>Feature sequence001 4581 4186 gene locus_tag LOCUS_00010 4581 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 5498 4578 gene locus_tag LOCUS_00020 5498 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6077 5610 gene locus_tag LOCUS_00030 6077 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6425 6991 gene locus_tag LOCUS_00040 6425 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7258 7022 gene locus_tag LOCUS_00050 7258 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8741 9718 gene locus_tag LOCUS_00060 8741 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10623 10823 gene locus_tag LOCUS_00070 10623 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11116 11382 gene locus_tag LOCUS_00080 11116 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11436 12488 gene locus_tag LOCUS_00090 11436 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12789 13094 gene locus_tag LOCUS_00100 12789 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13098 14312 gene locus_tag LOCUS_00110 13098 14312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14305 16035 gene locus_tag LOCUS_00120 14305 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17239 16166 gene locus_tag LOCUS_00130 17239 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17628 17539 gene locus_tag LOCUS_t00010 17628 17539 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19437 17986 gene locus_tag LOCUS_00140 19437 17986 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660080.1 protein_id gnl|my_center|LOCUS_00140 19592 20626 gene locus_tag LOCUS_00150 gene ruvB 19592 20626 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_00150 20748 21767 gene locus_tag LOCUS_00160 20748 21767 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_00160 21801 22931 gene locus_tag LOCUS_00170 21801 22931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24152 23115 gene locus_tag LOCUS_00180 24152 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25482 24436 gene locus_tag LOCUS_00190 25482 24436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27162 28331 gene locus_tag LOCUS_00200 27162 28331 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431768.1 protein_id gnl|my_center|LOCUS_00200 28661 29479 gene locus_tag LOCUS_00210 gene miaA 28661 29479 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_00210 29952 29500 gene locus_tag LOCUS_00220 29952 29500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30185 30514 gene locus_tag LOCUS_00230 30185 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 31984 31418 gene locus_tag LOCUS_00240 31984 31418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32431 32012 gene locus_tag LOCUS_00250 32431 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33496 34536 gene locus_tag LOCUS_00260 gene mnmA 33496 34536 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_00260 34533 35882 gene locus_tag LOCUS_00270 gene mnmE 34533 35882 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_00270 36247 36804 gene locus_tag LOCUS_00280 36247 36804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37493 36828 gene locus_tag LOCUS_00290 37493 36828 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461192.1 protein_id gnl|my_center|LOCUS_00290 38307 37528 gene locus_tag LOCUS_00300 38307 37528 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_00300 38451 38921 gene locus_tag LOCUS_00310 38451 38921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 >Feature sequence002 67 1284 gene locus_tag LOCUS_00320 67 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00320 1495 1680 gene locus_tag LOCUS_00330 1495 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 1769 2116 gene locus_tag LOCUS_00340 1769 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 2417 4312 gene locus_tag LOCUS_00350 2417 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5579 4776 gene locus_tag LOCUS_00360 5579 4776 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_00360 6095 5586 gene locus_tag LOCUS_00370 6095 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 6879 6115 gene locus_tag LOCUS_00380 6879 6115 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_00380 8697 6904 gene locus_tag LOCUS_00390 8697 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 11154 8722 gene locus_tag LOCUS_00400 11154 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 11597 11151 gene locus_tag LOCUS_00410 11597 11151 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887102.1 protein_id gnl|my_center|LOCUS_00410 12422 11631 gene locus_tag LOCUS_00420 12422 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12557 14101 gene locus_tag LOCUS_00430 12557 14101 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_00430 14108 14545 gene locus_tag LOCUS_00440 14108 14545 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_00440 15361 14966 gene locus_tag LOCUS_00450 gene rpsI 15361 14966 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 protein_id gnl|my_center|LOCUS_00450 15805 15377 gene locus_tag LOCUS_00460 gene rplM 15805 15377 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_00460 16283 16071 gene locus_tag LOCUS_00470 16283 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 16376 16576 gene locus_tag LOCUS_00480 gene infA 16376 16576 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_00480 16673 18163 gene locus_tag LOCUS_00490 16673 18163 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_00490 18163 18873 gene locus_tag LOCUS_00500 gene radC 18163 18873 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_00500 19044 18952 gene locus_tag LOCUS_t00020 19044 18952 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20195 19404 gene locus_tag LOCUS_00510 20195 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 21014 20265 gene locus_tag LOCUS_00520 21014 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 21377 21174 gene locus_tag LOCUS_00530 21377 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 21468 23486 gene locus_tag LOCUS_00540 21468 23486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 23532 23828 gene locus_tag LOCUS_00550 23532 23828 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_00550 23841 24878 gene locus_tag LOCUS_00560 23841 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 26606 24915 gene locus_tag LOCUS_00570 26606 24915 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_00570 27400 26627 gene locus_tag LOCUS_00580 27400 26627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 28315 27530 gene locus_tag LOCUS_00590 gene pyrF 28315 27530 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence003 2284 377 gene locus_tag LOCUS_00600 2284 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 2447 3211 gene locus_tag LOCUS_00610 gene gpmA 2447 3211 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_00610 3224 4243 gene locus_tag LOCUS_00620 3224 4243 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_00620 4398 5288 gene locus_tag LOCUS_00630 4398 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5451 6860 gene locus_tag LOCUS_00640 gene mdtD 5451 6860 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084717.1 protein_id gnl|my_center|LOCUS_00640 7355 6885 gene locus_tag LOCUS_00650 7355 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 7595 7855 gene locus_tag LOCUS_00660 7595 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8486 9055 gene locus_tag LOCUS_00670 8486 9055 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_00670 9055 9618 gene locus_tag LOCUS_00680 9055 9618 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_00680 9975 10874 gene locus_tag LOCUS_00690 gene yghA 9975 10874 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018758.1 protein_id gnl|my_center|LOCUS_00690 11190 12440 gene locus_tag LOCUS_00700 11190 12440 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_00700 13505 12531 gene locus_tag LOCUS_00710 13505 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 13841 13767 gene locus_tag LOCUS_t00030 13841 13767 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13953 15116 gene locus_tag LOCUS_00720 gene leuB 13953 15116 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_00720 15248 16288 gene locus_tag LOCUS_00730 15248 16288 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_00730 16372 17244 gene locus_tag LOCUS_00740 16372 17244 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_00740 17311 17320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17336 18862 gene locus_tag LOCUS_00750 17336 18862 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404336.1 protein_id gnl|my_center|LOCUS_00750 19646 18990 gene locus_tag LOCUS_00760 19646 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 21417 20128 gene locus_tag LOCUS_00770 21417 20128 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_00770 23224 21977 gene locus_tag LOCUS_00780 gene nirJ1 23224 21977 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_00780 24128 23217 gene locus_tag LOCUS_00790 24128 23217 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_00790 25168 24350 gene locus_tag LOCUS_00800 25168 24350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 25420 25235 gene locus_tag LOCUS_00810 25420 25235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 25897 25463 gene locus_tag LOCUS_00820 25897 25463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 >Feature sequence004 482 117 gene locus_tag LOCUS_00830 gene rplN 482 117 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081816.1 protein_id gnl|my_center|LOCUS_00830 792 520 gene locus_tag LOCUS_00840 gene rpsQ 792 520 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_00840 1045 842 gene locus_tag LOCUS_00850 1045 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1482 1060 gene locus_tag LOCUS_00860 gene rplP 1482 1060 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_00860 2221 1532 gene locus_tag LOCUS_00870 gene rpsC 2221 1532 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_00870 2600 2262 gene locus_tag LOCUS_00880 gene rplV 2600 2262 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_00880 3350 2640 gene locus_tag LOCUS_00890 3350 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3640 3371 gene locus_tag LOCUS_00900 gene rpsS 3640 3371 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_00900 4512 3676 gene locus_tag LOCUS_00910 gene rplB 4512 3676 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_00910 4823 4539 gene locus_tag LOCUS_00920 4823 4539 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_00920 5438 4830 gene locus_tag LOCUS_00930 gene rplD 5438 4830 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424397.1 protein_id gnl|my_center|LOCUS_00930 6113 5478 gene locus_tag LOCUS_00940 gene rplC 6113 5478 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 protein_id gnl|my_center|LOCUS_00940 6467 6159 gene locus_tag LOCUS_00950 gene rpsJ 6467 6159 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_00950 8651 6504 gene locus_tag LOCUS_00960 gene fusA 8651 6504 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583342.1 protein_id gnl|my_center|LOCUS_00960 9188 8715 gene locus_tag LOCUS_00970 gene rpsG 9188 8715 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_00970 9600 9217 gene locus_tag LOCUS_00980 gene rpsL 9600 9217 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_00980 11463 9922 gene locus_tag LOCUS_00990 gene gpmI 11463 9922 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_00990 11879 11469 gene locus_tag LOCUS_01000 11879 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 12000 13181 gene locus_tag LOCUS_01010 12000 13181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_01010 13178 14581 gene locus_tag LOCUS_01020 13178 14581 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_01020 14578 16458 gene locus_tag LOCUS_01030 14578 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 16468 16737 gene locus_tag LOCUS_01040 16468 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 16739 18613 gene locus_tag LOCUS_01050 gene dxs 16739 18613 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_01050 18610 19389 gene locus_tag LOCUS_01060 18610 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 19386 19931 gene locus_tag LOCUS_01070 19386 19931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 20063 21160 gene locus_tag LOCUS_01080 gene lptG 20063 21160 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_01080 21227 22630 gene locus_tag LOCUS_01090 gene der 21227 22630 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 protein_id gnl|my_center|LOCUS_01090 >Feature sequence005 176 1933 gene locus_tag LOCUS_01100 176 1933 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_01100 2114 2368 gene locus_tag LOCUS_01110 2114 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2851 2399 gene locus_tag LOCUS_01120 2851 2399 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458819.1 protein_id gnl|my_center|LOCUS_01120 3210 5033 gene locus_tag LOCUS_01130 3210 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5138 5518 gene locus_tag LOCUS_01140 5138 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 5582 7441 gene locus_tag LOCUS_01150 5582 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 7525 8259 gene locus_tag LOCUS_01160 7525 8259 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_01160 9041 8391 gene locus_tag LOCUS_01170 9041 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9485 10816 gene locus_tag LOCUS_01180 9485 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 11038 12216 gene locus_tag LOCUS_01190 gene galK 11038 12216 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_01190 12229 14529 gene locus_tag LOCUS_01200 12229 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17728 15722 gene locus_tag LOCUS_01210 17728 15722 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_01210 18673 17729 gene locus_tag LOCUS_01220 gene fmt 18673 17729 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_01220 18886 19986 gene locus_tag LOCUS_01230 18886 19986 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_01230 19992 20720 gene locus_tag LOCUS_01240 19992 20720 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_01240 20856 21098 gene locus_tag LOCUS_01250 gene acpP 20856 21098 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_01250 21198 21740 gene locus_tag LOCUS_01260 21198 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 21844 22473 gene locus_tag LOCUS_01270 21844 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence006 2099 945 gene locus_tag LOCUS_01280 2099 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 3206 2121 gene locus_tag LOCUS_01290 3206 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 3697 4734 gene locus_tag LOCUS_01300 3697 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4821 5855 gene locus_tag LOCUS_01310 4821 5855 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578518.1 protein_id gnl|my_center|LOCUS_01310 9616 5900 gene locus_tag LOCUS_01320 9616 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 11082 9787 gene locus_tag LOCUS_01330 11082 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 13497 11407 gene locus_tag LOCUS_01340 gene ppk1 13497 11407 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_01340 15015 13531 gene locus_tag LOCUS_01350 15015 13531 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_01350 16319 15252 gene locus_tag LOCUS_01360 16319 15252 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765274.1 protein_id gnl|my_center|LOCUS_01360 17138 16341 gene locus_tag LOCUS_01370 gene map 17138 16341 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_01370 17841 17152 gene locus_tag LOCUS_01380 17841 17152 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_01380 19271 17838 gene locus_tag LOCUS_01390 gene secY 19271 17838 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938618.1 protein_id gnl|my_center|LOCUS_01390 19939 19481 gene locus_tag LOCUS_01400 gene rplO 19939 19481 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_01400 <20543 20003 gene locus_tag LOCUS_01410 <20543 20003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938615.1:30S ribosomal protein S5 >Feature sequence007 <1 1179 gene locus_tag LOCUS_01420 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776819.1:glycoside hydrolase N-terminal domain-containing protein 2262 1531 gene locus_tag LOCUS_01430 2262 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3331 2408 gene locus_tag LOCUS_01440 gene manA 3331 2408 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_01440 4678 3428 gene locus_tag LOCUS_01450 4678 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6137 4797 gene locus_tag LOCUS_01460 6137 4797 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_01460 7269 6190 gene locus_tag LOCUS_01470 7269 6190 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_01470 8339 7272 gene locus_tag LOCUS_01480 gene gmd 8339 7272 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_01480 9603 8497 gene locus_tag LOCUS_01490 gene carA 9603 8497 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_01490 12837 9634 gene locus_tag LOCUS_01500 gene carB 12837 9634 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_01500 15243 13093 gene locus_tag LOCUS_01510 15243 13093 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_01510 15630 20069 gene locus_tag LOCUS_01520 gene gltB 15630 20069 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_01520 >Feature sequence008 486 1736 gene locus_tag LOCUS_01530 486 1736 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_01530 2002 3174 gene locus_tag LOCUS_01540 2002 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 4808 3171 gene locus_tag LOCUS_01550 4808 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5663 4977 gene locus_tag LOCUS_01560 5663 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5784 6797 gene locus_tag LOCUS_01570 5784 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 6970 8241 gene locus_tag LOCUS_01580 6970 8241 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_01580 10245 8227 gene locus_tag LOCUS_01590 10245 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 11597 10665 gene locus_tag LOCUS_01600 gene xerD 11597 10665 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_01600 12469 13104 gene locus_tag LOCUS_01610 12469 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 13125 13928 gene locus_tag LOCUS_01620 13125 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13956 15026 gene locus_tag LOCUS_01630 13956 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 15125 15862 gene locus_tag LOCUS_01640 15125 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 15887 16873 gene locus_tag LOCUS_01650 gene mgrA 15887 16873 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_01650 17288 19516 gene locus_tag LOCUS_01660 17288 19516 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_01660 19663 20067 gene locus_tag LOCUS_01670 19663 20067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence009 512 1498 gene locus_tag LOCUS_01680 512 1498 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 protein_id gnl|my_center|LOCUS_01680 1747 2238 gene locus_tag LOCUS_01690 1747 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3440 2373 gene locus_tag LOCUS_01700 gene aroG 3440 2373 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 protein_id gnl|my_center|LOCUS_01700 4240 3599 gene locus_tag LOCUS_01710 4240 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4884 4408 gene locus_tag LOCUS_01720 4884 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5225 4926 gene locus_tag LOCUS_01730 5225 4926 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080623.1 protein_id gnl|my_center|LOCUS_01730 6273 5338 gene locus_tag LOCUS_01740 gene ribF 6273 5338 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371105.1 protein_id gnl|my_center|LOCUS_01740 7012 6278 gene locus_tag LOCUS_01750 7012 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 7986 7009 gene locus_tag LOCUS_01760 7986 7009 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_01760 8327 8109 gene locus_tag LOCUS_01770 8327 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 8424 8433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8508 9359 gene locus_tag LOCUS_01780 8508 9359 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084355.1 protein_id gnl|my_center|LOCUS_01780 9469 10497 gene locus_tag LOCUS_01790 9469 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11491 10514 gene locus_tag LOCUS_01800 11491 10514 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296670.1 protein_id gnl|my_center|LOCUS_01800 12535 11510 gene locus_tag LOCUS_01810 12535 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13489 12563 gene locus_tag LOCUS_01820 13489 12563 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_01820 14495 13509 gene locus_tag LOCUS_01830 gene rfaD 14495 13509 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_01830 14798 15928 gene locus_tag LOCUS_01840 14798 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 15977 16603 gene locus_tag LOCUS_01850 15977 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 18023 16704 gene locus_tag LOCUS_01860 18023 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 18147 18392 gene locus_tag LOCUS_01870 18147 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 18965 18420 gene locus_tag LOCUS_01880 18965 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence010 3180 2851 gene locus_tag LOCUS_01890 3180 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3306 4364 gene locus_tag LOCUS_01900 3306 4364 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_01900 4568 5875 gene locus_tag LOCUS_01910 4568 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5918 6301 gene locus_tag LOCUS_01920 5918 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 6420 7139 gene locus_tag LOCUS_01930 6420 7139 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_01930 7170 8375 gene locus_tag LOCUS_01940 gene lpxK 7170 8375 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_01940 8483 12910 gene locus_tag LOCUS_01950 8483 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 13040 13573 gene locus_tag LOCUS_01960 13040 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 13607 15106 gene locus_tag LOCUS_01970 13607 15106 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_01970 15114 15716 gene locus_tag LOCUS_01980 15114 15716 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_01980 15924 16073 gene locus_tag LOCUS_01990 15924 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 16379 16233 gene locus_tag LOCUS_02000 16379 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 16583 17464 gene locus_tag LOCUS_02010 16583 17464 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_02010 18483 17731 gene locus_tag LOCUS_02020 18483 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 18713 19282 gene locus_tag LOCUS_02030 18713 19282 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence011 57 374 gene locus_tag LOCUS_02040 gene rplU 57 374 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564642.1 protein_id gnl|my_center|LOCUS_02040 403 663 gene locus_tag LOCUS_02050 gene rpmA 403 663 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_02050 818 1270 gene locus_tag LOCUS_02060 818 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 1287 2045 gene locus_tag LOCUS_02070 gene sufC 1287 2045 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_02070 2067 3503 gene locus_tag LOCUS_02080 gene sufB 2067 3503 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_02080 3513 4769 gene locus_tag LOCUS_02090 gene sufD 3513 4769 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_02090 5011 5532 gene locus_tag LOCUS_02100 5011 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02100 5526 5819 gene locus_tag LOCUS_02110 5526 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02110 6362 7327 gene locus_tag LOCUS_02120 gene bioB 6362 7327 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_02120 7362 8711 gene locus_tag LOCUS_02130 gene bioA 7362 8711 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_02130 8821 9912 gene locus_tag LOCUS_02140 8821 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 11743 9992 gene locus_tag LOCUS_02150 11743 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 12250 11906 gene locus_tag LOCUS_02160 12250 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 12585 12247 gene locus_tag LOCUS_02170 12585 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 13554 12616 gene locus_tag LOCUS_02180 13554 12616 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_02180 14048 13551 gene locus_tag LOCUS_02190 14048 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 15187 14045 gene locus_tag LOCUS_02200 gene rffA 15187 14045 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_02200 16422 15301 gene locus_tag LOCUS_02210 16422 15301 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_02210 16584 17099 gene locus_tag LOCUS_02220 16584 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 18441 17653 gene locus_tag LOCUS_02230 18441 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence012 4709 516 gene locus_tag LOCUS_02240 gene rpoC 4709 516 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_02240 8720 4782 gene locus_tag LOCUS_02250 gene rpoB 8720 4782 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_02250 9298 8924 gene locus_tag LOCUS_02260 gene rplL 9298 8924 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707747.1 protein_id gnl|my_center|LOCUS_02260 9960 9457 gene locus_tag LOCUS_02270 gene rplJ 9960 9457 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_02270 10683 9982 gene locus_tag LOCUS_02280 gene rplA 10683 9982 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_02280 11162 10734 gene locus_tag LOCUS_02290 gene rplK 11162 10734 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_02290 11786 11217 gene locus_tag LOCUS_02300 gene nusG 11786 11217 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_02300 12042 11815 gene locus_tag LOCUS_02310 12042 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12151 12076 gene locus_tag LOCUS_t00040 12151 12076 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 13434 12250 gene locus_tag LOCUS_02320 gene tuf 13434 12250 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_02320 13553 13479 gene locus_tag LOCUS_t00050 13553 13479 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14841 13759 gene locus_tag LOCUS_02330 gene tsaD 14841 13759 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_02330 16234 14864 gene locus_tag LOCUS_02340 gene clpX 16234 14864 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_02340 16928 16272 gene locus_tag LOCUS_02350 gene clpP 16928 16272 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_02350 <18212 17049 gene locus_tag LOCUS_02360 <18212 17049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965929.1:trigger factor >Feature sequence013 305 3055 gene locus_tag LOCUS_02370 305 3055 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_02370 3196 3627 gene locus_tag LOCUS_02380 3196 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3816 4202 gene locus_tag LOCUS_02390 3816 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 4199 5032 gene locus_tag LOCUS_02400 4199 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5221 6450 gene locus_tag LOCUS_02410 5221 6450 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_02410 6464 9604 gene locus_tag LOCUS_02420 6464 9604 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_02420 11061 9679 gene locus_tag LOCUS_02430 11061 9679 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 protein_id gnl|my_center|LOCUS_02430 11573 11268 gene locus_tag LOCUS_02440 11573 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 12562 11771 gene locus_tag LOCUS_02450 gene thiD 12562 11771 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_02450 12676 13143 gene locus_tag LOCUS_02460 12676 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14197 13151 gene locus_tag LOCUS_02470 14197 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 14373 15104 gene locus_tag LOCUS_02480 14373 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 16380 15127 gene locus_tag LOCUS_02490 16380 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 16501 17046 gene locus_tag LOCUS_02500 16501 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 18076 16991 gene locus_tag LOCUS_02510 18076 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence014 10455 6769 gene locus_tag LOCUS_02520 10455 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 10757 10966 gene locus_tag LOCUS_02530 10757 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12082 13035 gene locus_tag LOCUS_02540 12082 13035 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_02540 14973 13153 gene locus_tag LOCUS_02550 14973 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 16627 15281 gene locus_tag LOCUS_02560 16627 15281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence015 283 2040 gene locus_tag LOCUS_02570 283 2040 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_02570 3583 2117 gene locus_tag LOCUS_02580 gene gatB 3583 2117 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_02580 4836 4099 gene locus_tag LOCUS_02590 4836 4099 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_02590 4947 5909 gene locus_tag LOCUS_02600 gene pfkA 4947 5909 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_02600 6038 7090 gene locus_tag LOCUS_02610 gene rffG 6038 7090 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216798.1 protein_id gnl|my_center|LOCUS_02610 7100 7963 gene locus_tag LOCUS_02620 gene rfbA 7100 7963 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_02620 9023 8301 gene locus_tag LOCUS_02630 9023 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10599 9112 gene locus_tag LOCUS_02640 10599 9112 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_02640 11446 10667 gene locus_tag LOCUS_02650 11446 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 13147 11483 gene locus_tag LOCUS_02660 13147 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 13616 13227 gene locus_tag LOCUS_02670 13616 13227 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387810.1 protein_id gnl|my_center|LOCUS_02670 14145 13699 gene locus_tag LOCUS_02680 14145 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 15732 14167 gene locus_tag LOCUS_02690 15732 14167 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_02690 16191 15769 gene locus_tag LOCUS_02700 gene mce 16191 15769 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence016 315 118 gene locus_tag LOCUS_02710 315 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1082 315 gene locus_tag LOCUS_02720 1082 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1297 2520 gene locus_tag LOCUS_02730 1297 2520 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_02730 2981 3958 gene locus_tag LOCUS_02740 2981 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4269 4837 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcacctcacacgaggtgcgtggattgaaac 6690 5323 gene locus_tag LOCUS_02750 6690 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 8129 6690 gene locus_tag LOCUS_02760 8129 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 9361 8150 gene locus_tag LOCUS_02770 gene ftsA 9361 8150 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 protein_id gnl|my_center|LOCUS_02770 10021 9476 gene locus_tag LOCUS_02780 10021 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 12059 10119 gene locus_tag LOCUS_02790 12059 10119 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_02790 13994 12210 gene locus_tag LOCUS_02800 gene msbA 13994 12210 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_02800 15838 13988 gene locus_tag LOCUS_02810 gene msbA 15838 13988 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence017 1008 40 gene locus_tag LOCUS_02820 1008 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1095 1586 gene locus_tag LOCUS_02830 gene hisI 1095 1586 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_02830 1652 2602 gene locus_tag LOCUS_02840 1652 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2622 3137 gene locus_tag LOCUS_02850 2622 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3169 3867 gene locus_tag LOCUS_02860 gene rsmI 3169 3867 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_02860 4069 4326 gene locus_tag LOCUS_02870 4069 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 5808 4468 gene locus_tag LOCUS_02880 5808 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6643 5948 gene locus_tag LOCUS_02890 gene rnc 6643 5948 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_02890 6806 7309 gene locus_tag LOCUS_02900 6806 7309 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_02900 8426 7365 gene locus_tag LOCUS_02910 gene recF 8426 7365 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906242.1 protein_id gnl|my_center|LOCUS_02910 9063 8452 gene locus_tag LOCUS_02920 9063 8452 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_02920 9701 9060 gene locus_tag LOCUS_02930 gene cmk 9701 9060 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 protein_id gnl|my_center|LOCUS_02930 9840 11681 gene locus_tag LOCUS_02940 9840 11681 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_02940 12634 11738 gene locus_tag LOCUS_02950 gene thiL 12634 11738 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_02950 13553 12624 gene locus_tag LOCUS_02960 13553 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13692 15074 gene locus_tag LOCUS_02970 13692 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence018 1251 4640 gene locus_tag LOCUS_02980 1251 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5041 7470 gene locus_tag LOCUS_02990 5041 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8794 7553 gene locus_tag LOCUS_03000 8794 7553 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125805.1 protein_id gnl|my_center|LOCUS_03000 9629 8934 gene locus_tag LOCUS_03010 9629 8934 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_03010 9742 10395 gene locus_tag LOCUS_03020 9742 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 10490 11785 gene locus_tag LOCUS_03030 gene eno 10490 11785 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_03030 11814 12182 gene locus_tag LOCUS_03040 11814 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 13052 12537 gene locus_tag LOCUS_03050 13052 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 14567 13254 gene locus_tag LOCUS_03060 14567 13254 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_03060 15252 14704 gene locus_tag LOCUS_03070 15252 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 16095 15433 gene locus_tag LOCUS_03080 16095 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence019 2007 3638 gene locus_tag LOCUS_03090 2007 3638 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705882.1 protein_id gnl|my_center|LOCUS_03090 3863 4645 gene locus_tag LOCUS_03100 3863 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4647 5255 gene locus_tag LOCUS_03110 4647 5255 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_03110 5354 5608 gene locus_tag LOCUS_03120 gene rpsO 5354 5608 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_03120 5757 6374 gene locus_tag LOCUS_03130 5757 6374 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966545.1 protein_id gnl|my_center|LOCUS_03130 6371 7381 gene locus_tag LOCUS_03140 6371 7381 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957810.1 protein_id gnl|my_center|LOCUS_03140 7393 8952 gene locus_tag LOCUS_03150 7393 8952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_03150 8949 10364 gene locus_tag LOCUS_03160 8949 10364 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_03160 10780 12858 gene locus_tag LOCUS_03170 gene pnp 10780 12858 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_03170 13842 12979 gene locus_tag LOCUS_03180 13842 12979 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_03180 14226 15290 gene locus_tag LOCUS_03190 14226 15290 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764889.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence020 873 304 gene locus_tag LOCUS_03200 873 304 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_03200 2038 866 gene locus_tag LOCUS_03210 2038 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3792 2035 gene locus_tag LOCUS_03220 3792 2035 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_03220 5036 3816 gene locus_tag LOCUS_03230 5036 3816 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_03230 6551 5124 gene locus_tag LOCUS_03240 6551 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 8398 6812 gene locus_tag LOCUS_03250 8398 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 9246 8413 gene locus_tag LOCUS_03260 9246 8413 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_03260 12021 9274 gene locus_tag LOCUS_03270 12021 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 12167 13372 gene locus_tag LOCUS_03280 gene pepT 12167 13372 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_03280 16303 13694 gene locus_tag LOCUS_03290 16303 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence021 680 1798 gene locus_tag LOCUS_03300 680 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 1826 3214 gene locus_tag LOCUS_03310 1826 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_03310 3313 4584 gene locus_tag LOCUS_03320 3313 4584 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_03320 4908 5513 gene locus_tag LOCUS_03330 4908 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5710 5507 gene locus_tag LOCUS_03340 5710 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5794 9165 gene locus_tag LOCUS_03350 5794 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 9187 10629 gene locus_tag LOCUS_03360 9187 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 10777 11694 gene locus_tag LOCUS_03370 10777 11694 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_03370 11708 12889 gene locus_tag LOCUS_03380 11708 12889 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_03380 13333 13214 gene locus_tag LOCUS_03390 13333 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 13738 13361 gene locus_tag LOCUS_03400 13738 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03400 14822 13806 gene locus_tag LOCUS_03410 14822 13806 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_03410 14844 15446 gene locus_tag LOCUS_03420 14844 15446 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence022 1214 183 gene locus_tag LOCUS_03430 1214 183 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_03430 1540 4230 gene locus_tag LOCUS_03440 1540 4230 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202510.1 protein_id gnl|my_center|LOCUS_03440 4246 4716 gene locus_tag LOCUS_03450 4246 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5376 4951 gene locus_tag LOCUS_03460 5376 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5571 9107 gene locus_tag LOCUS_03470 5571 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 9372 9935 gene locus_tag LOCUS_03480 9372 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 10111 11097 gene locus_tag LOCUS_03490 10111 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11094 11726 gene locus_tag LOCUS_03500 11094 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 11689 12834 gene locus_tag LOCUS_03510 11689 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 13554 13141 gene locus_tag LOCUS_03520 13554 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 14136 13657 gene locus_tag LOCUS_03530 14136 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 14676 14344 gene locus_tag LOCUS_03540 14676 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 14579 15649 gene locus_tag LOCUS_03550 14579 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence023 519 109 gene locus_tag LOCUS_03560 gene rplQ 519 109 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 protein_id gnl|my_center|LOCUS_03560 1680 556 gene locus_tag LOCUS_03570 1680 556 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_03570 1893 3017 gene locus_tag LOCUS_03580 1893 3017 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942549.1 protein_id gnl|my_center|LOCUS_03580 3010 4125 gene locus_tag LOCUS_03590 3010 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4410 5462 gene locus_tag LOCUS_03600 4410 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 8183 5757 gene locus_tag LOCUS_03610 gene secDF 8183 5757 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_03610 9285 8383 gene locus_tag LOCUS_03620 9285 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 10170 9484 gene locus_tag LOCUS_03630 10170 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10356 11045 gene locus_tag LOCUS_03640 10356 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11273 12193 gene locus_tag LOCUS_03650 11273 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12323 13246 gene locus_tag LOCUS_03660 12323 13246 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_03660 13433 14140 gene locus_tag LOCUS_03670 13433 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 14168 15094 gene locus_tag LOCUS_03680 14168 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 15133 15564 gene locus_tag LOCUS_03690 15133 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence024 580 1323 gene locus_tag LOCUS_03700 580 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 1410 1589 gene locus_tag LOCUS_03710 1410 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03710 1746 2300 gene locus_tag LOCUS_03720 1746 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2324 3481 gene locus_tag LOCUS_03730 gene dnaJ 2324 3481 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_03730 3506 4243 gene locus_tag LOCUS_03740 3506 4243 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_03740 4266 5258 gene locus_tag LOCUS_03750 4266 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6436 5516 gene locus_tag LOCUS_03760 gene hpnD 6436 5516 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_03760 7800 6478 gene locus_tag LOCUS_03770 7800 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 9193 7817 gene locus_tag LOCUS_03780 9193 7817 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_03780 9808 9197 gene locus_tag LOCUS_03790 9808 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9898 10527 gene locus_tag LOCUS_03800 9898 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 11269 10547 gene locus_tag LOCUS_03810 11269 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 12236 11286 gene locus_tag LOCUS_03820 12236 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12319 13248 gene locus_tag LOCUS_03830 12319 13248 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_03830 13382 13984 gene locus_tag LOCUS_03840 13382 13984 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311165.1 protein_id gnl|my_center|LOCUS_03840 14119 15348 gene locus_tag LOCUS_03850 14119 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence025 1057 83 gene locus_tag LOCUS_03860 1057 83 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_03860 2080 1079 gene locus_tag LOCUS_03870 2080 1079 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_03870 2946 2188 gene locus_tag LOCUS_03880 2946 2188 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_03880 3507 3049 gene locus_tag LOCUS_03890 3507 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3674 5257 gene locus_tag LOCUS_03900 gene cobA 3674 5257 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_03900 5759 5322 gene locus_tag LOCUS_03910 5759 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6003 8576 gene locus_tag LOCUS_03920 6003 8576 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_03920 8856 10010 gene locus_tag LOCUS_03930 8856 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 10904 10032 gene locus_tag LOCUS_03940 10904 10032 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_03940 11655 10990 gene locus_tag LOCUS_03950 11655 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 14599 11846 gene locus_tag LOCUS_03960 gene acnA 14599 11846 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_03960 14839 15111 gene locus_tag LOCUS_03970 14839 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence026 2210 1104 gene locus_tag LOCUS_03980 gene holA 2210 1104 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_03980 2470 3930 gene locus_tag LOCUS_03990 2470 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4055 4537 gene locus_tag LOCUS_04000 gene ilvN 4055 4537 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_04000 4607 8302 gene locus_tag LOCUS_04010 gene hrpA 4607 8302 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_04010 9674 8970 gene locus_tag LOCUS_04020 9674 8970 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_04020 11433 9685 gene locus_tag LOCUS_04030 11433 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14118 11671 gene locus_tag LOCUS_04040 14118 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14959 14204 gene locus_tag LOCUS_04050 14959 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence027 608 6604 gene locus_tag LOCUS_04060 608 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 6698 8992 gene locus_tag LOCUS_04070 6698 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 9384 9046 gene locus_tag LOCUS_04080 9384 9046 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944869.1 protein_id gnl|my_center|LOCUS_04080 11909 9654 gene locus_tag LOCUS_04090 gene rnr 11909 9654 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_04090 14606 12102 gene locus_tag LOCUS_04100 14606 12102 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence028 73 9528 gene locus_tag LOCUS_04110 73 9528 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_04110 10081 9668 gene locus_tag LOCUS_04120 10081 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 11632 10487 gene locus_tag LOCUS_04130 11632 10487 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259309.1 protein_id gnl|my_center|LOCUS_04130 11949 11713 gene locus_tag LOCUS_04140 11949 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 13545 12082 gene locus_tag LOCUS_04150 13545 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence029 1 417 gene locus_tag LOCUS_04160 1 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 614 2422 gene locus_tag LOCUS_04170 gene ilvB 614 2422 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_04170 2957 3506 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccctcacgggtgcgtggattgaaac 3585 4247 gene locus_tag LOCUS_04180 3585 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4301 5203 gene locus_tag LOCUS_04190 4301 5203 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_04190 5479 6165 gene locus_tag LOCUS_04200 5479 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6956 6303 gene locus_tag LOCUS_04210 gene rpe 6956 6303 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870387.1 protein_id gnl|my_center|LOCUS_04210 9555 6982 gene locus_tag LOCUS_04220 gene leuS 9555 6982 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199945.1 protein_id gnl|my_center|LOCUS_04220 9735 11405 gene locus_tag LOCUS_04230 9735 11405 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_04230 12541 11711 gene locus_tag LOCUS_04240 12541 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 12720 13922 gene locus_tag LOCUS_04250 gene nspC 12720 13922 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence030 623 547 gene locus_tag LOCUS_t00060 623 547 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 718 1200 gene locus_tag LOCUS_04260 718 1200 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_04260 2092 1502 gene locus_tag LOCUS_04270 2092 1502 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798768.1 protein_id gnl|my_center|LOCUS_04270 2403 4091 gene locus_tag LOCUS_04280 gene rpsA 2403 4091 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_04280 4229 4630 gene locus_tag LOCUS_04290 4229 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5167 6168 gene locus_tag LOCUS_04300 gene prfB 5167 6168 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_04300 6181 6900 gene locus_tag LOCUS_04310 gene trmD 6181 6900 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_04310 7024 7179 gene locus_tag LOCUS_04320 7024 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 7380 9092 gene locus_tag LOCUS_04330 7380 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8530 8629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9089 10516 gene locus_tag LOCUS_04340 9089 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 10572 10871 gene locus_tag LOCUS_04350 gene tatA 10572 10871 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_04350 11004 11198 gene locus_tag LOCUS_04360 11004 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 11201 11500 gene locus_tag LOCUS_04370 11201 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 11844 13157 gene locus_tag LOCUS_04380 11844 13157 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_04380 13293 13652 gene locus_tag LOCUS_04390 13293 13652 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_04390 13661 14437 gene locus_tag LOCUS_04400 13661 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence031 413 1411 gene locus_tag LOCUS_04410 gene fbaA 413 1411 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 protein_id gnl|my_center|LOCUS_04410 1604 2626 gene locus_tag LOCUS_04420 1604 2626 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242482.1 protein_id gnl|my_center|LOCUS_04420 2623 3861 gene locus_tag LOCUS_04430 2623 3861 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_04430 5872 4037 gene locus_tag LOCUS_04440 gene typA 5872 4037 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933091.1 protein_id gnl|my_center|LOCUS_04440 6076 6942 gene locus_tag LOCUS_04450 gene ilvE 6076 6942 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_04450 8006 7089 gene locus_tag LOCUS_04460 8006 7089 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_04460 8190 8705 gene locus_tag LOCUS_04470 8190 8705 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_04470 9338 8727 gene locus_tag LOCUS_04480 9338 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9468 9971 gene locus_tag LOCUS_04490 9468 9971 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 protein_id gnl|my_center|LOCUS_04490 10056 11108 gene locus_tag LOCUS_04500 gene obgE 10056 11108 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_04500 11146 12303 gene locus_tag LOCUS_04510 11146 12303 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_04510 12437 13462 gene locus_tag LOCUS_04520 12437 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence032 1732 170 gene locus_tag LOCUS_04530 1732 170 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_04530 3405 1798 gene locus_tag LOCUS_04540 3405 1798 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_04540 4169 3420 gene locus_tag LOCUS_04550 gene kdsB 4169 3420 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_04550 5793 4270 gene locus_tag LOCUS_04560 5793 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5923 5848 gene locus_tag LOCUS_t00070 5923 5848 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7057 6857 gene locus_tag LOCUS_04570 7057 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 9745 8672 gene locus_tag LOCUS_04580 9745 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10863 9769 gene locus_tag LOCUS_04590 10863 9769 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_04590 11971 10889 gene locus_tag LOCUS_04600 11971 10889 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_04600 12468 12106 gene locus_tag LOCUS_04610 12468 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 12914 12468 gene locus_tag LOCUS_04620 12914 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 13300 12974 gene locus_tag LOCUS_04630 13300 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence033 1218 1045 gene locus_tag LOCUS_04640 1218 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 1190 1732 gene locus_tag LOCUS_04650 1190 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 1778 3844 gene locus_tag LOCUS_04660 gene recG 1778 3844 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_04660 3985 4428 gene locus_tag LOCUS_04670 3985 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4547 5953 gene locus_tag LOCUS_04680 4547 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8980 6023 gene locus_tag LOCUS_04690 8980 6023 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_04690 9712 9176 gene locus_tag LOCUS_04700 9712 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 10518 9814 gene locus_tag LOCUS_04710 10518 9814 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228901.1 protein_id gnl|my_center|LOCUS_04710 11823 10546 gene locus_tag LOCUS_04720 11823 10546 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_04720 12123 12539 gene locus_tag LOCUS_04730 12123 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 <13409 12648 gene locus_tag LOCUS_04740 <13409 12648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070659.1:3-dehydroquinate synthase >Feature sequence034 4135 740 gene locus_tag LOCUS_04750 4135 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4500 5315 gene locus_tag LOCUS_04760 4500 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 6988 5732 gene locus_tag LOCUS_04770 6988 5732 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_04770 7659 7027 gene locus_tag LOCUS_04780 7659 7027 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_04780 10355 7719 gene locus_tag LOCUS_04790 gene gyrA 10355 7719 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_04790 12937 10379 gene locus_tag LOCUS_04800 gene gyrB 12937 10379 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence035 2576 2914 gene locus_tag LOCUS_04810 2576 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4744 3443 gene locus_tag LOCUS_04820 gene gltX 4744 3443 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869827.1 protein_id gnl|my_center|LOCUS_04820 4919 6067 gene locus_tag LOCUS_04830 4919 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 6091 6927 gene locus_tag LOCUS_04840 6091 6927 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_04840 7268 9556 gene locus_tag LOCUS_04850 7268 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 9595 11490 gene locus_tag LOCUS_04860 9595 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 11592 12281 gene locus_tag LOCUS_04870 11592 12281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence036 294 986 gene locus_tag LOCUS_04880 294 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2500 1001 gene locus_tag LOCUS_04890 2500 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3961 2672 gene locus_tag LOCUS_04900 gene eno 3961 2672 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_04900 4949 4116 gene locus_tag LOCUS_04910 4949 4116 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_04910 5100 7196 gene locus_tag LOCUS_04920 5100 7196 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_04920 7292 8356 gene locus_tag LOCUS_04930 7292 8356 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009058447.1 protein_id gnl|my_center|LOCUS_04930 8414 10480 gene locus_tag LOCUS_04940 8414 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11819 10443 gene locus_tag LOCUS_04950 gene miaB 11819 10443 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_04950 13050 11827 gene locus_tag LOCUS_04960 gene rlmD 13050 11827 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence037 112 186 gene locus_tag LOCUS_t00080 112 186 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1399 299 gene locus_tag LOCUS_04970 1399 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4826 1476 gene locus_tag LOCUS_04980 gene secA 4826 1476 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_04980 5048 5419 gene locus_tag LOCUS_04990 5048 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5605 5447 gene locus_tag LOCUS_05000 5605 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5849 11371 gene locus_tag LOCUS_05010 gene uvrA 5849 11371 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_05010 11745 11455 gene locus_tag LOCUS_05020 11745 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence038 1 270 gene locus_tag LOCUS_05030 1 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1371 604 gene locus_tag LOCUS_05040 1371 604 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_05040 3370 1412 gene locus_tag LOCUS_05050 3370 1412 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_05050 4092 3391 gene locus_tag LOCUS_05060 4092 3391 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_05060 4293 4565 gene locus_tag LOCUS_05070 4293 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4571 5389 gene locus_tag LOCUS_05080 4571 5389 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_05080 6136 5585 gene locus_tag LOCUS_05090 6136 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7266 6547 gene locus_tag LOCUS_05100 7266 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 9090 7888 gene locus_tag LOCUS_05110 9090 7888 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_05110 9857 9111 gene locus_tag LOCUS_05120 gene fabG 9857 9111 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_05120 10720 10190 gene locus_tag LOCUS_05130 10720 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12389 10779 gene locus_tag LOCUS_05140 12389 10779 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence039 2229 85 gene locus_tag LOCUS_05150 gene scpA 2229 85 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_05150 4300 2252 gene locus_tag LOCUS_05160 4300 2252 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_05160 2814 2823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4503 7115 gene locus_tag LOCUS_05170 4503 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7112 7822 gene locus_tag LOCUS_05180 7112 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 7829 8062 gene locus_tag LOCUS_05190 7829 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 8082 9077 gene locus_tag LOCUS_05200 8082 9077 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_05200 9067 10509 gene locus_tag LOCUS_05210 9067 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10512 11951 gene locus_tag LOCUS_05220 10512 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 <12560 12046 gene locus_tag LOCUS_05230 <12560 12046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921679.1:pyrroline-5-carboxylate reductase >Feature sequence040 286 1452 gene locus_tag LOCUS_05240 286 1452 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_05240 1652 2635 gene locus_tag LOCUS_05250 1652 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2656 3504 gene locus_tag LOCUS_05260 2656 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 3574 4089 gene locus_tag LOCUS_05270 3574 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4861 4220 gene locus_tag LOCUS_05280 4861 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4990 5991 gene locus_tag LOCUS_05290 gene dusB 4990 5991 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_05290 6212 7858 gene locus_tag LOCUS_05300 6212 7858 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_05300 7887 9545 gene locus_tag LOCUS_05310 7887 9545 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_05310 9612 10880 gene locus_tag LOCUS_05320 9612 10880 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05320 10901 11566 gene locus_tag LOCUS_05330 10901 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence041 586 662 gene locus_tag LOCUS_t00090 586 662 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1131 2606 gene locus_tag LOCUS_05340 1131 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3203 3982 gene locus_tag LOCUS_05350 3203 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4190 4657 gene locus_tag LOCUS_05360 gene crcB 4190 4657 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_05360 4873 6357 gene locus_tag LOCUS_05370 4873 6357 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640791.1 protein_id gnl|my_center|LOCUS_05370 6350 7105 gene locus_tag LOCUS_05380 6350 7105 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_05380 7937 7257 gene locus_tag LOCUS_05390 7937 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9003 8131 gene locus_tag LOCUS_05400 9003 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 10103 9222 gene locus_tag LOCUS_05410 10103 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 10902 10105 gene locus_tag LOCUS_05420 10902 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11974 11054 gene locus_tag LOCUS_05430 11974 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence042 1437 652 gene locus_tag LOCUS_05440 1437 652 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_05440 2215 1562 gene locus_tag LOCUS_05450 2215 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3320 2271 gene locus_tag LOCUS_05460 gene floA 3320 2271 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_05460 3415 4404 gene locus_tag LOCUS_05470 gene queA 3415 4404 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_05470 5016 4408 gene locus_tag LOCUS_05480 5016 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5441 7192 gene locus_tag LOCUS_05490 5441 7192 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_05490 7933 7199 gene locus_tag LOCUS_05500 7933 7199 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861381.1 protein_id gnl|my_center|LOCUS_05500 9396 7972 gene locus_tag LOCUS_05510 9396 7972 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_05510 9699 10985 gene locus_tag LOCUS_05520 9699 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 11418 11849 gene locus_tag LOCUS_05530 11418 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence043 581 1582 gene locus_tag LOCUS_05540 gene purM 581 1582 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880467.1 protein_id gnl|my_center|LOCUS_05540 1646 3565 gene locus_tag LOCUS_05550 1646 3565 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_05550 3599 4198 gene locus_tag LOCUS_05560 gene rpoE 3599 4198 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_05560 4304 4807 gene locus_tag LOCUS_05570 4304 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4808 5692 gene locus_tag LOCUS_05580 4808 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5803 6171 gene locus_tag LOCUS_05590 5803 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6184 6723 gene locus_tag LOCUS_05600 6184 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6798 7379 gene locus_tag LOCUS_05610 6798 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7393 8442 gene locus_tag LOCUS_05620 7393 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8457 11120 gene locus_tag LOCUS_05630 8457 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence044 1848 166 gene locus_tag LOCUS_05640 1848 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2584 1898 gene locus_tag LOCUS_05650 2584 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2753 3241 gene locus_tag LOCUS_05660 2753 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5777 3516 gene locus_tag LOCUS_05670 5777 3516 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_05670 9175 6065 gene locus_tag LOCUS_05680 9175 6065 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_05680 10316 9183 gene locus_tag LOCUS_05690 10316 9183 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817170.1 protein_id gnl|my_center|LOCUS_05690 10793 10323 gene locus_tag LOCUS_05700 10793 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11023 11100 gene locus_tag LOCUS_t00100 11023 11100 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 407 51 gene locus_tag LOCUS_05710 407 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 795 2087 gene locus_tag LOCUS_05720 795 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2309 3925 gene locus_tag LOCUS_05730 2309 3925 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940631.1 protein_id gnl|my_center|LOCUS_05730 6211 3968 gene locus_tag LOCUS_05740 6211 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6907 9003 gene locus_tag LOCUS_05750 6907 9003 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_05750 9053 9247 gene locus_tag LOCUS_05760 9053 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9274 9990 gene locus_tag LOCUS_05770 9274 9990 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_05770 10002 11615 gene locus_tag LOCUS_05780 10002 11615 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327627.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence046 <1 769 gene locus_tag LOCUS_05790 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965357.1:D-alanyl-D-alanine carboxypeptidase family protein 827 1948 gene locus_tag LOCUS_05800 gene ychF 827 1948 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_05800 2023 3108 gene locus_tag LOCUS_05810 gene gcvT 2023 3108 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_05810 3179 3559 gene locus_tag LOCUS_05820 gene gcvH 3179 3559 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_05820 3654 6500 gene locus_tag LOCUS_05830 gene gcvP 3654 6500 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089349.1 protein_id gnl|my_center|LOCUS_05830 7048 7827 gene locus_tag LOCUS_05840 7048 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7956 10871 gene locus_tag LOCUS_05850 7956 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence047 835 242 gene locus_tag LOCUS_05860 835 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3245 837 gene locus_tag LOCUS_05870 gene mutS 3245 837 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_05870 3834 3484 gene locus_tag LOCUS_05880 gene rsfS 3834 3484 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418177.1 protein_id gnl|my_center|LOCUS_05880 6287 3855 gene locus_tag LOCUS_05890 6287 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7222 6434 gene locus_tag LOCUS_05900 7222 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8288 7212 gene locus_tag LOCUS_05910 8288 7212 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_05910 8576 9469 gene locus_tag LOCUS_05920 gene menB 8576 9469 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_05920 9485 10315 gene locus_tag LOCUS_05930 9485 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10787 10966 gene locus_tag LOCUS_05940 10787 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence048 297 1391 gene locus_tag LOCUS_05950 297 1391 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_05950 1410 3410 gene locus_tag LOCUS_05960 1410 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3431 4828 gene locus_tag LOCUS_05970 gene uxaC 3431 4828 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174193.1 protein_id gnl|my_center|LOCUS_05970 4832 5461 gene locus_tag LOCUS_05980 4832 5461 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_05980 5498 6778 gene locus_tag LOCUS_05990 5498 6778 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_05990 8835 7324 gene locus_tag LOCUS_06000 gene oadA 8835 7324 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_06000 10422 8956 gene locus_tag LOCUS_06010 gene cls 10422 8956 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_06010 10556 11371 gene locus_tag LOCUS_06020 10556 11371 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence049 522 1325 gene locus_tag LOCUS_06030 522 1325 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_06030 1514 2308 gene locus_tag LOCUS_06040 gene tcdA 1514 2308 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117726.1 protein_id gnl|my_center|LOCUS_06040 2305 2817 gene locus_tag LOCUS_06050 2305 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2922 3007 gene locus_tag LOCUS_t00110 2922 3007 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3031 3255 gene locus_tag LOCUS_06060 3031 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4113 3151 gene locus_tag LOCUS_06070 4113 3151 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_06070 4429 5904 gene locus_tag LOCUS_06080 4429 5904 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 protein_id gnl|my_center|LOCUS_06080 6005 7333 gene locus_tag LOCUS_06090 6005 7333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789653.1 protein_id gnl|my_center|LOCUS_06090 7574 8014 gene locus_tag LOCUS_06100 7574 8014 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_06100 9381 8245 gene locus_tag LOCUS_06110 9381 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 9777 10976 gene locus_tag LOCUS_06120 gene kbl 9777 10976 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213823.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence050 296 997 gene locus_tag LOCUS_06130 296 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 1523 2416 gene locus_tag LOCUS_06140 1523 2416 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_06140 2511 3599 gene locus_tag LOCUS_06150 2511 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3623 5161 gene locus_tag LOCUS_06160 3623 5161 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_06160 5619 8363 gene locus_tag LOCUS_06170 gene ppdK 5619 8363 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_06170 9051 8488 gene locus_tag LOCUS_06180 9051 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9676 9098 gene locus_tag LOCUS_06190 gene aat 9676 9098 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_06190 10698 9673 gene locus_tag LOCUS_06200 10698 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11623 10691 gene locus_tag LOCUS_06210 gene aroE 11623 10691 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257813.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence051 188 1411 gene locus_tag LOCUS_06220 gene trpB 188 1411 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_06220 1503 2441 gene locus_tag LOCUS_06230 1503 2441 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929187.1 protein_id gnl|my_center|LOCUS_06230 2446 3930 gene locus_tag LOCUS_06240 2446 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3927 4382 gene locus_tag LOCUS_06250 3927 4382 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_06250 4430 4903 gene locus_tag LOCUS_06260 gene elsL 4430 4903 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_06260 5056 6435 gene locus_tag LOCUS_06270 5056 6435 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_06270 6460 7497 gene locus_tag LOCUS_06280 gene cydB 6460 7497 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_06280 7578 10334 gene locus_tag LOCUS_06290 7578 10334 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_06290 10348 11442 gene locus_tag LOCUS_06300 gene odhB 10348 11442 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence052 1865 2893 gene locus_tag LOCUS_06310 1865 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4108 3074 gene locus_tag LOCUS_06320 gene hypE 4108 3074 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_06320 5203 4121 gene locus_tag LOCUS_06330 gene hypD 5203 4121 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_06330 5474 5232 gene locus_tag LOCUS_06340 5474 5232 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_06340 7805 5478 gene locus_tag LOCUS_06350 gene hypF 7805 5478 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_06350 8469 7786 gene locus_tag LOCUS_06360 gene hypB 8469 7786 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_06360 9506 8637 gene locus_tag LOCUS_06370 9506 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 9732 11006 gene locus_tag LOCUS_06380 gene hisS 9732 11006 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence053 4169 3333 gene locus_tag LOCUS_06390 4169 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4804 4166 gene locus_tag LOCUS_06400 gene pdxH 4804 4166 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 protein_id gnl|my_center|LOCUS_06400 5689 4826 gene locus_tag LOCUS_06410 gene nadC 5689 4826 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_06410 6599 5706 gene locus_tag LOCUS_06420 6599 5706 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_06420 7648 6638 gene locus_tag LOCUS_06430 7648 6638 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_06430 8527 7802 gene locus_tag LOCUS_06440 8527 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9973 8594 gene locus_tag LOCUS_06450 9973 8594 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_06450 10976 10047 gene locus_tag LOCUS_06460 gene trxB 10976 10047 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence054 338 1123 gene locus_tag LOCUS_06470 338 1123 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_06470 1143 2003 gene locus_tag LOCUS_06480 1143 2003 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101257.1 protein_id gnl|my_center|LOCUS_06480 2116 2607 gene locus_tag LOCUS_06490 2116 2607 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_06490 2613 3668 gene locus_tag LOCUS_06500 2613 3668 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_06500 3699 6293 gene locus_tag LOCUS_06510 3699 6293 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892034.1 protein_id gnl|my_center|LOCUS_06510 6421 8973 gene locus_tag LOCUS_06520 6421 8973 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918428.1 protein_id gnl|my_center|LOCUS_06520 9387 9022 gene locus_tag LOCUS_06530 9387 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 10297 9461 gene locus_tag LOCUS_06540 10297 9461 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061879.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence055 <1 1007 gene locus_tag LOCUS_06550 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043779541.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein 1032 2198 gene locus_tag LOCUS_06560 gene bioF 1032 2198 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_06560 2216 2746 gene locus_tag LOCUS_06570 2216 2746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855904.1 protein_id gnl|my_center|LOCUS_06570 2931 3389 gene locus_tag LOCUS_06580 2931 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3425 3808 gene locus_tag LOCUS_06590 3425 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4121 4681 gene locus_tag LOCUS_06600 4121 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5258 6013 gene locus_tag LOCUS_06610 5258 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6315 7583 gene locus_tag LOCUS_06620 6315 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence056 243 4277 gene locus_tag LOCUS_06630 243 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4352 4774 gene locus_tag LOCUS_06640 4352 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6610 4934 gene locus_tag LOCUS_06650 gene ilvD 6610 4934 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_06650 6826 7530 gene locus_tag LOCUS_06660 6826 7530 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_06660 7543 8772 gene locus_tag LOCUS_06670 7543 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 10983 9235 gene locus_tag LOCUS_06680 10983 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence057 2705 924 gene locus_tag LOCUS_06690 2705 924 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_06690 2769 3392 gene locus_tag LOCUS_06700 2769 3392 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_06700 3976 3491 gene locus_tag LOCUS_06710 3976 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4222 5127 gene locus_tag LOCUS_06720 4222 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5272 5919 gene locus_tag LOCUS_06730 gene pyrH 5272 5919 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_06730 5913 6542 gene locus_tag LOCUS_06740 gene frr 5913 6542 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_06740 6578 6898 gene locus_tag LOCUS_06750 6578 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9582 7087 gene locus_tag LOCUS_06760 9582 7087 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_06760 9846 10091 gene locus_tag LOCUS_06770 9846 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10237 10716 gene locus_tag LOCUS_06780 10237 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence058 410 1366 gene locus_tag LOCUS_06790 410 1366 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_06790 1380 1742 gene locus_tag LOCUS_06800 1380 1742 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_06800 1794 2024 gene locus_tag LOCUS_06810 1794 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2321 3472 gene locus_tag LOCUS_06820 gene tyrS 2321 3472 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_06820 3494 4495 gene locus_tag LOCUS_06830 3494 4495 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_06830 5052 4729 gene locus_tag LOCUS_06840 5052 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5276 6487 gene locus_tag LOCUS_06850 5276 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 8737 6539 gene locus_tag LOCUS_06860 8737 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_06860 10716 8734 gene locus_tag LOCUS_06870 10716 8734 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence059 <1 901 gene locus_tag LOCUS_06880 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074194.1:efflux RND transporter periplasmic adaptor subunit 1005 4163 gene locus_tag LOCUS_06890 1005 4163 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_06890 4296 4931 gene locus_tag LOCUS_06900 4296 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5075 4842 gene locus_tag LOCUS_06910 5075 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5393 5121 gene locus_tag LOCUS_06920 5393 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6335 5592 gene locus_tag LOCUS_06930 6335 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7305 6388 gene locus_tag LOCUS_06940 gene metF 7305 6388 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_06940 8133 7363 gene locus_tag LOCUS_06950 8133 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 10579 8156 gene locus_tag LOCUS_06960 gene bamA 10579 8156 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence060 335 901 gene locus_tag LOCUS_06970 335 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 914 1867 gene locus_tag LOCUS_06980 914 1867 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_06980 2004 4202 gene locus_tag LOCUS_06990 2004 4202 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143962.1 protein_id gnl|my_center|LOCUS_06990 4218 4964 gene locus_tag LOCUS_07000 4218 4964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339558.1 protein_id gnl|my_center|LOCUS_07000 4961 7798 gene locus_tag LOCUS_07010 4961 7798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123057.1 protein_id gnl|my_center|LOCUS_07010 8471 8851 gene locus_tag LOCUS_07020 8471 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 8932 9729 gene locus_tag LOCUS_07030 8932 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence061 667 1425 gene locus_tag LOCUS_07040 667 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4067 1989 gene locus_tag LOCUS_07050 4067 1989 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_07050 4261 4938 gene locus_tag LOCUS_07060 4261 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4967 5554 gene locus_tag LOCUS_07070 4967 5554 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162767.1 protein_id gnl|my_center|LOCUS_07070 6366 5572 gene locus_tag LOCUS_07080 gene truA 6366 5572 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_07080 6520 7785 gene locus_tag LOCUS_07090 6520 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence062 <1 1880 gene locus_tag LOCUS_07100 <1 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I 1998 4019 gene locus_tag LOCUS_07110 1998 4019 CDS product enterotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420958.1 protein_id gnl|my_center|LOCUS_07110 5203 4094 gene locus_tag LOCUS_07120 5203 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5690 5235 gene locus_tag LOCUS_07130 5690 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7437 6013 gene locus_tag LOCUS_07140 gene purB 7437 6013 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_07140 8790 7729 gene locus_tag LOCUS_07150 gene nagZ 8790 7729 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887975.1 protein_id gnl|my_center|LOCUS_07150 9373 8804 gene locus_tag LOCUS_07160 gene pyrE 9373 8804 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_07160 9503 10150 gene locus_tag LOCUS_07170 9503 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence063 5193 5270 gene locus_tag LOCUS_t00120 5193 5270 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5478 7058 gene locus_tag LOCUS_07180 gene ilvA 5478 7058 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696111.1 protein_id gnl|my_center|LOCUS_07180 7109 7672 gene locus_tag LOCUS_07190 7109 7672 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_07190 9236 7911 gene locus_tag LOCUS_07200 gene hflX 9236 7911 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873770.1 protein_id gnl|my_center|LOCUS_07200 9413 9246 gene locus_tag LOCUS_07210 9413 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence064 815 513 gene locus_tag LOCUS_07220 815 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1399 836 gene locus_tag LOCUS_07230 1399 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1420 1956 gene locus_tag LOCUS_07240 1420 1956 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_07240 2569 1976 gene locus_tag LOCUS_07250 2569 1976 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131372.1 protein_id gnl|my_center|LOCUS_07250 3839 2697 gene locus_tag LOCUS_07260 gene citZ 3839 2697 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_07260 4582 3914 gene locus_tag LOCUS_07270 4582 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4708 5616 gene locus_tag LOCUS_07280 4708 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5697 6218 gene locus_tag LOCUS_07290 5697 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6335 6778 gene locus_tag LOCUS_07300 6335 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 7729 6806 gene locus_tag LOCUS_07310 7729 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 8523 7747 gene locus_tag LOCUS_07320 8523 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 9498 9001 gene locus_tag LOCUS_07330 9498 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence065 269 1300 gene locus_tag LOCUS_07340 269 1300 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_07340 1421 2491 gene locus_tag LOCUS_07350 1421 2491 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_07350 2773 3981 gene locus_tag LOCUS_07360 2773 3981 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_07360 4003 5574 gene locus_tag LOCUS_07370 gene serA 4003 5574 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_07370 5723 6778 gene locus_tag LOCUS_07380 5723 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6840 7523 gene locus_tag LOCUS_07390 6840 7523 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_07390 9577 7583 gene locus_tag LOCUS_07400 9577 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 <10438 9626 gene locus_tag LOCUS_07410 <10438 9626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005904156.1:YebC/PmpR family DNA-binding transcriptional regulator >Feature sequence066 209 1171 gene locus_tag LOCUS_07420 209 1171 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_07420 1257 3611 gene locus_tag LOCUS_07430 1257 3611 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_07430 3647 5401 gene locus_tag LOCUS_07440 gene pstA 3647 5401 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_07440 5441 6220 gene locus_tag LOCUS_07450 gene pstB 5441 6220 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071864.1 protein_id gnl|my_center|LOCUS_07450 6253 6930 gene locus_tag LOCUS_07460 gene phoU 6253 6930 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401254.1 protein_id gnl|my_center|LOCUS_07460 7971 7366 gene locus_tag LOCUS_07470 7971 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 8675 7947 gene locus_tag LOCUS_07480 8675 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10173 8758 gene locus_tag LOCUS_07490 10173 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence067 1147 539 gene locus_tag LOCUS_07500 gene pgsA 1147 539 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_07500 3877 1565 gene locus_tag LOCUS_07510 gene ligA 3877 1565 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114675.1 protein_id gnl|my_center|LOCUS_07510 5554 3902 gene locus_tag LOCUS_07520 5554 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6767 5610 gene locus_tag LOCUS_07530 gene pheA 6767 5610 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_07530 7221 7757 gene locus_tag LOCUS_07540 7221 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8777 7803 gene locus_tag LOCUS_07550 8777 7803 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_07550 9564 8791 gene locus_tag LOCUS_07560 9564 8791 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence068 964 323 gene locus_tag LOCUS_07570 gene bioD 964 323 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_07570 1128 976 gene locus_tag LOCUS_07580 1128 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1897 1106 gene locus_tag LOCUS_07590 gene cdaA 1897 1106 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_07590 1989 2975 gene locus_tag LOCUS_07600 1989 2975 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_07600 3652 2999 gene locus_tag LOCUS_07610 3652 2999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_07610 4533 3682 gene locus_tag LOCUS_07620 gene panC 4533 3682 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_07620 4677 5273 gene locus_tag LOCUS_07630 4677 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5313 6350 gene locus_tag LOCUS_07640 gene lpxD 5313 6350 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882950.1 protein_id gnl|my_center|LOCUS_07640 7201 6410 gene locus_tag LOCUS_07650 7201 6410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_07650 7980 7198 gene locus_tag LOCUS_07660 7980 7198 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_07660 9029 7983 gene locus_tag LOCUS_07670 9029 7983 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_07670 9260 9904 gene locus_tag LOCUS_07680 9260 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence069 977 1306 gene locus_tag LOCUS_07690 977 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1389 2468 gene locus_tag LOCUS_07700 1389 2468 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_07700 2465 3499 gene locus_tag LOCUS_07710 2465 3499 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_07710 3571 6300 gene locus_tag LOCUS_07720 gene ileS 3571 6300 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_07720 6326 7099 gene locus_tag LOCUS_07730 6326 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7107 7769 gene locus_tag LOCUS_07740 7107 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7789 8271 gene locus_tag LOCUS_07750 7789 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8274 9500 gene locus_tag LOCUS_07760 8274 9500 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence070 392 1711 gene locus_tag LOCUS_07770 392 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2089 1880 gene locus_tag LOCUS_07780 2089 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2321 2725 gene locus_tag LOCUS_07790 2321 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3099 2908 gene locus_tag LOCUS_07800 3099 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6234 3112 gene locus_tag LOCUS_07810 6234 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6543 6313 gene locus_tag LOCUS_07820 6543 6313 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_07820 6785 6573 gene locus_tag LOCUS_07830 6785 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8461 7082 gene locus_tag LOCUS_07840 8461 7082 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793956.1 protein_id gnl|my_center|LOCUS_07840 9464 8526 gene locus_tag LOCUS_07850 gene lipA 9464 8526 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence071 366 629 gene locus_tag LOCUS_07860 366 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 643 1083 gene locus_tag LOCUS_07870 643 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1328 1110 gene locus_tag LOCUS_07880 1328 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2092 1325 gene locus_tag LOCUS_07890 2092 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2546 2112 gene locus_tag LOCUS_07900 2546 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3222 2572 gene locus_tag LOCUS_07910 3222 2572 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477701.1 protein_id gnl|my_center|LOCUS_07910 4003 3278 gene locus_tag LOCUS_07920 4003 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4196 5317 gene locus_tag LOCUS_07930 4196 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5617 8577 gene locus_tag LOCUS_07940 gene galB 5617 8577 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence072 92 2689 gene locus_tag LOCUS_07950 92 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4711 2702 gene locus_tag LOCUS_07960 4711 2702 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_07960 6111 4792 gene locus_tag LOCUS_07970 6111 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7515 6133 gene locus_tag LOCUS_07980 gene mpl 7515 6133 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_07980 8432 7548 gene locus_tag LOCUS_07990 8432 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9203 8457 gene locus_tag LOCUS_08000 gene lptB 9203 8457 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence073 2162 651 gene locus_tag LOCUS_08010 2162 651 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_08010 2297 3187 gene locus_tag LOCUS_08020 2297 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3203 3580 gene locus_tag LOCUS_08030 3203 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7240 3725 gene locus_tag LOCUS_08040 7240 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 7622 8029 gene locus_tag LOCUS_08050 7622 8029 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_08050 8057 9226 gene locus_tag LOCUS_08060 8057 9226 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence074 <1 1702 gene locus_tag LOCUS_08070 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122211.1:alpha-1,2-fucosyltransferase 1852 2658 gene locus_tag LOCUS_08080 1852 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2665 3471 gene locus_tag LOCUS_08090 2665 3471 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_08090 3494 4207 gene locus_tag LOCUS_08100 3494 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4365 4553 gene locus_tag LOCUS_08110 4365 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4603 8514 gene locus_tag LOCUS_08120 4603 8514 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_08120 9255 8935 gene locus_tag LOCUS_08130 9255 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence075 <1 3677 gene locus_tag LOCUS_08140 <1 3677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453805.1:methionine synthase 3703 4479 gene locus_tag LOCUS_08150 3703 4479 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_08150 4476 4979 gene locus_tag LOCUS_08160 4476 4979 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_08160 5205 6710 gene locus_tag LOCUS_08170 5205 6710 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_08170 6700 7866 gene locus_tag LOCUS_08180 6700 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence076 1580 699 gene locus_tag LOCUS_08190 gene spo0J 1580 699 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_08190 1783 2100 gene locus_tag LOCUS_08200 1783 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2134 2517 gene locus_tag LOCUS_08210 2134 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3472 2681 gene locus_tag LOCUS_08220 3472 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4293 3478 gene locus_tag LOCUS_08230 4293 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5108 6307 gene locus_tag LOCUS_08240 5108 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6533 6459 gene locus_tag LOCUS_t00130 6533 6459 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8775 6628 gene locus_tag LOCUS_08250 8775 6628 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_08250 9264 8887 gene locus_tag LOCUS_08260 9264 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence077 1701 130 gene locus_tag LOCUS_08270 1701 130 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_08270 2866 1745 gene locus_tag LOCUS_08280 2866 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3506 2898 gene locus_tag LOCUS_08290 gene leuD 3506 2898 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_08290 4866 3526 gene locus_tag LOCUS_08300 gene leuC 4866 3526 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_08300 5783 5154 gene locus_tag LOCUS_08310 gene lipB 5783 5154 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_08310 6796 5810 gene locus_tag LOCUS_08320 6796 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8261 7221 gene locus_tag LOCUS_08330 gene recA 8261 7221 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence078 1916 978 gene locus_tag LOCUS_08340 1916 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3280 2126 gene locus_tag LOCUS_08350 3280 2126 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225897.1 protein_id gnl|my_center|LOCUS_08350 5682 3301 gene locus_tag LOCUS_08360 5682 3301 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_08360 6474 5689 gene locus_tag LOCUS_08370 6474 5689 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_08370 8485 6494 gene locus_tag LOCUS_08380 8485 6494 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107228.1 protein_id gnl|my_center|LOCUS_08380 <9159 8491 gene locus_tag LOCUS_08390 <9159 8491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202265.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence079 1114 3942 gene locus_tag LOCUS_08400 gene alaS 1114 3942 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_08400 3977 4801 gene locus_tag LOCUS_08410 gene pssA 3977 4801 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_08410 5414 4899 gene locus_tag LOCUS_08420 5414 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5479 6318 gene locus_tag LOCUS_08430 gene folP 5479 6318 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 protein_id gnl|my_center|LOCUS_08430 6326 8917 gene locus_tag LOCUS_08440 6326 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence080 3094 128 gene locus_tag LOCUS_08450 3094 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3828 3460 gene locus_tag LOCUS_08460 3828 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4477 3971 gene locus_tag LOCUS_08470 gene gmhB 4477 3971 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_08470 5036 4467 gene locus_tag LOCUS_08480 5036 4467 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_08480 6523 5033 gene locus_tag LOCUS_08490 gene rfaE1 6523 5033 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_08490 6755 7009 gene locus_tag LOCUS_08500 6755 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7093 8373 gene locus_tag LOCUS_08510 gene hemL 7093 8373 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence081 140 1702 gene locus_tag LOCUS_08520 140 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1997 2488 gene locus_tag LOCUS_08530 gene nrdR 1997 2488 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_08530 2760 2464 gene locus_tag LOCUS_08540 2760 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3902 2901 gene locus_tag LOCUS_08550 3902 2901 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084558766.1 protein_id gnl|my_center|LOCUS_08550 4002 4334 gene locus_tag LOCUS_08560 4002 4334 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_08560 6030 4351 gene locus_tag LOCUS_08570 gene sulP 6030 4351 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_08570 7550 6162 gene locus_tag LOCUS_08580 gene argH 7550 6162 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_08580 8177 7647 gene locus_tag LOCUS_08590 8177 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence082 2339 1323 gene locus_tag LOCUS_08600 2339 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2505 3926 gene locus_tag LOCUS_08610 2505 3926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_08610 6662 4065 gene locus_tag LOCUS_08620 6662 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8439 6985 gene locus_tag LOCUS_08630 8439 6985 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_08630 <9029 8481 gene locus_tag LOCUS_08640 <9029 8481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221924.1:septal ring lytic transglycosylase RlpA family protein >Feature sequence083 414 3554 gene locus_tag LOCUS_08650 414 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 3943 4653 gene locus_tag LOCUS_08660 3943 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6186 4816 gene locus_tag LOCUS_08670 gene asnS 6186 4816 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_08670 7494 6289 gene locus_tag LOCUS_08680 7494 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8321 8330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence084 3 305 gene locus_tag LOCUS_08690 3 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 377 3109 gene locus_tag LOCUS_08700 377 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3205 3810 gene locus_tag LOCUS_08710 gene coaE 3205 3810 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_08710 3803 5245 gene locus_tag LOCUS_08720 gene rho 3803 5245 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_08720 7420 5486 gene locus_tag LOCUS_08730 7420 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8477 7500 gene locus_tag LOCUS_08740 8477 7500 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence085 1706 243 gene locus_tag LOCUS_08750 1706 243 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_08750 2122 2715 gene locus_tag LOCUS_08760 2122 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3727 2705 gene locus_tag LOCUS_08770 3727 2705 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_08770 6329 3792 gene locus_tag LOCUS_08780 gene pheT 6329 3792 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208407.1 protein_id gnl|my_center|LOCUS_08780 7373 6348 gene locus_tag LOCUS_08790 gene pheS 7373 6348 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018596.1 protein_id gnl|my_center|LOCUS_08790 8698 7541 gene locus_tag LOCUS_08800 8698 7541 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764112.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence086 797 495 gene locus_tag LOCUS_08810 797 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1493 1029 gene locus_tag LOCUS_08820 1493 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1703 1777 gene locus_tag LOCUS_t00140 1703 1777 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2996 2115 gene locus_tag LOCUS_08830 2996 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3270 2989 gene locus_tag LOCUS_08840 3270 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4904 3267 gene locus_tag LOCUS_08850 4904 3267 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939009.1 protein_id gnl|my_center|LOCUS_08850 5128 4913 gene locus_tag LOCUS_08860 5128 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5442 6062 gene locus_tag LOCUS_08870 5442 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6113 6406 gene locus_tag LOCUS_08880 6113 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6403 6660 gene locus_tag LOCUS_08890 6403 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6726 6960 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtttcaatccacgccctccttgcggagagcgac 7451 7161 gene locus_tag LOCUS_08900 gene cas2 7451 7161 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_08900 7755 7465 gene locus_tag LOCUS_08910 7755 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence087 1 1098 gene locus_tag LOCUS_08920 1 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1095 2285 gene locus_tag LOCUS_08930 1095 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2282 3796 gene locus_tag LOCUS_08940 2282 3796 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_08940 3787 4980 gene locus_tag LOCUS_08950 3787 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4983 6095 gene locus_tag LOCUS_08960 4983 6095 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_08960 6092 7132 gene locus_tag LOCUS_08970 6092 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7150 8247 gene locus_tag LOCUS_08980 7150 8247 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence088 119 286 gene locus_tag LOCUS_08990 119 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 557 2059 gene locus_tag LOCUS_09000 557 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2290 3828 gene locus_tag LOCUS_09010 2290 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3950 4477 gene locus_tag LOCUS_09020 3950 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4494 5855 gene locus_tag LOCUS_09030 4494 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7544 6144 gene locus_tag LOCUS_09040 7544 6144 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372247.1 protein_id gnl|my_center|LOCUS_09040 7740 7749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence089 2375 1548 gene locus_tag LOCUS_09050 gene cysE 2375 1548 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393467.1 protein_id gnl|my_center|LOCUS_09050 2972 2508 gene locus_tag LOCUS_09060 2972 2508 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615575.1 protein_id gnl|my_center|LOCUS_09060 4266 3088 gene locus_tag LOCUS_09070 4266 3088 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_09070 5111 4272 gene locus_tag LOCUS_09080 5111 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6144 5173 gene locus_tag LOCUS_09090 6144 5173 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_09090 6960 6181 gene locus_tag LOCUS_09100 6960 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 7473 6967 gene locus_tag LOCUS_09110 7473 6967 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083121.1 protein_id gnl|my_center|LOCUS_09110 8508 7576 gene locus_tag LOCUS_09120 8508 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence090 946 2025 gene locus_tag LOCUS_09130 946 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2588 2055 gene locus_tag LOCUS_09140 2588 2055 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_09140 3414 2602 gene locus_tag LOCUS_09150 3414 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3869 7063 gene locus_tag LOCUS_09160 gene carB 3869 7063 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_09160 7366 7169 gene locus_tag LOCUS_09170 7366 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8187 7405 gene locus_tag LOCUS_09180 8187 7405 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence091 211 1059 gene locus_tag LOCUS_09190 211 1059 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_09190 1041 1901 gene locus_tag LOCUS_09200 1041 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1905 3014 gene locus_tag LOCUS_09210 1905 3014 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203057.1 protein_id gnl|my_center|LOCUS_09210 3011 3580 gene locus_tag LOCUS_09220 3011 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3588 4835 gene locus_tag LOCUS_09230 3588 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4843 5979 gene locus_tag LOCUS_09240 4843 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6029 7120 gene locus_tag LOCUS_09250 6029 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7145 8287 gene locus_tag LOCUS_09260 7145 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence092 1 513 gene locus_tag LOCUS_09270 gene ruvA 1 513 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_09270 737 1765 gene locus_tag LOCUS_09280 gene gap 737 1765 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_09280 1936 3153 gene locus_tag LOCUS_09290 1936 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3392 4345 gene locus_tag LOCUS_09300 3392 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7518 4342 gene locus_tag LOCUS_09310 7518 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence093 1721 255 gene locus_tag LOCUS_09320 1721 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1875 2147 gene locus_tag LOCUS_09330 1875 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2274 4421 gene locus_tag LOCUS_09340 2274 4421 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_09340 4558 4719 gene locus_tag LOCUS_09350 4558 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4716 5591 gene locus_tag LOCUS_09360 4716 5591 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013653377.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 6140 5688 gene locus_tag LOCUS_09370 6140 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 6643 6161 gene locus_tag LOCUS_09380 6643 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8199 6640 gene locus_tag LOCUS_09390 8199 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence094 422 2812 gene locus_tag LOCUS_09400 422 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3098 3745 gene locus_tag LOCUS_09410 3098 3745 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_09410 4527 3757 gene locus_tag LOCUS_09420 4527 3757 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_09420 5231 4539 gene locus_tag LOCUS_09430 5231 4539 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_09430 5369 6751 gene locus_tag LOCUS_09440 5369 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6936 7793 gene locus_tag LOCUS_09450 6936 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence095 3096 574 gene locus_tag LOCUS_09460 3096 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4975 3206 gene locus_tag LOCUS_09470 4975 3206 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_09470 6337 5060 gene locus_tag LOCUS_09480 6337 5060 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_09480 7712 6450 gene locus_tag LOCUS_09490 7712 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence096 1725 3206 gene locus_tag LOCUS_09500 gene lysS 1725 3206 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833056.1 protein_id gnl|my_center|LOCUS_09500 3223 3993 gene locus_tag LOCUS_09510 3223 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4756 4013 gene locus_tag LOCUS_09520 4756 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4954 5700 gene locus_tag LOCUS_09530 4954 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 5783 6439 gene locus_tag LOCUS_09540 gene plsY 5783 6439 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_09540 6468 7463 gene locus_tag LOCUS_09550 6468 7463 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_09550 7460 7708 gene locus_tag LOCUS_09560 7460 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 >Feature sequence097 1584 220 gene locus_tag LOCUS_09570 gene cysS 1584 220 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_09570 3311 1755 gene locus_tag LOCUS_09580 3311 1755 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 protein_id gnl|my_center|LOCUS_09580 5163 3421 gene locus_tag LOCUS_09590 5163 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6386 5433 gene locus_tag LOCUS_09600 6386 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7445 6498 gene locus_tag LOCUS_09610 7445 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 7855 7442 gene locus_tag LOCUS_09620 7855 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 8181 7783 gene locus_tag LOCUS_09630 8181 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence098 2223 682 gene locus_tag LOCUS_09640 2223 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3008 2232 gene locus_tag LOCUS_09650 3008 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3231 5045 gene locus_tag LOCUS_09660 3231 5045 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_09660 <8348 5296 gene locus_tag LOCUS_09670 <8348 5296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence099 2569 962 gene locus_tag LOCUS_09680 2569 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3930 2575 gene locus_tag LOCUS_09690 3930 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4888 4151 gene locus_tag LOCUS_09700 4888 4151 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_09700 5952 5053 gene locus_tag LOCUS_09710 5952 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6891 5974 gene locus_tag LOCUS_09720 6891 5974 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_09720 <8342 6925 gene locus_tag LOCUS_09730 <8342 6925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966477.1:formate--tetrahydrofolate ligase >Feature sequence100 779 27 gene locus_tag LOCUS_09740 779 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2076 2462 gene locus_tag LOCUS_09750 2076 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3014 5281 gene locus_tag LOCUS_09760 gene pflB 3014 5281 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_09760 5295 6083 gene locus_tag LOCUS_09770 gene pflA 5295 6083 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_09770 6402 6103 gene locus_tag LOCUS_09780 6402 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8340 6478 gene locus_tag LOCUS_09790 8340 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence101 351 169 gene locus_tag LOCUS_09800 351 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 773 339 gene locus_tag LOCUS_09810 773 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1999 1178 gene locus_tag LOCUS_09820 1999 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2614 2027 gene locus_tag LOCUS_09830 2614 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2721 4325 gene locus_tag LOCUS_09840 gene nadB 2721 4325 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_09840 4319 5347 gene locus_tag LOCUS_09850 4319 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5488 6699 gene locus_tag LOCUS_09860 5488 6699 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_09860 <8312 6694 gene locus_tag LOCUS_09870 <8312 6694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105472.1:RecQ family ATP-dependent DNA helicase >Feature sequence102 >Feature sequence103 461 282 gene locus_tag LOCUS_09880 461 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 603 1889 gene locus_tag LOCUS_09890 603 1889 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_09890 1980 2978 gene locus_tag LOCUS_09900 1980 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3381 4412 gene locus_tag LOCUS_09910 3381 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4927 4454 gene locus_tag LOCUS_09920 4927 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5292 5053 gene locus_tag LOCUS_09930 5292 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7275 5410 gene locus_tag LOCUS_09940 7275 5410 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795334.1 protein_id gnl|my_center|LOCUS_09940 8196 8023 gene locus_tag LOCUS_09950 8196 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence104 145 489 gene locus_tag LOCUS_09960 145 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 506 2605 gene locus_tag LOCUS_09970 506 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2615 4114 gene locus_tag LOCUS_09980 2615 4114 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_09980 4133 5506 gene locus_tag LOCUS_09990 4133 5506 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_09990 5510 6613 gene locus_tag LOCUS_10000 gene mraY 5510 6613 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 protein_id gnl|my_center|LOCUS_10000 6621 7931 gene locus_tag LOCUS_10010 gene murD 6621 7931 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence105 3258 541 gene locus_tag LOCUS_10020 3258 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4562 3423 gene locus_tag LOCUS_10030 4562 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4884 4573 gene locus_tag LOCUS_10040 4884 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 5711 4881 gene locus_tag LOCUS_10050 5711 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 6331 5747 gene locus_tag LOCUS_10060 6331 5747 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_10060 6948 6367 gene locus_tag LOCUS_10070 gene nuoB 6948 6367 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403172.1 protein_id gnl|my_center|LOCUS_10070 7559 7278 gene locus_tag LOCUS_10080 7559 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 <8179 7572 gene locus_tag LOCUS_10090 <8179 7572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000525152.1:SAM-dependent methyltransferase >Feature sequence106 2912 1992 gene locus_tag LOCUS_10100 gene prmC 2912 1992 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_10100 4005 2929 gene locus_tag LOCUS_10110 gene prfA 4005 2929 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_10110 4980 4525 gene locus_tag LOCUS_10120 4980 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5434 5359 gene locus_tag LOCUS_t00150 5434 5359 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6932 5523 gene locus_tag LOCUS_10130 6932 5523 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_10130 7819 7076 gene locus_tag LOCUS_10140 7819 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence107 2105 993 gene locus_tag LOCUS_10150 2105 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2383 3774 gene locus_tag LOCUS_10160 2383 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3761 4456 gene locus_tag LOCUS_10170 3761 4456 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_10170 5026 4535 gene locus_tag LOCUS_10180 5026 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 5164 5595 gene locus_tag LOCUS_10190 5164 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6975 6064 gene locus_tag LOCUS_10200 gene fabD 6975 6064 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence108 54 1352 gene locus_tag LOCUS_10210 54 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3920 1371 gene locus_tag LOCUS_10220 3920 1371 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_10220 5647 3917 gene locus_tag LOCUS_10230 5647 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 6553 5675 gene locus_tag LOCUS_10240 6553 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence109 513 1448 gene locus_tag LOCUS_10250 513 1448 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_10250 1560 1853 gene locus_tag LOCUS_10260 1560 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1850 2272 gene locus_tag LOCUS_10270 1850 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2914 2303 gene locus_tag LOCUS_10280 2914 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3056 3700 gene locus_tag LOCUS_10290 3056 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3833 5314 gene locus_tag LOCUS_10300 3833 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5327 6361 gene locus_tag LOCUS_10310 5327 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7650 6727 gene locus_tag LOCUS_10320 7650 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence110 602 1459 gene locus_tag LOCUS_10330 602 1459 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_10330 1729 1995 gene locus_tag LOCUS_10340 1729 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1980 2198 gene locus_tag LOCUS_10350 1980 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3419 2313 gene locus_tag LOCUS_10360 3419 2313 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_10360 3876 3885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4318 5598 gene locus_tag LOCUS_10370 gene serS 4318 5598 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_10370 5633 6409 gene locus_tag LOCUS_10380 5633 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 7074 6436 gene locus_tag LOCUS_10390 7074 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7615 7082 gene locus_tag LOCUS_10400 7615 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence111 120 869 gene locus_tag LOCUS_10410 120 869 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_10410 1385 933 gene locus_tag LOCUS_10420 1385 933 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100916.1 protein_id gnl|my_center|LOCUS_10420 2730 1546 gene locus_tag LOCUS_10430 gene nifS 2730 1546 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_10430 2792 3451 gene locus_tag LOCUS_10440 2792 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3551 4672 gene locus_tag LOCUS_10450 gene rsgA 3551 4672 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_10450 4770 5702 gene locus_tag LOCUS_10460 4770 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6972 5686 gene locus_tag LOCUS_10470 gene waaA 6972 5686 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_10470 7513 6974 gene locus_tag LOCUS_10480 gene rsmD 7513 6974 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence112 804 2438 gene locus_tag LOCUS_10490 804 2438 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_10490 2495 3064 gene locus_tag LOCUS_10500 2495 3064 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_10500 3311 3093 gene locus_tag LOCUS_10510 3311 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4305 3430 gene locus_tag LOCUS_10520 4305 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7029 5170 gene locus_tag LOCUS_10530 7029 5170 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725041.1 protein_id gnl|my_center|LOCUS_10530 7242 7859 gene locus_tag LOCUS_10540 7242 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence113 <1 1215 gene locus_tag LOCUS_10550 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089073.1:dihydrolipoamide acetyltransferase family protein 1248 2066 gene locus_tag LOCUS_10560 gene lpxI 1248 2066 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_10560 2109 3629 gene locus_tag LOCUS_10570 2109 3629 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_10570 4766 3648 gene locus_tag LOCUS_10580 4766 3648 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_10580 5284 5087 gene locus_tag LOCUS_10590 5284 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5438 6502 gene locus_tag LOCUS_10600 5438 6502 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_10600 7021 6686 gene locus_tag LOCUS_10610 7021 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7462 7100 gene locus_tag LOCUS_10620 7462 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence114 <1 517 gene locus_tag LOCUS_10630 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289498.1:RNA polymerase sigma factor RpoD 556 1287 gene locus_tag LOCUS_10640 gene vanX 556 1287 CDS product D-Ala-D-Ala dipeptidase VanX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230017.1 protein_id gnl|my_center|LOCUS_10640 1381 2433 gene locus_tag LOCUS_10650 1381 2433 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202970.1 protein_id gnl|my_center|LOCUS_10650 3260 2724 gene locus_tag LOCUS_10660 3260 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5311 3623 gene locus_tag LOCUS_10670 5311 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 <7806 5490 gene locus_tag LOCUS_10680 <7806 5490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000650135.1:carboxy terminal-processing peptidase >Feature sequence115 386 4306 gene locus_tag LOCUS_10690 386 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4437 4519 gene locus_tag LOCUS_t00160 4437 4519 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6055 4829 gene locus_tag LOCUS_10700 6055 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence116 749 1330 gene locus_tag LOCUS_10710 749 1330 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 protein_id gnl|my_center|LOCUS_10710 2117 1311 gene locus_tag LOCUS_10720 2117 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2924 2253 gene locus_tag LOCUS_10730 2924 2253 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_10730 4659 2929 gene locus_tag LOCUS_10740 4659 2929 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_10740 5533 4679 gene locus_tag LOCUS_10750 gene yaeI 5533 4679 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 protein_id gnl|my_center|LOCUS_10750 6639 5530 gene locus_tag LOCUS_10760 6639 5530 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_10760 6721 7308 gene locus_tag LOCUS_10770 gene purN 6721 7308 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence117 7 1218 gene locus_tag LOCUS_10780 7 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1344 2480 gene locus_tag LOCUS_10790 1344 2480 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_10790 2605 3558 gene locus_tag LOCUS_10800 2605 3558 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_10800 4956 3640 gene locus_tag LOCUS_10810 4956 3640 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_10810 5101 6012 gene locus_tag LOCUS_10820 5101 6012 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_10820 6024 6773 gene locus_tag LOCUS_10830 6024 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 <7702 6740 gene locus_tag LOCUS_10840 <7702 6740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083613.1:apolipoprotein N-acyltransferase >Feature sequence118 2244 1786 gene locus_tag LOCUS_10850 2244 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2763 2257 gene locus_tag LOCUS_10860 2763 2257 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_10860 3632 2844 gene locus_tag LOCUS_10870 3632 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4363 3725 gene locus_tag LOCUS_10880 gene nth 4363 3725 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_10880 5091 4462 gene locus_tag LOCUS_10890 5091 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5655 6626 gene locus_tag LOCUS_10900 5655 6626 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_10900 6630 7415 gene locus_tag LOCUS_10910 6630 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence119 <1 1920 gene locus_tag LOCUS_10920 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529645.1:potassium-transporting ATPase subunit KdpB 1950 2516 gene locus_tag LOCUS_10930 gene kdpC 1950 2516 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_10930 4267 2666 gene locus_tag LOCUS_10940 4267 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4479 7022 gene locus_tag LOCUS_10950 gene clpB 4479 7022 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_10950 7100 7109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence120 2522 1134 gene locus_tag LOCUS_10960 gene lpdA 2522 1134 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_10960 4074 2683 gene locus_tag LOCUS_10970 4074 2683 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_10970 4151 4753 gene locus_tag LOCUS_10980 4151 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5034 5219 gene locus_tag LOCUS_10990 5034 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 <7490 5203 gene locus_tag LOCUS_11000 <7490 5203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766169.1:beta-galactosidase >Feature sequence121 686 2149 gene locus_tag LOCUS_11010 686 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3702 2314 gene locus_tag LOCUS_11020 3702 2314 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_11020 4299 3913 gene locus_tag LOCUS_11030 4299 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 5593 4667 gene locus_tag LOCUS_11040 5593 4667 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_11040 6718 5624 gene locus_tag LOCUS_11050 6718 5624 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11050 <7470 6728 gene locus_tag LOCUS_11060 <7470 6728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762743.1:nucleotidyltransferase >Feature sequence122 77 1330 gene locus_tag LOCUS_11070 gene argJ 77 1330 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_11070 1468 1842 gene locus_tag LOCUS_11080 1468 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3161 2019 gene locus_tag LOCUS_11090 3161 2019 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_11090 4295 3291 gene locus_tag LOCUS_11100 4295 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6900 4399 gene locus_tag LOCUS_11110 gene uvrA 6900 4399 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence123 1848 580 gene locus_tag LOCUS_11120 gene msrB 1848 580 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_11120 2330 1791 gene locus_tag LOCUS_11130 2330 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2445 4715 gene locus_tag LOCUS_11140 2445 4715 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764444.1 protein_id gnl|my_center|LOCUS_11140 5903 4785 gene locus_tag LOCUS_11150 5903 4785 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 protein_id gnl|my_center|LOCUS_11150 6019 6957 gene locus_tag LOCUS_11160 6019 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence124 1118 117 gene locus_tag LOCUS_11170 gene cbiB 1118 117 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_11170 3719 1122 gene locus_tag LOCUS_11180 3719 1122 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_11180 4276 3716 gene locus_tag LOCUS_11190 4276 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422870.1 protein_id gnl|my_center|LOCUS_11190 4628 5545 gene locus_tag LOCUS_11200 4628 5545 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_11200 6123 5647 gene locus_tag LOCUS_11210 6123 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6445 6792 gene locus_tag LOCUS_11220 6445 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7001 7294 gene locus_tag LOCUS_11230 7001 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence125 744 1988 gene locus_tag LOCUS_11240 744 1988 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_11240 2149 3084 gene locus_tag LOCUS_11250 2149 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3165 3452 gene locus_tag LOCUS_11260 3165 3452 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860072.1 protein_id gnl|my_center|LOCUS_11260 5421 3559 gene locus_tag LOCUS_11270 5421 3559 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 protein_id gnl|my_center|LOCUS_11270 6037 5444 gene locus_tag LOCUS_11280 6037 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6804 6121 gene locus_tag LOCUS_11290 6804 6121 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067162.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence126 4806 5270 gene locus_tag LOCUS_11300 4806 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5406 5480 gene locus_tag LOCUS_t00170 5406 5480 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5904 6131 gene locus_tag LOCUS_11310 5904 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6268 6978 gene locus_tag LOCUS_11320 6268 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence127 3527 1377 gene locus_tag LOCUS_11330 3527 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4666 3677 gene locus_tag LOCUS_11340 4666 3677 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_11340 4852 6174 gene locus_tag LOCUS_11350 4852 6174 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_11350 7263 6283 gene locus_tag LOCUS_11360 7263 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence128 287 1990 gene locus_tag LOCUS_11370 gene argS 287 1990 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_11370 2009 3613 gene locus_tag LOCUS_11380 2009 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3642 5738 gene locus_tag LOCUS_11390 3642 5738 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_11390 5763 7085 gene locus_tag LOCUS_11400 5763 7085 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence129 658 98 gene locus_tag LOCUS_11410 658 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1992 655 gene locus_tag LOCUS_11420 gene nrfD 1992 655 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_11420 2180 3049 gene locus_tag LOCUS_11430 2180 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3104 4117 gene locus_tag LOCUS_11440 3104 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6550 4139 gene locus_tag LOCUS_11450 6550 4139 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence130 <1 518 gene locus_tag LOCUS_11460 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228808.1:tRNA (guanosine(46)-N7)-methyltransferase TrmB 530 1663 gene locus_tag LOCUS_11470 gene tgt 530 1663 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_11470 1660 2040 gene locus_tag LOCUS_11480 gene yajC 1660 2040 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_11480 2149 2997 gene locus_tag LOCUS_11490 2149 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3011 3910 gene locus_tag LOCUS_11500 gene xerC 3011 3910 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_11500 3929 4552 gene locus_tag LOCUS_11510 3929 4552 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_11510 4721 4963 gene locus_tag LOCUS_11520 gene rpsP 4721 4963 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_11520 5637 5089 gene locus_tag LOCUS_11530 5637 5089 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_11530 5769 6815 gene locus_tag LOCUS_11540 5769 6815 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence131 <1 600 gene locus_tag LOCUS_11550 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666926.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD 713 1453 gene locus_tag LOCUS_11560 713 1453 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_11560 1598 2050 gene locus_tag LOCUS_11570 1598 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2979 2122 gene locus_tag LOCUS_11580 2979 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4127 2976 gene locus_tag LOCUS_11590 4127 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5186 4128 gene locus_tag LOCUS_11600 gene dusC 5186 4128 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 protein_id gnl|my_center|LOCUS_11600 5242 6456 gene locus_tag LOCUS_11610 5242 6456 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_11610 6807 6577 gene locus_tag LOCUS_11620 6807 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7140 6877 gene locus_tag LOCUS_11630 7140 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence132 438 1619 gene locus_tag LOCUS_11640 438 1619 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_11640 1968 3581 gene locus_tag LOCUS_11650 gene metG 1968 3581 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_11650 3588 5183 gene locus_tag LOCUS_11660 gene menD 3588 5183 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_11660 6193 5180 gene locus_tag LOCUS_11670 6193 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 <7019 6506 gene locus_tag LOCUS_11680 <7019 6506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937721.1:malate dehydrogenase >Feature sequence133 291 443 gene locus_tag LOCUS_11690 291 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 440 1540 gene locus_tag LOCUS_11700 gene dnaN 440 1540 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_11700 2201 1761 gene locus_tag LOCUS_11710 2201 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3358 2300 gene locus_tag LOCUS_11720 3358 2300 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947883.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence134 697 86 gene locus_tag LOCUS_11730 gene rpsD 697 86 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_11730 1281 730 gene locus_tag LOCUS_11740 1281 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1692 1315 gene locus_tag LOCUS_11750 gene rpsM 1692 1315 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_11750 2722 1805 gene locus_tag LOCUS_11760 gene queG 2722 1805 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_11760 2974 3897 gene locus_tag LOCUS_11770 2974 3897 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_11770 3894 5006 gene locus_tag LOCUS_11780 3894 5006 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_11780 5003 6118 gene locus_tag LOCUS_11790 gene dprA 5003 6118 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_11790 6825 6211 gene locus_tag LOCUS_11800 6825 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence135 385 301 gene locus_tag LOCUS_t00180 385 301 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 490 945 gene locus_tag LOCUS_11810 490 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1357 977 gene locus_tag LOCUS_11820 1357 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1444 3576 gene locus_tag LOCUS_11830 gene uvrB 1444 3576 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11830 3650 5230 gene locus_tag LOCUS_11840 3650 5230 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_11840 5330 5539 gene locus_tag LOCUS_11850 gene rpmI 5330 5539 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_11850 5691 6074 gene locus_tag LOCUS_11860 gene rplT 5691 6074 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence136 984 256 gene locus_tag LOCUS_11870 984 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1043 1771 gene locus_tag LOCUS_11880 1043 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1814 3334 gene locus_tag LOCUS_11890 gene proS 1814 3334 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_11890 3903 3977 gene locus_tag LOCUS_t00190 3903 3977 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4283 4765 gene locus_tag LOCUS_11900 4283 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5369 5533 gene locus_tag LOCUS_11910 5369 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 5690 6718 gene locus_tag LOCUS_11920 5690 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence137 3087 853 gene locus_tag LOCUS_11930 3087 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5818 3362 gene locus_tag LOCUS_11940 5818 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6516 5887 gene locus_tag LOCUS_11950 6516 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence138 667 113 gene locus_tag LOCUS_11960 667 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1089 667 gene locus_tag LOCUS_11970 1089 667 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_11970 2532 1114 gene locus_tag LOCUS_11980 gene atpD 2532 1114 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190491.1 protein_id gnl|my_center|LOCUS_11980 3480 2608 gene locus_tag LOCUS_11990 3480 2608 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_11990 5034 3502 gene locus_tag LOCUS_12000 gene atpA 5034 3502 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_12000 5461 5054 gene locus_tag LOCUS_12010 5461 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 5997 5470 gene locus_tag LOCUS_12020 5997 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6316 6098 gene locus_tag LOCUS_12030 gene atpE 6316 6098 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence139 75 806 gene locus_tag LOCUS_12040 75 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2191 1091 gene locus_tag LOCUS_12050 2191 1091 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_12050 2930 2322 gene locus_tag LOCUS_12060 gene recR 2930 2322 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_12060 3366 2923 gene locus_tag LOCUS_12070 3366 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4708 3461 gene locus_tag LOCUS_12080 gene fabF 4708 3461 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_12080 5857 4826 gene locus_tag LOCUS_12090 5857 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6497 5982 gene locus_tag LOCUS_12100 6497 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence140 206 799 gene locus_tag LOCUS_12110 206 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1837 923 gene locus_tag LOCUS_12120 1837 923 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_12120 <6708 1986 gene locus_tag LOCUS_12130 <6708 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865234.1:alpha-2-macroglobulin >Feature sequence141 1409 228 gene locus_tag LOCUS_12140 1409 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6309 4648 gene locus_tag LOCUS_12150 6309 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence142 1447 2526 gene locus_tag LOCUS_12160 1447 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3430 3029 gene locus_tag LOCUS_12170 gene acpS 3430 3029 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370293.1 protein_id gnl|my_center|LOCUS_12170 4205 3465 gene locus_tag LOCUS_12180 gene pdxJ 4205 3465 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296302.1 protein_id gnl|my_center|LOCUS_12180 5792 4245 gene locus_tag LOCUS_12190 gene purH 5792 4245 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_12190 6037 6492 gene locus_tag LOCUS_12200 gene rplI 6037 6492 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence143 <1 1195 gene locus_tag LOCUS_12210 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765281.1:tyrosine-protein kinase family protein 1331 2827 gene locus_tag LOCUS_12220 1331 2827 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_12220 2832 3692 gene locus_tag LOCUS_12230 2832 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203007.1 protein_id gnl|my_center|LOCUS_12230 3706 4692 gene locus_tag LOCUS_12240 3706 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_12240 4719 6029 gene locus_tag LOCUS_12250 4719 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence144 903 16 gene locus_tag LOCUS_12260 gene sucD 903 16 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_12260 2106 925 gene locus_tag LOCUS_12270 gene sucC 2106 925 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_12270 2348 3595 gene locus_tag LOCUS_12280 gene hisD 2348 3595 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_12280 3624 4280 gene locus_tag LOCUS_12290 gene psrA 3624 4280 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_12290 4306 5205 gene locus_tag LOCUS_12300 4306 5205 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence145 1424 66 gene locus_tag LOCUS_12310 gene rimO 1424 66 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_12310 2888 1452 gene locus_tag LOCUS_12320 2888 1452 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_12320 3109 4917 gene locus_tag LOCUS_12330 3109 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4977 5363 gene locus_tag LOCUS_12340 4977 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence146 80 2083 gene locus_tag LOCUS_12350 gene tkt 80 2083 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_12350 3400 2321 gene locus_tag LOCUS_12360 3400 2321 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_12360 4318 3539 gene locus_tag LOCUS_12370 4318 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5068 4361 gene locus_tag LOCUS_12380 gene purQ 5068 4361 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_12380 <6487 5116 gene locus_tag LOCUS_12390 <6487 5116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940439.1:AIR synthase-related protein >Feature sequence147 166 1722 gene locus_tag LOCUS_12400 166 1722 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_12400 1742 2236 gene locus_tag LOCUS_12410 1742 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2335 3585 gene locus_tag LOCUS_12420 2335 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6126 3871 gene locus_tag LOCUS_12430 6126 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence148 2020 173 gene locus_tag LOCUS_12440 2020 173 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872006.1 protein_id gnl|my_center|LOCUS_12440 3803 2124 gene locus_tag LOCUS_12450 3803 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4159 4869 gene locus_tag LOCUS_12460 4159 4869 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_12460 4945 5391 gene locus_tag LOCUS_12470 4945 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence149 1435 2592 gene locus_tag LOCUS_12480 1435 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3683 2814 gene locus_tag LOCUS_12490 3683 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12490 4699 3710 gene locus_tag LOCUS_12500 4699 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12500 5983 4847 gene locus_tag LOCUS_12510 gene thiH 5983 4847 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence150 290 57 gene locus_tag LOCUS_12520 290 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 564 2753 gene locus_tag LOCUS_12530 564 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2757 4121 gene locus_tag LOCUS_12540 gene xseA 2757 4121 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234453.1 protein_id gnl|my_center|LOCUS_12540 4267 4593 gene locus_tag LOCUS_12550 4267 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence151 1921 557 gene locus_tag LOCUS_12560 1921 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 2595 1918 gene locus_tag LOCUS_12570 2595 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 4103 2682 gene locus_tag LOCUS_12580 4103 2682 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_12580 4353 4362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 1118 45 gene locus_tag LOCUS_12590 1118 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1460 1143 gene locus_tag LOCUS_12600 gene nuoK 1460 1143 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_12600 2402 1488 gene locus_tag LOCUS_12610 2402 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2837 2439 gene locus_tag LOCUS_12620 2837 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4297 2768 gene locus_tag LOCUS_12630 gene nuoH 4297 2768 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_12630 6069 4333 gene locus_tag LOCUS_12640 6069 4333 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence153 1785 727 gene locus_tag LOCUS_12650 1785 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2355 1909 gene locus_tag LOCUS_12660 2355 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2456 2665 gene locus_tag LOCUS_12670 2456 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3852 2950 gene locus_tag LOCUS_12680 3852 2950 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_12680 4402 3845 gene locus_tag LOCUS_12690 4402 3845 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_12690 5547 4399 gene locus_tag LOCUS_12700 5547 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 <6189 5558 gene locus_tag LOCUS_12710 <6189 5558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393432.1:glycosyltransferase family 4 protein >Feature sequence154 97 1512 gene locus_tag LOCUS_12720 97 1512 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_12720 1623 2627 gene locus_tag LOCUS_12730 1623 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2640 3332 gene locus_tag LOCUS_12740 2640 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <6186 3681 gene locus_tag LOCUS_12750 <6186 3681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203260.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence155 1195 782 gene locus_tag LOCUS_12760 gene mscL 1195 782 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948242.1 protein_id gnl|my_center|LOCUS_12760 1391 2647 gene locus_tag LOCUS_12770 1391 2647 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_12770 2677 3135 gene locus_tag LOCUS_12780 2677 3135 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_12780 3258 3824 gene locus_tag LOCUS_12790 gene efp 3258 3824 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720643.1 protein_id gnl|my_center|LOCUS_12790 4017 4637 gene locus_tag LOCUS_12800 4017 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5698 4736 gene locus_tag LOCUS_12810 5698 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence156 2336 507 gene locus_tag LOCUS_12820 gene thiC 2336 507 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_12820 2805 3398 gene locus_tag LOCUS_12830 2805 3398 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_12830 5598 3550 gene locus_tag LOCUS_12840 5598 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence157 102 1439 gene locus_tag LOCUS_12850 102 1439 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_12850 1436 2761 gene locus_tag LOCUS_12860 1436 2761 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883976.1 protein_id gnl|my_center|LOCUS_12860 2852 5131 gene locus_tag LOCUS_12870 2852 5131 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_12870 5151 5891 gene locus_tag LOCUS_12880 5151 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence158 3255 958 gene locus_tag LOCUS_12890 3255 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4372 3248 gene locus_tag LOCUS_12900 gene murG 4372 3248 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_12900 5511 4369 gene locus_tag LOCUS_12910 gene spoVE 5511 4369 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence159 2389 1439 gene locus_tag LOCUS_12920 2389 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2631 3446 gene locus_tag LOCUS_12930 2631 3446 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 protein_id gnl|my_center|LOCUS_12930 3515 3997 gene locus_tag LOCUS_12940 3515 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4028 4732 gene locus_tag LOCUS_12950 4028 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5449 5216 gene locus_tag LOCUS_12960 5449 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5960 5778 gene locus_tag LOCUS_12970 5960 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence160 2253 691 gene locus_tag LOCUS_12980 2253 691 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389142.1 protein_id gnl|my_center|LOCUS_12980 4205 2415 gene locus_tag LOCUS_12990 4205 2415 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_12990 4430 5023 gene locus_tag LOCUS_13000 4430 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5840 5055 gene locus_tag LOCUS_13010 5840 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence161 129 725 gene locus_tag LOCUS_13020 129 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2029 1028 gene locus_tag LOCUS_13030 2029 1028 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_13030 2767 2075 gene locus_tag LOCUS_13040 2767 2075 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_13040 2987 3781 gene locus_tag LOCUS_13050 2987 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3927 4421 gene locus_tag LOCUS_13060 3927 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5555 4677 gene locus_tag LOCUS_13070 5555 4677 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976957.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence162 4738 476 gene locus_tag LOCUS_13080 4738 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 5684 4926 gene locus_tag LOCUS_13090 5684 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence163 2 658 gene locus_tag LOCUS_13100 2 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 655 1671 gene locus_tag LOCUS_13110 655 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1668 2990 gene locus_tag LOCUS_13120 1668 2990 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804800.1 protein_id gnl|my_center|LOCUS_13120 2934 2943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3005 4267 gene locus_tag LOCUS_13130 3005 4267 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_13130 4264 5490 gene locus_tag LOCUS_13140 4264 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence164 <1 717 gene locus_tag LOCUS_13150 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941152.1:GTP cyclohydrolase FolE2 736 1497 gene locus_tag LOCUS_13160 736 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1500 2516 gene locus_tag LOCUS_13170 1500 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2506 3441 gene locus_tag LOCUS_13180 gene hemC 2506 3441 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 protein_id gnl|my_center|LOCUS_13180 4223 3837 gene locus_tag LOCUS_13190 4223 3837 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence165 1088 1894 gene locus_tag LOCUS_13200 gene dapA 1088 1894 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_13200 1907 2647 gene locus_tag LOCUS_13210 gene dapB 1907 2647 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_13210 2703 3212 gene locus_tag LOCUS_13220 gene folK 2703 3212 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_13220 3233 4021 gene locus_tag LOCUS_13230 gene panB 3233 4021 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_13230 4091 4972 gene locus_tag LOCUS_13240 4091 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence166 3770 2118 gene locus_tag LOCUS_13250 gene groL 3770 2118 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_13250 4104 3814 gene locus_tag LOCUS_13260 gene groES 4104 3814 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_13260 <5841 4195 gene locus_tag LOCUS_13270 <5841 4195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002557108.1:molecular chaperone DnaK >Feature sequence167 2858 1356 gene locus_tag LOCUS_13280 2858 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4844 3264 gene locus_tag LOCUS_13290 4844 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence168 133 1125 gene locus_tag LOCUS_13300 gene corA 133 1125 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 protein_id gnl|my_center|LOCUS_13300 1122 2072 gene locus_tag LOCUS_13310 gene argB 1122 2072 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_13310 2085 2429 gene locus_tag LOCUS_13320 2085 2429 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761537.1 protein_id gnl|my_center|LOCUS_13320 2754 2470 gene locus_tag LOCUS_13330 2754 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3080 4117 gene locus_tag LOCUS_13340 3080 4117 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_13340 4125 4937 gene locus_tag LOCUS_13350 gene cbiQ 4125 4937 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_13350 4934 5680 gene locus_tag LOCUS_13360 4934 5680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence169 994 515 gene locus_tag LOCUS_13370 994 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1806 988 gene locus_tag LOCUS_13380 gene kdsA 1806 988 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_13380 2144 3397 gene locus_tag LOCUS_13390 2144 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3388 3864 gene locus_tag LOCUS_13400 3388 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3854 4060 gene locus_tag LOCUS_13410 3854 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5472 4081 gene locus_tag LOCUS_13420 5472 4081 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence170 1650 592 gene locus_tag LOCUS_13430 gene lgt 1650 592 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537555.1 protein_id gnl|my_center|LOCUS_13430 2741 1647 gene locus_tag LOCUS_13440 2741 1647 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_13440 2935 3651 gene locus_tag LOCUS_13450 2935 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3779 5566 gene locus_tag LOCUS_13460 3779 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5596 5751 gene locus_tag LOCUS_13470 5596 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence171 781 287 gene locus_tag LOCUS_13480 781 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1731 883 gene locus_tag LOCUS_13490 1731 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1890 2633 gene locus_tag LOCUS_13500 1890 2633 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_13500 2876 4261 gene locus_tag LOCUS_13510 2876 4261 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_13510 4248 4802 gene locus_tag LOCUS_13520 4248 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4789 5151 gene locus_tag LOCUS_13530 4789 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 5298 5735 gene locus_tag LOCUS_13540 5298 5735 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053228394.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence172 1495 692 gene locus_tag LOCUS_13550 gene trpA 1495 692 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_13550 2684 1509 gene locus_tag LOCUS_13560 gene trpB 2684 1509 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_13560 3328 2681 gene locus_tag LOCUS_13570 3328 2681 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404413.1 protein_id gnl|my_center|LOCUS_13570 4110 3325 gene locus_tag LOCUS_13580 4110 3325 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_13580 <5701 4100 gene locus_tag LOCUS_13590 <5701 4100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937774.1:anthranilate phosphoribosyltransferase >Feature sequence173 <1 1283 gene locus_tag LOCUS_13600 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201964.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1305 5174 gene locus_tag LOCUS_13610 1305 5174 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108747.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence174 845 9 gene locus_tag LOCUS_13620 845 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1952 957 gene locus_tag LOCUS_13630 1952 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3105 1957 gene locus_tag LOCUS_13640 3105 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3911 3102 gene locus_tag LOCUS_13650 3911 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4870 3908 gene locus_tag LOCUS_13660 4870 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence175 2443 809 gene locus_tag LOCUS_13670 gene cimA 2443 809 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939200.1 protein_id gnl|my_center|LOCUS_13670 2528 4735 gene locus_tag LOCUS_13680 2528 4735 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence176 137 319 gene locus_tag LOCUS_13690 137 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 608 1564 gene locus_tag LOCUS_13700 608 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3652 1607 gene locus_tag LOCUS_13710 3652 1607 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_13710 5601 3673 gene locus_tag LOCUS_13720 5601 3673 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence177 1006 1395 gene locus_tag LOCUS_13730 1006 1395 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_13730 1550 1984 gene locus_tag LOCUS_13740 1550 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2467 2000 gene locus_tag LOCUS_13750 2467 2000 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_13750 5099 2460 gene locus_tag LOCUS_13760 5099 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence178 1720 287 gene locus_tag LOCUS_13770 1720 287 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_13770 4973 1758 gene locus_tag LOCUS_13780 4973 1758 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_13780 <5617 5036 gene locus_tag LOCUS_13790 <5617 5036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706757.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence179 59 550 gene locus_tag LOCUS_13800 59 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 574 765 gene locus_tag LOCUS_13810 gene rpmF 574 765 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_13810 913 1962 gene locus_tag LOCUS_13820 gene plsX 913 1962 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_13820 1969 3720 gene locus_tag LOCUS_13830 1969 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3704 4189 gene locus_tag LOCUS_13840 3704 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4269 4345 gene locus_tag LOCUS_t00200 4269 4345 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5498 5154 gene locus_tag LOCUS_13850 5498 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence180 1590 1018 gene locus_tag LOCUS_13860 1590 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2496 1708 gene locus_tag LOCUS_13870 2496 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3023 3526 gene locus_tag LOCUS_13880 3023 3526 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence181 <1 1628 gene locus_tag LOCUS_13890 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G 1695 2816 gene locus_tag LOCUS_13900 1695 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2946 4613 gene locus_tag LOCUS_13910 2946 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4779 4988 gene locus_tag LOCUS_13920 4779 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4993 5385 gene locus_tag LOCUS_13930 4993 5385 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016796.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence182 402 1625 gene locus_tag LOCUS_13940 402 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_13940 1628 2878 gene locus_tag LOCUS_13950 1628 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_13950 2875 4020 gene locus_tag LOCUS_13960 2875 4020 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_13960 3999 5177 gene locus_tag LOCUS_13970 3999 5177 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence183 1181 4723 gene locus_tag LOCUS_13980 1181 4723 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926886.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence184 887 390 gene locus_tag LOCUS_13990 gene ssb 887 390 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_13990 1130 2284 gene locus_tag LOCUS_14000 1130 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2334 2957 gene locus_tag LOCUS_14010 2334 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2995 3393 gene locus_tag LOCUS_14020 2995 3393 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_14020 3420 3968 gene locus_tag LOCUS_14030 gene def 3420 3968 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_14030 5245 4493 gene locus_tag LOCUS_14040 5245 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence185 >Feature sequence186 4518 2692 gene locus_tag LOCUS_14050 4518 2692 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence187 1031 267 gene locus_tag LOCUS_14060 gene tpiA 1031 267 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_14060 2322 1084 gene locus_tag LOCUS_14070 gene rsmB 2322 1084 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_14070 3971 2406 gene locus_tag LOCUS_14080 3971 2406 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_14080 5358 4066 gene locus_tag LOCUS_14090 5358 4066 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence188 207 1217 gene locus_tag LOCUS_14100 207 1217 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_14100 1246 4770 gene locus_tag LOCUS_14110 1246 4770 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_14110 4784 5335 gene locus_tag LOCUS_14120 4784 5335 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence189 109 1116 gene locus_tag LOCUS_14130 109 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2161 1070 gene locus_tag LOCUS_14140 gene pta 2161 1070 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_14140 2283 3116 gene locus_tag LOCUS_14150 2283 3116 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_14150 3995 3093 gene locus_tag LOCUS_14160 3995 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5053 4010 gene locus_tag LOCUS_14170 5053 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence190 2737 1673 gene locus_tag LOCUS_14180 2737 1673 CDS product MexX/AxyX family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521590.1 protein_id gnl|my_center|LOCUS_14180 3111 3923 gene locus_tag LOCUS_14190 3111 3923 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262367.1 protein_id gnl|my_center|LOCUS_14190 5151 4015 gene locus_tag LOCUS_14200 5151 4015 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence191 1294 3687 gene locus_tag LOCUS_14210 1294 3687 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_14210 <5344 4054 gene locus_tag LOCUS_14220 <5344 4054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073016.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence192 <1 734 gene locus_tag LOCUS_14230 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119313.1:sialidase family protein 1289 1624 gene locus_tag LOCUS_14240 1289 1624 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_14240 3628 1700 gene locus_tag LOCUS_14250 3628 1700 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_14250 3960 4715 gene locus_tag LOCUS_14260 3960 4715 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858661.1 protein_id gnl|my_center|LOCUS_14260 5300 4893 gene locus_tag LOCUS_14270 5300 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence193 <1 1456 gene locus_tag LOCUS_14280 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787371.1:catalase 1989 2750 gene locus_tag LOCUS_14290 gene proB 1989 2750 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_14290 2755 4062 gene locus_tag LOCUS_14300 2755 4062 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_14300 <5268 4131 gene locus_tag LOCUS_14310 <5268 4131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063172153.1:autotransporter domain-containing protein >Feature sequence194 87 665 gene locus_tag LOCUS_14320 87 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 782 991 gene locus_tag LOCUS_14330 782 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2121 898 gene locus_tag LOCUS_14340 2121 898 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_14340 3794 2142 gene locus_tag LOCUS_14350 3794 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3953 5119 gene locus_tag LOCUS_14360 3953 5119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence195 2851 299 gene locus_tag LOCUS_14370 2851 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3730 2879 gene locus_tag LOCUS_14380 3730 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4018 4839 gene locus_tag LOCUS_14390 4018 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence196 387 302 gene locus_tag LOCUS_t00210 387 302 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 974 489 gene locus_tag LOCUS_14400 974 489 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_14400 1531 995 gene locus_tag LOCUS_14410 1531 995 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421522.1 protein_id gnl|my_center|LOCUS_14410 3833 1671 gene locus_tag LOCUS_14420 3833 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4252 4905 gene locus_tag LOCUS_14430 4252 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence197 844 918 gene locus_tag LOCUS_t00220 844 918 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 942 1017 gene locus_tag LOCUS_t00230 942 1017 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1114 1326 gene locus_tag LOCUS_14440 1114 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1362 3248 gene locus_tag LOCUS_14450 gene mutL 1362 3248 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404457.1 protein_id gnl|my_center|LOCUS_14450 4225 3263 gene locus_tag LOCUS_14460 4225 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence198 863 962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3084 1123 gene locus_tag LOCUS_14470 3084 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4856 3270 gene locus_tag LOCUS_14480 4856 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence199 1160 498 gene locus_tag LOCUS_14490 1160 498 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_14490 3538 1169 gene locus_tag LOCUS_14500 3538 1169 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_14500 4386 3601 gene locus_tag LOCUS_14510 4386 3601 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108518.1 protein_id gnl|my_center|LOCUS_14510 5114 4425 gene locus_tag LOCUS_14520 5114 4425 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence200 30 257 gene locus_tag LOCUS_14530 30 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 317 1072 gene locus_tag LOCUS_14540 317 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1491 1312 gene locus_tag LOCUS_14550 1491 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1997 1488 gene locus_tag LOCUS_14560 1997 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2631 2035 gene locus_tag LOCUS_14570 2631 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4235 2979 gene locus_tag LOCUS_14580 4235 2979 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence201 145 1011 gene locus_tag LOCUS_14590 145 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14590 1008 1535 gene locus_tag LOCUS_14600 1008 1535 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_14600 2119 3099 gene locus_tag LOCUS_14610 gene ilvC 2119 3099 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_14610 3198 3995 gene locus_tag LOCUS_14620 3198 3995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_14620 4021 4698 gene locus_tag LOCUS_14630 4021 4698 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461356.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence202 1478 123 gene locus_tag LOCUS_14640 gene gdhA 1478 123 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_14640 2252 1803 gene locus_tag LOCUS_14650 2252 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3368 2358 gene locus_tag LOCUS_14660 3368 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 <5094 3514 gene locus_tag LOCUS_14670 <5094 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192418.1:ClcB-like voltage-gated chloride channel protein >Feature sequence203 4088 1869 gene locus_tag LOCUS_14680 4088 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4987 4085 gene locus_tag LOCUS_14690 4987 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence204 1375 326 gene locus_tag LOCUS_14700 1375 326 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210042844.1 protein_id gnl|my_center|LOCUS_14700 1693 3870 gene locus_tag LOCUS_14710 1693 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence205 339 1214 gene locus_tag LOCUS_14720 339 1214 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_14720 1220 1816 gene locus_tag LOCUS_14730 gene gmk 1220 1816 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388624.1 protein_id gnl|my_center|LOCUS_14730 3919 2048 gene locus_tag LOCUS_14740 3919 2048 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_14740 4105 4899 gene locus_tag LOCUS_14750 gene gluQRS 4105 4899 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence206 <1 602 gene locus_tag LOCUS_14760 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941053.1:NAD(P)H-binding protein 744 2516 gene locus_tag LOCUS_14770 744 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2535 3185 gene locus_tag LOCUS_14780 2535 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4519 3182 gene locus_tag LOCUS_14790 4519 3182 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence207 1014 127 gene locus_tag LOCUS_14800 1014 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1136 1145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2744 1362 gene locus_tag LOCUS_14810 gene nuoN 2744 1362 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_14810 4215 2791 gene locus_tag LOCUS_14820 4215 2791 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_14820 <5075 4237 gene locus_tag LOCUS_14830 <5075 4237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence208 <1 2074 gene locus_tag LOCUS_14840 <1 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202630.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 3457 2069 gene locus_tag LOCUS_14850 3457 2069 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence209 93 956 gene locus_tag LOCUS_14860 gene ispE 93 956 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_14860 1004 1576 gene locus_tag LOCUS_14870 1004 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1592 3577 gene locus_tag LOCUS_14880 1592 3577 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_14880 4834 3590 gene locus_tag LOCUS_14890 4834 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence210 417 3242 gene locus_tag LOCUS_14900 417 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence211 1269 526 gene locus_tag LOCUS_14910 1269 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1604 2788 gene locus_tag LOCUS_14920 1604 2788 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14920 2913 2922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3096 3377 gene locus_tag LOCUS_14930 3096 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence212 53 1645 gene locus_tag LOCUS_14940 53 1645 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_14940 2012 2524 gene locus_tag LOCUS_14950 2012 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3479 3904 gene locus_tag LOCUS_14960 3479 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4070 4576 gene locus_tag LOCUS_14970 4070 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence213 71 559 gene locus_tag LOCUS_14980 gene ribH 71 559 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_14980 595 1488 gene locus_tag LOCUS_14990 595 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1509 2357 gene locus_tag LOCUS_15000 gene ftsY 1509 2357 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_15000 2374 3453 gene locus_tag LOCUS_15010 gene rlmN 2374 3453 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence214 888 2780 gene locus_tag LOCUS_15020 gene thrS 888 2780 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_15020 2913 3458 gene locus_tag LOCUS_15030 gene infC 2913 3458 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_15030 3963 4709 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccctcacgggtgcgtggattgaaac >Feature sequence215 2948 1740 gene locus_tag LOCUS_15040 2948 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3499 2981 gene locus_tag LOCUS_15050 3499 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3763 3690 gene locus_tag LOCUS_t00240 3763 3690 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3908 3981 gene locus_tag LOCUS_t00250 3908 3981 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence216 <4927 243 gene locus_tag LOCUS_15060 <4927 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence217 903 175 gene locus_tag LOCUS_15070 903 175 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_15070 1067 1669 gene locus_tag LOCUS_15080 1067 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2407 1709 gene locus_tag LOCUS_15090 2407 1709 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence218 <1 1102 gene locus_tag LOCUS_15100 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108979.1:sulfatase 1204 2121 gene locus_tag LOCUS_15110 gene argF 1204 2121 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_15110 2140 2562 gene locus_tag LOCUS_15120 2140 2562 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_15120 2577 2975 gene locus_tag LOCUS_15130 2577 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 <4889 3229 gene locus_tag LOCUS_15140 <4889 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787605.1:alpha amylase C-terminal domain-containing protein >Feature sequence219 1125 352 gene locus_tag LOCUS_15150 1125 352 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_15150 1013 2848 gene locus_tag LOCUS_15160 gene recN 1013 2848 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_15160 <4871 2910 gene locus_tag LOCUS_15170 <4871 2910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680864.1:heavy metal translocating P-type ATPase >Feature sequence220 201 1022 gene locus_tag LOCUS_15180 201 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1507 1019 gene locus_tag LOCUS_15190 1507 1019 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101942.1 protein_id gnl|my_center|LOCUS_15190 2925 1504 gene locus_tag LOCUS_15200 gene pyk 2925 1504 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_15200 3038 4282 gene locus_tag LOCUS_15210 3038 4282 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_15210 4544 4272 gene locus_tag LOCUS_15220 4544 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence221 3831 2956 gene locus_tag LOCUS_15230 gene hisG 3831 2956 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_15230 <4759 3897 gene locus_tag LOCUS_15240 <4759 3897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:aminopeptidase P family protein >Feature sequence222 265 1893 gene locus_tag LOCUS_15250 265 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1490 1499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2352 2128 gene locus_tag LOCUS_15260 2352 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2815 2552 gene locus_tag LOCUS_15270 gene rpmB 2815 2552 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_15270 2994 3995 gene locus_tag LOCUS_15280 2994 3995 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275492.1 protein_id gnl|my_center|LOCUS_15280 3992 4531 gene locus_tag LOCUS_15290 3992 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence223 <1 512 gene locus_tag LOCUS_15300 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122095.1:MoxR family ATPase 550 1458 gene locus_tag LOCUS_15310 550 1458 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_15310 1575 2150 gene locus_tag LOCUS_15320 gene pth 1575 2150 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence224 876 73 gene locus_tag LOCUS_15330 876 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1707 3860 gene locus_tag LOCUS_15340 1707 3860 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_15340 3870 4505 gene locus_tag LOCUS_15350 3870 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence225 1219 638 gene locus_tag LOCUS_15360 1219 638 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_15360 2514 1531 gene locus_tag LOCUS_15370 gene purD 2514 1531 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404599.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15370 >Feature sequence226 1113 304 gene locus_tag LOCUS_15380 1113 304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_15380 1647 1120 gene locus_tag LOCUS_15390 1647 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1819 4011 gene locus_tag LOCUS_15400 gene glaB 1819 4011 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence227 <1 2462 gene locus_tag LOCUS_15410 <1 2462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336808.1:double-strand break repair helicase AddA 3446 2526 gene locus_tag LOCUS_15420 3446 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence228 621 546 gene locus_tag LOCUS_t00260 621 546 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3846 2341 gene locus_tag LOCUS_15430 3846 2341 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_15430 4514 3843 gene locus_tag LOCUS_15440 gene ubiE 4514 3843 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence229 1755 589 gene locus_tag LOCUS_15450 1755 589 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_15450 3284 1842 gene locus_tag LOCUS_15460 3284 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3651 4178 gene locus_tag LOCUS_15470 gene coaD 3651 4178 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence230 <1 540 gene locus_tag LOCUS_15480 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965072.1:signal recognition particle protein 629 2284 gene locus_tag LOCUS_15490 629 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2478 3239 gene locus_tag LOCUS_15500 2478 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3738 3286 gene locus_tag LOCUS_15510 3738 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence231 <1 1719 gene locus_tag LOCUS_15520 <1 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010904125.1:oligopeptide transporter, OPT family 4358 1800 gene locus_tag LOCUS_15530 4358 1800 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence232 <1 1440 gene locus_tag LOCUS_15540 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000944579.1:PDZ domain-containing protein 1486 2643 gene locus_tag LOCUS_15550 1486 2643 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_15550 3874 2660 gene locus_tag LOCUS_15560 3874 2660 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence233 452 201 gene locus_tag LOCUS_15570 452 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1132 659 gene locus_tag LOCUS_15580 1132 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1190 2227 gene locus_tag LOCUS_15590 1190 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2272 3351 gene locus_tag LOCUS_15600 2272 3351 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_15600 <4445 3401 gene locus_tag LOCUS_15610 <4445 3401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001198802.1:DUF805 domain-containing protein >Feature sequence234 282 929 gene locus_tag LOCUS_15620 282 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence235 1970 822 gene locus_tag LOCUS_15630 gene nagA 1970 822 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080848.1 protein_id gnl|my_center|LOCUS_15630 2290 2033 gene locus_tag LOCUS_15640 2290 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2936 2322 gene locus_tag LOCUS_15650 2936 2322 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_15650 <4416 3076 gene locus_tag LOCUS_15660 <4416 3076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009937746.1:MFS transporter >Feature sequence236 334 2271 gene locus_tag LOCUS_15670 334 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2297 4075 gene locus_tag LOCUS_15680 gene fucI 2297 4075 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033899.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence237 405 46 gene locus_tag LOCUS_15690 405 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1824 592 gene locus_tag LOCUS_15700 1824 592 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_15700 3028 1796 gene locus_tag LOCUS_15710 3028 1796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_15710 3984 3061 gene locus_tag LOCUS_15720 3984 3061 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence238 210 785 gene locus_tag LOCUS_15730 210 785 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_15730 877 3537 gene locus_tag LOCUS_15740 877 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3712 3786 gene locus_tag LOCUS_t00270 3712 3786 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence239 262 1188 gene locus_tag LOCUS_15750 262 1188 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_15750 1195 2469 gene locus_tag LOCUS_15760 1195 2469 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082347.1 protein_id gnl|my_center|LOCUS_15760 2536 3198 gene locus_tag LOCUS_15770 gene tsaA 2536 3198 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_15770 3859 4029 gene locus_tag LOCUS_15780 3859 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence240 1220 1981 gene locus_tag LOCUS_15790 1220 1981 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_15790 2009 2620 gene locus_tag LOCUS_15800 2009 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3257 2682 gene locus_tag LOCUS_15810 3257 2682 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_15810 3423 4337 gene locus_tag LOCUS_15820 3423 4337 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence241 1903 482 gene locus_tag LOCUS_15830 1903 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3062 2412 gene locus_tag LOCUS_15840 3062 2412 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_15840 4013 3282 gene locus_tag LOCUS_15850 4013 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence242 2533 1211 gene locus_tag LOCUS_15860 2533 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2912 3307 gene locus_tag LOCUS_15870 2912 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence243 <1 1072 gene locus_tag LOCUS_15880 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545292.1:diaminopimelate decarboxylase 1159 4020 gene locus_tag LOCUS_15890 1159 4020 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence244 47 1045 gene locus_tag LOCUS_15900 gene hemB 47 1045 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124398.1 protein_id gnl|my_center|LOCUS_15900 1108 1479 gene locus_tag LOCUS_15910 1108 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1600 2304 gene locus_tag LOCUS_15920 1600 2304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_15920 2308 3945 gene locus_tag LOCUS_15930 2308 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence245 1991 696 gene locus_tag LOCUS_15940 1991 696 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982162.1 protein_id gnl|my_center|LOCUS_15940 2119 2823 gene locus_tag LOCUS_15950 2119 2823 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_15950 2884 3996 gene locus_tag LOCUS_15960 2884 3996 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence246 874 3189 gene locus_tag LOCUS_15970 874 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3858 3229 gene locus_tag LOCUS_15980 3858 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence247 >Feature sequence248 <1 1421 gene locus_tag LOCUS_15990 <1 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963522.1:YitT family protein 1462 1926 gene locus_tag LOCUS_16000 1462 1926 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence249 121 879 gene locus_tag LOCUS_16010 121 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 938 1309 gene locus_tag LOCUS_16020 938 1309 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388136.1 protein_id gnl|my_center|LOCUS_16020 2063 1524 gene locus_tag LOCUS_16030 2063 1524 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844895.1 protein_id gnl|my_center|LOCUS_16030 <4148 2157 gene locus_tag LOCUS_16040 <4148 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000515824.1:beta-N-acetylglucosaminidase domain-containing protein >Feature sequence250 1294 314 gene locus_tag LOCUS_16050 1294 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1606 2136 gene locus_tag LOCUS_16060 1606 2136 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_16060 3348 2164 gene locus_tag LOCUS_16070 3348 2164 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793345.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence251 1337 441 gene locus_tag LOCUS_16080 1337 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2453 1368 gene locus_tag LOCUS_16090 gene aroC 2453 1368 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_16090 2854 2585 gene locus_tag LOCUS_16100 2854 2585 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_16100 <4131 2937 gene locus_tag LOCUS_16110 <4131 2937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943723.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence252 2445 2370 gene locus_tag LOCUS_t00280 2445 2370 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2561 2487 gene locus_tag LOCUS_t00290 2561 2487 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2757 3254 gene locus_tag LOCUS_16120 2757 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence253 2305 1550 gene locus_tag LOCUS_16130 gene larB 2305 1550 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_16130 3117 2302 gene locus_tag LOCUS_16140 gene larE 3117 2302 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947958.1 protein_id gnl|my_center|LOCUS_16140 <4103 3089 gene locus_tag LOCUS_16150 <4103 3089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964092.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence254 1626 1309 gene locus_tag LOCUS_16160 gene trxA 1626 1309 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_16160 2243 1665 gene locus_tag LOCUS_16170 2243 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2550 3230 gene locus_tag LOCUS_16180 2550 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence255 385 1245 gene locus_tag LOCUS_16190 385 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2615 1401 gene locus_tag LOCUS_16200 2615 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3357 2593 gene locus_tag LOCUS_16210 3357 2593 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612460.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence256 >Feature sequence257 914 69 gene locus_tag LOCUS_16220 914 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1929 1081 gene locus_tag LOCUS_16230 1929 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence258 <1 871 gene locus_tag LOCUS_16240 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764890.1:DUF3737 family protein 868 2058 gene locus_tag LOCUS_16250 868 2058 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_16250 2104 3108 gene locus_tag LOCUS_16260 2104 3108 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence259 1999 395 gene locus_tag LOCUS_16270 1999 395 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050547433.1 protein_id gnl|my_center|LOCUS_16270 2868 2260 gene locus_tag LOCUS_16280 2868 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3771 2995 gene locus_tag LOCUS_16290 3771 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence260 <1 692 gene locus_tag LOCUS_16300 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086877.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA 1582 689 gene locus_tag LOCUS_16310 1582 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2589 1687 gene locus_tag LOCUS_16320 2589 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2874 3158 gene locus_tag LOCUS_16330 2874 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 <3853 3274 gene locus_tag LOCUS_16340 <3853 3274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203343.1:serine hydrolase >Feature sequence261 819 658 gene locus_tag LOCUS_16350 819 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1159 3435 gene locus_tag LOCUS_16360 1159 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence262 64 1722 gene locus_tag LOCUS_16370 64 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1828 2337 gene locus_tag LOCUS_16380 1828 2337 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_16380 2686 3189 gene locus_tag LOCUS_16390 2686 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966118.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence263 1930 230 gene locus_tag LOCUS_16400 gene kdpA 1930 230 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_16400 2827 2048 gene locus_tag LOCUS_16410 2827 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 <3736 2978 gene locus_tag LOCUS_16420 <3736 2978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185947.1:two-component system response regulator KdpE >Feature sequence264 191 916 gene locus_tag LOCUS_16430 191 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1086 1235 gene locus_tag LOCUS_16440 1086 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1251 1841 gene locus_tag LOCUS_16450 1251 1841 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence265 1155 595 gene locus_tag LOCUS_16460 1155 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1933 1337 gene locus_tag LOCUS_16470 1933 1337 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948585.1 protein_id gnl|my_center|LOCUS_16470 2374 2162 gene locus_tag LOCUS_16480 2374 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2529 2981 gene locus_tag LOCUS_16490 2529 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence266 >Feature sequence267 <1 2966 gene locus_tag LOCUS_16500 <1 2966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010725378.1:polymorphic outer membrane protein middle domain-containing protein >Feature sequence268 111 326 gene locus_tag LOCUS_16510 111 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 333 590 gene locus_tag LOCUS_16520 333 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1466 2299 gene locus_tag LOCUS_16530 1466 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2309 2662 gene locus_tag LOCUS_16540 2309 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3549 2641 gene locus_tag LOCUS_16550 3549 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence269 <1 1071 gene locus_tag LOCUS_16560 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921450.1:alpha/beta fold hydrolase 1153 2823 gene locus_tag LOCUS_16570 1153 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2829 3584 gene locus_tag LOCUS_16580 2829 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence270 235 1086 gene locus_tag LOCUS_16590 gene pstB 235 1086 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_16590 1278 1937 gene locus_tag LOCUS_16600 gene phoU 1278 1937 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880553.1 protein_id gnl|my_center|LOCUS_16600 2005 2601 gene locus_tag LOCUS_16610 2005 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2532 2903 gene locus_tag LOCUS_16620 2532 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 <3678 2984 gene locus_tag LOCUS_16630 <3678 2984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275413.1:galactose mutarotase >Feature sequence271 505 143 gene locus_tag LOCUS_16640 gene rplR 505 143 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_16640 1080 541 gene locus_tag LOCUS_16650 gene rplF 1080 541 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_16650 1504 1103 gene locus_tag LOCUS_16660 gene rpsH 1504 1103 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_16660 2098 1517 gene locus_tag LOCUS_16670 gene rplE 2098 1517 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_16670 2387 2160 gene locus_tag LOCUS_16680 2387 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3528 2656 gene locus_tag LOCUS_16690 3528 2656 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence272 1113 298 gene locus_tag LOCUS_16700 1113 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1405 1692 gene locus_tag LOCUS_16710 1405 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1738 2430 gene locus_tag LOCUS_16720 1738 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence273 3 1277 gene locus_tag LOCUS_16730 3 1277 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_16730 1274 1894 gene locus_tag LOCUS_16740 gene tmk 1274 1894 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_16740 2638 1979 gene locus_tag LOCUS_16750 gene queC 2638 1979 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972958.1 protein_id gnl|my_center|LOCUS_16750 3070 2663 gene locus_tag LOCUS_16760 gene queF 3070 2663 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938262.1 protein_id gnl|my_center|LOCUS_16760 3595 3104 gene locus_tag LOCUS_16770 3595 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence274 2596 1145 gene locus_tag LOCUS_16780 gene guaB 2596 1145 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_16780 3291 2692 gene locus_tag LOCUS_16790 3291 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence275 116 772 gene locus_tag LOCUS_16800 116 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 789 998 gene locus_tag LOCUS_16810 789 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1024 2265 gene locus_tag LOCUS_16820 1024 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence276 1136 27 gene locus_tag LOCUS_16830 gene hemW 1136 27 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence277 2568 1477 gene locus_tag LOCUS_16840 2568 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3362 2718 gene locus_tag LOCUS_16850 3362 2718 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence278 469 1314 gene locus_tag LOCUS_16860 469 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1636 1971 gene locus_tag LOCUS_16870 1636 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2428 3213 gene locus_tag LOCUS_16880 2428 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence279 2153 975 gene locus_tag LOCUS_16890 2153 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2453 3145 gene locus_tag LOCUS_16900 2453 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence280 2958 502 gene locus_tag LOCUS_16910 2958 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence281 <1 2435 gene locus_tag LOCUS_16920 <1 2435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 3155 2712 gene locus_tag LOCUS_16930 3155 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence282 1922 123 gene locus_tag LOCUS_16940 gene lepA 1922 123 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_16940 2184 2387 gene locus_tag LOCUS_16950 2184 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3041 2406 gene locus_tag LOCUS_16960 3041 2406 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence283 345 533 gene locus_tag LOCUS_16970 345 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 748 1107 gene locus_tag LOCUS_16980 gene ndhC 748 1107 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_16980 1341 2501 gene locus_tag LOCUS_16990 1341 2501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_16990 2529 2538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3116 2802 gene locus_tag LOCUS_17000 3116 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence284 >Feature sequence285 <1 615 gene locus_tag LOCUS_17010 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203259.1:alpha-L-fucosidase 1605 1245 gene locus_tag LOCUS_tm00010 1605 1245 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1760 1684 gene locus_tag LOCUS_t00300 1760 1684 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence286 327 965 gene locus_tag LOCUS_17020 327 965 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_17020 1093 1350 gene locus_tag LOCUS_17030 1093 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 <3435 1345 gene locus_tag LOCUS_17040 <3435 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244418.1:copper-translocating P-type ATPase >Feature sequence287 244 23 gene locus_tag LOCUS_17050 244 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 925 317 gene locus_tag LOCUS_17060 925 317 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_17060 1340 1759 gene locus_tag LOCUS_17070 1340 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1863 2318 gene locus_tag LOCUS_17080 gene ndk 1863 2318 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_17080 3278 2457 gene locus_tag LOCUS_17090 3278 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence288 <1 1826 gene locus_tag LOCUS_17100 <1 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798674.1:M60 family metallopeptidase 3378 2752 gene locus_tag LOCUS_17110 3378 2752 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764769.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence289 843 2291 gene locus_tag LOCUS_17120 843 2291 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_17120 2320 3261 gene locus_tag LOCUS_17130 gene glsA 2320 3261 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883028.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence290 1905 1324 gene locus_tag LOCUS_17140 1905 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3198 1954 gene locus_tag LOCUS_17150 gene nuoD 3198 1954 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence291 1949 2959 gene locus_tag LOCUS_17160 1949 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence292 <1 2433 gene locus_tag LOCUS_17170 <1 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703586.1:enterotoxin 3313 2795 gene locus_tag LOCUS_17180 3313 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence293 838 149 gene locus_tag LOCUS_17190 838 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1789 1121 gene locus_tag LOCUS_17200 1789 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <3313 2107 gene locus_tag LOCUS_17210 <3313 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258505.1:GAF domain-containing protein >Feature sequence294 6 974 gene locus_tag LOCUS_17220 gene hprK 6 974 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_17220 1052 1318 gene locus_tag LOCUS_17230 1052 1318 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 protein_id gnl|my_center|LOCUS_17230 1365 3146 gene locus_tag LOCUS_17240 gene ptsP 1365 3146 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence295 1966 989 gene locus_tag LOCUS_17250 1966 989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_17250 3304 1970 gene locus_tag LOCUS_17260 3304 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence296 2511 2074 gene locus_tag LOCUS_17270 2511 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence297 1537 2697 gene locus_tag LOCUS_17280 1537 2697 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868464.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence298 <3287 2711 gene locus_tag LOCUS_17290 <3287 2711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257306.1:ParA family protein >Feature sequence299 3119 1623 gene locus_tag LOCUS_17300 3119 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence300 <1 1087 gene locus_tag LOCUS_17310 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073343.1:DUF5009 domain-containing protein 1098 3128 gene locus_tag LOCUS_17320 1098 3128 CDS product Sip1-related alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785073.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence301 2668 995 gene locus_tag LOCUS_17330 2668 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2783 2857 gene locus_tag LOCUS_t00310 2783 2857 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence302 2847 1186 gene locus_tag LOCUS_17340 2847 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence303 586 1194 gene locus_tag LOCUS_17350 586 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1214 1861 gene locus_tag LOCUS_17360 1214 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2153 2950 gene locus_tag LOCUS_17370 2153 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3220 3044 gene locus_tag LOCUS_17380 3220 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence304 1647 916 gene locus_tag LOCUS_17390 1647 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1820 2383 gene locus_tag LOCUS_17400 1820 2383 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence305 621 148 gene locus_tag LOCUS_17410 621 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1171 626 gene locus_tag LOCUS_17420 gene sufT 1171 626 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_17420 1525 2562 gene locus_tag LOCUS_17430 1525 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2414 2423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence306 101 1138 gene locus_tag LOCUS_17440 101 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1135 1542 gene locus_tag LOCUS_17450 1135 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1637 2146 gene locus_tag LOCUS_17460 1637 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2183 2788 gene locus_tag LOCUS_17470 2183 2788 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence307 567 64 gene locus_tag LOCUS_17480 gene ybaK 567 64 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_17480 1816 698 gene locus_tag LOCUS_17490 gene lpxB 1816 698 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_17490 1908 2600 gene locus_tag LOCUS_17500 1908 2600 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_17500 2611 3087 gene locus_tag LOCUS_17510 2611 3087 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence308 319 1131 gene locus_tag LOCUS_17520 319 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3137 1989 gene locus_tag LOCUS_17530 3137 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence309 <1 1048 gene locus_tag LOCUS_17540 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338403.1:MoxR family ATPase 1100 1981 gene locus_tag LOCUS_17550 1100 1981 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence310 1040 2704 gene locus_tag LOCUS_17560 gene glgP 1040 2704 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence311 476 384 gene locus_tag LOCUS_t00320 476 384 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2115 550 gene locus_tag LOCUS_17570 2115 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 <3116 2431 gene locus_tag LOCUS_17580 <3116 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399229.1:DNA helicase RecQ >Feature sequence312 813 1289 gene locus_tag LOCUS_17590 813 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1338 2135 gene locus_tag LOCUS_17600 1338 2135 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence313 251 1018 gene locus_tag LOCUS_17610 gene hisF 251 1018 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence314 337 1296 gene locus_tag LOCUS_17620 337 1296 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933663.1 protein_id gnl|my_center|LOCUS_17620 1301 2275 gene locus_tag LOCUS_17630 1301 2275 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920841.1 protein_id gnl|my_center|LOCUS_17630 2272 2781 gene locus_tag LOCUS_17640 2272 2781 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence315 1220 18 gene locus_tag LOCUS_17650 1220 18 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_17650 2884 1247 gene locus_tag LOCUS_17660 2884 1247 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence316 <3061 359 gene locus_tag LOCUS_17670 <3061 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:PD-(D/E)XK nuclease family protein >Feature sequence317 <1 900 gene locus_tag LOCUS_17680 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275159.1:ATP-dependent helicase HrpB >Feature sequence318 281 940 gene locus_tag LOCUS_17690 281 940 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_17690 3031 1022 gene locus_tag LOCUS_17700 3031 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence319 463 1836 gene locus_tag LOCUS_17710 463 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 1848 2366 gene locus_tag LOCUS_17720 1848 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 >Feature sequence320 1125 2339 gene locus_tag LOCUS_17730 1125 2339 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence321 943 1758 gene locus_tag LOCUS_17740 943 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence322 1599 523 gene locus_tag LOCUS_17750 gene apbC 1599 523 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_17750 2059 1847 gene locus_tag LOCUS_17760 2059 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2363 2536 gene locus_tag LOCUS_17770 2363 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence323 1532 966 gene locus_tag LOCUS_17780 1532 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence324 804 1034 gene locus_tag LOCUS_17790 804 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence325 1189 65 gene locus_tag LOCUS_17800 1189 65 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_17800 2288 1182 gene locus_tag LOCUS_17810 2288 1182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_17810 <2917 2285 gene locus_tag LOCUS_17820 <2917 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937437.1:ATP-binding cassette domain-containing protein >Feature sequence326 1494 469 gene locus_tag LOCUS_17830 1494 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2254 1514 gene locus_tag LOCUS_17840 2254 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2392 2264 gene locus_tag LOCUS_17850 2392 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2582 2656 gene locus_tag LOCUS_t00330 2582 2656 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence327 215 547 gene locus_tag LOCUS_17860 215 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1013 1591 gene locus_tag LOCUS_17870 1013 1591 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_17870 1591 2646 gene locus_tag LOCUS_17880 1591 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence328 408 214 gene locus_tag LOCUS_17890 408 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1055 1978 gene locus_tag LOCUS_17900 1055 1978 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_17900 2553 2098 gene locus_tag LOCUS_17910 2553 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence329 2370 1051 gene locus_tag LOCUS_17920 2370 1051 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence330 2528 468 gene locus_tag LOCUS_17930 2528 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence331 3 146 gene locus_tag LOCUS_17940 3 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 353 278 gene locus_tag LOCUS_t00340 353 278 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 923 441 gene locus_tag LOCUS_17950 923 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1474 911 gene locus_tag LOCUS_17960 1474 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1994 1695 gene locus_tag LOCUS_17970 1994 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence332 171 584 gene locus_tag LOCUS_17980 171 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 711 2027 gene locus_tag LOCUS_17990 711 2027 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence333 <1 829 gene locus_tag LOCUS_18000 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176709.1:type I-C CRISPR-associated protein Cas7/Csd2 2611 1034 gene locus_tag LOCUS_18010 2611 1034 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence334 39 1433 gene locus_tag LOCUS_18020 gene rpoN 39 1433 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809012.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence335 <1 923 gene locus_tag LOCUS_18030 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009039963.1:polysaccharide pyruvyl transferase family protein 1143 2060 gene locus_tag LOCUS_18040 1143 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence336 278 1102 gene locus_tag LOCUS_18050 gene dapF 278 1102 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_18050 1724 1155 gene locus_tag LOCUS_18060 1724 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2553 2627 gene locus_tag LOCUS_t00350 2553 2627 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence337 996 151 gene locus_tag LOCUS_18070 996 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 <2702 1015 gene locus_tag LOCUS_18080 <2702 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933216.1:valine--tRNA ligase >Feature sequence338 1346 3 gene locus_tag LOCUS_18090 gene dnaA 1346 3 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_18090 1935 2498 gene locus_tag LOCUS_18100 1935 2498 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence339 2402 159 gene locus_tag LOCUS_18110 2402 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence340 435 1061 gene locus_tag LOCUS_18120 435 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1196 1819 gene locus_tag LOCUS_18130 1196 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1970 2380 gene locus_tag LOCUS_18140 gene purE 1970 2380 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence341 >Feature sequence342 42 491 gene locus_tag LOCUS_18150 42 491 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_18150 2203 575 gene locus_tag LOCUS_18160 2203 575 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109383.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence343 309 602 gene locus_tag LOCUS_18170 gene gatC 309 602 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_18170 646 2058 gene locus_tag LOCUS_18180 gene gatA 646 2058 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence344 957 337 gene locus_tag LOCUS_18190 957 337 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_18190 1611 1075 gene locus_tag LOCUS_18200 1611 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1804 2277 gene locus_tag LOCUS_18210 1804 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence345 <1 1113 gene locus_tag LOCUS_18220 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382922.1:DEAD/DEAH box helicase 1274 1879 gene locus_tag LOCUS_18230 1274 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence346 219 2078 gene locus_tag LOCUS_18240 219 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence347 1035 331 gene locus_tag LOCUS_18250 1035 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1253 2461 gene locus_tag LOCUS_18260 1253 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence348 204 653 gene locus_tag LOCUS_18270 204 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 662 1657 gene locus_tag LOCUS_18280 662 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence349 2128 131 gene locus_tag LOCUS_18290 gene btuB 2128 131 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence350 71 949 gene locus_tag LOCUS_18300 71 949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_18300 916 1506 gene locus_tag LOCUS_18310 916 1506 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_18310