67973 66930 gene locus_tag LOCUS_00580 gene aroB 67973 66930 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_00580 69040 67970 gene locus_tag LOCUS_00590 69040 67970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69409 69230 gene locus_tag LOCUS_00600 69409 69230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70164 69412 gene locus_tag LOCUS_00610 70164 69412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70934 70206 gene locus_tag LOCUS_00620 70934 70206 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_00620 71153 71992 gene locus_tag LOCUS_00630 71153 71992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72024 73403 gene locus_tag LOCUS_00640 72024 73403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73443 74045 gene locus_tag LOCUS_00650 73443 74045 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_00650 74129 75514 gene locus_tag LOCUS_00660 74129 75514 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_00660 75561 76265 gene locus_tag LOCUS_00670 75561 76265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 76358 77764 gene locus_tag LOCUS_00680 76358 77764 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_00680 78414 77938 gene locus_tag LOCUS_00690 78414 77938 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_00690 78682 79086 gene locus_tag LOCUS_00700 78682 79086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 79884 79087 gene locus_tag LOCUS_00710 79884 79087 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_00710 81221 79863 gene locus_tag LOCUS_00720 81221 79863 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_00720 81981 81349 gene locus_tag LOCUS_00730 81981 81349 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388779.1 protein_id gnl|my_center|LOCUS_00730 82212 82299 gene locus_tag LOCUS_t00020 82212 82299 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 82334 82427 gene locus_tag LOCUS_t00030 82334 82427 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 83297 82551 gene locus_tag LOCUS_00740 83297 82551 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_00740 83544 84428 gene locus_tag LOCUS_00750 83544 84428 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_00750 85067 86641 gene locus_tag LOCUS_00760 85067 86641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 87118 86699 gene locus_tag LOCUS_00770 87118 86699 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_00770 87371 87180 gene locus_tag LOCUS_00780 87371 87180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 87808 87563 gene locus_tag LOCUS_00790 87808 87563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87974 87899 gene locus_tag LOCUS_t00040 87974 87899 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 88187 88720 gene locus_tag LOCUS_00800 gene ruvC 88187 88720 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_00800 88841 89452 gene locus_tag LOCUS_00810 gene ruvA 88841 89452 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174059.1 protein_id gnl|my_center|LOCUS_00810 89456 90511 gene locus_tag LOCUS_00820 gene ruvB 89456 90511 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_00820 90558 91433 gene locus_tag LOCUS_00830 90558 91433 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00830 91545 92384 gene locus_tag LOCUS_00840 91545 92384 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_00840 92399 93313 gene locus_tag LOCUS_00850 92399 93313 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_00850 93313 94128 gene locus_tag LOCUS_00860 93313 94128 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966381.1 protein_id gnl|my_center|LOCUS_00860 94203 94964 gene locus_tag LOCUS_00870 gene truA 94203 94964 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_00870 94961 96181 gene locus_tag LOCUS_00880 94961 96181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 96242 96937 gene locus_tag LOCUS_00890 96242 96937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 96959 99268 gene locus_tag LOCUS_00900 96959 99268 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_00900 99426 99623 gene locus_tag LOCUS_00910 99426 99623 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_00910 99627 100070 gene locus_tag LOCUS_00920 99627 100070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 >Feature sequence002 1 645 gene locus_tag LOCUS_00930 1 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 772 1440 gene locus_tag LOCUS_00940 772 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2603 1554 gene locus_tag LOCUS_00950 2603 1554 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_00950 2920 2657 gene locus_tag LOCUS_00960 2920 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 3547 3296 gene locus_tag LOCUS_00970 3547 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 3667 4428 gene locus_tag LOCUS_00980 3667 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5557 4550 gene locus_tag LOCUS_00990 5557 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 6025 5711 gene locus_tag LOCUS_01000 6025 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6330 6022 gene locus_tag LOCUS_01010 6330 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 6709 6344 gene locus_tag LOCUS_01020 6709 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 6934 6761 gene locus_tag LOCUS_01030 6934 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7095 6931 gene locus_tag LOCUS_01040 7095 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 7256 7092 gene locus_tag LOCUS_01050 7256 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 8962 7253 gene locus_tag LOCUS_01060 8962 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10094 8874 gene locus_tag LOCUS_01070 10094 8874 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_01070 10800 10414 gene locus_tag LOCUS_01080 10800 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 11074 10814 gene locus_tag LOCUS_01090 11074 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 11292 11074 gene locus_tag LOCUS_01100 11292 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 12448 11306 gene locus_tag LOCUS_01110 12448 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 12861 12460 gene locus_tag LOCUS_01120 12861 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 13208 12864 gene locus_tag LOCUS_01130 13208 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 13994 13245 gene locus_tag LOCUS_01140 13994 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 14660 14013 gene locus_tag LOCUS_01150 14660 14013 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024831595.1 protein_id gnl|my_center|LOCUS_01150 16051 14660 gene locus_tag LOCUS_01160 16051 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 16341 16066 gene locus_tag LOCUS_01170 16341 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 16934 16356 gene locus_tag LOCUS_01180 16934 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 17336 16950 gene locus_tag LOCUS_01190 17336 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 18256 17336 gene locus_tag LOCUS_01200 18256 17336 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460133.1 protein_id gnl|my_center|LOCUS_01200 18486 18262 gene locus_tag LOCUS_01210 18486 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 20512 18458 gene locus_tag LOCUS_01220 20512 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 21032 20622 gene locus_tag LOCUS_01230 21032 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 21593 21087 gene locus_tag LOCUS_01240 21593 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 23110 21593 gene locus_tag LOCUS_01250 23110 21593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_01250 23777 23160 gene locus_tag LOCUS_01260 23777 23160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014487.1 protein_id gnl|my_center|LOCUS_01260 24114 23791 gene locus_tag LOCUS_01270 24114 23791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 24560 24114 gene locus_tag LOCUS_01280 24560 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 25656 24583 gene locus_tag LOCUS_01290 25656 24583 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975797.1 protein_id gnl|my_center|LOCUS_01290 26082 25675 gene locus_tag LOCUS_01300 26082 25675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 27320 26082 gene locus_tag LOCUS_01310 27320 26082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 28965 27307 gene locus_tag LOCUS_01320 28965 27307 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 protein_id gnl|my_center|LOCUS_01320 29326 29063 gene locus_tag LOCUS_01330 29326 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 31267 29339 gene locus_tag LOCUS_01340 31267 29339 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_01340 31823 31251 gene locus_tag LOCUS_01350 31823 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 32774 32115 gene locus_tag LOCUS_01360 32774 32115 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149545272.1 protein_id gnl|my_center|LOCUS_01360 33464 32979 gene locus_tag LOCUS_01370 33464 32979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 34865 33477 gene locus_tag LOCUS_01380 34865 33477 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_01380 35121 34852 gene locus_tag LOCUS_01390 35121 34852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 35348 35118 gene locus_tag LOCUS_01400 35348 35118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 36158 35361 gene locus_tag LOCUS_01410 36158 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 36331 36155 gene locus_tag LOCUS_01420 36331 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 37100 36387 gene locus_tag LOCUS_01430 37100 36387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922062.1 protein_id gnl|my_center|LOCUS_01430 37493 37119 gene locus_tag LOCUS_01440 37493 37119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 38338 37490 gene locus_tag LOCUS_01450 38338 37490 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_01450 38627 38325 gene locus_tag LOCUS_01460 38627 38325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 38838 38587 gene locus_tag LOCUS_01470 38838 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 39406 38783 gene locus_tag LOCUS_01480 39406 38783 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095944.1 protein_id gnl|my_center|LOCUS_01480 40017 39403 gene locus_tag LOCUS_01490 40017 39403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 40522 40010 gene locus_tag LOCUS_01500 40522 40010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 41521 40532 gene locus_tag LOCUS_01510 41521 40532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 42293 41424 gene locus_tag LOCUS_01520 42293 41424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 42802 42368 gene locus_tag LOCUS_01530 gene ssb 42802 42368 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391677.1 protein_id gnl|my_center|LOCUS_01530 43614 42802 gene locus_tag LOCUS_01540 43614 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 44268 43627 gene locus_tag LOCUS_01550 44268 43627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 44935 44261 gene locus_tag LOCUS_01560 44935 44261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 45223 44948 gene locus_tag LOCUS_01570 45223 44948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 45939 45229 gene locus_tag LOCUS_01580 45939 45229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 46621 45932 gene locus_tag LOCUS_01590 46621 45932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 46797 46618 gene locus_tag LOCUS_01600 46797 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 47651 46794 gene locus_tag LOCUS_01610 47651 46794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 47917 47639 gene locus_tag LOCUS_01620 47917 47639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 48455 47910 gene locus_tag LOCUS_01630 48455 47910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 49057 48473 gene locus_tag LOCUS_01640 49057 48473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 49522 49259 gene locus_tag LOCUS_01650 49522 49259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 49678 49753 gene locus_tag LOCUS_t00050 49678 49753 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50704 49853 gene locus_tag LOCUS_01660 50704 49853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 51413 50688 gene locus_tag LOCUS_01670 51413 50688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 51946 51425 gene locus_tag LOCUS_01680 51946 51425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 52478 51933 gene locus_tag LOCUS_01690 52478 51933 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764719.1 protein_id gnl|my_center|LOCUS_01690 52652 53614 gene locus_tag LOCUS_01700 52652 53614 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_01700 54567 53668 gene locus_tag LOCUS_01710 54567 53668 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_01710 55215 54583 gene locus_tag LOCUS_01720 gene rsxA 55215 54583 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_01720 55882 55217 gene locus_tag LOCUS_01730 55882 55217 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_01730 56454 55900 gene locus_tag LOCUS_01740 56454 55900 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_01740 <57196 56451 gene locus_tag LOCUS_01750 <57196 56451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761244.1:RnfABCDGE type electron transport complex subunit D >Feature sequence003 639 833 gene locus_tag LOCUS_01760 639 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 879 1100 gene locus_tag LOCUS_01770 879 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 1216 1986 gene locus_tag LOCUS_01780 1216 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2067 2492 gene locus_tag LOCUS_01790 2067 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 2476 2964 gene locus_tag LOCUS_01800 2476 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3846 4352 gene locus_tag LOCUS_01810 3846 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4740 4973 gene locus_tag LOCUS_01820 4740 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5024 5503 gene locus_tag LOCUS_01830 5024 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5879 6106 gene locus_tag LOCUS_01840 5879 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6193 6867 gene locus_tag LOCUS_01850 6193 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7100 7199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7217 7822 gene locus_tag LOCUS_01860 7217 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7937 8302 gene locus_tag LOCUS_01870 7937 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8305 9801 gene locus_tag LOCUS_01880 8305 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 9944 9865 gene locus_tag LOCUS_t00060 9944 9865 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10319 11365 gene locus_tag LOCUS_01890 gene spoIID 10319 11365 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_01890 11492 13906 gene locus_tag LOCUS_01900 11492 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 13884 14735 gene locus_tag LOCUS_01910 13884 14735 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_01910 14969 15856 gene locus_tag LOCUS_01920 gene rfbA 14969 15856 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_01920 15879 16796 gene locus_tag LOCUS_01930 gene rfbD 15879 16796 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_01930 16841 17311 gene locus_tag LOCUS_01940 16841 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 17332 18396 gene locus_tag LOCUS_01950 gene rfbB 17332 18396 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_01950 19174 18575 gene locus_tag LOCUS_01960 19174 18575 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_01960 19496 20083 gene locus_tag LOCUS_01970 19496 20083 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_01970 20643 20858 gene locus_tag LOCUS_01980 20643 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 20911 21132 gene locus_tag LOCUS_01990 20911 21132 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_01990 21163 23349 gene locus_tag LOCUS_02000 gene feoB 21163 23349 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_02000 23374 23529 gene locus_tag LOCUS_02010 23374 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 23663 24058 gene locus_tag LOCUS_02020 23663 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 25346 24279 gene locus_tag LOCUS_02030 25346 24279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 27107 25380 gene locus_tag LOCUS_02040 gene lcfA 27107 25380 CDS product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 protein_id gnl|my_center|LOCUS_02040 28446 27130 gene locus_tag LOCUS_02050 28446 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 29425 28451 gene locus_tag LOCUS_02060 29425 28451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 31378 29456 gene locus_tag LOCUS_02070 31378 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 33469 31514 gene locus_tag LOCUS_02080 gene glgB 33469 31514 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_02080 33706 35061 gene locus_tag LOCUS_02090 33706 35061 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_02090 35238 35756 gene locus_tag LOCUS_02100 35238 35756 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262516.1 protein_id gnl|my_center|LOCUS_02100 35853 36404 gene locus_tag LOCUS_02110 35853 36404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 36911 37051 gene locus_tag LOCUS_02120 36911 37051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 37086 40121 gene locus_tag LOCUS_02130 37086 40121 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_02130 40183 41121 gene locus_tag LOCUS_02140 40183 41121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 41176 42300 gene locus_tag LOCUS_02150 41176 42300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_02150 42293 43318 gene locus_tag LOCUS_02160 42293 43318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 44564 43542 gene locus_tag LOCUS_02170 44564 43542 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_02170 44835 44921 gene locus_tag LOCUS_t00070 44835 44921 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45090 45341 gene locus_tag LOCUS_02180 45090 45341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 45847 45380 gene locus_tag LOCUS_02190 45847 45380 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_02190 45965 46504 gene locus_tag LOCUS_02200 45965 46504 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_02200 46504 47256 gene locus_tag LOCUS_02210 46504 47256 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_02210 48596 47469 gene locus_tag LOCUS_02220 48596 47469 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973962.1 protein_id gnl|my_center|LOCUS_02220 49536 48607 gene locus_tag LOCUS_02230 49536 48607 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_02230 49967 49626 gene locus_tag LOCUS_02240 49967 49626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 50607 50290 gene locus_tag LOCUS_02250 gene rhaM 50607 50290 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence004 722 1810 gene locus_tag LOCUS_02260 722 1810 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_02260 2308 2081 gene locus_tag LOCUS_02270 2308 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3291 2323 gene locus_tag LOCUS_02280 gene draG 3291 2323 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943427.1 protein_id gnl|my_center|LOCUS_02280 3605 3288 gene locus_tag LOCUS_02290 3605 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4034 3618 gene locus_tag LOCUS_02300 4034 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4270 4031 gene locus_tag LOCUS_02310 4270 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4529 4365 gene locus_tag LOCUS_02320 4529 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4778 4533 gene locus_tag LOCUS_02330 4778 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4994 4782 gene locus_tag LOCUS_02340 4994 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5229 5008 gene locus_tag LOCUS_02350 5229 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5466 5233 gene locus_tag LOCUS_02360 5466 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5735 5484 gene locus_tag LOCUS_02370 5735 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6329 5922 gene locus_tag LOCUS_02380 6329 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6977 6348 gene locus_tag LOCUS_02390 6977 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7475 6990 gene locus_tag LOCUS_02400 7475 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7737 7555 gene locus_tag LOCUS_02410 7737 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 7926 7759 gene locus_tag LOCUS_02420 7926 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8145 7939 gene locus_tag LOCUS_02430 8145 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9417 8158 gene locus_tag LOCUS_02440 9417 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10667 9438 gene locus_tag LOCUS_02450 10667 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 10966 10814 gene locus_tag LOCUS_02460 10966 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 11584 11009 gene locus_tag LOCUS_02470 11584 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 11973 11587 gene locus_tag LOCUS_02480 11973 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 12423 11974 gene locus_tag LOCUS_02490 12423 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 13313 12444 gene locus_tag LOCUS_02500 13313 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 14459 13332 gene locus_tag LOCUS_02510 14459 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 15229 14456 gene locus_tag LOCUS_02520 15229 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 16398 15226 gene locus_tag LOCUS_02530 16398 15226 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047786.1 protein_id gnl|my_center|LOCUS_02530 16872 16411 gene locus_tag LOCUS_02540 16872 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 17427 16897 gene locus_tag LOCUS_02550 17427 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 18687 17443 gene locus_tag LOCUS_02560 18687 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 19375 18698 gene locus_tag LOCUS_02570 19375 18698 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232674.1 protein_id gnl|my_center|LOCUS_02570 22975 19391 gene locus_tag LOCUS_02580 22975 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 23656 23138 gene locus_tag LOCUS_02590 23656 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 24219 23764 gene locus_tag LOCUS_02600 24219 23764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 25644 24235 gene locus_tag LOCUS_02610 25644 24235 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047796.1 protein_id gnl|my_center|LOCUS_02610 25852 25646 gene locus_tag LOCUS_02620 25852 25646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26749 25865 gene locus_tag LOCUS_02630 26749 25865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 27020 26739 gene locus_tag LOCUS_02640 27020 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 27461 27036 gene locus_tag LOCUS_02650 27461 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 27801 27451 gene locus_tag LOCUS_02660 27801 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 28210 27788 gene locus_tag LOCUS_02670 28210 27788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 28648 28211 gene locus_tag LOCUS_02680 28648 28211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 29687 28659 gene locus_tag LOCUS_02690 29687 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 30104 29706 gene locus_tag LOCUS_02700 30104 29706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 31400 30123 gene locus_tag LOCUS_02710 31400 30123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 31956 31480 gene locus_tag LOCUS_02720 31956 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 32429 32061 gene locus_tag LOCUS_02730 32429 32061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 35854 32426 gene locus_tag LOCUS_02740 35854 32426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 37265 35856 gene locus_tag LOCUS_02750 37265 35856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 38774 37284 gene locus_tag LOCUS_02760 gene terL 38774 37284 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_02760 39327 38740 gene locus_tag LOCUS_02770 39327 38740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 41092 39389 gene locus_tag LOCUS_02780 41092 39389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 41774 41169 gene locus_tag LOCUS_02790 41774 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 42757 41771 gene locus_tag LOCUS_02800 42757 41771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 43215 42754 gene locus_tag LOCUS_02810 43215 42754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 43458 43216 gene locus_tag LOCUS_02820 43458 43216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 43833 43462 gene locus_tag LOCUS_02830 43833 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 44090 43848 gene locus_tag LOCUS_02840 44090 43848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 44436 44239 gene locus_tag LOCUS_02850 44436 44239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 44606 44433 gene locus_tag LOCUS_02860 44606 44433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 45517 44603 gene locus_tag LOCUS_02870 45517 44603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 46057 45530 gene locus_tag LOCUS_02880 46057 45530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 46532 46044 gene locus_tag LOCUS_02890 46532 46044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 46869 46525 gene locus_tag LOCUS_02900 46869 46525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 47084 46866 gene locus_tag LOCUS_02910 47084 46866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 47816 47106 gene locus_tag LOCUS_02920 47816 47106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 48087 47827 gene locus_tag LOCUS_02930 48087 47827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 48677 48084 gene locus_tag LOCUS_02940 48677 48084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence005 146 826 gene locus_tag LOCUS_02950 146 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1778 915 gene locus_tag LOCUS_02960 gene fba 1778 915 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_02960 2569 3375 gene locus_tag LOCUS_02970 gene rlmB 2569 3375 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_02970 3418 6132 gene locus_tag LOCUS_02980 3418 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7584 6199 gene locus_tag LOCUS_02990 7584 6199 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_02990 9153 7843 gene locus_tag LOCUS_03000 gene thiC 9153 7843 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_03000 10124 9486 gene locus_tag LOCUS_03010 gene thiE 10124 9486 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_03010 10932 10111 gene locus_tag LOCUS_03020 gene thiM 10932 10111 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_03020 11463 10948 gene locus_tag LOCUS_03030 11463 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 14464 12029 gene locus_tag LOCUS_03040 14464 12029 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_03040 14993 16000 gene locus_tag LOCUS_03050 14993 16000 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_03050 16079 17524 gene locus_tag LOCUS_03060 16079 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 17622 18599 gene locus_tag LOCUS_03070 17622 18599 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_03070 18602 19468 gene locus_tag LOCUS_03080 gene araQ 18602 19468 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_03080 19956 19546 gene locus_tag LOCUS_03090 19956 19546 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_03090 20392 19970 gene locus_tag LOCUS_03100 20392 19970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 20635 21405 gene locus_tag LOCUS_03110 20635 21405 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_03110 21399 21983 gene locus_tag LOCUS_03120 21399 21983 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_03120 23365 22148 gene locus_tag LOCUS_03130 gene rodA 23365 22148 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_03130 23612 24823 gene locus_tag LOCUS_03140 23612 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 24909 25334 gene locus_tag LOCUS_03150 gene tsaE 24909 25334 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_03150 25331 26041 gene locus_tag LOCUS_03160 25331 26041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 26083 26529 gene locus_tag LOCUS_03170 gene rpiB 26083 26529 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_03170 26671 27297 gene locus_tag LOCUS_03180 gene upp 26671 27297 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966163.1 protein_id gnl|my_center|LOCUS_03180 28683 27355 gene locus_tag LOCUS_03190 28683 27355 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_03190 29632 28721 gene locus_tag LOCUS_03200 gene cysK 29632 28721 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_03200 29859 30242 gene locus_tag LOCUS_03210 29859 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 30269 31624 gene locus_tag LOCUS_03220 gene ffh 30269 31624 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_03220 31694 31936 gene locus_tag LOCUS_03230 gene rpsP 31694 31936 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_03230 31954 32187 gene locus_tag LOCUS_03240 31954 32187 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_03240 32410 32946 gene locus_tag LOCUS_03250 gene rimM 32410 32946 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_03250 32950 34197 gene locus_tag LOCUS_03260 32950 34197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 34480 34743 gene locus_tag LOCUS_03270 34480 34743 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_03270 34870 36723 gene locus_tag LOCUS_03280 gene uvrC 34870 36723 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_03280 37891 36785 gene locus_tag LOCUS_03290 37891 36785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 38212 37895 gene locus_tag LOCUS_03300 38212 37895 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_03300 39269 38433 gene locus_tag LOCUS_03310 39269 38433 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_03310 40118 39318 gene locus_tag LOCUS_03320 40118 39318 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_03320 40820 40137 gene locus_tag LOCUS_03330 40820 40137 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_03330 41182 42216 gene locus_tag LOCUS_03340 41182 42216 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_03340 42443 43240 gene locus_tag LOCUS_03350 42443 43240 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_03350 43283 44539 gene locus_tag LOCUS_03360 43283 44539 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_03360 45065 46354 gene locus_tag LOCUS_03370 45065 46354 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_03370 47146 46532 gene locus_tag LOCUS_03380 47146 46532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 <47970 47318 gene locus_tag LOCUS_03390 <47970 47318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272679.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence006 1421 222 gene locus_tag LOCUS_03400 1421 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2810 1509 gene locus_tag LOCUS_03410 2810 1509 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_03410 3046 4536 gene locus_tag LOCUS_03420 3046 4536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775580.1 protein_id gnl|my_center|LOCUS_03420 4624 6831 gene locus_tag LOCUS_03430 4624 6831 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_03430 6838 8652 gene locus_tag LOCUS_03440 6838 8652 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_03440 8656 9504 gene locus_tag LOCUS_03450 8656 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 12230 9615 gene locus_tag LOCUS_03460 12230 9615 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_03460 13684 12515 gene locus_tag LOCUS_03470 13684 12515 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359496.1 protein_id gnl|my_center|LOCUS_03470 15150 13777 gene locus_tag LOCUS_03480 15150 13777 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393182.1 protein_id gnl|my_center|LOCUS_03480 16476 15175 gene locus_tag LOCUS_03490 16476 15175 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355306.1 protein_id gnl|my_center|LOCUS_03490 17006 16497 gene locus_tag LOCUS_03500 17006 16497 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 protein_id gnl|my_center|LOCUS_03500 18056 17025 gene locus_tag LOCUS_03510 18056 17025 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645961.1 protein_id gnl|my_center|LOCUS_03510 18397 19308 gene locus_tag LOCUS_03520 18397 19308 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_03520 22674 19660 gene locus_tag LOCUS_03530 22674 19660 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068233.1 protein_id gnl|my_center|LOCUS_03530 24459 22771 gene locus_tag LOCUS_03540 24459 22771 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107726402.1 protein_id gnl|my_center|LOCUS_03540 25619 24459 gene locus_tag LOCUS_03550 25619 24459 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596395.1 protein_id gnl|my_center|LOCUS_03550 27391 25625 gene locus_tag LOCUS_03560 gene uidA 27391 25625 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775174.1 protein_id gnl|my_center|LOCUS_03560 28355 27495 gene locus_tag LOCUS_03570 28355 27495 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_03570 29298 28372 gene locus_tag LOCUS_03580 29298 28372 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_03580 30794 29475 gene locus_tag LOCUS_03590 30794 29475 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_03590 30697 30951 gene locus_tag LOCUS_03600 30697 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 31139 32956 gene locus_tag LOCUS_03610 31139 32956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 32931 34193 gene locus_tag LOCUS_03620 32931 34193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 34208 36004 gene locus_tag LOCUS_03630 34208 36004 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_03630 36016 36813 gene locus_tag LOCUS_03640 36016 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 protein_id gnl|my_center|LOCUS_03640 36815 38218 gene locus_tag LOCUS_03650 36815 38218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 39169 40503 gene locus_tag LOCUS_03660 39169 40503 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_03660 41369 40617 gene locus_tag LOCUS_03670 41369 40617 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_03670 41573 42265 gene locus_tag LOCUS_03680 41573 42265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence007 1389 1150 gene locus_tag LOCUS_03690 1389 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1752 1432 gene locus_tag LOCUS_03700 1752 1432 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989608.1 protein_id gnl|my_center|LOCUS_03700 2884 1826 gene locus_tag LOCUS_03710 2884 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3107 2862 gene locus_tag LOCUS_03720 3107 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3764 3543 gene locus_tag LOCUS_03730 3764 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4012 3782 gene locus_tag LOCUS_03740 4012 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4239 4574 gene locus_tag LOCUS_03750 4239 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4623 4871 gene locus_tag LOCUS_03760 4623 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5028 5816 gene locus_tag LOCUS_03770 5028 5816 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_03770 6404 6063 gene locus_tag LOCUS_03780 6404 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6868 7083 gene locus_tag LOCUS_03790 6868 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7083 7439 gene locus_tag LOCUS_03800 7083 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7904 8716 gene locus_tag LOCUS_03810 7904 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 8998 10515 gene locus_tag LOCUS_03820 8998 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10644 12188 gene locus_tag LOCUS_03830 10644 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 12506 13816 gene locus_tag LOCUS_03840 gene celB 12506 13816 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_03840 13875 14174 gene locus_tag LOCUS_03850 13875 14174 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 protein_id gnl|my_center|LOCUS_03850 14178 14561 gene locus_tag LOCUS_03860 14178 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14566 15333 gene locus_tag LOCUS_03870 14566 15333 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644021.1 protein_id gnl|my_center|LOCUS_03870 15351 16766 gene locus_tag LOCUS_03880 15351 16766 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_03880 16808 18199 gene locus_tag LOCUS_03890 16808 18199 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379465.1 protein_id gnl|my_center|LOCUS_03890 18285 19478 gene locus_tag LOCUS_03900 18285 19478 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232783.1 protein_id gnl|my_center|LOCUS_03900 19585 20937 gene locus_tag LOCUS_03910 19585 20937 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_03910 21349 21179 gene locus_tag LOCUS_03920 21349 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 21473 21336 gene locus_tag LOCUS_03930 21473 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21952 21482 gene locus_tag LOCUS_03940 21952 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 22941 22012 gene locus_tag LOCUS_03950 gene spo0J 22941 22012 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_03950 23677 22898 gene locus_tag LOCUS_03960 23677 22898 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_03960 24596 23730 gene locus_tag LOCUS_03970 24596 23730 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_03970 25516 24809 gene locus_tag LOCUS_03980 25516 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068694.1 protein_id gnl|my_center|LOCUS_03980 26921 25506 gene locus_tag LOCUS_03990 26921 25506 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_03990 27780 27157 gene locus_tag LOCUS_04000 27780 27157 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027096094.1 protein_id gnl|my_center|LOCUS_04000 28788 28351 gene locus_tag LOCUS_04010 28788 28351 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_04010 29621 28785 gene locus_tag LOCUS_04020 29621 28785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 30296 29661 gene locus_tag LOCUS_04030 30296 29661 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939481.1 protein_id gnl|my_center|LOCUS_04030 30573 30947 gene locus_tag LOCUS_04040 30573 30947 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_04040 30976 32310 gene locus_tag LOCUS_04050 30976 32310 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927762.1 protein_id gnl|my_center|LOCUS_04050 32361 33557 gene locus_tag LOCUS_04060 32361 33557 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_04060 33789 34973 gene locus_tag LOCUS_04070 33789 34973 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_04070 35029 36216 gene locus_tag LOCUS_04080 35029 36216 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_04080 36277 37488 gene locus_tag LOCUS_04090 36277 37488 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_04090 38248 37592 gene locus_tag LOCUS_04100 38248 37592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 39033 38278 gene locus_tag LOCUS_04110 gene aroD 39033 38278 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230523.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence008 105 806 gene locus_tag LOCUS_04120 105 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 803 1840 gene locus_tag LOCUS_04130 gene selD 803 1840 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_04130 1855 2469 gene locus_tag LOCUS_04140 gene yedF 1855 2469 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_04140 2466 3614 gene locus_tag LOCUS_04150 2466 3614 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681891.1 protein_id gnl|my_center|LOCUS_04150 3605 3835 gene locus_tag LOCUS_04160 3605 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3855 4910 gene locus_tag LOCUS_04170 3855 4910 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_04170 4907 5722 gene locus_tag LOCUS_04180 gene yqeB 4907 5722 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_04180 5993 5799 gene locus_tag LOCUS_04190 5993 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 6657 6154 gene locus_tag LOCUS_04200 6657 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6971 6654 gene locus_tag LOCUS_04210 6971 6654 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194196.1 protein_id gnl|my_center|LOCUS_04210 7224 8219 gene locus_tag LOCUS_04220 7224 8219 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04220 8243 8734 gene locus_tag LOCUS_04230 gene ybeY 8243 8734 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_04230 8770 9705 gene locus_tag LOCUS_04240 gene era 8770 9705 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_04240 9809 9973 gene locus_tag LOCUS_04250 9809 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9924 10673 gene locus_tag LOCUS_04260 gene recO 9924 10673 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_04260 10689 13103 gene locus_tag LOCUS_04270 10689 13103 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_04270 13420 14076 gene locus_tag LOCUS_04280 13420 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 15925 14717 gene locus_tag LOCUS_04290 15925 14717 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_04290 17344 15941 gene locus_tag LOCUS_04300 gene radA 17344 15941 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_04300 18165 17419 gene locus_tag LOCUS_04310 18165 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 18378 18208 gene locus_tag LOCUS_04320 18378 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 18422 18521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19200 18883 gene locus_tag LOCUS_04330 19200 18883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 20420 19275 gene locus_tag LOCUS_04340 gene tgt 20420 19275 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_04340 21627 20599 gene locus_tag LOCUS_04350 gene queA 21627 20599 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_04350 21794 22876 gene locus_tag LOCUS_04360 gene asd 21794 22876 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_04360 22921 23814 gene locus_tag LOCUS_04370 gene dapA 22921 23814 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_04370 23888 24646 gene locus_tag LOCUS_04380 gene dapB 23888 24646 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_04380 24688 25980 gene locus_tag LOCUS_04390 24688 25980 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_04390 26036 26503 gene locus_tag LOCUS_04400 26036 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 26620 27189 gene locus_tag LOCUS_04410 26620 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 28467 27247 gene locus_tag LOCUS_04420 gene tyrS 28467 27247 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04420 30527 28857 gene locus_tag LOCUS_04430 gene recN 30527 28857 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_04430 31034 30546 gene locus_tag LOCUS_04440 31034 30546 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_04440 31906 31055 gene locus_tag LOCUS_04450 31906 31055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 32741 31938 gene locus_tag LOCUS_04460 32741 31938 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_04460 34621 32738 gene locus_tag LOCUS_04470 gene dxs 34621 32738 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_04470 35137 34670 gene locus_tag LOCUS_04480 35137 34670 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_04480 36037 35156 gene locus_tag LOCUS_04490 36037 35156 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_04490 36267 36037 gene locus_tag LOCUS_04500 36267 36037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 <37187 36245 gene locus_tag LOCUS_04510 <37187 36245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415249.1:exodeoxyribonuclease VII large subunit >Feature sequence009 1009 155 gene locus_tag LOCUS_04520 1009 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1814 996 gene locus_tag LOCUS_04530 1814 996 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774996.1 protein_id gnl|my_center|LOCUS_04530 3553 1922 gene locus_tag LOCUS_04540 3553 1922 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_04540 4074 3634 gene locus_tag LOCUS_04550 4074 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5666 4182 gene locus_tag LOCUS_04560 5666 4182 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_04560 11213 5817 gene locus_tag LOCUS_04570 11213 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 11826 11236 gene locus_tag LOCUS_04580 gene lepB 11826 11236 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774995.1 protein_id gnl|my_center|LOCUS_04580 12362 11823 gene locus_tag LOCUS_04590 12362 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 13000 12767 gene locus_tag LOCUS_04600 13000 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13505 13047 gene locus_tag LOCUS_04610 13505 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 13915 13988 gene locus_tag LOCUS_t00080 13915 13988 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14730 14029 gene locus_tag LOCUS_04620 14730 14029 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_04620 15205 16002 gene locus_tag LOCUS_04630 15205 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 16982 16050 gene locus_tag LOCUS_04640 16982 16050 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_04640 17252 17506 gene locus_tag LOCUS_04650 17252 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 17667 18305 gene locus_tag LOCUS_04660 17667 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 18720 18875 gene locus_tag LOCUS_04670 18720 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18985 19761 gene locus_tag LOCUS_04680 18985 19761 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_04680 20209 23148 gene locus_tag LOCUS_04690 20209 23148 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_04690 23238 24554 gene locus_tag LOCUS_04700 23238 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04700 24793 25698 gene locus_tag LOCUS_04710 24793 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 25875 28457 gene locus_tag LOCUS_04720 25875 28457 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_04720 28608 29507 gene locus_tag LOCUS_04730 28608 29507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 30522 29788 gene locus_tag LOCUS_04740 30522 29788 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_04740 31552 30545 gene locus_tag LOCUS_04750 gene tsaD 31552 30545 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_04750 34127 31554 gene locus_tag LOCUS_04760 gene polA 34127 31554 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 protein_id gnl|my_center|LOCUS_04760 34595 34407 gene locus_tag LOCUS_04770 34595 34407 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966884.1 protein_id gnl|my_center|LOCUS_04770 34707 35048 gene locus_tag LOCUS_04780 34707 35048 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_04780 35151 36059 gene locus_tag LOCUS_04790 35151 36059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence010 367 1554 gene locus_tag LOCUS_04800 367 1554 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_04800 1567 2451 gene locus_tag LOCUS_04810 gene ispE 1567 2451 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_04810 2511 2717 gene locus_tag LOCUS_04820 2511 2717 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_04820 3447 2803 gene locus_tag LOCUS_04830 3447 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4085 3771 gene locus_tag LOCUS_04840 4085 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4334 5056 gene locus_tag LOCUS_04850 4334 5056 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641564.1 protein_id gnl|my_center|LOCUS_04850 5536 5105 gene locus_tag LOCUS_04860 gene ruvX 5536 5105 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_04860 5675 9037 gene locus_tag LOCUS_04870 gene addB 5675 9037 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_04870 9034 12720 gene locus_tag LOCUS_04880 gene addA 9034 12720 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_04880 13269 13847 gene locus_tag LOCUS_04890 gene infC 13269 13847 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031267356.1 protein_id gnl|my_center|LOCUS_04890 13866 14069 gene locus_tag LOCUS_04900 gene rpmI 13866 14069 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_04900 14125 14475 gene locus_tag LOCUS_04910 gene rplT 14125 14475 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_04910 14652 15434 gene locus_tag LOCUS_04920 14652 15434 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_04920 15431 16558 gene locus_tag LOCUS_04930 gene dprA 15431 16558 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_04930 16670 18754 gene locus_tag LOCUS_04940 gene topA 16670 18754 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 protein_id gnl|my_center|LOCUS_04940 18876 20252 gene locus_tag LOCUS_04950 gene trmFO 18876 20252 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_04950 20282 21295 gene locus_tag LOCUS_04960 gene plsX 20282 21295 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_04960 21495 22169 gene locus_tag LOCUS_04970 gene rnc 21495 22169 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_04970 22170 25727 gene locus_tag LOCUS_04980 gene smc 22170 25727 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_04980 25763 26701 gene locus_tag LOCUS_04990 gene ftsY 25763 26701 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_04990 26845 27480 gene locus_tag LOCUS_05000 gene rdgB 26845 27480 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_05000 27553 27849 gene locus_tag LOCUS_05010 gene yhbY 27553 27849 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935148.1 protein_id gnl|my_center|LOCUS_05010 27851 28489 gene locus_tag LOCUS_05020 gene nadD 27851 28489 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922150.1 protein_id gnl|my_center|LOCUS_05020 28490 29068 gene locus_tag LOCUS_05030 gene yqeK 28490 29068 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_05030 29216 30589 gene locus_tag LOCUS_05040 29216 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 30651 31034 gene locus_tag LOCUS_05050 gene rsfS 30651 31034 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_05050 31231 33780 gene locus_tag LOCUS_05060 gene leuS 31231 33780 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_05060 34002 34178 gene locus_tag LOCUS_05070 34002 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 34314 34817 gene locus_tag LOCUS_05080 34314 34817 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_05080 34814 35683 gene locus_tag LOCUS_05090 34814 35683 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence011 4414 2282 gene locus_tag LOCUS_05100 4414 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5760 4411 gene locus_tag LOCUS_05110 5760 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7363 5768 gene locus_tag LOCUS_05120 7363 5768 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_05120 8689 7385 gene locus_tag LOCUS_05130 8689 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9588 8686 gene locus_tag LOCUS_05140 gene cdaA 9588 8686 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_05140 10769 9603 gene locus_tag LOCUS_05150 10769 9603 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_05150 12820 11138 gene locus_tag LOCUS_05160 12820 11138 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_05160 13293 12946 gene locus_tag LOCUS_05170 13293 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 13449 14987 gene locus_tag LOCUS_05180 13449 14987 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_05180 15032 16315 gene locus_tag LOCUS_05190 15032 16315 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_05190 16463 16933 gene locus_tag LOCUS_05200 16463 16933 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_05200 17924 17061 gene locus_tag LOCUS_05210 17924 17061 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 protein_id gnl|my_center|LOCUS_05210 18174 19544 gene locus_tag LOCUS_05220 18174 19544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_05220 19659 22745 gene locus_tag LOCUS_05230 19659 22745 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_05230 25394 23235 gene locus_tag LOCUS_05240 gene gnpA 25394 23235 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_05240 25621 25433 gene locus_tag LOCUS_05250 25621 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 26529 25633 gene locus_tag LOCUS_05260 26529 25633 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_05260 27426 26542 gene locus_tag LOCUS_05270 27426 26542 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_05270 28883 27510 gene locus_tag LOCUS_05280 gene ngcE 28883 27510 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030591.1 protein_id gnl|my_center|LOCUS_05280 29299 30165 gene locus_tag LOCUS_05290 29299 30165 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_05290 30155 31294 gene locus_tag LOCUS_05300 30155 31294 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_05300 32147 31437 gene locus_tag LOCUS_05310 32147 31437 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_05310 33936 32140 gene locus_tag LOCUS_05320 33936 32140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence012 <1 1119 gene locus_tag LOCUS_05330 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435012.1:chaperonin GroEL 1409 1636 gene locus_tag LOCUS_05340 1409 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1668 2435 gene locus_tag LOCUS_05350 1668 2435 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_05350 2888 2511 gene locus_tag LOCUS_05360 2888 2511 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_05360 3220 3029 gene locus_tag LOCUS_05370 3220 3029 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214976.1 protein_id gnl|my_center|LOCUS_05370 3635 3333 gene locus_tag LOCUS_05380 3635 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 3824 5767 gene locus_tag LOCUS_05390 3824 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5767 9075 gene locus_tag LOCUS_05400 5767 9075 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_05400 9220 9504 gene locus_tag LOCUS_05410 9220 9504 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209550774.1 protein_id gnl|my_center|LOCUS_05410 9501 10157 gene locus_tag LOCUS_05420 9501 10157 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_05420 10543 10830 gene locus_tag LOCUS_05430 10543 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 10958 12112 gene locus_tag LOCUS_05440 10958 12112 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_05440 12465 14060 gene locus_tag LOCUS_05450 12465 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 14162 14413 gene locus_tag LOCUS_05460 14162 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 14586 16709 gene locus_tag LOCUS_05470 gene rnr 14586 16709 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_05470 17090 17653 gene locus_tag LOCUS_05480 17090 17653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460044.1 protein_id gnl|my_center|LOCUS_05480 17650 20031 gene locus_tag LOCUS_05490 17650 20031 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969760.1 protein_id gnl|my_center|LOCUS_05490 20022 21125 gene locus_tag LOCUS_05500 20022 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 20977 21076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21080 21562 gene locus_tag LOCUS_05510 21080 21562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 21555 23165 gene locus_tag LOCUS_05520 21555 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 25252 23579 gene locus_tag LOCUS_05530 25252 23579 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_05530 25464 25249 gene locus_tag LOCUS_05540 25464 25249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 25691 25545 gene locus_tag LOCUS_05550 25691 25545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 26575 25760 gene locus_tag LOCUS_05560 26575 25760 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_05560 27354 26593 gene locus_tag LOCUS_05570 27354 26593 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860781.1 protein_id gnl|my_center|LOCUS_05570 28429 27356 gene locus_tag LOCUS_05580 28429 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 32625 29653 gene locus_tag LOCUS_05590 32625 29653 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence013 306 148 gene locus_tag LOCUS_05600 306 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 786 364 gene locus_tag LOCUS_05610 786 364 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_05610 1749 994 gene locus_tag LOCUS_05620 1749 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3001 1778 gene locus_tag LOCUS_05630 3001 1778 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_05630 4225 3083 gene locus_tag LOCUS_05640 gene mltG 4225 3083 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889177.1 protein_id gnl|my_center|LOCUS_05640 5054 4242 gene locus_tag LOCUS_05650 5054 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5761 5090 gene locus_tag LOCUS_05660 5761 5090 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_05660 6537 5758 gene locus_tag LOCUS_05670 gene thyX 6537 5758 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_05670 9220 6542 gene locus_tag LOCUS_05680 gene pcrA 9220 6542 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_05680 9846 9304 gene locus_tag LOCUS_05690 9846 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10023 10778 gene locus_tag LOCUS_05700 10023 10778 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253254.1 protein_id gnl|my_center|LOCUS_05700 10796 11737 gene locus_tag LOCUS_05710 gene pyrB 10796 11737 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_05710 11739 12176 gene locus_tag LOCUS_05720 11739 12176 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_05720 14121 12829 gene locus_tag LOCUS_05730 14121 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 14836 14114 gene locus_tag LOCUS_05740 gene rgbR 14836 14114 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_05740 16342 14972 gene locus_tag LOCUS_05750 16342 14972 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_05750 17184 16357 gene locus_tag LOCUS_05760 17184 16357 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_05760 17719 17315 gene locus_tag LOCUS_05770 gene ytfJ 17719 17315 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_05770 18527 17799 gene locus_tag LOCUS_05780 18527 17799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19076 18531 gene locus_tag LOCUS_05790 gene scpB 19076 18531 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_05790 19795 19073 gene locus_tag LOCUS_05800 19795 19073 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081460.1 protein_id gnl|my_center|LOCUS_05800 20470 19796 gene locus_tag LOCUS_05810 20470 19796 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_05810 20664 20852 gene locus_tag LOCUS_05820 gene rpmB 20664 20852 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_05820 20922 21098 gene locus_tag LOCUS_05830 20922 21098 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_05830 21178 21936 gene locus_tag LOCUS_05840 21178 21936 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_05840 22205 22567 gene locus_tag LOCUS_05850 22205 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 22606 25161 gene locus_tag LOCUS_05860 22606 25161 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_05860 26274 25723 gene locus_tag LOCUS_05870 26274 25723 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_05870 27892 26531 gene locus_tag LOCUS_05880 27892 26531 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_05880 28276 29397 gene locus_tag LOCUS_05890 28276 29397 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398687.1 protein_id gnl|my_center|LOCUS_05890 30726 29524 gene locus_tag LOCUS_05900 gene tuf 30726 29524 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700007.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence014 404 673 gene locus_tag LOCUS_05910 404 673 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_05910 698 2065 gene locus_tag LOCUS_05920 698 2065 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_05920 2182 2817 gene locus_tag LOCUS_05930 2182 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2867 3337 gene locus_tag LOCUS_05940 2867 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3597 4739 gene locus_tag LOCUS_05950 3597 4739 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_05950 4736 7540 gene locus_tag LOCUS_05960 4736 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 7582 7983 gene locus_tag LOCUS_05970 7582 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8085 8306 gene locus_tag LOCUS_05980 8085 8306 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963866.1 protein_id gnl|my_center|LOCUS_05980 8303 8890 gene locus_tag LOCUS_05990 8303 8890 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_05990 9371 8952 gene locus_tag LOCUS_06000 9371 8952 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_06000 10768 9380 gene locus_tag LOCUS_06010 gene pepV 10768 9380 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_06010 11374 10889 gene locus_tag LOCUS_06020 11374 10889 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_06020 12142 11390 gene locus_tag LOCUS_06030 12142 11390 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_06030 13535 12159 gene locus_tag LOCUS_06040 13535 12159 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_06040 14404 15720 gene locus_tag LOCUS_06050 14404 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 15801 16904 gene locus_tag LOCUS_06060 15801 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 16901 17365 gene locus_tag LOCUS_06070 16901 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 17365 18261 gene locus_tag LOCUS_06080 17365 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 20424 18370 gene locus_tag LOCUS_06090 20424 18370 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_06090 20811 20521 gene locus_tag LOCUS_06100 20811 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 22386 21010 gene locus_tag LOCUS_06110 gene mgtE 22386 21010 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_06110 23869 22550 gene locus_tag LOCUS_06120 23869 22550 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_06120 24528 23866 gene locus_tag LOCUS_06130 24528 23866 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_06130 24800 25189 gene locus_tag LOCUS_06140 24800 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 25220 27322 gene locus_tag LOCUS_06150 25220 27322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 28161 27574 gene locus_tag LOCUS_06160 28161 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 28724 28095 gene locus_tag LOCUS_06170 28724 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 29169 28756 gene locus_tag LOCUS_06180 29169 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 29324 30628 gene locus_tag LOCUS_06190 29324 30628 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence015 418 1587 gene locus_tag LOCUS_06200 418 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2427 2035 gene locus_tag LOCUS_06210 2427 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5059 3242 gene locus_tag LOCUS_06220 5059 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5277 6518 gene locus_tag LOCUS_06230 5277 6518 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_06230 6583 7743 gene locus_tag LOCUS_06240 6583 7743 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705317.1 protein_id gnl|my_center|LOCUS_06240 7807 8973 gene locus_tag LOCUS_06250 7807 8973 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234754.1 protein_id gnl|my_center|LOCUS_06250 8994 9908 gene locus_tag LOCUS_06260 gene dapA 8994 9908 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_06260 9937 11007 gene locus_tag LOCUS_06270 gene pdxA 9937 11007 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_06270 11341 12621 gene locus_tag LOCUS_06280 11341 12621 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 protein_id gnl|my_center|LOCUS_06280 12637 12984 gene locus_tag LOCUS_06290 12637 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13079 14053 gene locus_tag LOCUS_06300 13079 14053 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_06300 15105 14140 gene locus_tag LOCUS_06310 15105 14140 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383224.1 protein_id gnl|my_center|LOCUS_06310 15209 16117 gene locus_tag LOCUS_06320 gene murQ 15209 16117 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_06320 16187 17629 gene locus_tag LOCUS_06330 16187 17629 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159750.1 protein_id gnl|my_center|LOCUS_06330 17622 18671 gene locus_tag LOCUS_06340 17622 18671 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364446.1 protein_id gnl|my_center|LOCUS_06340 20098 18722 gene locus_tag LOCUS_06350 20098 18722 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 protein_id gnl|my_center|LOCUS_06350 21056 20232 gene locus_tag LOCUS_06360 21056 20232 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_06360 21699 21064 gene locus_tag LOCUS_06370 gene hisIE 21699 21064 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_06370 22533 21778 gene locus_tag LOCUS_06380 gene hisF 22533 21778 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_06380 23268 22549 gene locus_tag LOCUS_06390 gene hisA 23268 22549 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989518.1 protein_id gnl|my_center|LOCUS_06390 24235 23627 gene locus_tag LOCUS_06400 gene hisH 24235 23627 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_06400 24828 24232 gene locus_tag LOCUS_06410 gene hisB 24828 24232 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_06410 25892 24831 gene locus_tag LOCUS_06420 gene hisC 25892 24831 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_06420 27182 25905 gene locus_tag LOCUS_06430 gene hisD 27182 25905 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930740.1 protein_id gnl|my_center|LOCUS_06430 28774 27179 gene locus_tag LOCUS_06440 28774 27179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 29307 29720 gene locus_tag LOCUS_06450 29307 29720 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence016 205 47 gene locus_tag LOCUS_06460 205 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1772 282 gene locus_tag LOCUS_06470 1772 282 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_06470 3371 1857 gene locus_tag LOCUS_06480 3371 1857 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_06480 3693 5126 gene locus_tag LOCUS_06490 gene uxaC 3693 5126 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_06490 5373 6257 gene locus_tag LOCUS_06500 5373 6257 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_06500 6445 8103 gene locus_tag LOCUS_06510 6445 8103 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_06510 8131 8520 gene locus_tag LOCUS_06520 8131 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9569 8577 gene locus_tag LOCUS_06530 9569 8577 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_06530 10058 9711 gene locus_tag LOCUS_06540 10058 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 10393 10469 gene locus_tag LOCUS_t00090 10393 10469 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10697 11386 gene locus_tag LOCUS_06550 10697 11386 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_06550 11373 13796 gene locus_tag LOCUS_06560 11373 13796 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_06560 14372 14582 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcacccccgcgtatgcggggaaaag 14758 14618 gene locus_tag LOCUS_06570 14758 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 15401 14769 gene locus_tag LOCUS_06580 gene cas6e 15401 14769 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_06580 16079 15417 gene locus_tag LOCUS_06590 16079 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17137 16079 gene locus_tag LOCUS_06600 gene cas7e 17137 16079 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_06600 17754 17140 gene locus_tag LOCUS_06610 gene casB 17754 17140 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_06610 19380 17767 gene locus_tag LOCUS_06620 19380 17767 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_06620 20179 19367 gene locus_tag LOCUS_06630 20179 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 20959 20597 gene locus_tag LOCUS_06640 20959 20597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 21697 21056 gene locus_tag LOCUS_06650 21697 21056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 25068 21694 gene locus_tag LOCUS_06660 25068 21694 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263812.1 protein_id gnl|my_center|LOCUS_06660 26248 25100 gene locus_tag LOCUS_06670 26248 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 27208 26264 gene locus_tag LOCUS_06680 27208 26264 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016429.1 protein_id gnl|my_center|LOCUS_06680 27550 27386 gene locus_tag LOCUS_06690 27550 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence017 2879 2052 gene locus_tag LOCUS_06700 2879 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3719 2901 gene locus_tag LOCUS_06710 3719 2901 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_06710 4167 3703 gene locus_tag LOCUS_06720 gene sepF 4167 3703 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_06720 5590 4277 gene locus_tag LOCUS_06730 5590 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6546 5596 gene locus_tag LOCUS_06740 gene miaA 6546 5596 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_06740 8674 6530 gene locus_tag LOCUS_06750 gene mutL 8674 6530 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_06750 11324 8709 gene locus_tag LOCUS_06760 gene mutS 11324 8709 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_06760 11846 11439 gene locus_tag LOCUS_06770 11846 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 13289 11907 gene locus_tag LOCUS_06780 gene miaB 13289 11907 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_06780 13821 13417 gene locus_tag LOCUS_06790 13821 13417 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_06790 15120 13846 gene locus_tag LOCUS_06800 15120 13846 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_06800 15293 15982 gene locus_tag LOCUS_06810 15293 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 16003 16329 gene locus_tag LOCUS_06820 16003 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 16535 16460 gene locus_tag LOCUS_t00100 16535 16460 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16728 17096 gene locus_tag LOCUS_06830 16728 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 17113 18027 gene locus_tag LOCUS_06840 17113 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 18037 19017 gene locus_tag LOCUS_06850 18037 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 19961 19173 gene locus_tag LOCUS_06860 19961 19173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_06860 21325 20039 gene locus_tag LOCUS_06870 21325 20039 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_06870 23625 21607 gene locus_tag LOCUS_06880 23625 21607 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_06880 23759 24673 gene locus_tag LOCUS_06890 23759 24673 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_06890 24837 25925 gene locus_tag LOCUS_06900 24837 25925 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288240.1 protein_id gnl|my_center|LOCUS_06900 26841 26044 gene locus_tag LOCUS_06910 26841 26044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence018 501 337 gene locus_tag LOCUS_06920 501 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 866 1135 gene locus_tag LOCUS_06930 866 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1781 1389 gene locus_tag LOCUS_06940 1781 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 1924 1745 gene locus_tag LOCUS_06950 1924 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2519 1947 gene locus_tag LOCUS_06960 2519 1947 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_06960 3091 2516 gene locus_tag LOCUS_06970 3091 2516 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_06970 3844 3107 gene locus_tag LOCUS_06980 3844 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5144 3912 gene locus_tag LOCUS_06990 5144 3912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_06990 5989 5144 gene locus_tag LOCUS_07000 5989 5144 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_07000 6804 5989 gene locus_tag LOCUS_07010 6804 5989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_07010 7857 6811 gene locus_tag LOCUS_07020 7857 6811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_07020 9100 8108 gene locus_tag LOCUS_07030 9100 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 10544 9111 gene locus_tag LOCUS_07040 10544 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 11432 10560 gene locus_tag LOCUS_07050 11432 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12402 11434 gene locus_tag LOCUS_07060 12402 11434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_07060 12801 12601 gene locus_tag LOCUS_07070 gene rpmE 12801 12601 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632496.1 protein_id gnl|my_center|LOCUS_07070 13250 12963 gene locus_tag LOCUS_07080 13250 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 13389 13613 gene locus_tag LOCUS_07090 13389 13613 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_07090 17316 14674 gene locus_tag LOCUS_07100 17316 14674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964262.1 protein_id gnl|my_center|LOCUS_07100 19183 17510 gene locus_tag LOCUS_07110 19183 17510 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_07110 19739 19200 gene locus_tag LOCUS_07120 19739 19200 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288192.1 protein_id gnl|my_center|LOCUS_07120 20729 19743 gene locus_tag LOCUS_07130 20729 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 22065 20749 gene locus_tag LOCUS_07140 22065 20749 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_07140 23083 22139 gene locus_tag LOCUS_07150 23083 22139 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_07150 24198 23107 gene locus_tag LOCUS_07160 gene gmd 24198 23107 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_07160 24601 24410 gene locus_tag LOCUS_07170 24601 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 25052 25279 gene locus_tag LOCUS_07180 25052 25279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 26169 25294 gene locus_tag LOCUS_07190 26169 25294 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289864.1 protein_id gnl|my_center|LOCUS_07190 26862 26197 gene locus_tag LOCUS_07200 26862 26197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence019 452 54 gene locus_tag LOCUS_07210 452 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1077 685 gene locus_tag LOCUS_07220 gene mutT 1077 685 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_07220 1460 1092 gene locus_tag LOCUS_07230 1460 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 4625 1467 gene locus_tag LOCUS_07240 4625 1467 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_07240 5602 4847 gene locus_tag LOCUS_07250 gene cas6 5602 4847 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_07250 6708 5599 gene locus_tag LOCUS_07260 gene csm5 6708 5599 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_07260 7670 6705 gene locus_tag LOCUS_07270 gene csm4 7670 6705 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_07270 8316 7651 gene locus_tag LOCUS_07280 gene csm3 8316 7651 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_07280 8813 8319 gene locus_tag LOCUS_07290 gene csm2 8813 8319 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917164.1 protein_id gnl|my_center|LOCUS_07290 11157 8797 gene locus_tag LOCUS_07300 gene cas10 11157 8797 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_07300 11398 11971 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttcgcccccttacgggg 12384 12016 gene locus_tag LOCUS_07310 12384 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 12476 13039 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcgcccccttacggggattgta 13225 13833 gene locus_tag LOCUS_07320 13225 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13840 14853 gene locus_tag LOCUS_07330 13840 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 14855 16309 gene locus_tag LOCUS_07340 14855 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 20173 17018 gene locus_tag LOCUS_07350 20173 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 21235 20201 gene locus_tag LOCUS_07360 21235 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21506 23761 gene locus_tag LOCUS_07370 21506 23761 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966109.1 protein_id gnl|my_center|LOCUS_07370 24938 24132 gene locus_tag LOCUS_07380 24938 24132 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_07380 26393 25449 gene locus_tag LOCUS_07390 26393 25449 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence020 2256 1735 gene locus_tag LOCUS_07400 2256 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2682 3929 gene locus_tag LOCUS_07410 gene sstT 2682 3929 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_07410 4578 4000 gene locus_tag LOCUS_07420 4578 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6322 4751 gene locus_tag LOCUS_07430 gene rny 6322 4751 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_07430 7329 6775 gene locus_tag LOCUS_07440 7329 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 9760 7343 gene locus_tag LOCUS_07450 9760 7343 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_07450 12943 9818 gene locus_tag LOCUS_07460 12943 9818 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_07460 14464 13190 gene locus_tag LOCUS_07470 14464 13190 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_07470 15171 14461 gene locus_tag LOCUS_07480 15171 14461 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 protein_id gnl|my_center|LOCUS_07480 15292 15441 gene locus_tag LOCUS_07490 15292 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 17147 15651 gene locus_tag LOCUS_07500 17147 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 17856 17176 gene locus_tag LOCUS_07510 17856 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 19019 18291 gene locus_tag LOCUS_07520 gene nagB 19019 18291 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_07520 19785 19033 gene locus_tag LOCUS_07530 19785 19033 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384446.1 protein_id gnl|my_center|LOCUS_07530 21576 19834 gene locus_tag LOCUS_07540 21576 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 22134 21583 gene locus_tag LOCUS_07550 22134 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 22100 23803 gene locus_tag LOCUS_07560 22100 23803 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625706.1 protein_id gnl|my_center|LOCUS_07560 23828 24082 gene locus_tag LOCUS_07570 23828 24082 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_07570 24322 24167 gene locus_tag LOCUS_07580 24322 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 25079 25327 gene locus_tag LOCUS_07590 25079 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 25925 25449 gene locus_tag LOCUS_07600 25925 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence021 154 1557 gene locus_tag LOCUS_07610 gene oadA 154 1557 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_07610 1754 2095 gene locus_tag LOCUS_07620 1754 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2364 3242 gene locus_tag LOCUS_07630 2364 3242 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_07630 3261 3539 gene locus_tag LOCUS_07640 3261 3539 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_07640 3529 4101 gene locus_tag LOCUS_07650 gene gmk 3529 4101 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_07650 4130 6391 gene locus_tag LOCUS_07660 gene priA 4130 6391 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_07660 6411 6947 gene locus_tag LOCUS_07670 gene def 6411 6947 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_07670 6947 7867 gene locus_tag LOCUS_07680 gene fmt 6947 7867 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704265.1 protein_id gnl|my_center|LOCUS_07680 7867 9198 gene locus_tag LOCUS_07690 gene rsmB 7867 9198 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965032.1 protein_id gnl|my_center|LOCUS_07690 9240 10280 gene locus_tag LOCUS_07700 gene rlmN 9240 10280 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_07700 10297 11046 gene locus_tag LOCUS_07710 gene prpC 10297 11046 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_07710 11039 12925 gene locus_tag LOCUS_07720 gene pknB 11039 12925 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_07720 12938 13816 gene locus_tag LOCUS_07730 gene rsgA 12938 13816 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_07730 13839 14474 gene locus_tag LOCUS_07740 13839 14474 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_07740 14747 16264 gene locus_tag LOCUS_07750 14747 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 16684 18690 gene locus_tag LOCUS_07760 gene ligA 16684 18690 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_07760 18840 19445 gene locus_tag LOCUS_07770 18840 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 19305 19314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19363 19713 gene locus_tag LOCUS_07780 19363 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19710 20174 gene locus_tag LOCUS_07790 19710 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 20202 20396 gene locus_tag LOCUS_07800 gene spoIIIAC 20202 20396 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_07800 20411 20776 gene locus_tag LOCUS_07810 20411 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 20773 21831 gene locus_tag LOCUS_07820 20773 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 21832 22314 gene locus_tag LOCUS_07830 21832 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 22311 22823 gene locus_tag LOCUS_07840 22311 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 22883 23506 gene locus_tag LOCUS_07850 22883 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 23796 24155 gene locus_tag LOCUS_07860 23796 24155 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965385.1 protein_id gnl|my_center|LOCUS_07860 24239 24685 gene locus_tag LOCUS_07870 gene nusB 24239 24685 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 protein_id gnl|my_center|LOCUS_07870 24682 25623 gene locus_tag LOCUS_07880 24682 25623 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence022 60 905 gene locus_tag LOCUS_07890 60 905 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_07890 907 2301 gene locus_tag LOCUS_07900 gene gltA 907 2301 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_07900 2812 2357 gene locus_tag LOCUS_07910 2812 2357 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_07910 3324 3674 gene locus_tag LOCUS_07920 3324 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3730 5424 gene locus_tag LOCUS_07930 3730 5424 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_07930 9956 5667 gene locus_tag LOCUS_07940 9956 5667 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_07940 11087 10041 gene locus_tag LOCUS_07950 gene ispG 11087 10041 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_07950 12215 11103 gene locus_tag LOCUS_07960 gene rseP 12215 11103 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143011.1 protein_id gnl|my_center|LOCUS_07960 13434 12283 gene locus_tag LOCUS_07970 13434 12283 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07970 14314 13454 gene locus_tag LOCUS_07980 14314 13454 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_07980 15155 14442 gene locus_tag LOCUS_07990 15155 14442 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_07990 15803 15249 gene locus_tag LOCUS_08000 gene frr 15803 15249 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985763.1 protein_id gnl|my_center|LOCUS_08000 16618 15908 gene locus_tag LOCUS_08010 gene pyrH 16618 15908 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_08010 17430 16711 gene locus_tag LOCUS_08020 17430 16711 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_08020 18327 17569 gene locus_tag LOCUS_08030 gene spo0A 18327 17569 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_08030 19670 18447 gene locus_tag LOCUS_08040 gene spoIVB 19670 18447 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_08040 20907 19786 gene locus_tag LOCUS_08050 gene prfB 20907 19786 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096772597.1 protein_id gnl|my_center|LOCUS_08050 21166 22155 gene locus_tag LOCUS_08060 21166 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 22234 23109 gene locus_tag LOCUS_08070 gene galU 22234 23109 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_08070 24454 23261 gene locus_tag LOCUS_08080 24454 23261 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence023 645 91 gene locus_tag LOCUS_08090 645 91 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_08090 1466 792 gene locus_tag LOCUS_08100 1466 792 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_08100 2959 1463 gene locus_tag LOCUS_08110 2959 1463 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_08110 4005 2956 gene locus_tag LOCUS_08120 gene cobD 4005 2956 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_08120 4955 4005 gene locus_tag LOCUS_08130 gene cbiB 4955 4005 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_08130 5551 4952 gene locus_tag LOCUS_08140 5551 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5871 5545 gene locus_tag LOCUS_08150 5871 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6620 5868 gene locus_tag LOCUS_08160 gene cobS 6620 5868 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_08160 7138 6617 gene locus_tag LOCUS_08170 gene cobU 7138 6617 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_08170 8196 7132 gene locus_tag LOCUS_08180 gene cobT 8196 7132 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_08180 9542 8202 gene locus_tag LOCUS_08190 9542 8202 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964684.1 protein_id gnl|my_center|LOCUS_08190 10735 9539 gene locus_tag LOCUS_08200 10735 9539 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_08200 11469 10732 gene locus_tag LOCUS_08210 gene cobK 11469 10732 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_08210 12233 11466 gene locus_tag LOCUS_08220 gene cobJ 12233 11466 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_08220 13224 12226 gene locus_tag LOCUS_08230 gene cbiG 13224 12226 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_08230 13979 13221 gene locus_tag LOCUS_08240 gene cobM 13979 13221 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681800.1 protein_id gnl|my_center|LOCUS_08240 15898 13985 gene locus_tag LOCUS_08250 15898 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16911 15895 gene locus_tag LOCUS_08260 16911 15895 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_08260 18064 16922 gene locus_tag LOCUS_08270 18064 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 18913 18071 gene locus_tag LOCUS_08280 18913 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 20293 19058 gene locus_tag LOCUS_08290 20293 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 20805 21524 gene locus_tag LOCUS_08300 20805 21524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836515.1 protein_id gnl|my_center|LOCUS_08300 21521 23113 gene locus_tag LOCUS_08310 21521 23113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_08310 24070 23303 gene locus_tag LOCUS_08320 24070 23303 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275306.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence024 1593 73 gene locus_tag LOCUS_08330 gene atpA 1593 73 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_08330 2222 1683 gene locus_tag LOCUS_08340 2222 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2725 2219 gene locus_tag LOCUS_08350 gene atpF 2725 2219 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025478.1 protein_id gnl|my_center|LOCUS_08350 3044 2763 gene locus_tag LOCUS_08360 3044 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3839 3096 gene locus_tag LOCUS_08370 gene atpB 3839 3096 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_08370 4343 3840 gene locus_tag LOCUS_08380 4343 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4619 4359 gene locus_tag LOCUS_08390 4619 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6376 4958 gene locus_tag LOCUS_08400 gene glgA 6376 4958 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_08400 7668 6541 gene locus_tag LOCUS_08410 gene glgD 7668 6541 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_08410 8855 7662 gene locus_tag LOCUS_08420 8855 7662 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_08420 11167 8942 gene locus_tag LOCUS_08430 gene glgB 11167 8942 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_08430 12596 11535 gene locus_tag LOCUS_08440 12596 11535 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_08440 13319 14941 gene locus_tag LOCUS_08450 13319 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 14954 15541 gene locus_tag LOCUS_08460 14954 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 15538 16638 gene locus_tag LOCUS_08470 15538 16638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 16640 17317 gene locus_tag LOCUS_08480 16640 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 17329 17742 gene locus_tag LOCUS_08490 17329 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 17748 17966 gene locus_tag LOCUS_08500 17748 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 17971 18225 gene locus_tag LOCUS_08510 17971 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 19023 18424 gene locus_tag LOCUS_08520 19023 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 20147 19164 gene locus_tag LOCUS_08530 20147 19164 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 protein_id gnl|my_center|LOCUS_08530 21065 20175 gene locus_tag LOCUS_08540 21065 20175 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723743.1 protein_id gnl|my_center|LOCUS_08540 21250 22446 gene locus_tag LOCUS_08550 gene coaBC 21250 22446 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_08550 22628 24013 gene locus_tag LOCUS_08560 gene murC 22628 24013 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence025 1485 1949 gene locus_tag LOCUS_08570 gene rnhA 1485 1949 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 protein_id gnl|my_center|LOCUS_08570 1946 2488 gene locus_tag LOCUS_08580 1946 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2960 2556 gene locus_tag LOCUS_08590 gene mgsA 2960 2556 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_08590 5355 3118 gene locus_tag LOCUS_08600 5355 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5908 5375 gene locus_tag LOCUS_08610 5908 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6754 5924 gene locus_tag LOCUS_08620 gene mreC 6754 5924 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_08620 7951 6929 gene locus_tag LOCUS_08630 7951 6929 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964555.1 protein_id gnl|my_center|LOCUS_08630 8671 8114 gene locus_tag LOCUS_08640 8671 8114 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_08640 9239 8793 gene locus_tag LOCUS_08650 gene dut 9239 8793 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_08650 11372 9303 gene locus_tag LOCUS_08660 11372 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 11873 11409 gene locus_tag LOCUS_08670 11873 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12298 14703 gene locus_tag LOCUS_08680 12298 14703 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_08680 14778 16634 gene locus_tag LOCUS_08690 14778 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 16896 17357 gene locus_tag LOCUS_08700 16896 17357 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_08700 17373 18278 gene locus_tag LOCUS_08710 17373 18278 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_08710 18775 18377 gene locus_tag LOCUS_08720 18775 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 20100 18814 gene locus_tag LOCUS_08730 20100 18814 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_08730 22083 20185 gene locus_tag LOCUS_08740 22083 20185 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_08740 23799 22234 gene locus_tag LOCUS_08750 gene spoVB 23799 22234 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence026 29 817 gene locus_tag LOCUS_08760 29 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 880 1536 gene locus_tag LOCUS_08770 880 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1958 2137 gene locus_tag LOCUS_08780 1958 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2403 4181 gene locus_tag LOCUS_08790 2403 4181 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_08790 4606 4232 gene locus_tag LOCUS_08800 4606 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4845 7427 gene locus_tag LOCUS_08810 4845 7427 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723002.1 protein_id gnl|my_center|LOCUS_08810 7601 8032 gene locus_tag LOCUS_08820 7601 8032 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_08820 8060 9295 gene locus_tag LOCUS_08830 8060 9295 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_08830 9314 10219 gene locus_tag LOCUS_08840 gene thrB 9314 10219 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_08840 10304 11503 gene locus_tag LOCUS_08850 10304 11503 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_08850 11673 12494 gene locus_tag LOCUS_08860 11673 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 12538 13839 gene locus_tag LOCUS_08870 12538 13839 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_08870 13826 15139 gene locus_tag LOCUS_08880 13826 15139 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 protein_id gnl|my_center|LOCUS_08880 15136 16185 gene locus_tag LOCUS_08890 gene lgt 15136 16185 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_08890 16333 16644 gene locus_tag LOCUS_08900 gene rplU 16333 16644 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_08900 16659 16910 gene locus_tag LOCUS_08910 gene rpmA 16659 16910 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_08910 17053 18336 gene locus_tag LOCUS_08920 gene obgE 17053 18336 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_08920 18349 18753 gene locus_tag LOCUS_08930 18349 18753 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_08930 19042 18854 gene locus_tag LOCUS_08940 19042 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 19149 20687 gene locus_tag LOCUS_08950 19149 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 20856 21593 gene locus_tag LOCUS_08960 20856 21593 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_08960 23049 21679 gene locus_tag LOCUS_08970 gene dsdA 23049 21679 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094797.1 protein_id gnl|my_center|LOCUS_08970 23363 23178 gene locus_tag LOCUS_08980 23363 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence027 2308 2054 gene locus_tag LOCUS_08990 gene rpsO 2308 2054 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_08990 3301 2465 gene locus_tag LOCUS_09000 3301 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3567 6407 gene locus_tag LOCUS_09010 gene secA 3567 6407 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_09010 6490 7707 gene locus_tag LOCUS_09020 6490 7707 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_09020 7743 8309 gene locus_tag LOCUS_09030 7743 8309 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 protein_id gnl|my_center|LOCUS_09030 8551 9996 gene locus_tag LOCUS_09040 8551 9996 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_09040 9989 11242 gene locus_tag LOCUS_09050 9989 11242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_09050 11248 11595 gene locus_tag LOCUS_09060 11248 11595 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_09060 12788 11739 gene locus_tag LOCUS_09070 12788 11739 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379414.1 protein_id gnl|my_center|LOCUS_09070 13456 12785 gene locus_tag LOCUS_09080 gene modB 13456 12785 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_09080 14351 13467 gene locus_tag LOCUS_09090 gene modA 14351 13467 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_09090 15357 14425 gene locus_tag LOCUS_09100 15357 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 16341 15364 gene locus_tag LOCUS_09110 gene moaA 16341 15364 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_09110 16831 16334 gene locus_tag LOCUS_09120 gene moaC 16831 16334 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_09120 17922 16903 gene locus_tag LOCUS_09130 17922 16903 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_09130 18454 17936 gene locus_tag LOCUS_09140 18454 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 19682 18444 gene locus_tag LOCUS_09150 19682 18444 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_09150 21042 20125 gene locus_tag LOCUS_09160 21042 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 23225 21069 gene locus_tag LOCUS_09170 23225 21069 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence028 711 10 gene locus_tag LOCUS_09180 711 10 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041823010.1 protein_id gnl|my_center|LOCUS_09180 2275 830 gene locus_tag LOCUS_09190 gene purB 2275 830 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_09190 6205 2513 gene locus_tag LOCUS_09200 6205 2513 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_09200 7599 6295 gene locus_tag LOCUS_09210 gene purD 7599 6295 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_09210 8972 7791 gene locus_tag LOCUS_09220 8972 7791 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_09220 9806 9006 gene locus_tag LOCUS_09230 9806 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10588 9992 gene locus_tag LOCUS_09240 gene purN 10588 9992 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_09240 11628 10582 gene locus_tag LOCUS_09250 gene purM 11628 10582 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_09250 13111 11633 gene locus_tag LOCUS_09260 gene purF 13111 11633 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_09260 13622 13122 gene locus_tag LOCUS_09270 gene purE 13622 13122 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_09270 14568 14086 gene locus_tag LOCUS_09280 gene ybaK 14568 14086 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_09280 14941 15954 gene locus_tag LOCUS_09290 gene aroF 14941 15954 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_09290 16223 16645 gene locus_tag LOCUS_09300 16223 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 16642 17724 gene locus_tag LOCUS_09310 16642 17724 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_09310 19463 17937 gene locus_tag LOCUS_09320 gene gpmI 19463 17937 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_09320 20419 19649 gene locus_tag LOCUS_09330 gene tpiA 20419 19649 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_09330 21731 20523 gene locus_tag LOCUS_09340 21731 20523 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429565.1 protein_id gnl|my_center|LOCUS_09340 22498 22031 gene locus_tag LOCUS_09350 22498 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence029 2042 1371 gene locus_tag LOCUS_09360 2042 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2420 2956 gene locus_tag LOCUS_09370 2420 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3442 3068 gene locus_tag LOCUS_09380 3442 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5215 3560 gene locus_tag LOCUS_09390 5215 3560 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_09390 5467 6825 gene locus_tag LOCUS_09400 5467 6825 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_09400 7079 7735 gene locus_tag LOCUS_09410 7079 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8776 7805 gene locus_tag LOCUS_09420 gene gluQRS 8776 7805 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_09420 10258 8900 gene locus_tag LOCUS_09430 10258 8900 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861576.1 protein_id gnl|my_center|LOCUS_09430 11888 10329 gene locus_tag LOCUS_09440 11888 10329 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890719.1 protein_id gnl|my_center|LOCUS_09440 12793 11975 gene locus_tag LOCUS_09450 12793 11975 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431027.1 protein_id gnl|my_center|LOCUS_09450 13141 13755 gene locus_tag LOCUS_09460 13141 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14944 13820 gene locus_tag LOCUS_09470 14944 13820 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_09470 15331 16608 gene locus_tag LOCUS_09480 15331 16608 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 protein_id gnl|my_center|LOCUS_09480 17537 16686 gene locus_tag LOCUS_09490 17537 16686 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262750.1 protein_id gnl|my_center|LOCUS_09490 17735 18148 gene locus_tag LOCUS_09500 17735 18148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 18193 18861 gene locus_tag LOCUS_09510 18193 18861 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_09510 18858 19289 gene locus_tag LOCUS_09520 18858 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 19286 20641 gene locus_tag LOCUS_09530 19286 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 20719 21381 gene locus_tag LOCUS_09540 20719 21381 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_09540 21691 21620 gene locus_tag LOCUS_t00110 21691 21620 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 21859 21783 gene locus_tag LOCUS_t00120 21859 21783 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 487 972 gene locus_tag LOCUS_09550 487 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 995 2539 gene locus_tag LOCUS_09560 995 2539 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_09560 2729 3184 gene locus_tag LOCUS_09570 2729 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3147 4493 gene locus_tag LOCUS_09580 3147 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4876 5175 gene locus_tag LOCUS_09590 4876 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5205 5304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5306 6694 gene locus_tag LOCUS_09600 5306 6694 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_09600 7164 7412 gene locus_tag LOCUS_09610 7164 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8541 7714 gene locus_tag LOCUS_09620 8541 7714 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_09620 9347 8544 gene locus_tag LOCUS_09630 gene frlD 9347 8544 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853346.1 protein_id gnl|my_center|LOCUS_09630 9791 9360 gene locus_tag LOCUS_09640 9791 9360 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211334279.1 protein_id gnl|my_center|LOCUS_09640 10648 9788 gene locus_tag LOCUS_09650 10648 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 12208 10664 gene locus_tag LOCUS_09660 12208 10664 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_09660 13032 12223 gene locus_tag LOCUS_09670 gene sgcQ 13032 12223 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_09670 13877 13062 gene locus_tag LOCUS_09680 13877 13062 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966765.1 protein_id gnl|my_center|LOCUS_09680 15335 14022 gene locus_tag LOCUS_09690 15335 14022 CDS product anaerobic C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966766.1 protein_id gnl|my_center|LOCUS_09690 16442 15729 gene locus_tag LOCUS_09700 16442 15729 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_09700 16806 17816 gene locus_tag LOCUS_09710 16806 17816 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 protein_id gnl|my_center|LOCUS_09710 17841 18728 gene locus_tag LOCUS_09720 17841 18728 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_09720 18750 19166 gene locus_tag LOCUS_09730 18750 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966763.1 protein_id gnl|my_center|LOCUS_09730 19180 19842 gene locus_tag LOCUS_09740 19180 19842 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_09740 19970 20251 gene locus_tag LOCUS_09750 19970 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 20641 21300 gene locus_tag LOCUS_09760 20641 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence031 <1 1097 gene locus_tag LOCUS_09770 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861673.1:cell wall-binding glycosyl-hydrolase Cwp19 1245 1787 gene locus_tag LOCUS_09780 1245 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1784 2701 gene locus_tag LOCUS_09790 1784 2701 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_09790 2703 3257 gene locus_tag LOCUS_09800 2703 3257 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_09800 3286 4776 gene locus_tag LOCUS_09810 3286 4776 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838864.1 protein_id gnl|my_center|LOCUS_09810 5043 6593 gene locus_tag LOCUS_09820 5043 6593 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_09820 6606 7304 gene locus_tag LOCUS_09830 6606 7304 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_09830 7417 8295 gene locus_tag LOCUS_09840 7417 8295 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_09840 8401 8655 gene locus_tag LOCUS_09850 8401 8655 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_09850 8656 9315 gene locus_tag LOCUS_09860 8656 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 9317 10093 gene locus_tag LOCUS_09870 9317 10093 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_09870 10225 11979 gene locus_tag LOCUS_09880 10225 11979 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_09880 12658 12969 gene locus_tag LOCUS_09890 gene rpsJ 12658 12969 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129973.1 protein_id gnl|my_center|LOCUS_09890 13067 13699 gene locus_tag LOCUS_09900 gene rplC 13067 13699 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_09900 13714 14337 gene locus_tag LOCUS_09910 gene rplD 13714 14337 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_09910 14337 14633 gene locus_tag LOCUS_09920 gene rplW 14337 14633 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_09920 14711 15541 gene locus_tag LOCUS_09930 gene rplB 14711 15541 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_09930 15559 15825 gene locus_tag LOCUS_09940 gene rpsS 15559 15825 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 protein_id gnl|my_center|LOCUS_09940 15844 16179 gene locus_tag LOCUS_09950 gene rplV 15844 16179 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_09950 16192 16896 gene locus_tag LOCUS_09960 gene rpsC 16192 16896 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_09960 16896 17336 gene locus_tag LOCUS_09970 gene rplP 16896 17336 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_09970 17326 17511 gene locus_tag LOCUS_09980 gene rpmC 17326 17511 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_09980 17524 17781 gene locus_tag LOCUS_09990 gene rpsQ 17524 17781 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_09990 17825 18193 gene locus_tag LOCUS_10000 gene rplN 17825 18193 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_10000 18207 18521 gene locus_tag LOCUS_10010 gene rplX 18207 18521 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_10010 18778 18877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19152 19550 gene locus_tag LOCUS_10020 gene rpsH 19152 19550 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_10020 19568 20119 gene locus_tag LOCUS_10030 gene rplF 19568 20119 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_10030 20138 20497 gene locus_tag LOCUS_10040 gene rplR 20138 20497 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_10040 20517 21017 gene locus_tag LOCUS_10050 gene rpsE 20517 21017 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_10050 21032 21217 gene locus_tag LOCUS_10060 21032 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 21238 21678 gene locus_tag LOCUS_10070 gene rplO 21238 21678 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence032 756 307 gene locus_tag LOCUS_10080 gene mscL 756 307 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_10080 2003 975 gene locus_tag LOCUS_10090 2003 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2319 2092 gene locus_tag LOCUS_10100 2319 2092 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_10100 4216 2399 gene locus_tag LOCUS_10110 gene dnaK 4216 2399 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_10110 5396 4299 gene locus_tag LOCUS_10120 5396 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5545 7284 gene locus_tag LOCUS_10130 5545 7284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_10130 7281 9056 gene locus_tag LOCUS_10140 7281 9056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_10140 9314 9865 gene locus_tag LOCUS_10150 9314 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 9967 10164 gene locus_tag LOCUS_10160 9967 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10167 10964 gene locus_tag LOCUS_10170 gene tatC 10167 10964 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_10170 13380 11119 gene locus_tag LOCUS_10180 gene glgP 13380 11119 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_10180 13566 14423 gene locus_tag LOCUS_10190 13566 14423 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_10190 14545 14802 gene locus_tag LOCUS_10200 14545 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 15679 14972 gene locus_tag LOCUS_10210 15679 14972 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_10210 15986 15672 gene locus_tag LOCUS_10220 15986 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 16672 16241 gene locus_tag LOCUS_10230 gene iscR 16672 16241 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_10230 16909 17841 gene locus_tag LOCUS_10240 gene cysK 16909 17841 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_10240 18833 18180 gene locus_tag LOCUS_10250 18833 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 19056 20006 gene locus_tag LOCUS_10260 19056 20006 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_10260 20475 20230 gene locus_tag LOCUS_10270 20475 20230 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence033 2013 1468 gene locus_tag LOCUS_10280 2013 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3873 2029 gene locus_tag LOCUS_10290 3873 2029 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_10290 4695 3955 gene locus_tag LOCUS_10300 4695 3955 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_10300 5003 4782 gene locus_tag LOCUS_10310 5003 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6907 5060 gene locus_tag LOCUS_10320 6907 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7621 6947 gene locus_tag LOCUS_10330 7621 6947 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_10330 8180 7854 gene locus_tag LOCUS_10340 8180 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 8548 8240 gene locus_tag LOCUS_10350 8548 8240 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_10350 9251 10978 gene locus_tag LOCUS_10360 9251 10978 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_10360 11836 11144 gene locus_tag LOCUS_10370 11836 11144 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 protein_id gnl|my_center|LOCUS_10370 13474 12266 gene locus_tag LOCUS_10380 13474 12266 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_10380 13846 13490 gene locus_tag LOCUS_10390 13846 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15032 14007 gene locus_tag LOCUS_10400 15032 14007 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_10400 17403 15172 gene locus_tag LOCUS_10410 17403 15172 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_10410 17560 18549 gene locus_tag LOCUS_10420 17560 18549 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_10420 18659 19585 gene locus_tag LOCUS_10430 18659 19585 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence034 445 209 gene locus_tag LOCUS_10440 445 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2018 873 gene locus_tag LOCUS_10450 2018 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6367 1994 gene locus_tag LOCUS_10460 6367 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2131 2230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7583 6669 gene locus_tag LOCUS_10470 gene argF 7583 6669 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_10470 8782 7580 gene locus_tag LOCUS_10480 8782 7580 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_10480 9737 8883 gene locus_tag LOCUS_10490 gene argB 9737 8883 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_10490 10983 9754 gene locus_tag LOCUS_10500 gene argJ 10983 9754 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_10500 11958 11017 gene locus_tag LOCUS_10510 gene argC 11958 11017 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_10510 13355 11955 gene locus_tag LOCUS_10520 gene argH 13355 11955 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_10520 14722 13490 gene locus_tag LOCUS_10530 14722 13490 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_10530 16228 15170 gene locus_tag LOCUS_10540 16228 15170 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_10540 16620 18053 gene locus_tag LOCUS_10550 16620 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 18181 18834 gene locus_tag LOCUS_10560 18181 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 19127 19384 gene locus_tag LOCUS_10570 19127 19384 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence035 74 868 gene locus_tag LOCUS_10580 74 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1081 1368 gene locus_tag LOCUS_10590 1081 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1480 2742 gene locus_tag LOCUS_10600 1480 2742 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_10600 4584 3331 gene locus_tag LOCUS_10610 4584 3331 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811490.1 protein_id gnl|my_center|LOCUS_10610 5462 4581 gene locus_tag LOCUS_10620 5462 4581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 protein_id gnl|my_center|LOCUS_10620 6206 5475 gene locus_tag LOCUS_10630 6206 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6745 6203 gene locus_tag LOCUS_10640 6745 6203 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459747.1 protein_id gnl|my_center|LOCUS_10640 7432 6824 gene locus_tag LOCUS_10650 7432 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7702 7899 gene locus_tag LOCUS_10660 7702 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 8016 8092 gene locus_tag LOCUS_t00130 8016 8092 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8423 8250 gene locus_tag LOCUS_10670 8423 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8649 9503 gene locus_tag LOCUS_10680 8649 9503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_10680 10812 9649 gene locus_tag LOCUS_10690 10812 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 11293 10799 gene locus_tag LOCUS_10700 11293 10799 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_10700 12127 11555 gene locus_tag LOCUS_10710 12127 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 12393 12256 gene locus_tag LOCUS_10720 12393 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12692 13261 gene locus_tag LOCUS_10730 12692 13261 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_10730 14327 13332 gene locus_tag LOCUS_10740 gene argF 14327 13332 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_10740 14900 14421 gene locus_tag LOCUS_10750 14900 14421 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_10750 15303 15061 gene locus_tag LOCUS_10760 15303 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15560 17644 gene locus_tag LOCUS_10770 gene fusA 15560 17644 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_10770 19392 17806 gene locus_tag LOCUS_10780 gene asnB 19392 17806 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence036 1936 1673 gene locus_tag LOCUS_10790 1936 1673 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_10790 2802 1942 gene locus_tag LOCUS_10800 2802 1942 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_10800 5093 2817 gene locus_tag LOCUS_10810 5093 2817 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704357.1 protein_id gnl|my_center|LOCUS_10810 6691 5330 gene locus_tag LOCUS_10820 6691 5330 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_10820 7665 6883 gene locus_tag LOCUS_10830 gene yecC 7665 6883 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273033.1 protein_id gnl|my_center|LOCUS_10830 8335 7682 gene locus_tag LOCUS_10840 8335 7682 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_10840 9216 8374 gene locus_tag LOCUS_10850 9216 8374 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_10850 10365 9505 gene locus_tag LOCUS_10860 10365 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 10346 10642 gene locus_tag LOCUS_10870 10346 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 12167 10626 gene locus_tag LOCUS_10880 gene cls 12167 10626 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_10880 13367 12519 gene locus_tag LOCUS_10890 13367 12519 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219939.1 protein_id gnl|my_center|LOCUS_10890 13625 14167 gene locus_tag LOCUS_10900 13625 14167 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_10900 14627 14340 gene locus_tag LOCUS_10910 14627 14340 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_10910 14983 14624 gene locus_tag LOCUS_10920 14983 14624 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_10920 15121 16227 gene locus_tag LOCUS_10930 15121 16227 CDS product IS3-like element ISSag5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088197835.1 protein_id gnl|my_center|LOCUS_10930 16638 16288 gene locus_tag LOCUS_tm00010 16638 16288 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 17191 16709 gene locus_tag LOCUS_10940 gene smpB 17191 16709 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_10940 17892 17293 gene locus_tag LOCUS_10950 gene recR 17892 17293 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_10950 18250 17912 gene locus_tag LOCUS_10960 18250 17912 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_10960 18847 18281 gene locus_tag LOCUS_10970 18847 18281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence037 336 1421 gene locus_tag LOCUS_10980 336 1421 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435617.1 protein_id gnl|my_center|LOCUS_10980 1445 3934 gene locus_tag LOCUS_10990 1445 3934 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592867.1 protein_id gnl|my_center|LOCUS_10990 4502 3987 gene locus_tag LOCUS_11000 gene cobO 4502 3987 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_11000 5837 4584 gene locus_tag LOCUS_11010 5837 4584 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_11010 6068 6640 gene locus_tag LOCUS_11020 6068 6640 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946330.1 protein_id gnl|my_center|LOCUS_11020 6631 7266 gene locus_tag LOCUS_11030 6631 7266 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_11030 7289 8149 gene locus_tag LOCUS_11040 7289 8149 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_11040 9187 8234 gene locus_tag LOCUS_11050 9187 8234 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_11050 9353 10771 gene locus_tag LOCUS_11060 9353 10771 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_11060 11437 10838 gene locus_tag LOCUS_11070 11437 10838 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_11070 11861 12952 gene locus_tag LOCUS_11080 11861 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13202 14359 gene locus_tag LOCUS_11090 13202 14359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_11090 15440 14502 gene locus_tag LOCUS_11100 15440 14502 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674778.1 protein_id gnl|my_center|LOCUS_11100 17626 15530 gene locus_tag LOCUS_11110 17626 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 18304 17927 gene locus_tag LOCUS_11120 18304 17927 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_11120 18502 18428 gene locus_tag LOCUS_t00140 18502 18428 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 985 227 gene locus_tag LOCUS_11130 985 227 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_11130 1797 1027 gene locus_tag LOCUS_11140 1797 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 3048 1969 gene locus_tag LOCUS_11150 3048 1969 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_11150 3301 3954 gene locus_tag LOCUS_11160 3301 3954 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_11160 5959 4007 gene locus_tag LOCUS_11170 5959 4007 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_11170 6199 6372 gene locus_tag LOCUS_11180 6199 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 7323 6373 gene locus_tag LOCUS_11190 7323 6373 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_11190 8358 7474 gene locus_tag LOCUS_11200 8358 7474 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_11200 8925 8374 gene locus_tag LOCUS_11210 8925 8374 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_11210 9293 9000 gene locus_tag LOCUS_11220 9293 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 9899 9405 gene locus_tag LOCUS_11230 9899 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 10429 9908 gene locus_tag LOCUS_11240 10429 9908 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_11240 10655 11245 gene locus_tag LOCUS_11250 10655 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 11416 11925 gene locus_tag LOCUS_11260 11416 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 12211 13674 gene locus_tag LOCUS_11270 gene nagE 12211 13674 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 protein_id gnl|my_center|LOCUS_11270 13880 15007 gene locus_tag LOCUS_11280 gene nagA 13880 15007 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830343.1 protein_id gnl|my_center|LOCUS_11280 15625 15113 gene locus_tag LOCUS_11290 15625 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 15994 17229 gene locus_tag LOCUS_11300 15994 17229 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_11300 17242 18321 gene locus_tag LOCUS_11310 17242 18321 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence039 1427 798 gene locus_tag LOCUS_11320 1427 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2627 1491 gene locus_tag LOCUS_11330 2627 1491 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_11330 4147 2633 gene locus_tag LOCUS_11340 4147 2633 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_11340 5225 4161 gene locus_tag LOCUS_11350 5225 4161 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_11350 5779 5231 gene locus_tag LOCUS_11360 5779 5231 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022159.1 protein_id gnl|my_center|LOCUS_11360 7061 5772 gene locus_tag LOCUS_11370 7061 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8259 7102 gene locus_tag LOCUS_11380 8259 7102 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107241.1 protein_id gnl|my_center|LOCUS_11380 9338 8256 gene locus_tag LOCUS_11390 9338 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 10418 9369 gene locus_tag LOCUS_11400 10418 9369 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101653.1 protein_id gnl|my_center|LOCUS_11400 11571 10420 gene locus_tag LOCUS_11410 11571 10420 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_11410 12646 11588 gene locus_tag LOCUS_11420 12646 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 15778 14408 gene locus_tag LOCUS_11430 15778 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 <18049 15857 gene locus_tag LOCUS_11440 <18049 15857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206191380.1:helicase associated domain-containing protein >Feature sequence040 993 616 gene locus_tag LOCUS_11450 993 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1276 977 gene locus_tag LOCUS_11460 1276 977 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_11460 2416 1310 gene locus_tag LOCUS_11470 gene nusA 2416 1310 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_11470 2958 2473 gene locus_tag LOCUS_11480 gene rimP 2958 2473 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_11480 4348 3107 gene locus_tag LOCUS_11490 4348 3107 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_11490 5830 4439 gene locus_tag LOCUS_11500 5830 4439 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_11500 7266 5962 gene locus_tag LOCUS_11510 7266 5962 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_11510 7643 8188 gene locus_tag LOCUS_11520 gene yfcE 7643 8188 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_11520 8472 9425 gene locus_tag LOCUS_11530 8472 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 9647 10579 gene locus_tag LOCUS_11540 9647 10579 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924429.1 protein_id gnl|my_center|LOCUS_11540 10914 12044 gene locus_tag LOCUS_11550 10914 12044 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_11550 12058 12186 gene locus_tag LOCUS_11560 12058 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 13112 12282 gene locus_tag LOCUS_11570 13112 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 13327 14715 gene locus_tag LOCUS_11580 13327 14715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_11580 14719 15474 gene locus_tag LOCUS_11590 14719 15474 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_11590 15505 17430 gene locus_tag LOCUS_11600 15505 17430 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence041 2019 664 gene locus_tag LOCUS_11610 2019 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2590 2213 gene locus_tag LOCUS_11620 2590 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5024 3195 gene locus_tag LOCUS_11630 5024 3195 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_11630 5960 5028 gene locus_tag LOCUS_11640 5960 5028 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_11640 6614 5997 gene locus_tag LOCUS_11650 6614 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7251 6601 gene locus_tag LOCUS_11660 7251 6601 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 protein_id gnl|my_center|LOCUS_11660 8324 7269 gene locus_tag LOCUS_11670 8324 7269 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_11670 8688 9635 gene locus_tag LOCUS_11680 8688 9635 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_11680 9649 10554 gene locus_tag LOCUS_11690 9649 10554 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_11690 10631 12304 gene locus_tag LOCUS_11700 10631 12304 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_11700 12329 13804 gene locus_tag LOCUS_11710 12329 13804 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608887.1 protein_id gnl|my_center|LOCUS_11710 14140 13889 gene locus_tag LOCUS_11720 14140 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 14313 14137 gene locus_tag LOCUS_11730 14313 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15960 14728 gene locus_tag LOCUS_11740 15960 14728 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_11740 16355 16068 gene locus_tag LOCUS_11750 16355 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 17682 16432 gene locus_tag LOCUS_11760 17682 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence042 256 2655 gene locus_tag LOCUS_11770 256 2655 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527693.1 protein_id gnl|my_center|LOCUS_11770 2803 3198 gene locus_tag LOCUS_11780 2803 3198 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_11780 3205 4050 gene locus_tag LOCUS_11790 3205 4050 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_11790 4138 4890 gene locus_tag LOCUS_11800 4138 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5446 4967 gene locus_tag LOCUS_11810 5446 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5791 6348 gene locus_tag LOCUS_11820 5791 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6543 7217 gene locus_tag LOCUS_11830 6543 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 7976 7302 gene locus_tag LOCUS_11840 7976 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8741 8100 gene locus_tag LOCUS_11850 8741 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 8866 9774 gene locus_tag LOCUS_11860 gene yidA 8866 9774 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023536.1 protein_id gnl|my_center|LOCUS_11860 10467 10566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10796 11821 gene locus_tag LOCUS_11870 10796 11821 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_11870 11841 12689 gene locus_tag LOCUS_11880 gene kduI 11841 12689 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_11880 12781 13581 gene locus_tag LOCUS_11890 12781 13581 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027182.1 protein_id gnl|my_center|LOCUS_11890 15094 13805 gene locus_tag LOCUS_11900 15094 13805 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_11900 <17684 15339 gene locus_tag LOCUS_11910 <17684 15339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365401.1:ATP-dependent chaperone ClpB >Feature sequence043 753 1877 gene locus_tag LOCUS_11920 gene ribD 753 1877 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_11920 1841 2482 gene locus_tag LOCUS_11930 1841 2482 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_11930 2495 3691 gene locus_tag LOCUS_11940 2495 3691 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_11940 3713 4189 gene locus_tag LOCUS_11950 gene ribE 3713 4189 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_11950 4210 4626 gene locus_tag LOCUS_11960 4210 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4623 5072 gene locus_tag LOCUS_11970 4623 5072 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 protein_id gnl|my_center|LOCUS_11970 6924 5413 gene locus_tag LOCUS_11980 gene lysS 6924 5413 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 protein_id gnl|my_center|LOCUS_11980 7422 6937 gene locus_tag LOCUS_11990 gene greA 7422 6937 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_11990 7746 10067 gene locus_tag LOCUS_12000 7746 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10790 10152 gene locus_tag LOCUS_12010 10790 10152 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_12010 11727 10798 gene locus_tag LOCUS_12020 11727 10798 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_12020 12450 11746 gene locus_tag LOCUS_12030 12450 11746 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130140.1 protein_id gnl|my_center|LOCUS_12030 12904 12455 gene locus_tag LOCUS_12040 12904 12455 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575438.1 protein_id gnl|my_center|LOCUS_12040 13907 12978 gene locus_tag LOCUS_12050 13907 12978 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_12050 14998 14027 gene locus_tag LOCUS_12060 14998 14027 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730582.1 protein_id gnl|my_center|LOCUS_12060 15909 15013 gene locus_tag LOCUS_12070 15909 15013 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_12070 17396 16041 gene locus_tag LOCUS_12080 17396 16041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023462.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence044 1170 250 gene locus_tag LOCUS_12090 1170 250 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_12090 1981 1475 gene locus_tag LOCUS_12100 1981 1475 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_12100 2547 2149 gene locus_tag LOCUS_12110 2547 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3483 2815 gene locus_tag LOCUS_12120 gene phoU 3483 2815 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_12120 4270 3503 gene locus_tag LOCUS_12130 gene pstB 4270 3503 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_12130 5145 4288 gene locus_tag LOCUS_12140 gene pstA 5145 4288 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_12140 6052 5138 gene locus_tag LOCUS_12150 gene pstC 6052 5138 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_12150 7260 6367 gene locus_tag LOCUS_12160 7260 6367 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_12160 7990 7505 gene locus_tag LOCUS_12170 7990 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 8570 8028 gene locus_tag LOCUS_12180 8570 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8843 8917 gene locus_tag LOCUS_t00150 8843 8917 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8959 9035 gene locus_tag LOCUS_t00160 8959 9035 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9255 10316 gene locus_tag LOCUS_12190 gene trpS 9255 10316 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_12190 10469 11242 gene locus_tag LOCUS_12200 10469 11242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_12200 11566 12375 gene locus_tag LOCUS_12210 gene dhuD 11566 12375 CDS product monomeric 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase DhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139169.1 protein_id gnl|my_center|LOCUS_12210 12474 12818 gene locus_tag LOCUS_12220 12474 12818 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_12220 12862 13497 gene locus_tag LOCUS_12230 12862 13497 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_12230 13513 13929 gene locus_tag LOCUS_12240 13513 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14166 15905 gene locus_tag LOCUS_12250 14166 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 16169 16441 gene locus_tag LOCUS_12260 16169 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 16438 16728 gene locus_tag LOCUS_12270 16438 16728 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence045 237 79 gene locus_tag LOCUS_12280 237 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 2155 374 gene locus_tag LOCUS_12290 2155 374 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_12290 2610 2152 gene locus_tag LOCUS_12300 2610 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3105 2641 gene locus_tag LOCUS_12310 3105 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3214 3011 gene locus_tag LOCUS_12320 3214 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3687 3214 gene locus_tag LOCUS_12330 3687 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4124 3699 gene locus_tag LOCUS_12340 4124 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5114 4188 gene locus_tag LOCUS_12350 5114 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5907 5071 gene locus_tag LOCUS_12360 gene soj 5907 5071 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12360 6311 5904 gene locus_tag LOCUS_12370 6311 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 8644 7433 gene locus_tag LOCUS_12380 gene nspC 8644 7433 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_12380 9903 8644 gene locus_tag LOCUS_12390 9903 8644 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_12390 10818 9943 gene locus_tag LOCUS_12400 gene speB 10818 9943 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_12400 11675 10818 gene locus_tag LOCUS_12410 gene speE 11675 10818 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_12410 13154 11688 gene locus_tag LOCUS_12420 13154 11688 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_12420 13747 14469 gene locus_tag LOCUS_12430 13747 14469 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_12430 14487 15803 gene locus_tag LOCUS_12440 14487 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 16127 15888 gene locus_tag LOCUS_12450 16127 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 16623 16147 gene locus_tag LOCUS_12460 16623 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence046 <1 734 gene locus_tag LOCUS_12470 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011222018.1:recombinase family protein 712 846 gene locus_tag LOCUS_12480 712 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2741 894 gene locus_tag LOCUS_12490 2741 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4283 2757 gene locus_tag LOCUS_12500 4283 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4489 4824 gene locus_tag LOCUS_12510 4489 4824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_12510 6317 5061 gene locus_tag LOCUS_12520 6317 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6538 6338 gene locus_tag LOCUS_12530 6538 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6653 6829 gene locus_tag LOCUS_12540 6653 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 7182 7880 gene locus_tag LOCUS_12550 7182 7880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_12550 7880 9409 gene locus_tag LOCUS_12560 7880 9409 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_12560 9979 10629 gene locus_tag LOCUS_12570 gene rpe 9979 10629 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939801.1 protein_id gnl|my_center|LOCUS_12570 10642 11661 gene locus_tag LOCUS_12580 10642 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 11658 12383 gene locus_tag LOCUS_12590 gene rsxE 11658 12383 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895956.1 protein_id gnl|my_center|LOCUS_12590 12380 12994 gene locus_tag LOCUS_12600 12380 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 13019 14125 gene locus_tag LOCUS_12610 13019 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 14253 15545 gene locus_tag LOCUS_12620 14253 15545 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence047 755 1513 gene locus_tag LOCUS_12630 755 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1538 2062 gene locus_tag LOCUS_12640 1538 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2193 2771 gene locus_tag LOCUS_12650 gene pth 2193 2771 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_12650 2956 6432 gene locus_tag LOCUS_12660 gene mfd 2956 6432 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_12660 6429 7547 gene locus_tag LOCUS_12670 6429 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9339 7696 gene locus_tag LOCUS_12680 9339 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 11593 9824 gene locus_tag LOCUS_12690 11593 9824 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_12690 13759 11840 gene locus_tag LOCUS_12700 13759 11840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_12700 15510 13759 gene locus_tag LOCUS_12710 15510 13759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_12710 16187 15651 gene locus_tag LOCUS_12720 16187 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence048 79 1260 gene locus_tag LOCUS_12730 79 1260 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_12730 1503 3041 gene locus_tag LOCUS_12740 1503 3041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_12740 3045 4214 gene locus_tag LOCUS_12750 3045 4214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_12750 4216 5133 gene locus_tag LOCUS_12760 4216 5133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_12760 5369 6079 gene locus_tag LOCUS_12770 5369 6079 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_12770 6084 6848 gene locus_tag LOCUS_12780 6084 6848 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_12780 6861 7613 gene locus_tag LOCUS_12790 6861 7613 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_12790 7677 8471 gene locus_tag LOCUS_12800 7677 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9012 9929 gene locus_tag LOCUS_12810 9012 9929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_12810 9948 10997 gene locus_tag LOCUS_12820 9948 10997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_12820 11012 12013 gene locus_tag LOCUS_12830 11012 12013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_12830 12010 13005 gene locus_tag LOCUS_12840 12010 13005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_12840 13225 14919 gene locus_tag LOCUS_12850 13225 14919 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_12850 15854 15096 gene locus_tag LOCUS_12860 15854 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 16442 16146 gene locus_tag LOCUS_12870 16442 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence049 96 353 gene locus_tag LOCUS_12880 96 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 687 1622 gene locus_tag LOCUS_12890 687 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1634 1972 gene locus_tag LOCUS_12900 1634 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1969 2901 gene locus_tag LOCUS_12910 1969 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3065 3775 gene locus_tag LOCUS_12920 3065 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3888 5561 gene locus_tag LOCUS_12930 3888 5561 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_12930 5652 5990 gene locus_tag LOCUS_12940 5652 5990 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_12940 6003 6353 gene locus_tag LOCUS_12950 6003 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6477 7217 gene locus_tag LOCUS_12960 6477 7217 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_12960 7758 7399 gene locus_tag LOCUS_12970 7758 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8934 7768 gene locus_tag LOCUS_12980 8934 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9767 8940 gene locus_tag LOCUS_12990 9767 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11977 9821 gene locus_tag LOCUS_13000 11977 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 12255 11995 gene locus_tag LOCUS_13010 12255 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 13275 12268 gene locus_tag LOCUS_13020 13275 12268 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_13020 13514 13855 gene locus_tag LOCUS_13030 13514 13855 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_13030 15190 13934 gene locus_tag LOCUS_13040 15190 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 15854 15207 gene locus_tag LOCUS_13050 15854 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence050 743 192 gene locus_tag LOCUS_13060 gene nusG 743 192 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_13060 1025 774 gene locus_tag LOCUS_13070 1025 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1192 1043 gene locus_tag LOCUS_13080 gene rpmG 1192 1043 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_13080 1502 2596 gene locus_tag LOCUS_13090 1502 2596 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_13090 2589 3413 gene locus_tag LOCUS_13100 gene murI 2589 3413 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_13100 3428 3904 gene locus_tag LOCUS_13110 3428 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3940 5754 gene locus_tag LOCUS_13120 gene argS 3940 5754 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_13120 5988 7007 gene locus_tag LOCUS_13130 gene dusB 5988 7007 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_13130 8044 7457 gene locus_tag LOCUS_13140 gene yfbR 8044 7457 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813851.1 protein_id gnl|my_center|LOCUS_13140 8183 10585 gene locus_tag LOCUS_13150 8183 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 11011 12111 gene locus_tag LOCUS_13160 11011 12111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_13160 12276 13220 gene locus_tag LOCUS_13170 12276 13220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_13170 13222 14040 gene locus_tag LOCUS_13180 13222 14040 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_13180 14893 14234 gene locus_tag LOCUS_13190 14893 14234 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963701.1 protein_id gnl|my_center|LOCUS_13190 15267 15752 gene locus_tag LOCUS_13200 gene fur 15267 15752 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814098.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence051 1344 181 gene locus_tag LOCUS_13210 1344 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1608 2780 gene locus_tag LOCUS_13220 1608 2780 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_13220 2796 3635 gene locus_tag LOCUS_13230 2796 3635 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_13230 3649 4203 gene locus_tag LOCUS_13240 3649 4203 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_13240 4426 4815 gene locus_tag LOCUS_13250 4426 4815 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_13250 5008 6186 gene locus_tag LOCUS_13260 5008 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6465 9761 gene locus_tag LOCUS_13270 6465 9761 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_13270 9777 10766 gene locus_tag LOCUS_13280 9777 10766 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_13280 10925 11698 gene locus_tag LOCUS_13290 10925 11698 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_13290 12730 11873 gene locus_tag LOCUS_13300 12730 11873 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_13300 12931 13320 gene locus_tag LOCUS_13310 12931 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 13334 13834 gene locus_tag LOCUS_13320 gene tadA 13334 13834 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_13320 14075 15076 gene locus_tag LOCUS_13330 14075 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence052 3594 2986 gene locus_tag LOCUS_13340 3594 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4193 3660 gene locus_tag LOCUS_13350 4193 3660 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038108.1 protein_id gnl|my_center|LOCUS_13350 5670 4210 gene locus_tag LOCUS_13360 5670 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_13360 5996 5685 gene locus_tag LOCUS_13370 5996 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6499 5993 gene locus_tag LOCUS_13380 6499 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7205 6501 gene locus_tag LOCUS_13390 7205 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7603 7211 gene locus_tag LOCUS_13400 7603 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8657 7608 gene locus_tag LOCUS_13410 8657 7608 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939445.1 protein_id gnl|my_center|LOCUS_13410 9025 8675 gene locus_tag LOCUS_13420 9025 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10196 9039 gene locus_tag LOCUS_13430 10196 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 11751 10153 gene locus_tag LOCUS_13440 11751 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 12002 11766 gene locus_tag LOCUS_13450 12002 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 13847 12006 gene locus_tag LOCUS_13460 13847 12006 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_13460 14431 13937 gene locus_tag LOCUS_13470 14431 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 15149 14412 gene locus_tag LOCUS_13480 15149 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence053 692 285 gene locus_tag LOCUS_13490 692 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2104 692 gene locus_tag LOCUS_13500 gene atpD 2104 692 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_13500 3112 2234 gene locus_tag LOCUS_13510 gene atpG 3112 2234 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_13510 4853 3099 gene locus_tag LOCUS_13520 gene atpA 4853 3099 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985238.1 protein_id gnl|my_center|LOCUS_13520 5334 4843 gene locus_tag LOCUS_13530 5334 4843 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_13530 5577 5350 gene locus_tag LOCUS_13540 5577 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6301 5618 gene locus_tag LOCUS_13550 6301 5618 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_13550 7308 6859 gene locus_tag LOCUS_13560 7308 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8380 8697 gene locus_tag LOCUS_13570 8380 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8723 9034 gene locus_tag LOCUS_13580 8723 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 9045 9266 gene locus_tag LOCUS_13590 9045 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9341 9643 gene locus_tag LOCUS_13600 9341 9643 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789142.1 protein_id gnl|my_center|LOCUS_13600 10001 9768 gene locus_tag LOCUS_13610 10001 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 10907 10092 gene locus_tag LOCUS_13620 10907 10092 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_13620 11863 10904 gene locus_tag LOCUS_13630 11863 10904 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_13630 13873 11876 gene locus_tag LOCUS_13640 gene metG 13873 11876 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_13640 15714 14329 gene locus_tag LOCUS_13650 gene glmM 15714 14329 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence054 2776 3888 gene locus_tag LOCUS_13660 2776 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3995 4282 gene locus_tag LOCUS_13670 3995 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4382 4618 gene locus_tag LOCUS_13680 4382 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4945 5979 gene locus_tag LOCUS_13690 4945 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6744 6085 gene locus_tag LOCUS_13700 6744 6085 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_13700 7402 6725 gene locus_tag LOCUS_13710 7402 6725 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_13710 7584 9176 gene locus_tag LOCUS_13720 7584 9176 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_13720 10459 9320 gene locus_tag LOCUS_13730 10459 9320 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_13730 10865 10789 gene locus_tag LOCUS_t00170 10865 10789 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11137 11304 gene locus_tag LOCUS_13740 11137 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 11703 11410 gene locus_tag LOCUS_13750 11703 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11963 11700 gene locus_tag LOCUS_13760 11963 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 12156 12776 gene locus_tag LOCUS_13770 12156 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12799 13017 gene locus_tag LOCUS_13780 12799 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 13032 13730 gene locus_tag LOCUS_13790 gene tsaA 13032 13730 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_13790 13743 14633 gene locus_tag LOCUS_13800 13743 14633 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 protein_id gnl|my_center|LOCUS_13800 <15688 14826 gene locus_tag LOCUS_13810 <15688 14826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966512.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC >Feature sequence055 1167 2948 gene locus_tag LOCUS_13820 1167 2948 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_13820 2952 3638 gene locus_tag LOCUS_13830 2952 3638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_13830 3635 4984 gene locus_tag LOCUS_13840 3635 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5847 4981 gene locus_tag LOCUS_13850 5847 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6725 5937 gene locus_tag LOCUS_13860 6725 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8188 6722 gene locus_tag LOCUS_13870 8188 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 8266 8958 gene locus_tag LOCUS_13880 8266 8958 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_13880 8955 9323 gene locus_tag LOCUS_13890 8955 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 9849 9382 gene locus_tag LOCUS_13900 gene nrdR 9849 9382 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_13900 12199 9866 gene locus_tag LOCUS_13910 12199 9866 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_13910 13662 12382 gene locus_tag LOCUS_13920 13662 12382 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_13920 15212 13890 gene locus_tag LOCUS_13930 gene clpX 15212 13890 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965927.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence056 <1 632 gene locus_tag LOCUS_13940 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356788.1:glutamate--tRNA ligase 888 3107 gene locus_tag LOCUS_13950 888 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3201 4166 gene locus_tag LOCUS_13960 3201 4166 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_13960 4163 4324 gene locus_tag LOCUS_13970 4163 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5929 4397 gene locus_tag LOCUS_13980 5929 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6635 5949 gene locus_tag LOCUS_13990 6635 5949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_13990 6896 8185 gene locus_tag LOCUS_14000 6896 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8446 9759 gene locus_tag LOCUS_14010 8446 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 9776 10336 gene locus_tag LOCUS_14020 9776 10336 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_14020 10342 11061 gene locus_tag LOCUS_14030 10342 11061 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_14030 11081 12871 gene locus_tag LOCUS_14040 11081 12871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_14040 13819 12950 gene locus_tag LOCUS_14050 13819 12950 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_14050 14154 14081 gene locus_tag LOCUS_t00180 14154 14081 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14650 14231 gene locus_tag LOCUS_14060 14650 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 14776 15276 gene locus_tag LOCUS_14070 14776 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence057 818 114 gene locus_tag LOCUS_14080 818 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1296 811 gene locus_tag LOCUS_14090 1296 811 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_14090 3759 1930 gene locus_tag LOCUS_14100 3759 1930 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_14100 4256 3756 gene locus_tag LOCUS_14110 4256 3756 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_14110 4762 4343 gene locus_tag LOCUS_14120 4762 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5086 4775 gene locus_tag LOCUS_14130 5086 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5855 5109 gene locus_tag LOCUS_14140 5855 5109 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922216.1 protein_id gnl|my_center|LOCUS_14140 6753 5890 gene locus_tag LOCUS_14150 6753 5890 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_14150 7006 6821 gene locus_tag LOCUS_14160 7006 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7311 7036 gene locus_tag LOCUS_14170 7311 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8250 7324 gene locus_tag LOCUS_14180 8250 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9028 8207 gene locus_tag LOCUS_14190 9028 8207 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_14190 10614 9148 gene locus_tag LOCUS_14200 gene rlmD 10614 9148 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_14200 10795 11712 gene locus_tag LOCUS_14210 10795 11712 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_14210 11690 11827 gene locus_tag LOCUS_14220 11690 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11835 11984 gene locus_tag LOCUS_14230 11835 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 13311 12037 gene locus_tag LOCUS_14240 13311 12037 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_14240 13913 13401 gene locus_tag LOCUS_14250 13913 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence058 219 743 gene locus_tag LOCUS_14260 219 743 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_14260 740 1162 gene locus_tag LOCUS_14270 740 1162 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964881.1 protein_id gnl|my_center|LOCUS_14270 1868 2281 gene locus_tag LOCUS_14280 1868 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2403 2579 gene locus_tag LOCUS_14290 2403 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2641 3327 gene locus_tag LOCUS_14300 2641 3327 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_14300 3324 4355 gene locus_tag LOCUS_14310 3324 4355 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_14310 4499 5164 gene locus_tag LOCUS_14320 4499 5164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_14320 5178 7826 gene locus_tag LOCUS_14330 5178 7826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_14330 8038 8703 gene locus_tag LOCUS_14340 8038 8703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_14340 8716 11349 gene locus_tag LOCUS_14350 8716 11349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_14350 11987 12400 gene locus_tag LOCUS_14360 11987 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 12899 13249 gene locus_tag LOCUS_14370 12899 13249 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989608.1 protein_id gnl|my_center|LOCUS_14370 13329 13490 gene locus_tag LOCUS_14380 13329 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 13546 15219 gene locus_tag LOCUS_14390 13546 15219 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence059 1002 2525 gene locus_tag LOCUS_14400 1002 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4673 2853 gene locus_tag LOCUS_14410 gene glmS 4673 2853 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_14410 5529 4972 gene locus_tag LOCUS_14420 5529 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6395 5526 gene locus_tag LOCUS_14430 6395 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7863 6667 gene locus_tag LOCUS_14440 7863 6667 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_14440 8506 7958 gene locus_tag LOCUS_14450 8506 7958 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457104.1 protein_id gnl|my_center|LOCUS_14450 8857 8552 gene locus_tag LOCUS_14460 8857 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9377 8904 gene locus_tag LOCUS_14470 9377 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9655 9377 gene locus_tag LOCUS_14480 9655 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 9946 9701 gene locus_tag LOCUS_14490 9946 9701 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_14490 10290 10021 gene locus_tag LOCUS_14500 10290 10021 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_14500 11060 10344 gene locus_tag LOCUS_14510 11060 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 11659 11234 gene locus_tag LOCUS_14520 11659 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 12767 11832 gene locus_tag LOCUS_14530 12767 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 14202 12733 gene locus_tag LOCUS_14540 14202 12733 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460348.1 protein_id gnl|my_center|LOCUS_14540 14832 14215 gene locus_tag LOCUS_14550 14832 14215 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_14550 15296 14835 gene locus_tag LOCUS_14560 gene dtd 15296 14835 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence060 1168 488 gene locus_tag LOCUS_14570 1168 488 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_14570 1356 2408 gene locus_tag LOCUS_14580 1356 2408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_14580 2542 4026 gene locus_tag LOCUS_14590 2542 4026 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051601.1 protein_id gnl|my_center|LOCUS_14590 4310 5065 gene locus_tag LOCUS_14600 4310 5065 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957279.1 protein_id gnl|my_center|LOCUS_14600 5062 5967 gene locus_tag LOCUS_14610 gene pfkB 5062 5967 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_14610 5998 7926 gene locus_tag LOCUS_14620 5998 7926 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_14620 8189 9682 gene locus_tag LOCUS_14630 8189 9682 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_14630 9822 11192 gene locus_tag LOCUS_14640 9822 11192 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_14640 11261 13000 gene locus_tag LOCUS_14650 gene ade 11261 13000 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_14650 13182 13952 gene locus_tag LOCUS_14660 13182 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 14131 15048 gene locus_tag LOCUS_14670 14131 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence061 1222 347 gene locus_tag LOCUS_14680 gene sdaAA 1222 347 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_14680 1906 1226 gene locus_tag LOCUS_14690 gene sdaAB 1906 1226 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_14690 2207 3466 gene locus_tag LOCUS_14700 gene tig 2207 3466 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723884.1 protein_id gnl|my_center|LOCUS_14700 4288 3512 gene locus_tag LOCUS_14710 4288 3512 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022242.1 protein_id gnl|my_center|LOCUS_14710 4724 4290 gene locus_tag LOCUS_14720 4724 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7201 4859 gene locus_tag LOCUS_14730 gene feoB 7201 4859 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_14730 8388 7363 gene locus_tag LOCUS_14740 gene galE 8388 7363 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996163.1 protein_id gnl|my_center|LOCUS_14740 9767 8694 gene locus_tag LOCUS_14750 9767 8694 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_14750 13955 10011 gene locus_tag LOCUS_14760 13955 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence062 1831 353 gene locus_tag LOCUS_14770 1831 353 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_14770 3402 1855 gene locus_tag LOCUS_14780 3402 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4567 3440 gene locus_tag LOCUS_14790 gene murG 4567 3440 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_14790 5936 4623 gene locus_tag LOCUS_14800 gene spoVE 5936 4623 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_14800 6960 5965 gene locus_tag LOCUS_14810 6960 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8371 6989 gene locus_tag LOCUS_14820 8371 6989 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_14820 10955 8478 gene locus_tag LOCUS_14830 10955 8478 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_14830 11548 11069 gene locus_tag LOCUS_14840 11548 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 12553 11588 gene locus_tag LOCUS_14850 gene rsmH 12553 11588 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_14850 13010 12591 gene locus_tag LOCUS_14860 gene mraZ 13010 12591 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_14860 13700 13239 gene locus_tag LOCUS_14870 13700 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 14272 13697 gene locus_tag LOCUS_14880 gene rsmD 14272 13697 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence063 <1 1034 gene locus_tag LOCUS_14890 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399402.1:ABC transporter substrate-binding protein 1137 1988 gene locus_tag LOCUS_14900 1137 1988 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_14900 1988 2830 gene locus_tag LOCUS_14910 1988 2830 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_14910 2844 4316 gene locus_tag LOCUS_14920 gene malQ 2844 4316 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_14920 4660 5130 gene locus_tag LOCUS_14930 4660 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5165 5524 gene locus_tag LOCUS_14940 5165 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6878 5586 gene locus_tag LOCUS_14950 gene galK 6878 5586 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_14950 7079 7939 gene locus_tag LOCUS_14960 7079 7939 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 protein_id gnl|my_center|LOCUS_14960 7967 9616 gene locus_tag LOCUS_14970 gene rlmD 7967 9616 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_14970 9806 11563 gene locus_tag LOCUS_14980 9806 11563 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_14980 11567 12511 gene locus_tag LOCUS_14990 11567 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_14990 12504 13784 gene locus_tag LOCUS_15000 12504 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 13788 14636 gene locus_tag LOCUS_15010 13788 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence064 2093 774 gene locus_tag LOCUS_15020 2093 774 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_15020 3309 2131 gene locus_tag LOCUS_15030 3309 2131 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861145.1 protein_id gnl|my_center|LOCUS_15030 3731 5482 gene locus_tag LOCUS_15040 gene pyk 3731 5482 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_15040 5505 5957 gene locus_tag LOCUS_15050 5505 5957 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_15050 6942 6100 gene locus_tag LOCUS_15060 6942 6100 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823564.1 protein_id gnl|my_center|LOCUS_15060 7949 6957 gene locus_tag LOCUS_15070 7949 6957 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167747.1 protein_id gnl|my_center|LOCUS_15070 8944 8147 gene locus_tag LOCUS_15080 8944 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 10062 9019 gene locus_tag LOCUS_15090 10062 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 12224 10089 gene locus_tag LOCUS_15100 12224 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 12812 12264 gene locus_tag LOCUS_15110 gene hpt 12812 12264 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_15110 14232 12796 gene locus_tag LOCUS_15120 14232 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence065 2173 1298 gene locus_tag LOCUS_15130 2173 1298 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_15130 3074 2196 gene locus_tag LOCUS_15140 gene soj 3074 2196 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_15140 4541 3747 gene locus_tag LOCUS_15150 gene noc 4541 3747 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_15150 5403 4696 gene locus_tag LOCUS_15160 gene rsmG 5403 4696 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393994.1 protein_id gnl|my_center|LOCUS_15160 7341 5467 gene locus_tag LOCUS_15170 gene mnmG 7341 5467 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_15170 8747 7377 gene locus_tag LOCUS_15180 gene mnmE 8747 7377 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_15180 9458 10408 gene locus_tag LOCUS_15190 9458 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 11899 10754 gene locus_tag LOCUS_15200 11899 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 12979 11918 gene locus_tag LOCUS_15210 12979 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13381 13079 gene locus_tag LOCUS_15220 13381 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 13785 13378 gene locus_tag LOCUS_15230 gene rnpA 13785 13378 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_15230 14123 13989 gene locus_tag LOCUS_15240 gene rpmH 14123 13989 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001847286.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence066 731 102 gene locus_tag LOCUS_15250 731 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1323 835 gene locus_tag LOCUS_15260 1323 835 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_15260 2213 1320 gene locus_tag LOCUS_15270 2213 1320 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476527.1 protein_id gnl|my_center|LOCUS_15270 3239 2352 gene locus_tag LOCUS_15280 3239 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4222 3452 gene locus_tag LOCUS_15290 4222 3452 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15290 5336 4233 gene locus_tag LOCUS_15300 gene mnmA 5336 4233 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_15300 6727 5405 gene locus_tag LOCUS_15310 6727 5405 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_15310 7662 6724 gene locus_tag LOCUS_15320 7662 6724 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_15320 7776 7958 gene locus_tag LOCUS_15330 7776 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8993 8043 gene locus_tag LOCUS_15340 gene pyrB 8993 8043 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 protein_id gnl|my_center|LOCUS_15340 10300 8990 gene locus_tag LOCUS_15350 10300 8990 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869244.1 protein_id gnl|my_center|LOCUS_15350 10554 11465 gene locus_tag LOCUS_15360 10554 11465 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812144.1 protein_id gnl|my_center|LOCUS_15360 12402 11611 gene locus_tag LOCUS_15370 12402 11611 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_15370 12585 12995 gene locus_tag LOCUS_15380 12585 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 14344 13463 gene locus_tag LOCUS_15390 14344 13463 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920915.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence067 754 155 gene locus_tag LOCUS_15400 gene pgsA 754 155 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_15400 2100 775 gene locus_tag LOCUS_15410 gene rimO 2100 775 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_15410 2666 2157 gene locus_tag LOCUS_15420 2666 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3842 2667 gene locus_tag LOCUS_15430 gene recA 3842 2667 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_15430 4930 3959 gene locus_tag LOCUS_15440 gene prmC 4930 3959 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973616.1 protein_id gnl|my_center|LOCUS_15440 5871 4924 gene locus_tag LOCUS_15450 5871 4924 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_15450 7427 6003 gene locus_tag LOCUS_15460 7427 6003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_15460 8222 7518 gene locus_tag LOCUS_15470 8222 7518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814304.1 protein_id gnl|my_center|LOCUS_15470 9553 8240 gene locus_tag LOCUS_15480 9553 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 9814 9629 gene locus_tag LOCUS_15490 9814 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 10195 9854 gene locus_tag LOCUS_15500 gene rplQ 10195 9854 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_15500 11179 10223 gene locus_tag LOCUS_15510 11179 10223 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_15510 11893 11291 gene locus_tag LOCUS_15520 gene rpsD 11893 11291 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_15520 12324 11914 gene locus_tag LOCUS_15530 gene rpsK 12324 11914 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_15530 12710 12339 gene locus_tag LOCUS_15540 gene rpsM 12710 12339 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357564.1 protein_id gnl|my_center|LOCUS_15540 12736 12930 gene locus_tag LOCUS_15550 12736 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 13193 12942 gene locus_tag LOCUS_15560 gene infA 13193 12942 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_15560 13457 13323 gene locus_tag LOCUS_15570 13457 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 <14347 13689 gene locus_tag LOCUS_15580 <14347 13689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545375.1:type I methionyl aminopeptidase >Feature sequence068 1092 1469 gene locus_tag LOCUS_15590 1092 1469 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_15590 1462 2160 gene locus_tag LOCUS_15600 1462 2160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_15600 2154 2972 gene locus_tag LOCUS_15610 2154 2972 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262156.1 protein_id gnl|my_center|LOCUS_15610 3598 3041 gene locus_tag LOCUS_15620 3598 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4196 3756 gene locus_tag LOCUS_15630 4196 3756 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_15630 5993 4728 gene locus_tag LOCUS_15640 gene hflX 5993 4728 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_15640 6598 5990 gene locus_tag LOCUS_15650 6598 5990 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 protein_id gnl|my_center|LOCUS_15650 6750 8534 gene locus_tag LOCUS_15660 6750 8534 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_15660 8560 9546 gene locus_tag LOCUS_15670 8560 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 9543 11072 gene locus_tag LOCUS_15680 9543 11072 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_15680 11069 12055 gene locus_tag LOCUS_15690 11069 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12016 12204 gene locus_tag LOCUS_15700 12016 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence069 1570 11 gene locus_tag LOCUS_15710 gene cls 1570 11 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_15710 2134 1886 gene locus_tag LOCUS_15720 2134 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2688 2485 gene locus_tag LOCUS_15730 2688 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3011 3110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3700 4152 gene locus_tag LOCUS_15740 3700 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4688 5176 gene locus_tag LOCUS_15750 4688 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 5537 5764 gene locus_tag LOCUS_15760 5537 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5900 6571 gene locus_tag LOCUS_15770 5900 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6562 7383 gene locus_tag LOCUS_15780 6562 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460981.1 protein_id gnl|my_center|LOCUS_15780 7481 7636 gene locus_tag LOCUS_15790 7481 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7762 9495 gene locus_tag LOCUS_15800 7762 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 9633 9559 gene locus_tag LOCUS_t00190 9633 9559 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10742 9915 gene locus_tag LOCUS_15810 10742 9915 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_15810 14057 10851 gene locus_tag LOCUS_15820 14057 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence070 1756 419 gene locus_tag LOCUS_15830 1756 419 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_15830 2031 1954 gene locus_tag LOCUS_t00200 2031 1954 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5055 2188 gene locus_tag LOCUS_15840 gene uvrA 5055 2188 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_15840 7099 5042 gene locus_tag LOCUS_15850 gene uvrB 7099 5042 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_15850 7912 7193 gene locus_tag LOCUS_15860 gene radC 7912 7193 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_15860 8082 9071 gene locus_tag LOCUS_15870 8082 9071 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_15870 10511 9144 gene locus_tag LOCUS_15880 10511 9144 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_15880 11227 10508 gene locus_tag LOCUS_15890 11227 10508 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460542.1 protein_id gnl|my_center|LOCUS_15890 11393 12319 gene locus_tag LOCUS_15900 11393 12319 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_15900 12321 13070 gene locus_tag LOCUS_15910 12321 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence071 1 267 gene locus_tag LOCUS_15920 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 341 916 gene locus_tag LOCUS_15930 341 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1390 1103 gene locus_tag LOCUS_15940 1390 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1612 2511 gene locus_tag LOCUS_15950 1612 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4230 2569 gene locus_tag LOCUS_15960 4230 2569 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_15960 4527 5678 gene locus_tag LOCUS_15970 4527 5678 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_15970 5977 7176 gene locus_tag LOCUS_15980 gene thiI 5977 7176 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_15980 7184 8503 gene locus_tag LOCUS_15990 7184 8503 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438532.1 protein_id gnl|my_center|LOCUS_15990 8537 9451 gene locus_tag LOCUS_16000 8537 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 9608 9532 gene locus_tag LOCUS_t00210 9608 9532 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9762 11159 gene locus_tag LOCUS_16010 9762 11159 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_16010 11227 11433 gene locus_tag LOCUS_16020 11227 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 13552 11405 gene locus_tag LOCUS_16030 13552 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence072 792 478 gene locus_tag LOCUS_16040 792 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1014 1250 gene locus_tag LOCUS_16050 1014 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1273 2010 gene locus_tag LOCUS_16060 1273 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2047 2313 gene locus_tag LOCUS_16070 2047 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2344 2619 gene locus_tag LOCUS_16080 2344 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2647 3567 gene locus_tag LOCUS_16090 2647 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3634 3798 gene locus_tag LOCUS_16100 3634 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3816 4364 gene locus_tag LOCUS_16110 3816 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4435 5409 gene locus_tag LOCUS_16120 4435 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5411 6559 gene locus_tag LOCUS_16130 5411 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 6586 11214 gene locus_tag LOCUS_16140 6586 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 11228 12265 gene locus_tag LOCUS_16150 11228 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 12293 12541 gene locus_tag LOCUS_16160 12293 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence073 1519 1196 gene locus_tag LOCUS_16170 1519 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2480 1596 gene locus_tag LOCUS_16180 2480 1596 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_16180 3856 2477 gene locus_tag LOCUS_16190 3856 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5066 3993 gene locus_tag LOCUS_16200 5066 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5960 5085 gene locus_tag LOCUS_16210 5960 5085 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_16210 6116 5979 gene locus_tag LOCUS_16220 6116 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8290 6131 gene locus_tag LOCUS_16230 8290 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 9334 8312 gene locus_tag LOCUS_16240 9334 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 10091 9324 gene locus_tag LOCUS_16250 10091 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 11427 10177 gene locus_tag LOCUS_16260 11427 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 12025 11450 gene locus_tag LOCUS_16270 12025 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence074 492 1904 gene locus_tag LOCUS_16280 492 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2278 1979 gene locus_tag LOCUS_16290 2278 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2577 2275 gene locus_tag LOCUS_16300 2577 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3067 2729 gene locus_tag LOCUS_16310 gene mobC 3067 2729 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_16310 3876 3070 gene locus_tag LOCUS_16320 3876 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5746 3878 gene locus_tag LOCUS_16330 5746 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16330 11379 5743 gene locus_tag LOCUS_16340 11379 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 5761 5860 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11888 11532 gene locus_tag LOCUS_16350 11888 11532 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_16350 12196 12642 gene locus_tag LOCUS_16360 12196 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 13533 12742 gene locus_tag LOCUS_16370 13533 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence075 1270 89 gene locus_tag LOCUS_16380 1270 89 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_16380 2730 1393 gene locus_tag LOCUS_16390 gene rmuC 2730 1393 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_16390 4254 2791 gene locus_tag LOCUS_16400 4254 2791 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_16400 5346 4279 gene locus_tag LOCUS_16410 5346 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5538 6056 gene locus_tag LOCUS_16420 5538 6056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_16420 6729 6205 gene locus_tag LOCUS_16430 6729 6205 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_16430 7210 6770 gene locus_tag LOCUS_16440 7210 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 8125 7349 gene locus_tag LOCUS_16450 8125 7349 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_16450 8617 8126 gene locus_tag LOCUS_16460 8617 8126 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_16460 8887 10815 gene locus_tag LOCUS_16470 gene htpG 8887 10815 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_16470 11022 12128 gene locus_tag LOCUS_16480 11022 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence076 608 1273 gene locus_tag LOCUS_16490 608 1273 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_16490 1411 2898 gene locus_tag LOCUS_16500 1411 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2895 3686 gene locus_tag LOCUS_16510 2895 3686 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_16510 3911 4936 gene locus_tag LOCUS_16520 3911 4936 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288260.1 protein_id gnl|my_center|LOCUS_16520 4948 5502 gene locus_tag LOCUS_16530 4948 5502 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015052.1 protein_id gnl|my_center|LOCUS_16530 5506 6807 gene locus_tag LOCUS_16540 5506 6807 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804397.1 protein_id gnl|my_center|LOCUS_16540 6933 7919 gene locus_tag LOCUS_16550 6933 7919 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 protein_id gnl|my_center|LOCUS_16550 8958 8062 gene locus_tag LOCUS_16560 8958 8062 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_16560 9075 10466 gene locus_tag LOCUS_16570 9075 10466 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088187.1 protein_id gnl|my_center|LOCUS_16570 10666 11634 gene locus_tag LOCUS_16580 10666 11634 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 protein_id gnl|my_center|LOCUS_16580 11700 12827 gene locus_tag LOCUS_16590 11700 12827 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence077 341 1018 gene locus_tag LOCUS_16600 341 1018 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_16600 1224 2666 gene locus_tag LOCUS_16610 1224 2666 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_16610 2739 4055 gene locus_tag LOCUS_16620 2739 4055 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_16620 4236 4706 gene locus_tag LOCUS_16630 4236 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 7101 4789 gene locus_tag LOCUS_16640 7101 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 8911 7127 gene locus_tag LOCUS_16650 8911 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 10344 9223 gene locus_tag LOCUS_16660 10344 9223 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_16660 10586 11929 gene locus_tag LOCUS_16670 10586 11929 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence078 2061 871 gene locus_tag LOCUS_16680 2061 871 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048209.1 protein_id gnl|my_center|LOCUS_16680 2530 3201 gene locus_tag LOCUS_16690 gene cysE 2530 3201 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_16690 5652 3277 gene locus_tag LOCUS_16700 5652 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6659 6102 gene locus_tag LOCUS_16710 6659 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7917 6739 gene locus_tag LOCUS_16720 gene ftsZ 7917 6739 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_16720 9335 8004 gene locus_tag LOCUS_16730 gene murA 9335 8004 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920208.1 protein_id gnl|my_center|LOCUS_16730 10646 9516 gene locus_tag LOCUS_16740 gene spoVE 10646 9516 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_16740 10748 12631 gene locus_tag LOCUS_16750 10748 12631 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence079 5094 1231 gene locus_tag LOCUS_16760 gene rpoB 5094 1231 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_16760 6652 5570 gene locus_tag LOCUS_16770 gene rpoD 6652 5570 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_16770 8476 6701 gene locus_tag LOCUS_16780 gene dnaG 8476 6701 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_16780 9500 8502 gene locus_tag LOCUS_16790 9500 8502 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_16790 10263 9643 gene locus_tag LOCUS_16800 10263 9643 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_16800 11315 10377 gene locus_tag LOCUS_16810 11315 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 <12567 11863 gene locus_tag LOCUS_16820 <12567 11863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986692.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence080 1732 1274 gene locus_tag LOCUS_16830 1732 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2774 1737 gene locus_tag LOCUS_16840 2774 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4559 2952 gene locus_tag LOCUS_16850 4559 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5388 4594 gene locus_tag LOCUS_16860 5388 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6570 5455 gene locus_tag LOCUS_16870 6570 5455 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 protein_id gnl|my_center|LOCUS_16870 6945 8414 gene locus_tag LOCUS_16880 6945 8414 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_16880 8442 8684 gene locus_tag LOCUS_16890 8442 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 8691 9899 gene locus_tag LOCUS_16900 8691 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 10042 11181 gene locus_tag LOCUS_16910 10042 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 11942 11322 gene locus_tag LOCUS_16920 11942 11322 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957156.1 protein_id gnl|my_center|LOCUS_16920 12018 12242 gene locus_tag LOCUS_16930 12018 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence081 2109 1264 gene locus_tag LOCUS_16940 2109 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3149 2109 gene locus_tag LOCUS_16950 3149 2109 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_16950 4713 3151 gene locus_tag LOCUS_16960 4713 3151 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_16960 4999 5541 gene locus_tag LOCUS_16970 4999 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6855 5608 gene locus_tag LOCUS_16980 6855 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7363 7130 gene locus_tag LOCUS_16990 7363 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8573 7449 gene locus_tag LOCUS_17000 8573 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8893 8570 gene locus_tag LOCUS_17010 8893 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 9972 8896 gene locus_tag LOCUS_17020 9972 8896 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_17020 10162 9977 gene locus_tag LOCUS_17030 10162 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 10496 10999 gene locus_tag LOCUS_17040 10496 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 <12508 11157 gene locus_tag LOCUS_17050 <12508 11157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048241.1:glutamine-hydrolyzing GMP synthase >Feature sequence082 3 1661 gene locus_tag LOCUS_17060 3 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1974 3866 gene locus_tag LOCUS_17070 1974 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5168 3933 gene locus_tag LOCUS_17080 5168 3933 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_17080 5658 5371 gene locus_tag LOCUS_17090 5658 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6090 5758 gene locus_tag LOCUS_17100 gene mobC 6090 5758 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_17100 <12504 6087 gene locus_tag LOCUS_17110 <12504 6087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein >Feature sequence083 974 129 gene locus_tag LOCUS_17120 974 129 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 protein_id gnl|my_center|LOCUS_17120 1544 1344 gene locus_tag LOCUS_17130 1544 1344 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_17130 2590 1544 gene locus_tag LOCUS_17140 2590 1544 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_17140 4011 2761 gene locus_tag LOCUS_17150 4011 2761 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_17150 4511 4089 gene locus_tag LOCUS_17160 4511 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5698 4514 gene locus_tag LOCUS_17170 5698 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 6435 5695 gene locus_tag LOCUS_17180 6435 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17180 6675 6436 gene locus_tag LOCUS_17190 6675 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 7475 6897 gene locus_tag LOCUS_17200 7475 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 8861 7506 gene locus_tag LOCUS_17210 8861 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 10301 8871 gene locus_tag LOCUS_17220 10301 8871 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_17220 10950 10321 gene locus_tag LOCUS_17230 10950 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11907 11239 gene locus_tag LOCUS_17240 11907 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 12155 12298 gene locus_tag LOCUS_17250 12155 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence084 424 846 gene locus_tag LOCUS_17260 424 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 856 1302 gene locus_tag LOCUS_17270 856 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1302 1502 gene locus_tag LOCUS_17280 1302 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1426 1872 gene locus_tag LOCUS_17290 1426 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1902 2360 gene locus_tag LOCUS_17300 1902 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2357 2665 gene locus_tag LOCUS_17310 2357 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2713 4560 gene locus_tag LOCUS_17320 2713 4560 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_17320 4640 4831 gene locus_tag LOCUS_17330 4640 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4965 5261 gene locus_tag LOCUS_17340 4965 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5344 5736 gene locus_tag LOCUS_17350 5344 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5866 6165 gene locus_tag LOCUS_17360 5866 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6762 7904 gene locus_tag LOCUS_17370 6762 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 8597 7965 gene locus_tag LOCUS_17380 8597 7965 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272479.1 protein_id gnl|my_center|LOCUS_17380 8686 10587 gene locus_tag LOCUS_17390 8686 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 10712 12151 gene locus_tag LOCUS_17400 10712 12151 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence085 171 1034 gene locus_tag LOCUS_17410 171 1034 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261883.1 protein_id gnl|my_center|LOCUS_17410 1039 1719 gene locus_tag LOCUS_17420 1039 1719 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_17420 1701 2651 gene locus_tag LOCUS_17430 1701 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3777 2842 gene locus_tag LOCUS_17440 3777 2842 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_17440 4050 3799 gene locus_tag LOCUS_17450 4050 3799 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_17450 5597 4302 gene locus_tag LOCUS_17460 5597 4302 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_17460 6943 5915 gene locus_tag LOCUS_17470 6943 5915 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_17470 7194 8768 gene locus_tag LOCUS_17480 7194 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 9509 8946 gene locus_tag LOCUS_17490 gene nrdG 9509 8946 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148220968.1 protein_id gnl|my_center|LOCUS_17490 11764 9593 gene locus_tag LOCUS_17500 gene nrdD 11764 9593 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905257.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence086 1440 517 gene locus_tag LOCUS_17510 gene ylqF 1440 517 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_17510 1988 1437 gene locus_tag LOCUS_17520 gene lepB 1988 1437 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774995.1 protein_id gnl|my_center|LOCUS_17520 2435 2094 gene locus_tag LOCUS_17530 gene rplS 2435 2094 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_17530 3297 2653 gene locus_tag LOCUS_17540 3297 2653 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_17540 5131 3272 gene locus_tag LOCUS_17550 5131 3272 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_17550 5678 5169 gene locus_tag LOCUS_17560 5678 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6205 5675 gene locus_tag LOCUS_17570 6205 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8726 6333 gene locus_tag LOCUS_17580 8726 6333 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_17580 9124 8780 gene locus_tag LOCUS_17590 9124 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 10034 9207 gene locus_tag LOCUS_17600 10034 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10963 10031 gene locus_tag LOCUS_17610 10963 10031 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_17610 11449 10967 gene locus_tag LOCUS_17620 gene lspA 11449 10967 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_17620 12149 11541 gene locus_tag LOCUS_17630 12149 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence087 1617 445 gene locus_tag LOCUS_17640 1617 445 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933903.1 protein_id gnl|my_center|LOCUS_17640 1854 1777 gene locus_tag LOCUS_t00220 1854 1777 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2799 2005 gene locus_tag LOCUS_17650 2799 2005 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_17650 4976 2799 gene locus_tag LOCUS_17660 4976 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 6228 5017 gene locus_tag LOCUS_17670 6228 5017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_17670 6974 6225 gene locus_tag LOCUS_17680 6974 6225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_17680 8782 6989 gene locus_tag LOCUS_17690 8782 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 9626 9225 gene locus_tag LOCUS_17700 9626 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 11539 9623 gene locus_tag LOCUS_17710 11539 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence088 821 2260 gene locus_tag LOCUS_17720 821 2260 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964717.1 protein_id gnl|my_center|LOCUS_17720 2341 3372 gene locus_tag LOCUS_17730 2341 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3915 3445 gene locus_tag LOCUS_17740 gene fabZ 3915 3445 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 protein_id gnl|my_center|LOCUS_17740 5157 3919 gene locus_tag LOCUS_17750 gene fabF 5157 3919 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_17750 5919 5170 gene locus_tag LOCUS_17760 gene fabG 5919 5170 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_17760 6848 5916 gene locus_tag LOCUS_17770 gene fabD 6848 5916 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_17770 7912 6845 gene locus_tag LOCUS_17780 7912 6845 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_17780 8841 7906 gene locus_tag LOCUS_17790 8841 7906 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_17790 9797 8847 gene locus_tag LOCUS_17800 9797 8847 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_17800 10753 9794 gene locus_tag LOCUS_17810 gene accA 10753 9794 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818803.1 protein_id gnl|my_center|LOCUS_17810 11625 10768 gene locus_tag LOCUS_17820 gene accD 11625 10768 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773830.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence089 1402 344 gene locus_tag LOCUS_17830 1402 344 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_17830 1914 1651 gene locus_tag LOCUS_17840 1914 1651 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905918.1 protein_id gnl|my_center|LOCUS_17840 2325 1918 gene locus_tag LOCUS_17850 2325 1918 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_17850 2747 2343 gene locus_tag LOCUS_17860 2747 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3055 2900 gene locus_tag LOCUS_17870 3055 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3404 3057 gene locus_tag LOCUS_17880 3404 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4522 3356 gene locus_tag LOCUS_17890 4522 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5233 4847 gene locus_tag LOCUS_17900 5233 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 6761 5433 gene locus_tag LOCUS_17910 6761 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 7615 6758 gene locus_tag LOCUS_17920 7615 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 8756 7608 gene locus_tag LOCUS_17930 8756 7608 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_17930 9066 8749 gene locus_tag LOCUS_17940 9066 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9455 9063 gene locus_tag LOCUS_17950 9455 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 10073 9468 gene locus_tag LOCUS_17960 10073 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 11140 10070 gene locus_tag LOCUS_17970 11140 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 11352 11143 gene locus_tag LOCUS_17980 11352 11143 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272385.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence090 821 69 gene locus_tag LOCUS_17990 821 69 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 protein_id gnl|my_center|LOCUS_17990 1794 826 gene locus_tag LOCUS_18000 gene yclO 1794 826 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_18000 2762 1791 gene locus_tag LOCUS_18010 2762 1791 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454520.1 protein_id gnl|my_center|LOCUS_18010 3651 3148 gene locus_tag LOCUS_18020 3651 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3955 5355 gene locus_tag LOCUS_18030 3955 5355 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_18030 5629 5543 gene locus_tag LOCUS_t00230 5629 5543 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6028 6405 gene locus_tag LOCUS_18040 6028 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6422 7375 gene locus_tag LOCUS_18050 6422 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 8079 7492 gene locus_tag LOCUS_18060 8079 7492 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347516.1 protein_id gnl|my_center|LOCUS_18060 9256 8264 gene locus_tag LOCUS_18070 9256 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 10085 9264 gene locus_tag LOCUS_18080 10085 9264 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence091 1729 251 gene locus_tag LOCUS_18090 1729 251 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_18090 6279 1744 gene locus_tag LOCUS_18100 gene gltB 6279 1744 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_18100 8241 6664 gene locus_tag LOCUS_18110 gene hcp 8241 6664 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_18110 9707 8355 gene locus_tag LOCUS_18120 gene gdhA 9707 8355 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_18120 10934 10101 gene locus_tag LOCUS_18130 10934 10101 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence092 530 1252 gene locus_tag LOCUS_18140 530 1252 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_18140 1344 1973 gene locus_tag LOCUS_18150 1344 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2001 2963 gene locus_tag LOCUS_18160 2001 2963 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 protein_id gnl|my_center|LOCUS_18160 3089 3580 gene locus_tag LOCUS_18170 3089 3580 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_18170 4343 3651 gene locus_tag LOCUS_18180 4343 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6959 4347 gene locus_tag LOCUS_18190 6959 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 7963 7085 gene locus_tag LOCUS_18200 7963 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 8852 7968 gene locus_tag LOCUS_18210 8852 7968 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_18210 8988 8845 gene locus_tag LOCUS_18220 8988 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 9137 9814 gene locus_tag LOCUS_18230 9137 9814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence093 1513 173 gene locus_tag LOCUS_18240 1513 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1717 1532 gene locus_tag LOCUS_18250 1717 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3585 1705 gene locus_tag LOCUS_18260 3585 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3981 3598 gene locus_tag LOCUS_18270 3981 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4259 4047 gene locus_tag LOCUS_18280 4259 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5268 4270 gene locus_tag LOCUS_18290 5268 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6219 5293 gene locus_tag LOCUS_18300 6219 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8005 6221 gene locus_tag LOCUS_18310 8005 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 9476 8031 gene locus_tag LOCUS_18320 9476 8031 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_18320 9760 9473 gene locus_tag LOCUS_18330 9760 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence094 331 116 gene locus_tag LOCUS_18340 331 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 3617 333 gene locus_tag LOCUS_18350 3617 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3902 3624 gene locus_tag LOCUS_18360 3902 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6007 3899 gene locus_tag LOCUS_18370 6007 3899 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_18370 6958 6194 gene locus_tag LOCUS_18380 6958 6194 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_18380 7205 6948 gene locus_tag LOCUS_18390 7205 6948 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 protein_id gnl|my_center|LOCUS_18390 8970 7234 gene locus_tag LOCUS_18400 8970 7234 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_18400 9343 8963 gene locus_tag LOCUS_18410 9343 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 <10776 9343 gene locus_tag LOCUS_18420 <10776 9343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein >Feature sequence095 2842 431 gene locus_tag LOCUS_18430 gene pheT 2842 431 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_18430 4038 2932 gene locus_tag LOCUS_18440 gene pheS 4038 2932 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_18440 3061 3160 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5512 4385 gene locus_tag LOCUS_18450 5512 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5583 5870 gene locus_tag LOCUS_18460 5583 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5880 7016 gene locus_tag LOCUS_18470 5880 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 8144 7239 gene locus_tag LOCUS_18480 gene hslO 8144 7239 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_18480 8897 8148 gene locus_tag LOCUS_18490 8897 8148 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_18490 9504 8902 gene locus_tag LOCUS_18500 gene yihA 9504 8902 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_18500 <10707 9526 gene locus_tag LOCUS_18510 <10707 9526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000097289.1:endopeptidase La >Feature sequence096 537 175 gene locus_tag LOCUS_18520 537 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1332 649 gene locus_tag LOCUS_18530 1332 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1542 1420 gene locus_tag LOCUS_18540 1542 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2324 1608 gene locus_tag LOCUS_18550 2324 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3317 2385 gene locus_tag LOCUS_18560 3317 2385 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_18560 3652 3314 gene locus_tag LOCUS_18570 3652 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4598 3663 gene locus_tag LOCUS_18580 4598 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4958 6439 gene locus_tag LOCUS_18590 4958 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6570 8279 gene locus_tag LOCUS_18600 6570 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 8276 8788 gene locus_tag LOCUS_18610 8276 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 8831 9031 gene locus_tag LOCUS_18620 8831 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 9172 9324 gene locus_tag LOCUS_18630 9172 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 9336 10331 gene locus_tag LOCUS_18640 9336 10331 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence097 183 383 gene locus_tag LOCUS_18650 183 383 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_18650 517 1716 gene locus_tag LOCUS_18660 517 1716 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_18660 1899 2348 gene locus_tag LOCUS_18670 1899 2348 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18670 2362 2949 gene locus_tag LOCUS_18680 2362 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3423 4151 gene locus_tag LOCUS_18690 3423 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4166 4918 gene locus_tag LOCUS_18700 4166 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_18700 6073 5225 gene locus_tag LOCUS_18710 6073 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 6843 6169 gene locus_tag LOCUS_18720 6843 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9268 6848 gene locus_tag LOCUS_18730 9268 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 9519 9445 gene locus_tag LOCUS_t00240 9519 9445 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 869 1585 gene locus_tag LOCUS_18740 869 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2012 4672 gene locus_tag LOCUS_18750 gene alaS 2012 4672 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_18750 4751 5083 gene locus_tag LOCUS_18760 4751 5083 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_18760 5111 5650 gene locus_tag LOCUS_18770 5111 5650 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_18770 5741 7780 gene locus_tag LOCUS_18780 5741 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7849 8877 gene locus_tag LOCUS_18790 7849 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 8877 9488 gene locus_tag LOCUS_18800 8877 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10176 9493 gene locus_tag LOCUS_18810 gene sigE 10176 9493 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence099 1625 1266 gene locus_tag LOCUS_18820 1625 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1816 2538 gene locus_tag LOCUS_18830 1816 2538 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_18830 2538 3854 gene locus_tag LOCUS_18840 2538 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 6095 4368 gene locus_tag LOCUS_18850 6095 4368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772887.1 protein_id gnl|my_center|LOCUS_18850 7868 6099 gene locus_tag LOCUS_18860 7868 6099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_18860 8654 7938 gene locus_tag LOCUS_18870 8654 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 9711 8728 gene locus_tag LOCUS_18880 9711 8728 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_18880 <10417 9761 gene locus_tag LOCUS_18890 <10417 9761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680020.1:acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein >Feature sequence100 <1 812 gene locus_tag LOCUS_18900 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426959.1:ribosome biogenesis GTPase Der 831 1493 gene locus_tag LOCUS_18910 gene plsY 831 1493 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_18910 2090 1560 gene locus_tag LOCUS_18920 2090 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3182 2178 gene locus_tag LOCUS_18930 3182 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4828 3200 gene locus_tag LOCUS_18940 4828 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 6339 4951 gene locus_tag LOCUS_18950 6339 4951 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_18950 6620 7474 gene locus_tag LOCUS_18960 6620 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 8435 7545 gene locus_tag LOCUS_18970 8435 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 8647 8556 gene locus_tag LOCUS_t00250 8647 8556 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8910 9929 gene locus_tag LOCUS_18980 8910 9929 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence101 204 1043 gene locus_tag LOCUS_18990 204 1043 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_18990 1090 2388 gene locus_tag LOCUS_19000 1090 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2385 4223 gene locus_tag LOCUS_19010 2385 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4220 5419 gene locus_tag LOCUS_19020 4220 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5434 6546 gene locus_tag LOCUS_19030 5434 6546 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_19030 6595 7974 gene locus_tag LOCUS_19040 6595 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 7993 9012 gene locus_tag LOCUS_19050 7993 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 9375 9088 gene locus_tag LOCUS_19060 9375 9088 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence102 <1 711 gene locus_tag LOCUS_19070 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054937112.1:mannitol dehydrogenase family protein 1439 909 gene locus_tag LOCUS_19080 1439 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1751 3280 gene locus_tag LOCUS_19090 1751 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3277 4092 gene locus_tag LOCUS_19100 3277 4092 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_19100 4089 5093 gene locus_tag LOCUS_19110 4089 5093 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529042.1 protein_id gnl|my_center|LOCUS_19110 5379 6473 gene locus_tag LOCUS_19120 5379 6473 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_19120 6571 7092 gene locus_tag LOCUS_19130 6571 7092 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972786.1 protein_id gnl|my_center|LOCUS_19130 7094 8434 gene locus_tag LOCUS_19140 7094 8434 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_19140 8604 10205 gene locus_tag LOCUS_19150 8604 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence103 <1 605 gene locus_tag LOCUS_19160 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025774280.1:RNA polymerase sporulation sigma factor SigE 763 1530 gene locus_tag LOCUS_19170 gene sigG 763 1530 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774282.1 protein_id gnl|my_center|LOCUS_19170 1908 1660 gene locus_tag LOCUS_19180 gene spoIIID 1908 1660 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_19180 2205 2771 gene locus_tag LOCUS_19190 gene thiT 2205 2771 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_19190 3055 3130 gene locus_tag LOCUS_t00260 3055 3130 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4908 3310 gene locus_tag LOCUS_19200 4908 3310 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_19200 5232 5047 gene locus_tag LOCUS_19210 5232 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 6158 5340 gene locus_tag LOCUS_19220 6158 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460981.1 protein_id gnl|my_center|LOCUS_19220 6826 6149 gene locus_tag LOCUS_19230 6826 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 7188 6961 gene locus_tag LOCUS_19240 7188 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 8123 7635 gene locus_tag LOCUS_19250 8123 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 8167 8358 gene locus_tag LOCUS_19260 8167 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 9968 8643 gene locus_tag LOCUS_19270 9968 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence104 286 116 gene locus_tag LOCUS_19280 286 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 861 3524 gene locus_tag LOCUS_19290 gene mgtA 861 3524 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861944.1 protein_id gnl|my_center|LOCUS_19290 3540 4037 gene locus_tag LOCUS_19300 3540 4037 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861943.1 protein_id gnl|my_center|LOCUS_19300 4140 4817 gene locus_tag LOCUS_19310 4140 4817 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898609.1 protein_id gnl|my_center|LOCUS_19310 4864 5175 gene locus_tag LOCUS_19320 4864 5175 CDS product DUF3784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898605.1 protein_id gnl|my_center|LOCUS_19320 5193 7973 gene locus_tag LOCUS_19330 gene mgtA 5193 7973 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_19330 7986 8159 gene locus_tag LOCUS_19340 7986 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006566804.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence105 2952 1657 gene locus_tag LOCUS_19350 gene mtaB 2952 1657 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_19350 3469 3134 gene locus_tag LOCUS_19360 3469 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3698 4930 gene locus_tag LOCUS_19370 gene dacF 3698 4930 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_19370 5156 6487 gene locus_tag LOCUS_19380 5156 6487 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_19380 6550 6954 gene locus_tag LOCUS_19390 6550 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_19390 7100 7603 gene locus_tag LOCUS_19400 7100 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7627 7806 gene locus_tag LOCUS_19410 gene rpmF 7627 7806 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_19410 7899 9236 gene locus_tag LOCUS_19420 7899 9236 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence106 643 1815 gene locus_tag LOCUS_19430 gene dnaJ 643 1815 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_19430 2296 1967 gene locus_tag LOCUS_19440 2296 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2726 2373 gene locus_tag LOCUS_19450 2726 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4122 2950 gene locus_tag LOCUS_19460 4122 2950 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_19460 5553 4135 gene locus_tag LOCUS_19470 5553 4135 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_19470 6358 5789 gene locus_tag LOCUS_19480 6358 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 7318 6500 gene locus_tag LOCUS_19490 7318 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 7398 7847 gene locus_tag LOCUS_19500 gene spoVAC 7398 7847 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_19500 7937 8953 gene locus_tag LOCUS_19510 gene spoVAD 7937 8953 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_19510 8955 9311 gene locus_tag LOCUS_19520 gene spoVAE 8955 9311 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_19520 9387 9638 gene locus_tag LOCUS_19530 9387 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence107 395 514 gene locus_tag LOCUS_19540 395 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 529 1671 gene locus_tag LOCUS_19550 529 1671 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_19550 1998 3905 gene locus_tag LOCUS_19560 1998 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 4113 4817 gene locus_tag LOCUS_19570 4113 4817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_19570 4811 8089 gene locus_tag LOCUS_19580 4811 8089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_19580 9547 8177 gene locus_tag LOCUS_19590 9547 8177 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence108 1867 536 gene locus_tag LOCUS_19600 1867 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2542 1949 gene locus_tag LOCUS_19610 2542 1949 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_19610 3333 2539 gene locus_tag LOCUS_19620 3333 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 6055 3476 gene locus_tag LOCUS_19630 6055 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 6872 6045 gene locus_tag LOCUS_19640 6872 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 8995 6890 gene locus_tag LOCUS_19650 8995 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence109 350 1501 gene locus_tag LOCUS_19660 350 1501 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_19660 1901 2236 gene locus_tag LOCUS_19670 1901 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2598 2272 gene locus_tag LOCUS_19680 2598 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2570 4438 gene locus_tag LOCUS_19690 2570 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4684 4974 gene locus_tag LOCUS_19700 4684 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5750 5100 gene locus_tag LOCUS_19710 5750 5100 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_19710 7718 5787 gene locus_tag LOCUS_19720 7718 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7898 8461 gene locus_tag LOCUS_19730 7898 8461 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_19730 8490 9026 gene locus_tag LOCUS_19740 8490 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9192 9268 gene locus_tag LOCUS_t00270 9192 9268 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 678 175 gene locus_tag LOCUS_19750 678 175 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_19750 1316 666 gene locus_tag LOCUS_19760 1316 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2697 1396 gene locus_tag LOCUS_19770 2697 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3002 2808 gene locus_tag LOCUS_19780 3002 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3225 3007 gene locus_tag LOCUS_19790 3225 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4287 3244 gene locus_tag LOCUS_19800 gene mutY 4287 3244 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_19800 5762 4374 gene locus_tag LOCUS_19810 gene asnS 5762 4374 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_19810 6217 6765 gene locus_tag LOCUS_19820 6217 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8070 6943 gene locus_tag LOCUS_19830 8070 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 8873 8088 gene locus_tag LOCUS_19840 8873 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence111 77 1591 gene locus_tag LOCUS_19850 77 1591 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_19850 1815 3332 gene locus_tag LOCUS_19860 1815 3332 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_19860 3525 3608 gene locus_tag LOCUS_t00280 3525 3608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3730 4698 gene locus_tag LOCUS_19870 gene xerD 3730 4698 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_19870 4773 6581 gene locus_tag LOCUS_19880 4773 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 7887 7528 gene locus_tag LOCUS_19890 7887 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence112 135 1637 gene locus_tag LOCUS_19900 135 1637 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_19900 1794 2810 gene locus_tag LOCUS_19910 1794 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 4047 3130 gene locus_tag LOCUS_19920 4047 3130 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_19920 4273 6186 gene locus_tag LOCUS_19930 4273 6186 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_19930 7633 6272 gene locus_tag LOCUS_19940 7633 6272 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_19940 7855 7779 gene locus_tag LOCUS_t00290 7855 7779 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8702 7926 gene locus_tag LOCUS_19950 8702 7926 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919801.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence113 1220 423 gene locus_tag LOCUS_19960 gene proB 1220 423 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_19960 2034 1228 gene locus_tag LOCUS_19970 gene proC 2034 1228 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_19970 2305 2880 gene locus_tag LOCUS_19980 2305 2880 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_19980 3049 4479 gene locus_tag LOCUS_19990 3049 4479 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_19990 6099 4840 gene locus_tag LOCUS_20000 6099 4840 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_20000 7497 6151 gene locus_tag LOCUS_20010 7497 6151 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_20010 8000 8500 gene locus_tag LOCUS_20020 gene coaD 8000 8500 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence114 753 118 gene locus_tag LOCUS_20030 753 118 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_20030 1126 743 gene locus_tag LOCUS_20040 1126 743 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_20040 2264 1290 gene locus_tag LOCUS_20050 gene pfkA 2264 1290 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_20050 6046 2537 gene locus_tag LOCUS_20060 6046 2537 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_20060 6975 6043 gene locus_tag LOCUS_20070 gene whiA 6975 6043 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_20070 7855 6992 gene locus_tag LOCUS_20080 gene rapZ 7855 6992 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_20080 8783 7887 gene locus_tag LOCUS_20090 gene murB 8783 7887 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence115 731 168 gene locus_tag LOCUS_20100 gene ilvN 731 168 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_20100 2411 747 gene locus_tag LOCUS_20110 gene ilvB 2411 747 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_20110 2938 4155 gene locus_tag LOCUS_20120 2938 4155 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460075.1 protein_id gnl|my_center|LOCUS_20120 4617 4243 gene locus_tag LOCUS_20130 gene ridA 4617 4243 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 protein_id gnl|my_center|LOCUS_20130 5894 4689 gene locus_tag LOCUS_20140 gene ilvA 5894 4689 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_20140 6951 6037 gene locus_tag LOCUS_20150 6951 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 7706 6948 gene locus_tag LOCUS_20160 7706 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 <8770 7708 gene locus_tag LOCUS_20170 <8770 7708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454642.1:toxic anion resistance protein >Feature sequence116 134 58 gene locus_tag LOCUS_t00300 134 58 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 915 840 gene locus_tag LOCUS_t00310 915 840 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1453 983 gene locus_tag LOCUS_20180 1453 983 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_20180 1586 1909 gene locus_tag LOCUS_20190 1586 1909 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_20190 1962 2402 gene locus_tag LOCUS_20200 1962 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2536 3753 gene locus_tag LOCUS_20210 gene nifS 2536 3753 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_20210 3756 4199 gene locus_tag LOCUS_20220 gene nifU 3756 4199 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_20220 5876 4338 gene locus_tag LOCUS_20230 5876 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 7324 5894 gene locus_tag LOCUS_20240 7324 5894 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_20240 8439 7339 gene locus_tag LOCUS_20250 8439 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence117 2055 3707 gene locus_tag LOCUS_20260 2055 3707 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_20260 3724 4983 gene locus_tag LOCUS_20270 gene leuC 3724 4983 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_20270 5002 5484 gene locus_tag LOCUS_20280 gene leuD 5002 5484 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_20280 5534 6607 gene locus_tag LOCUS_20290 gene leuB 5534 6607 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_20290 7444 6680 gene locus_tag LOCUS_20300 7444 6680 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261958.1 protein_id gnl|my_center|LOCUS_20300 8198 7434 gene locus_tag LOCUS_20310 8198 7434 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence118 <1 1002 gene locus_tag LOCUS_20320 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681144.1:O-acetyl-ADP-ribose deacetylase 1095 1754 gene locus_tag LOCUS_20330 1095 1754 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_20330 2662 2009 gene locus_tag LOCUS_20340 2662 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2865 3848 gene locus_tag LOCUS_20350 2865 3848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_20350 3944 4153 gene locus_tag LOCUS_20360 3944 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4184 4369 gene locus_tag LOCUS_20370 4184 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 4530 5297 gene locus_tag LOCUS_20380 4530 5297 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_20380 5584 6342 gene locus_tag LOCUS_20390 5584 6342 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 protein_id gnl|my_center|LOCUS_20390 6361 6567 gene locus_tag LOCUS_20400 6361 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7525 6689 gene locus_tag LOCUS_20410 7525 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 7817 8599 gene locus_tag LOCUS_20420 7817 8599 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence119 382 2202 gene locus_tag LOCUS_20430 382 2202 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_20430 2380 3498 gene locus_tag LOCUS_20440 2380 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3536 4045 gene locus_tag LOCUS_20450 3536 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4627 4091 gene locus_tag LOCUS_20460 4627 4091 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_20460 5706 4720 gene locus_tag LOCUS_20470 5706 4720 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_20470 5892 7193 gene locus_tag LOCUS_20480 5892 7193 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_20480 8035 7190 gene locus_tag LOCUS_20490 8035 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence120 3237 1612 gene locus_tag LOCUS_20500 3237 1612 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_20500 3513 3331 gene locus_tag LOCUS_20510 3513 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3976 3737 gene locus_tag LOCUS_20520 3976 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 6467 4875 gene locus_tag LOCUS_20530 6467 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 7039 6725 gene locus_tag LOCUS_20540 7039 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 7513 7208 gene locus_tag LOCUS_20550 7513 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7788 7531 gene locus_tag LOCUS_20560 7788 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 8092 7835 gene locus_tag LOCUS_20570 8092 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence121 1178 294 gene locus_tag LOCUS_20580 1178 294 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_20580 1644 1162 gene locus_tag LOCUS_20590 1644 1162 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_20590 2966 2220 gene locus_tag LOCUS_20600 2966 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 4600 2981 gene locus_tag LOCUS_20610 4600 2981 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_20610 5340 4597 gene locus_tag LOCUS_20620 5340 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 5546 5340 gene locus_tag LOCUS_20630 5546 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 6941 5592 gene locus_tag LOCUS_20640 6941 5592 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20640 7160 7017 gene locus_tag LOCUS_20650 7160 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 8194 7805 gene locus_tag LOCUS_20660 8194 7805 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272720.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence122 144 629 gene locus_tag LOCUS_20670 144 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 613 2679 gene locus_tag LOCUS_20680 613 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3172 2987 gene locus_tag LOCUS_20690 3172 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3622 3224 gene locus_tag LOCUS_20700 3622 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4020 3820 gene locus_tag LOCUS_20710 4020 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 4375 4091 gene locus_tag LOCUS_20720 4375 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 5109 4447 gene locus_tag LOCUS_20730 5109 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5518 5243 gene locus_tag LOCUS_20740 5518 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 5736 5978 gene locus_tag LOCUS_20750 5736 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 6507 6196 gene locus_tag LOCUS_20760 6507 6196 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_20760 7781 6627 gene locus_tag LOCUS_20770 7781 6627 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence123 1 1824 gene locus_tag LOCUS_20780 1 1824 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_20780 1848 3059 gene locus_tag LOCUS_20790 1848 3059 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_20790 3225 5576 gene locus_tag LOCUS_20800 3225 5576 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_20800 3296 3395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5587 6630 gene locus_tag LOCUS_20810 5587 6630 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_20810 6665 7528 gene locus_tag LOCUS_20820 6665 7528 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence124 368 1045 gene locus_tag LOCUS_20830 368 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2525 1107 gene locus_tag LOCUS_20840 2525 1107 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391589.1 protein_id gnl|my_center|LOCUS_20840 3973 2522 gene locus_tag LOCUS_20850 gene scfB 3973 2522 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_20850 4187 4041 gene locus_tag LOCUS_20860 gene scfA 4187 4041 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_20860 4595 4308 gene locus_tag LOCUS_20870 4595 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4825 4898 gene locus_tag LOCUS_t00320 4825 4898 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7230 5470 gene locus_tag LOCUS_20880 7230 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 <8028 7507 gene locus_tag LOCUS_20890 <8028 7507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262036.1:oleate hydratase >Feature sequence125 129 1220 gene locus_tag LOCUS_20900 129 1220 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_20900 1235 2080 gene locus_tag LOCUS_20910 1235 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2266 4563 gene locus_tag LOCUS_20920 2266 4563 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_20920 4643 5626 gene locus_tag LOCUS_20930 4643 5626 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_20930 6769 5693 gene locus_tag LOCUS_20940 6769 5693 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107852.1 protein_id gnl|my_center|LOCUS_20940 7074 7361 gene locus_tag LOCUS_20950 7074 7361 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence126 <1 809 gene locus_tag LOCUS_20960 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965433.1:redox-regulated ATPase YchF 821 1504 gene locus_tag LOCUS_20970 gene mtnN 821 1504 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111987.1 protein_id gnl|my_center|LOCUS_20970 3448 1565 gene locus_tag LOCUS_20980 3448 1565 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_20980 3928 3707 gene locus_tag LOCUS_20990 3928 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4305 3970 gene locus_tag LOCUS_21000 4305 3970 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_21000 4543 4743 gene locus_tag LOCUS_21010 4543 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 4887 5276 gene locus_tag LOCUS_21020 4887 5276 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_21020 5428 5273 gene locus_tag LOCUS_21030 5428 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5570 7210 gene locus_tag LOCUS_21040 5570 7210 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_21040 7291 7746 gene locus_tag LOCUS_21050 7291 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence127 83 319 gene locus_tag LOCUS_21060 83 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 640 1725 gene locus_tag LOCUS_21070 640 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2282 1848 gene locus_tag LOCUS_21080 2282 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2459 2818 gene locus_tag LOCUS_21090 2459 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2984 3799 gene locus_tag LOCUS_21100 2984 3799 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037617203.1 protein_id gnl|my_center|LOCUS_21100 3945 4988 gene locus_tag LOCUS_21110 3945 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5140 7194 gene locus_tag LOCUS_21120 5140 7194 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence128 1075 68 gene locus_tag LOCUS_21130 1075 68 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382271.1 protein_id gnl|my_center|LOCUS_21130 1630 1839 gene locus_tag LOCUS_21140 1630 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2058 2429 gene locus_tag LOCUS_21150 2058 2429 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_21150 2432 3277 gene locus_tag LOCUS_21160 2432 3277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_21160 3274 3915 gene locus_tag LOCUS_21170 3274 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3917 4075 gene locus_tag LOCUS_21180 3917 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5243 4152 gene locus_tag LOCUS_21190 5243 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 5509 6732 gene locus_tag LOCUS_21200 5509 6732 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence129 1664 321 gene locus_tag LOCUS_21210 1664 321 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_21210 1845 2537 gene locus_tag LOCUS_21220 1845 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2546 3580 gene locus_tag LOCUS_21230 2546 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3595 4707 gene locus_tag LOCUS_21240 3595 4707 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_21240 6811 4751 gene locus_tag LOCUS_21250 gene recG 6811 4751 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_21250 6938 7420 gene locus_tag LOCUS_21260 6938 7420 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence130 274 1038 gene locus_tag LOCUS_21270 gene ftsE 274 1038 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_21270 1035 1943 gene locus_tag LOCUS_21280 gene ftsX 1035 1943 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_21280 1963 3327 gene locus_tag LOCUS_21290 1963 3327 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726077.1 protein_id gnl|my_center|LOCUS_21290 3480 4844 gene locus_tag LOCUS_21300 3480 4844 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_21300 4925 5776 gene locus_tag LOCUS_21310 gene rsmA 4925 5776 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_21310 6097 5918 gene locus_tag LOCUS_21320 6097 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6429 7454 gene locus_tag LOCUS_21330 6429 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence131 1012 2214 gene locus_tag LOCUS_21340 1012 2214 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930700.1 protein_id gnl|my_center|LOCUS_21340 2356 3672 gene locus_tag LOCUS_21350 2356 3672 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_21350 3973 5475 gene locus_tag LOCUS_21360 gene glpK 3973 5475 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_21360 5884 5588 gene locus_tag LOCUS_21370 5884 5588 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_21370 6155 5874 gene locus_tag LOCUS_21380 6155 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 6143 6292 gene locus_tag LOCUS_21390 6143 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6676 6275 gene locus_tag LOCUS_21400 6676 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 <7523 6810 gene locus_tag LOCUS_21410 <7523 6810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein >Feature sequence132 611 60 gene locus_tag LOCUS_21420 611 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1177 689 gene locus_tag LOCUS_21430 1177 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1288 2517 gene locus_tag LOCUS_21440 1288 2517 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_21440 2845 4932 gene locus_tag LOCUS_21450 2845 4932 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_21450 5095 6414 gene locus_tag LOCUS_21460 gene glnA 5095 6414 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_21460 6448 7026 gene locus_tag LOCUS_21470 6448 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence133 1991 81 gene locus_tag LOCUS_21480 1991 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4097 1998 gene locus_tag LOCUS_21490 4097 1998 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_21490 4363 4965 gene locus_tag LOCUS_21500 4363 4965 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_21500 5043 5118 gene locus_tag LOCUS_t00330 5043 5118 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5675 5887 gene locus_tag LOCUS_21510 5675 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5924 6895 gene locus_tag LOCUS_21520 5924 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence134 <1 1229 gene locus_tag LOCUS_21530 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837602.1:adenylosuccinate synthase 1278 2180 gene locus_tag LOCUS_21540 1278 2180 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982687.1 protein_id gnl|my_center|LOCUS_21540 3335 2322 gene locus_tag LOCUS_21550 gene asnA 3335 2322 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_21550 4234 3521 gene locus_tag LOCUS_21560 4234 3521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_21560 5077 4238 gene locus_tag LOCUS_21570 5077 4238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_21570 6098 5070 gene locus_tag LOCUS_21580 6098 5070 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_21580 6989 6111 gene locus_tag LOCUS_21590 6989 6111 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence135 1307 732 gene locus_tag LOCUS_21600 1307 732 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_21600 1595 2176 gene locus_tag LOCUS_21610 1595 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2834 2385 gene locus_tag LOCUS_21620 2834 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21620 3622 2831 gene locus_tag LOCUS_21630 3622 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21630 4314 5228 gene locus_tag LOCUS_21640 4314 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5265 6278 gene locus_tag LOCUS_21650 gene metN 5265 6278 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 protein_id gnl|my_center|LOCUS_21650 6275 6931 gene locus_tag LOCUS_21660 6275 6931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009571.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence136 208 711 gene locus_tag LOCUS_21670 208 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 698 895 gene locus_tag LOCUS_21680 698 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 892 1128 gene locus_tag LOCUS_21690 892 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1192 3156 gene locus_tag LOCUS_21700 1192 3156 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_21700 3153 3413 gene locus_tag LOCUS_21710 3153 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3410 3625 gene locus_tag LOCUS_21720 3410 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3615 3962 gene locus_tag LOCUS_21730 3615 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3980 5095 gene locus_tag LOCUS_21740 3980 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5096 5797 gene locus_tag LOCUS_21750 5096 5797 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 protein_id gnl|my_center|LOCUS_21750 5818 6633 gene locus_tag LOCUS_21760 5818 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence137 1528 47 gene locus_tag LOCUS_21770 1528 47 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_21770 2095 1547 gene locus_tag LOCUS_21780 2095 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2613 2074 gene locus_tag LOCUS_21790 2613 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5784 2713 gene locus_tag LOCUS_21800 5784 2713 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_21800 <7033 5797 gene locus_tag LOCUS_21810 <7033 5797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028730510.1:FRG domain-containing protein >Feature sequence138 4349 1485 gene locus_tag LOCUS_21820 4349 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 5287 4604 gene locus_tag LOCUS_21830 gene tepA 5287 4604 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_21830 5542 6183 gene locus_tag LOCUS_21840 5542 6183 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_21840 6188 6793 gene locus_tag LOCUS_21850 6188 6793 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence139 27 284 gene locus_tag LOCUS_21860 27 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 281 985 gene locus_tag LOCUS_21870 281 985 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_21870 990 1244 gene locus_tag LOCUS_21880 990 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1220 1390 gene locus_tag LOCUS_21890 1220 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1387 1665 gene locus_tag LOCUS_21900 1387 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1662 1976 gene locus_tag LOCUS_21910 1662 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1994 2545 gene locus_tag LOCUS_21920 1994 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2542 3051 gene locus_tag LOCUS_21930 2542 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3525 3674 gene locus_tag LOCUS_21940 3525 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3664 5031 gene locus_tag LOCUS_21950 3664 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 5013 5465 gene locus_tag LOCUS_21960 5013 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5455 6003 gene locus_tag LOCUS_21970 5455 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 6005 6517 gene locus_tag LOCUS_21980 6005 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence140 570 1250 gene locus_tag LOCUS_21990 570 1250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_21990 1260 2297 gene locus_tag LOCUS_22000 1260 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2399 3082 gene locus_tag LOCUS_22010 2399 3082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_22010 3079 5433 gene locus_tag LOCUS_22020 3079 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 5755 5507 gene locus_tag LOCUS_22030 5755 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 <6957 6071 gene locus_tag LOCUS_22040 <6957 6071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein >Feature sequence141 634 3897 gene locus_tag LOCUS_22050 634 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3988 4206 gene locus_tag LOCUS_22060 3988 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4227 4973 gene locus_tag LOCUS_22070 4227 4973 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_22070 4991 5536 gene locus_tag LOCUS_22080 4991 5536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_22080 6625 5825 gene locus_tag LOCUS_22090 6625 5825 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence142 788 1222 gene locus_tag LOCUS_22100 788 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence143 1727 462 gene locus_tag LOCUS_22110 1727 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2425 1727 gene locus_tag LOCUS_22120 2425 1727 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_22120 3205 3375 gene locus_tag LOCUS_22130 3205 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3431 3530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3592 4356 gene locus_tag LOCUS_22140 3592 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4359 4640 gene locus_tag LOCUS_22150 4359 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4723 5001 gene locus_tag LOCUS_22160 4723 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 5014 5751 gene locus_tag LOCUS_22170 5014 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence144 747 340 gene locus_tag LOCUS_22180 747 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_22180 2074 1067 gene locus_tag LOCUS_22190 2074 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2348 2076 gene locus_tag LOCUS_22200 2348 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3556 2360 gene locus_tag LOCUS_22210 3556 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272737.1 protein_id gnl|my_center|LOCUS_22210 5388 3556 gene locus_tag LOCUS_22220 5388 3556 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272164.1 protein_id gnl|my_center|LOCUS_22220 5986 5402 gene locus_tag LOCUS_22230 5986 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272690.1 protein_id gnl|my_center|LOCUS_22230 6210 5983 gene locus_tag LOCUS_22240 6210 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272741.1 protein_id gnl|my_center|LOCUS_22240 6596 6309 gene locus_tag LOCUS_22250 6596 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence145 2101 1019 gene locus_tag LOCUS_22260 gene serC 2101 1019 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_22260 2584 3006 gene locus_tag LOCUS_22270 2584 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3125 4483 gene locus_tag LOCUS_22280 3125 4483 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_22280 4499 4951 gene locus_tag LOCUS_22290 4499 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6136 5021 gene locus_tag LOCUS_22300 6136 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 <6749 6109 gene locus_tag LOCUS_22310 <6749 6109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437073.1:YgiQ family radical SAM protein >Feature sequence146 791 174 gene locus_tag LOCUS_22320 gene coaE 791 174 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_22320 1822 788 gene locus_tag LOCUS_22330 1822 788 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_22330 2979 1894 gene locus_tag LOCUS_22340 gene prfA 2979 1894 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_22340 3221 3030 gene locus_tag LOCUS_22350 3221 3030 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_22350 3423 4358 gene locus_tag LOCUS_22360 3423 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4467 5018 gene locus_tag LOCUS_22370 4467 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6578 5085 gene locus_tag LOCUS_22380 gene spoIVA 6578 5085 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence147 <1 1367 gene locus_tag LOCUS_22390 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947977.1:CTP synthase 3290 1437 gene locus_tag LOCUS_22400 3290 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3750 3671 gene locus_tag LOCUS_t00340 3750 3671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3872 3789 gene locus_tag LOCUS_t00350 3872 3789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4119 4970 gene locus_tag LOCUS_22410 4119 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5822 4977 gene locus_tag LOCUS_22420 5822 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 <6664 6144 gene locus_tag LOCUS_22430 <6664 6144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667252.1:aminopeptidase >Feature sequence148 1189 932 gene locus_tag LOCUS_22440 1189 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2921 1203 gene locus_tag LOCUS_22450 2921 1203 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_22450 5351 2925 gene locus_tag LOCUS_22460 5351 2925 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_22460 5706 5272 gene locus_tag LOCUS_22470 5706 5272 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_22470 6590 5724 gene locus_tag LOCUS_22480 6590 5724 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence149 1172 336 gene locus_tag LOCUS_22490 1172 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1431 1862 gene locus_tag LOCUS_22500 1431 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2145 4073 gene locus_tag LOCUS_22510 2145 4073 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_22510 4077 4430 gene locus_tag LOCUS_22520 4077 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4447 6126 gene locus_tag LOCUS_22530 4447 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence150 526 1548 gene locus_tag LOCUS_22540 526 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1548 2888 gene locus_tag LOCUS_22550 1548 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2881 4089 gene locus_tag LOCUS_22560 2881 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458867.1 protein_id gnl|my_center|LOCUS_22560 4356 4135 gene locus_tag LOCUS_22570 4356 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4816 4493 gene locus_tag LOCUS_22580 4816 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 5035 5373 gene locus_tag LOCUS_22590 5035 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5370 6332 gene locus_tag LOCUS_22600 5370 6332 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028307122.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence151 563 177 gene locus_tag LOCUS_22610 563 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 912 565 gene locus_tag LOCUS_22620 912 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1295 1086 gene locus_tag LOCUS_22630 1295 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1794 1279 gene locus_tag LOCUS_22640 1794 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2696 1803 gene locus_tag LOCUS_22650 2696 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 4732 2690 gene locus_tag LOCUS_22660 4732 2690 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_22660 5567 4833 gene locus_tag LOCUS_22670 5567 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 5823 5551 gene locus_tag LOCUS_22680 5823 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence152 88 1014 gene locus_tag LOCUS_22690 88 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3027 1216 gene locus_tag LOCUS_22700 3027 1216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_22700 5326 3029 gene locus_tag LOCUS_22710 5326 3029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_22710 5819 5310 gene locus_tag LOCUS_22720 5819 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence153 364 71 gene locus_tag LOCUS_22730 364 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1178 348 gene locus_tag LOCUS_22740 1178 348 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_22740 2302 1343 gene locus_tag LOCUS_22750 2302 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3176 2541 gene locus_tag LOCUS_22760 3176 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3558 4925 gene locus_tag LOCUS_22770 3558 4925 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_22770 <6209 4981 gene locus_tag LOCUS_22780 <6209 4981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263541.1:ATP-grasp domain-containing protein >Feature sequence154 111 422 gene locus_tag LOCUS_22790 111 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 509 790 gene locus_tag LOCUS_22800 509 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1562 1227 gene locus_tag LOCUS_22810 1562 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2478 1567 gene locus_tag LOCUS_22820 2478 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 3411 2704 gene locus_tag LOCUS_22830 3411 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 3854 3423 gene locus_tag LOCUS_22840 3854 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 5225 4530 gene locus_tag LOCUS_22850 5225 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5748 5218 gene locus_tag LOCUS_22860 5748 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5844 6161 gene locus_tag LOCUS_22870 5844 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence155 3 2525 gene locus_tag LOCUS_22880 3 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2820 3248 gene locus_tag LOCUS_22890 gene rpsL 2820 3248 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_22890 3408 3878 gene locus_tag LOCUS_22900 gene rpsG 3408 3878 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 protein_id gnl|my_center|LOCUS_22900 3903 6029 gene locus_tag LOCUS_22910 gene fusA 3903 6029 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence156 245 766 gene locus_tag LOCUS_22920 245 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 992 1381 gene locus_tag LOCUS_22930 992 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1415 2125 gene locus_tag LOCUS_22940 1415 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2135 3043 gene locus_tag LOCUS_22950 2135 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3043 4449 gene locus_tag LOCUS_22960 3043 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 4464 4619 gene locus_tag LOCUS_22970 4464 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence157 182 853 gene locus_tag LOCUS_22980 182 853 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_22980 893 1225 gene locus_tag LOCUS_22990 893 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22990 1203 2672 gene locus_tag LOCUS_23000 1203 2672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23000 1210 1219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2688 4493 gene locus_tag LOCUS_23010 2688 4493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814582.1 protein_id gnl|my_center|LOCUS_23010 4513 5115 gene locus_tag LOCUS_23020 4513 5115 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence158 1421 132 gene locus_tag LOCUS_23030 1421 132 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393008.1 protein_id gnl|my_center|LOCUS_23030 1529 2047 gene locus_tag LOCUS_23040 1529 2047 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_23040 3263 2298 gene locus_tag LOCUS_23050 3263 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3724 3542 gene locus_tag LOCUS_23060 3724 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4377 3733 gene locus_tag LOCUS_23070 4377 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence159 2627 156 gene locus_tag LOCUS_23080 2627 156 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157437265.1 protein_id gnl|my_center|LOCUS_23080 4036 2624 gene locus_tag LOCUS_23090 4036 2624 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_23090 4272 5327 gene locus_tag LOCUS_23100 4272 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5598 5347 gene locus_tag LOCUS_23110 5598 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence160 631 26 gene locus_tag LOCUS_23120 631 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1404 730 gene locus_tag LOCUS_23130 gene cobC 1404 730 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_23130 2009 1443 gene locus_tag LOCUS_23140 2009 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2424 3119 gene locus_tag LOCUS_23150 2424 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3235 3852 gene locus_tag LOCUS_23160 3235 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4026 4538 gene locus_tag LOCUS_23170 4026 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4586 5128 gene locus_tag LOCUS_23180 4586 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5520 5611 gene locus_tag LOCUS_t00360 5520 5611 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence161 178 1575 gene locus_tag LOCUS_23190 178 1575 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_23190 2238 1579 gene locus_tag LOCUS_23200 gene mocA 2238 1579 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 protein_id gnl|my_center|LOCUS_23200 2342 3145 gene locus_tag LOCUS_23210 2342 3145 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902983.1 protein_id gnl|my_center|LOCUS_23210 3146 3616 gene locus_tag LOCUS_23220 3146 3616 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence162 1293 106 gene locus_tag LOCUS_23230 1293 106 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_23230 2249 1410 gene locus_tag LOCUS_23240 gene dapF 2249 1410 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_23240 2527 2763 gene locus_tag LOCUS_23250 gene acpP 2527 2763 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_23250 2887 4326 gene locus_tag LOCUS_23260 gene proS 2887 4326 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_23260 5281 4400 gene locus_tag LOCUS_23270 5281 4400 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565426.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence163 9 227 gene locus_tag LOCUS_23280 9 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 224 544 gene locus_tag LOCUS_23290 224 544 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018366816.1 protein_id gnl|my_center|LOCUS_23290 558 2231 gene locus_tag LOCUS_23300 558 2231 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_23300 3572 2490 gene locus_tag LOCUS_23310 gene hemW 3572 2490 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143078.1 protein_id gnl|my_center|LOCUS_23310 3682 4386 gene locus_tag LOCUS_23320 3682 4386 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_23320 5365 4520 gene locus_tag LOCUS_23330 gene hexR 5365 4520 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence164 <1 1171 gene locus_tag LOCUS_23340 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000451023.1:sodium:alanine symporter family protein 1260 2615 gene locus_tag LOCUS_23350 1260 2615 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_23350 3879 2695 gene locus_tag LOCUS_23360 3879 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5014 4166 gene locus_tag LOCUS_23370 gene rlmA 5014 4166 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_23370 5601 5011 gene locus_tag LOCUS_23380 5601 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence165 <1 587 gene locus_tag LOCUS_23390 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963681.1:glycoside hydrolase family 88 protein 747 1511 gene locus_tag LOCUS_23400 747 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2750 1557 gene locus_tag LOCUS_23410 2750 1557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111709.1 protein_id gnl|my_center|LOCUS_23410 3475 2831 gene locus_tag LOCUS_23420 3475 2831 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_23420 3653 4945 gene locus_tag LOCUS_23430 3653 4945 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence166 546 160 gene locus_tag LOCUS_23440 546 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 895 548 gene locus_tag LOCUS_23450 895 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1364 987 gene locus_tag LOCUS_23460 1364 987 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_23460 2159 1380 gene locus_tag LOCUS_23470 2159 1380 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_23470 3113 2256 gene locus_tag LOCUS_23480 3113 2256 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_23480 4077 3238 gene locus_tag LOCUS_23490 4077 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4888 4148 gene locus_tag LOCUS_23500 4888 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 5183 4878 gene locus_tag LOCUS_23510 5183 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence167 1409 546 gene locus_tag LOCUS_23520 1409 546 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_23520 2104 1421 gene locus_tag LOCUS_23530 2104 1421 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_23530 3054 2149 gene locus_tag LOCUS_23540 3054 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3672 3067 gene locus_tag LOCUS_23550 3672 3067 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_23550 4291 3677 gene locus_tag LOCUS_23560 4291 3677 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_23560 4981 4403 gene locus_tag LOCUS_23570 4981 4403 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603095.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence168 447 932 gene locus_tag LOCUS_23580 gene rlmH 447 932 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 protein_id gnl|my_center|LOCUS_23580 1111 1947 gene locus_tag LOCUS_23590 1111 1947 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_23590 1940 4144 gene locus_tag LOCUS_23600 1940 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence169 <1 780 gene locus_tag LOCUS_23610 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001036947.1:galactose/glucose ABC transporter substrate-binding protein MglB 936 2477 gene locus_tag LOCUS_23620 gene mglA 936 2477 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255020.1 protein_id gnl|my_center|LOCUS_23620 2496 3494 gene locus_tag LOCUS_23630 gene mglC 2496 3494 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275103.1 protein_id gnl|my_center|LOCUS_23630 3608 3919 gene locus_tag LOCUS_23640 3608 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence170 <1 845 gene locus_tag LOCUS_23650 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425850.1:F0F1 ATP synthase subunit beta 849 1247 gene locus_tag LOCUS_23660 849 1247 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_23660 1936 1307 gene locus_tag LOCUS_23670 gene udk 1936 1307 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_23670 2128 3744 gene locus_tag LOCUS_23680 gene cls 2128 3744 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_23680 4955 3795 gene locus_tag LOCUS_23690 4955 3795 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704481.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence171 1937 2491 gene locus_tag LOCUS_23700 1937 2491 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_23700 2515 3183 gene locus_tag LOCUS_23710 2515 3183 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_23710 3176 3871 gene locus_tag LOCUS_23720 3176 3871 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_23720 4658 4077 gene locus_tag LOCUS_23730 4658 4077 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence172 1075 620 gene locus_tag LOCUS_23740 gene rplI 1075 620 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_23740 2273 1170 gene locus_tag LOCUS_23750 gene glf 2273 1170 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 protein_id gnl|my_center|LOCUS_23750 4274 2277 gene locus_tag LOCUS_23760 4274 2277 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_23760 <5125 4323 gene locus_tag LOCUS_23770 <5125 4323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003385808.1:ribonuclease J >Feature sequence173 97 759 gene locus_tag LOCUS_23780 97 759 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_23780 756 1772 gene locus_tag LOCUS_23790 756 1772 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_23790 1899 2669 gene locus_tag LOCUS_23800 1899 2669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_23800 2656 4671 gene locus_tag LOCUS_23810 2656 4671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_23810 4675 4809 gene locus_tag LOCUS_23820 4675 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence174 1617 559 gene locus_tag LOCUS_23830 1617 559 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_23830 1875 1675 gene locus_tag LOCUS_23840 1875 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_23840 2397 2248 gene locus_tag LOCUS_23850 2397 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2798 3853 gene locus_tag LOCUS_23860 2798 3853 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_23860 3921 4958 gene locus_tag LOCUS_23870 3921 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23870 >Feature sequence175 1452 88 gene locus_tag LOCUS_23880 1452 88 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_23880 2020 1457 gene locus_tag LOCUS_23890 2020 1457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_23890 2315 3079 gene locus_tag LOCUS_23900 2315 3079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_23900 3076 3801 gene locus_tag LOCUS_23910 3076 3801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994320.1 protein_id gnl|my_center|LOCUS_23910 3818 4582 gene locus_tag LOCUS_23920 3818 4582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114222.1 protein_id gnl|my_center|LOCUS_23920 4587 4883 gene locus_tag LOCUS_23930 4587 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence176 255 998 gene locus_tag LOCUS_23940 255 998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_23940 1000 2877 gene locus_tag LOCUS_23950 1000 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2882 3418 gene locus_tag LOCUS_23960 2882 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3609 4109 gene locus_tag LOCUS_23970 3609 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4230 4772 gene locus_tag LOCUS_23980 4230 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence177 980 777 gene locus_tag LOCUS_23990 980 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 1576 980 gene locus_tag LOCUS_24000 1576 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2195 1590 gene locus_tag LOCUS_24010 2195 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4267 2192 gene locus_tag LOCUS_24020 4267 2192 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_24020 <4936 4365 gene locus_tag LOCUS_24030 <4936 4365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723214.1:Type 1 glutamine amidotransferase-like domain-containing protein >Feature sequence178 <1 1920 gene locus_tag LOCUS_24040 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460393.1:translation initiation factor IF-2 2126 2518 gene locus_tag LOCUS_24050 gene rbfA 2126 2518 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_24050 2548 3525 gene locus_tag LOCUS_24060 2548 3525 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_24060 3525 4409 gene locus_tag LOCUS_24070 gene truB 3525 4409 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766456.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence179 963 346 gene locus_tag LOCUS_24080 963 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2033 960 gene locus_tag LOCUS_24090 gene hrcA 2033 960 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_24090 2673 4286 gene locus_tag LOCUS_24100 2673 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 4899 4357 gene locus_tag LOCUS_24110 gene spoVT 4899 4357 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence180 74 406 gene locus_tag LOCUS_24120 74 406 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947952.1 protein_id gnl|my_center|LOCUS_24120 399 1067 gene locus_tag LOCUS_24130 399 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1291 2163 gene locus_tag LOCUS_24140 1291 2163 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 protein_id gnl|my_center|LOCUS_24140 2248 2973 gene locus_tag LOCUS_24150 2248 2973 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015538576.1 protein_id gnl|my_center|LOCUS_24150 3160 4188 gene locus_tag LOCUS_24160 3160 4188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence181 746 1039 gene locus_tag LOCUS_24170 746 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1195 3132 gene locus_tag LOCUS_24180 1195 3132 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_24180 3334 4056 gene locus_tag LOCUS_24190 gene rpsB 3334 4056 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence182 <1 815 gene locus_tag LOCUS_24200 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764097.1:homoserine O-succinyltransferase 1856 984 gene locus_tag LOCUS_24210 1856 984 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_24210 2371 1865 gene locus_tag LOCUS_24220 gene trmL 2371 1865 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_24220 3216 2368 gene locus_tag LOCUS_24230 3216 2368 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948987.1 protein_id gnl|my_center|LOCUS_24230 3381 3587 gene locus_tag LOCUS_24240 3381 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4111 3638 gene locus_tag LOCUS_24250 4111 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence183 1062 199 gene locus_tag LOCUS_24260 1062 199 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_24260 1357 2751 gene locus_tag LOCUS_24270 1357 2751 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_24270 2807 4285 gene locus_tag LOCUS_24280 2807 4285 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_24280 4600 4352 gene locus_tag LOCUS_24290 4600 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence184 830 1936 gene locus_tag LOCUS_24300 gene dnaN 830 1936 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_24300 1949 2164 gene locus_tag LOCUS_24310 gene yaaA 1949 2164 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583899.1 protein_id gnl|my_center|LOCUS_24310 2165 3286 gene locus_tag LOCUS_24320 gene recF 2165 3286 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662310.1 protein_id gnl|my_center|LOCUS_24320 3376 3633 gene locus_tag LOCUS_24330 3376 3633 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence185 221 1144 gene locus_tag LOCUS_24340 221 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2493 1051 gene locus_tag LOCUS_24350 2493 1051 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_24350 2660 3307 gene locus_tag LOCUS_24360 2660 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4610 3360 gene locus_tag LOCUS_24370 4610 3360 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence186 1670 354 gene locus_tag LOCUS_24380 gene tig 1670 354 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_24380 2570 1887 gene locus_tag LOCUS_24390 2570 1887 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_24390 4067 2607 gene locus_tag LOCUS_24400 gene thrC 4067 2607 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 protein_id gnl|my_center|LOCUS_24400 4540 4172 gene locus_tag LOCUS_24410 4540 4172 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence187 2295 214 gene locus_tag LOCUS_24420 2295 214 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373408.1 protein_id gnl|my_center|LOCUS_24420 3487 2318 gene locus_tag LOCUS_24430 3487 2318 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_24430 4586 3513 gene locus_tag LOCUS_24440 4586 3513 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence188 4253 2262 gene locus_tag LOCUS_24450 gene gyrB 4253 2262 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence189 1088 369 gene locus_tag LOCUS_24460 gene deoD 1088 369 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_24460 3054 1159 gene locus_tag LOCUS_24470 3054 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 4156 3245 gene locus_tag LOCUS_24480 4156 3245 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence190 277 202 gene locus_tag LOCUS_t00370 277 202 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1914 343 gene locus_tag LOCUS_24490 1914 343 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476525.1 protein_id gnl|my_center|LOCUS_24490 2166 3569 gene locus_tag LOCUS_24500 gene murD 2166 3569 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_24500 3566 4327 gene locus_tag LOCUS_24510 3566 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence191 939 265 gene locus_tag LOCUS_24520 gene sigF 939 265 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_24520 1401 961 gene locus_tag LOCUS_24530 gene spoIIAB 1401 961 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_24530 1721 1398 gene locus_tag LOCUS_24540 1721 1398 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_24540 3086 1821 gene locus_tag LOCUS_24550 3086 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3595 3083 gene locus_tag LOCUS_24560 3595 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 <4535 3600 gene locus_tag LOCUS_24570 <4535 3600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048157.1:valine--tRNA ligase >Feature sequence192 1 492 gene locus_tag LOCUS_24580 1 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 505 867 gene locus_tag LOCUS_24590 505 867 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_24590 842 3211 gene locus_tag LOCUS_24600 842 3211 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence193 1598 3019 gene locus_tag LOCUS_24610 1598 3019 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence194 <1 531 gene locus_tag LOCUS_24620 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868812.1:ZIP family metal transporter 1960 599 gene locus_tag LOCUS_24630 1960 599 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_24630 2168 2776 gene locus_tag LOCUS_24640 2168 2776 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_24640 2939 4273 gene locus_tag LOCUS_24650 gene aspS 2939 4273 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529801.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence195 2174 618 gene locus_tag LOCUS_24660 2174 618 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_24660 2286 3104 gene locus_tag LOCUS_24670 2286 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4045 3188 gene locus_tag LOCUS_24680 4045 3188 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210833.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence196 1667 348 gene locus_tag LOCUS_24690 1667 348 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969866.1 protein_id gnl|my_center|LOCUS_24690 2038 3990 gene locus_tag LOCUS_24700 2038 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence197 176 721 gene locus_tag LOCUS_24710 176 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 781 915 gene locus_tag LOCUS_24720 781 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 934 1599 gene locus_tag LOCUS_24730 gene deoC 934 1599 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880896.1 protein_id gnl|my_center|LOCUS_24730 1815 2984 gene locus_tag LOCUS_24740 1815 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence198 <1 1664 gene locus_tag LOCUS_24750 <1 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101721463.1:FAD-dependent oxidoreductase 1867 2787 gene locus_tag LOCUS_24760 1867 2787 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence199 189 1052 gene locus_tag LOCUS_24770 189 1052 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_24770 1049 1549 gene locus_tag LOCUS_24780 1049 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1572 1766 gene locus_tag LOCUS_24790 1572 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1751 2242 gene locus_tag LOCUS_24800 1751 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2254 3096 gene locus_tag LOCUS_24810 2254 3096 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_24810 3093 4019 gene locus_tag LOCUS_24820 3093 4019 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence200 <1 988 gene locus_tag LOCUS_24830 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965270.1:type IV secretory system conjugative DNA transfer family protein 1003 2199 gene locus_tag LOCUS_24840 1003 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2274 3086 gene locus_tag LOCUS_24850 2274 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3165 4262 gene locus_tag LOCUS_24860 3165 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence201 <1 2489 gene locus_tag LOCUS_24870 <1 2489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965697.1:acyl-CoA dehydratase activase-related protein 270 279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence202 1355 447 gene locus_tag LOCUS_24880 1355 447 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_24880 1663 1352 gene locus_tag LOCUS_24890 1663 1352 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420397.1 protein_id gnl|my_center|LOCUS_24890 2297 1644 gene locus_tag LOCUS_24900 2297 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 3594 2407 gene locus_tag LOCUS_24910 3594 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence203 2065 311 gene locus_tag LOCUS_24920 2065 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462010.1 protein_id gnl|my_center|LOCUS_24920 2721 2143 gene locus_tag LOCUS_24930 2721 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272745.1 protein_id gnl|my_center|LOCUS_24930 3343 2807 gene locus_tag LOCUS_24940 3343 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461918.1 protein_id gnl|my_center|LOCUS_24940 3735 3340 gene locus_tag LOCUS_24950 3735 3340 CDS product DUF4320 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272747.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence204 <1 968 gene locus_tag LOCUS_24960 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1961 1449 gene locus_tag LOCUS_24970 1961 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2253 1987 gene locus_tag LOCUS_24980 2253 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence205 519 595 gene locus_tag LOCUS_t00380 519 595 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 925 3261 gene locus_tag LOCUS_24990 925 3261 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681955.1 protein_id gnl|my_center|LOCUS_24990 3422 3877 gene locus_tag LOCUS_25000 3422 3877 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096142.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence206 174 270 gene locus_tag LOCUS_t00390 174 270 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 388 463 gene locus_tag LOCUS_t00400 388 463 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 847 1536 gene locus_tag LOCUS_25010 847 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1609 2301 gene locus_tag LOCUS_25020 1609 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2298 3485 gene locus_tag LOCUS_25030 2298 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence207 782 168 gene locus_tag LOCUS_25040 782 168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_25040 1459 1238 gene locus_tag LOCUS_25050 1459 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2110 1598 gene locus_tag LOCUS_25060 2110 1598 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_25060 2604 2113 gene locus_tag LOCUS_25070 2604 2113 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_25070 3172 2933 gene locus_tag LOCUS_25080 3172 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3714 3190 gene locus_tag LOCUS_25090 3714 3190 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261962.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence208 500 348 gene locus_tag LOCUS_25100 500 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 775 497 gene locus_tag LOCUS_25110 775 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1056 772 gene locus_tag LOCUS_25120 1056 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1328 1059 gene locus_tag LOCUS_25130 1328 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1546 1325 gene locus_tag LOCUS_25140 1546 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2279 1536 gene locus_tag LOCUS_25150 2279 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2516 2304 gene locus_tag LOCUS_25160 2516 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2681 3115 gene locus_tag LOCUS_25170 2681 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3160 3804 gene locus_tag LOCUS_25180 3160 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence209 3090 1648 gene locus_tag LOCUS_25190 3090 1648 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_25190 3912 3103 gene locus_tag LOCUS_25200 3912 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence210 63 437 gene locus_tag LOCUS_25210 63 437 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_25210 475 1803 gene locus_tag LOCUS_25220 475 1803 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_25220 1894 3090 gene locus_tag LOCUS_25230 1894 3090 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_25230 3451 3215 gene locus_tag LOCUS_25240 3451 3215 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence211 412 1761 gene locus_tag LOCUS_25250 412 1761 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_25250 2345 1806 gene locus_tag LOCUS_25260 2345 1806 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304258.1 protein_id gnl|my_center|LOCUS_25260 2569 2357 gene locus_tag LOCUS_25270 2569 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 2727 3662 gene locus_tag LOCUS_25280 2727 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence212 <1 705 gene locus_tag LOCUS_25290 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861114.1:ATP-binding protein 1117 1458 gene locus_tag LOCUS_25300 1117 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1592 3568 gene locus_tag LOCUS_25310 1592 3568 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence213 140 1939 gene locus_tag LOCUS_25320 140 1939 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_25320 2315 3139 gene locus_tag LOCUS_25330 2315 3139 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_25330 3152 3487 gene locus_tag LOCUS_25340 3152 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence214 1256 462 gene locus_tag LOCUS_25350 1256 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1715 1329 gene locus_tag LOCUS_25360 1715 1329 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_25360 3330 1705 gene locus_tag LOCUS_25370 3330 1705 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence215 441 599 gene locus_tag LOCUS_25380 441 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 668 1282 gene locus_tag LOCUS_25390 668 1282 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_25390 2793 1459 gene locus_tag LOCUS_25400 2793 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 3578 3261 gene locus_tag LOCUS_25410 3578 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence216 1077 310 gene locus_tag LOCUS_25420 1077 310 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286032.1 protein_id gnl|my_center|LOCUS_25420 1565 1074 gene locus_tag LOCUS_25430 1565 1074 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_25430 2436 1588 gene locus_tag LOCUS_25440 gene rsmI 2436 1588 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_25440 3090 2452 gene locus_tag LOCUS_25450 3090 2452 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence217 713 1162 gene locus_tag LOCUS_25460 713 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1285 2025 gene locus_tag LOCUS_25470 1285 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2154 2927 gene locus_tag LOCUS_25480 2154 2927 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_25480 <3577 3060 gene locus_tag LOCUS_25490 <3577 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001868596.1:HAMP domain-containing sensor histidine kinase >Feature sequence218 1844 237 gene locus_tag LOCUS_25500 1844 237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence219 3325 131 gene locus_tag LOCUS_25510 3325 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence220 <1 1614 gene locus_tag LOCUS_25520 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289265.1:formate C-acetyltransferase 1601 2353 gene locus_tag LOCUS_25530 gene pflA 1601 2353 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905907.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence221 3438 226 gene locus_tag LOCUS_25540 3438 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence222 622 2166 gene locus_tag LOCUS_25550 622 2166 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_25550 2150 3370 gene locus_tag LOCUS_25560 2150 3370 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence223 151 1392 gene locus_tag LOCUS_25570 151 1392 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_25570 1427 2704 gene locus_tag LOCUS_25580 1427 2704 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_25580 3385 2999 gene locus_tag LOCUS_25590 3385 2999 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966444.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence224 1118 48 gene locus_tag LOCUS_25600 1118 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25600 1866 1177 gene locus_tag LOCUS_25610 1866 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2762 1863 gene locus_tag LOCUS_25620 2762 1863 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272743.1 protein_id gnl|my_center|LOCUS_25620 3282 2857 gene locus_tag LOCUS_25630 3282 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272744.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence225 607 1914 gene locus_tag LOCUS_25640 607 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2159 3118 gene locus_tag LOCUS_25650 2159 3118 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence226 58 576 gene locus_tag LOCUS_25660 58 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272181.1 protein_id gnl|my_center|LOCUS_25660 606 1334 gene locus_tag LOCUS_25670 606 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1354 1716 gene locus_tag LOCUS_25680 1354 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1747 2298 gene locus_tag LOCUS_25690 1747 2298 CDS product YodL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272180.1 protein_id gnl|my_center|LOCUS_25690 2420 2695 gene locus_tag LOCUS_25700 2420 2695 CDS product DUF6133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272179.1 protein_id gnl|my_center|LOCUS_25700 2695 3099 gene locus_tag LOCUS_25710 2695 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence227 430 999 gene locus_tag LOCUS_25720 430 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 996 1796 gene locus_tag LOCUS_25730 996 1796 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_25730 1777 2979 gene locus_tag LOCUS_25740 gene alr 1777 2979 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence228 293 550 gene locus_tag LOCUS_25750 293 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 600 1985 gene locus_tag LOCUS_25760 600 1985 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_25760 2232 2038 gene locus_tag LOCUS_25770 2232 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3121 2531 gene locus_tag LOCUS_25780 3121 2531 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence229 1788 484 gene locus_tag LOCUS_25790 1788 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2194 1889 gene locus_tag LOCUS_25800 2194 1889 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_25800 2637 2464 gene locus_tag LOCUS_25810 2637 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence230 <1 699 gene locus_tag LOCUS_25820 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 738 1085 gene locus_tag LOCUS_25830 738 1085 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_25830 1124 2152 gene locus_tag LOCUS_25840 1124 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence231 322 1401 gene locus_tag LOCUS_25850 322 1401 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_25850 1656 2873 gene locus_tag LOCUS_25860 gene pepT 1656 2873 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence232 1195 323 gene locus_tag LOCUS_25870 1195 323 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_25870 2020 1235 gene locus_tag LOCUS_25880 2020 1235 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_25880 <3092 2145 gene locus_tag LOCUS_25890 <3092 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357329.1:acetyl-CoA C-acetyltransferase >Feature sequence233 2290 899 gene locus_tag LOCUS_25900 2290 899 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence234 1546 2025 gene locus_tag LOCUS_25910 1546 2025 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_25910 2167 2343 gene locus_tag LOCUS_25920 2167 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2479 2835 gene locus_tag LOCUS_25930 2479 2835 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368681.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence235 433 1035 gene locus_tag LOCUS_25940 433 1035 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_25940 1055 1849 gene locus_tag LOCUS_25950 1055 1849 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_25950 1846 2448 gene locus_tag LOCUS_25960 1846 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence236 1128 121 gene locus_tag LOCUS_25970 1128 121 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383270.1 protein_id gnl|my_center|LOCUS_25970 1445 2038 gene locus_tag LOCUS_25980 1445 2038 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582354.1 protein_id gnl|my_center|LOCUS_25980 2383 2126 gene locus_tag LOCUS_25990 gene rpsR 2383 2126 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_25990 2909 2430 gene locus_tag LOCUS_26000 gene ssb 2909 2430 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence237 1393 275 gene locus_tag LOCUS_26010 1393 275 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870487.1 protein_id gnl|my_center|LOCUS_26010 1849 1403 gene locus_tag LOCUS_26020 gene crtO 1849 1403 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_26020 3020 1872 gene locus_tag LOCUS_26030 3020 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence238 1553 657 gene locus_tag LOCUS_26040 1553 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2372 1572 gene locus_tag LOCUS_26050 2372 1572 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870429.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence239 >Feature sequence240 <1 1124 gene locus_tag LOCUS_26060 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986378.1:methionine gamma-lyase family protein 1673 1233 gene locus_tag LOCUS_26070 gene mgsA 1673 1233 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355823.1 protein_id gnl|my_center|LOCUS_26070 <3011 2113 gene locus_tag LOCUS_26080 <3011 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836905.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence241 88 163 gene locus_tag LOCUS_t00410 88 163 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 919 269 gene locus_tag LOCUS_26090 919 269 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_26090 1462 935 gene locus_tag LOCUS_26100 1462 935 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_26100 2391 1804 gene locus_tag LOCUS_26110 2391 1804 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 protein_id gnl|my_center|LOCUS_26110 <2974 2388 gene locus_tag LOCUS_26120 <2974 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096000.1:glycosyltransferase family 2 protein >Feature sequence242 1437 406 gene locus_tag LOCUS_26130 gene gap 1437 406 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_26130 2421 1636 gene locus_tag LOCUS_26140 2421 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence243 >Feature sequence244 271 873 gene locus_tag LOCUS_26150 271 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 892 1419 gene locus_tag LOCUS_26160 892 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1591 1923 gene locus_tag LOCUS_26170 1591 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2245 1967 gene locus_tag LOCUS_26180 2245 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2520 2242 gene locus_tag LOCUS_26190 2520 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence245 692 1468 gene locus_tag LOCUS_26200 692 1468 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_26200 1458 1763 gene locus_tag LOCUS_26210 1458 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1786 2622 gene locus_tag LOCUS_26220 1786 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence246 217 1050 gene locus_tag LOCUS_26230 217 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1200 2582 gene locus_tag LOCUS_26240 1200 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence247 <1 858 gene locus_tag LOCUS_26250 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276374.1:OFA family MFS transporter 1189 1890 gene locus_tag LOCUS_26260 1189 1890 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence248 150 761 gene locus_tag LOCUS_26270 150 761 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_26270 765 2675 gene locus_tag LOCUS_26280 765 2675 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence249 1015 1527 gene locus_tag LOCUS_26290 1015 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 1577 1831 gene locus_tag LOCUS_26300 1577 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence250 70 984 gene locus_tag LOCUS_26310 70 984 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_26310 1085 1555 gene locus_tag LOCUS_26320 1085 1555 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence251 879 286 gene locus_tag LOCUS_26330 879 286 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_26330 1246 2115 gene locus_tag LOCUS_26340 1246 2115 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence252 1737 1746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence253 1347 892 gene locus_tag LOCUS_26350 1347 892 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_26350 2237 1368 gene locus_tag LOCUS_26360 2237 1368 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence254 <1 1805 gene locus_tag LOCUS_26370 <1 1805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080806.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence255 992 147 gene locus_tag LOCUS_26380 992 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2121 1024 gene locus_tag LOCUS_26390 2121 1024 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence256 <2450 277 gene locus_tag LOCUS_26400 <2450 277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892173.1:carbamoyl-phosphate synthase large subunit >Feature sequence257 1458 532 gene locus_tag LOCUS_26410 1458 532 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_26410 2231 1458 gene locus_tag LOCUS_26420 2231 1458 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965939.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence258 <2416 56 gene locus_tag LOCUS_26430 <2416 56 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814229.1:ABC transporter permease >Feature sequence259 180 1043 gene locus_tag LOCUS_26440 180 1043 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_26440 1059 1484 gene locus_tag LOCUS_26450 1059 1484 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence260 698 321 gene locus_tag LOCUS_26460 698 321 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_26460 1529 804 gene locus_tag LOCUS_26470 1529 804 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_26470 2273 1608 gene locus_tag LOCUS_26480 gene sfsA 2273 1608 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence261 1225 2241 gene locus_tag LOCUS_26490 gene spoIID 1225 2241 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence262 <1 687 gene locus_tag LOCUS_26500 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729265.1:galactokinase 684 2183 gene locus_tag LOCUS_26510 gene galT 684 2183 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence263 111 575 gene locus_tag LOCUS_26520 111 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 659 2296 gene locus_tag LOCUS_26530 gene tndX 659 2296 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence264 1283 810 gene locus_tag LOCUS_26540 1283 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2269 1280 gene locus_tag LOCUS_26550 2269 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence265 667 1086 gene locus_tag LOCUS_26560 667 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1071 1484 gene locus_tag LOCUS_26570 1071 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1468 2133 gene locus_tag LOCUS_26580 1468 2133 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256722.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence266 <1 500 gene locus_tag LOCUS_26590 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 870 1286 gene locus_tag LOCUS_26600 870 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1386 2225 gene locus_tag LOCUS_26610 1386 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence267 >Feature sequence268 3 1298 gene locus_tag LOCUS_26620 gene secY 3 1298 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_26620 1419 2051 gene locus_tag LOCUS_26630 gene adk 1419 2051 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence269 900 487 gene locus_tag LOCUS_26640 900 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1183 1192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1319 1603 gene locus_tag LOCUS_26650 1319 1603 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence270 632 414 gene locus_tag LOCUS_26660 632 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 942 673 gene locus_tag LOCUS_26670 942 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence271 761 195 gene locus_tag LOCUS_26680 761 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 957 1982 gene locus_tag LOCUS_26690 gene pta 957 1982 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence272 1 1149 gene locus_tag LOCUS_26700 1 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1867 1196 gene locus_tag LOCUS_26710 1867 1196 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence273 222 10 gene locus_tag LOCUS_26720 222 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 637 215 gene locus_tag LOCUS_26730 637 215 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204162807.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence274 8 93 gene locus_tag LOCUS_t00420 8 93 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 246 497 gene locus_tag LOCUS_26740 246 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 772 596 gene locus_tag LOCUS_26750 772 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 <2038 790 gene locus_tag LOCUS_26760 <2038 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000119405.1:MobV family relaxase >Feature sequence275 1369 1040 gene locus_tag LOCUS_26770 gene mobC 1369 1040 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_26770 1929 1561 gene locus_tag LOCUS_26780 1929 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence276 250 1329 gene locus_tag LOCUS_26790 250 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence277 <2008 769 gene locus_tag LOCUS_26800 <2008 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244294.1:L-rhamnose isomerase >Feature sequence278 553 248 gene locus_tag LOCUS_26810 553 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1540 566 gene locus_tag LOCUS_26820 1540 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence279 580 290 gene locus_tag LOCUS_26830 580 290 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_26830 855 577 gene locus_tag LOCUS_26840 855 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 982 1380 gene locus_tag LOCUS_26850 982 1380 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence280 185 1504 gene locus_tag LOCUS_26860 185 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence281 <1 1253 gene locus_tag LOCUS_26870 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986523.1:PTS system trehalose-specific EIIBC component >Feature sequence282 1063 389 gene locus_tag LOCUS_26880 1063 389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_26880 1316 1128 gene locus_tag LOCUS_26890 1316 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence283 <1 1193 gene locus_tag LOCUS_26900 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861367.1:DEAD/DEAH box helicase family protein 1190 1522 gene locus_tag LOCUS_26910 gene mobC 1190 1522 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence284 <1 1212 gene locus_tag LOCUS_26920 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087297.1:tyrosine-type recombinase/integrase 1439 1363 gene locus_tag LOCUS_t00430 1439 1363 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence285 <1547 468 gene locus_tag LOCUS_26930 <1547 468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964121.1:histidine--tRNA ligase >Feature sequence286 1148 750 gene locus_tag LOCUS_26940 gene rpsI 1148 750 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence287 90 542 gene locus_tag LOCUS_26950 90 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1439 558 gene locus_tag LOCUS_26960 1439 558 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence288 >Feature sequence289 >Feature sequence290 >Feature sequence291 >Feature sequence292 >Feature sequence293 393 1001 gene locus_tag LOCUS_26970 393 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence294 266 697 gene locus_tag LOCUS_26980 266 697 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 protein_id gnl|my_center|LOCUS_26980 704 949 gene locus_tag LOCUS_26990 704 949 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002334012.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence295 <1 1095 gene locus_tag LOCUS_27000 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391556.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence296