>Feature sequence001 1010 249 gene locus_tag LOCUS_00010 1010 249 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_00010 2541 1168 gene locus_tag LOCUS_00020 gene pyk 2541 1168 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_00020 3408 2881 gene locus_tag LOCUS_00030 3408 2881 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_00030 3792 3607 gene locus_tag LOCUS_00040 3792 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3870 3969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4754 5038 gene locus_tag LOCUS_00050 4754 5038 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_00050 5319 6890 gene locus_tag LOCUS_00060 5319 6890 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_00060 9074 6987 gene locus_tag LOCUS_00070 9074 6987 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_00070 9358 10524 gene locus_tag LOCUS_00080 9358 10524 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793803.1 protein_id gnl|my_center|LOCUS_00080 10916 10749 gene locus_tag LOCUS_00090 10916 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11238 10906 gene locus_tag LOCUS_00100 11238 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11702 11328 gene locus_tag LOCUS_00110 11702 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11906 11742 gene locus_tag LOCUS_00120 11906 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12122 11925 gene locus_tag LOCUS_00130 12122 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12389 12141 gene locus_tag LOCUS_00140 12389 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13170 12811 gene locus_tag LOCUS_00150 13170 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042369609.1 protein_id gnl|my_center|LOCUS_00150 13898 13362 gene locus_tag LOCUS_00160 13898 13362 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267954.1 protein_id gnl|my_center|LOCUS_00160 14250 13885 gene locus_tag LOCUS_00170 14250 13885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14845 14360 gene locus_tag LOCUS_00180 14845 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15327 14857 gene locus_tag LOCUS_00190 15327 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16252 15422 gene locus_tag LOCUS_00200 16252 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 16743 16405 gene locus_tag LOCUS_00210 16743 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 17063 16755 gene locus_tag LOCUS_00220 17063 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 17812 17375 gene locus_tag LOCUS_00230 17812 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19097 17826 gene locus_tag LOCUS_00240 19097 17826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 19626 19117 gene locus_tag LOCUS_00250 19626 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 20209 19640 gene locus_tag LOCUS_00260 20209 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 21400 20222 gene locus_tag LOCUS_00270 21400 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 21934 21431 gene locus_tag LOCUS_00280 21934 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 22528 21938 gene locus_tag LOCUS_00290 22528 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 23693 22626 gene locus_tag LOCUS_00300 23693 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 25010 23727 gene locus_tag LOCUS_00310 25010 23727 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149920565.1 protein_id gnl|my_center|LOCUS_00310 28313 25206 gene locus_tag LOCUS_00320 28313 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30419 28326 gene locus_tag LOCUS_00330 30419 28326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31756 30659 gene locus_tag LOCUS_00340 31756 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 32286 31753 gene locus_tag LOCUS_00350 32286 31753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32714 32283 gene locus_tag LOCUS_00360 32714 32283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33265 32717 gene locus_tag LOCUS_00370 33265 32717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34467 33286 gene locus_tag LOCUS_00380 34467 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 35116 34511 gene locus_tag LOCUS_00390 35116 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35447 35641 gene locus_tag LOCUS_00400 35447 35641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 37125 35764 gene locus_tag LOCUS_00410 37125 35764 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_00410 37793 37251 gene locus_tag LOCUS_00420 37793 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 38563 38267 gene locus_tag LOCUS_00430 38563 38267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 39703 38678 gene locus_tag LOCUS_00440 39703 38678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 40514 40032 gene locus_tag LOCUS_00450 40514 40032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 41732 40851 gene locus_tag LOCUS_00460 41732 40851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 43008 42067 gene locus_tag LOCUS_00470 43008 42067 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_00470 43320 43021 gene locus_tag LOCUS_00480 43320 43021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44298 43438 gene locus_tag LOCUS_00490 44298 43438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 44899 44558 gene locus_tag LOCUS_00500 44899 44558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 45395 44904 gene locus_tag LOCUS_00510 45395 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 45636 45400 gene locus_tag LOCUS_00520 45636 45400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 45830 45633 gene locus_tag LOCUS_00530 45830 45633 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202817.1 protein_id gnl|my_center|LOCUS_00530 46198 45956 gene locus_tag LOCUS_00540 46198 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 46361 46717 gene locus_tag LOCUS_00550 46361 46717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 46745 46978 gene locus_tag LOCUS_00560 46745 46978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 47128 47574 gene locus_tag LOCUS_00570 47128 47574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 47580 48068 gene locus_tag LOCUS_00580 47580 48068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 48253 48588 gene locus_tag LOCUS_00590 48253 48588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 48622 48939 gene locus_tag LOCUS_00600 48622 48939 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence002 322 2181 gene locus_tag LOCUS_00610 322 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2206 5010 gene locus_tag LOCUS_00620 2206 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7112 5163 gene locus_tag LOCUS_00630 7112 5163 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_00630 8052 7330 gene locus_tag LOCUS_00640 gene cdaA 8052 7330 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_00640 8981 8148 gene locus_tag LOCUS_00650 gene folP 8981 8148 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_00650 9092 10432 gene locus_tag LOCUS_00660 9092 10432 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_00660 12117 10615 gene locus_tag LOCUS_00670 12117 10615 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_00670 12490 12963 gene locus_tag LOCUS_00680 12490 12963 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_00680 13065 14834 gene locus_tag LOCUS_00690 13065 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 14917 15852 gene locus_tag LOCUS_00700 14917 15852 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_00700 15940 17133 gene locus_tag LOCUS_00710 15940 17133 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_00710 17287 18297 gene locus_tag LOCUS_00720 gene pta 17287 18297 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762631.1 protein_id gnl|my_center|LOCUS_00720 18378 19517 gene locus_tag LOCUS_00730 18378 19517 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_00730 20515 19613 gene locus_tag LOCUS_00740 gene xerD 20515 19613 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_00740 21083 20538 gene locus_tag LOCUS_00750 21083 20538 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_00750 21324 22079 gene locus_tag LOCUS_00760 gene dapB 21324 22079 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_00760 22099 23550 gene locus_tag LOCUS_00770 22099 23550 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_00770 23576 23818 gene locus_tag LOCUS_00780 23576 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 24014 24580 gene locus_tag LOCUS_00790 24014 24580 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_00790 24611 25015 gene locus_tag LOCUS_00800 24611 25015 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_00800 25550 25957 gene locus_tag LOCUS_00810 25550 25957 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_00810 25957 26976 gene locus_tag LOCUS_00820 gene dusB 25957 26976 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_00820 27814 26930 gene locus_tag LOCUS_00830 27814 26930 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_00830 28623 27847 gene locus_tag LOCUS_00840 28623 27847 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_00840 29576 28638 gene locus_tag LOCUS_00850 29576 28638 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_00850 30184 29561 gene locus_tag LOCUS_00860 30184 29561 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_00860 31299 30181 gene locus_tag LOCUS_00870 31299 30181 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_00870 31753 31418 gene locus_tag LOCUS_00880 gene rbfA 31753 31418 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_00880 31979 32572 gene locus_tag LOCUS_00890 31979 32572 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_00890 32714 33613 gene locus_tag LOCUS_00900 32714 33613 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764420.1 protein_id gnl|my_center|LOCUS_00900 33642 34064 gene locus_tag LOCUS_00910 gene aroQ 33642 34064 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_00910 34076 34777 gene locus_tag LOCUS_00920 34076 34777 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_00920 35022 36128 gene locus_tag LOCUS_00930 gene ychF 35022 36128 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_00930 36162 37016 gene locus_tag LOCUS_00940 gene lgt 36162 37016 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 protein_id gnl|my_center|LOCUS_00940 37115 37720 gene locus_tag LOCUS_00950 37115 37720 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_00950 37783 38661 gene locus_tag LOCUS_00960 37783 38661 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_00960 38726 39733 gene locus_tag LOCUS_00970 38726 39733 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_00970 40543 41898 gene locus_tag LOCUS_00980 40543 41898 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_00980 41947 43134 gene locus_tag LOCUS_00990 41947 43134 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_00990 44183 43308 gene locus_tag LOCUS_01000 44183 43308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 44449 44769 gene locus_tag LOCUS_01010 44449 44769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 44775 45164 gene locus_tag LOCUS_01020 44775 45164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 45181 45972 gene locus_tag LOCUS_01030 45181 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 46663 45983 gene locus_tag LOCUS_01040 46663 45983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence003 1627 92 gene locus_tag LOCUS_01050 1627 92 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_01050 3057 1639 gene locus_tag LOCUS_01060 3057 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4943 3237 gene locus_tag LOCUS_01070 4943 3237 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_01070 8199 5083 gene locus_tag LOCUS_01080 8199 5083 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_01080 10656 8401 gene locus_tag LOCUS_01090 10656 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 10880 12604 gene locus_tag LOCUS_01100 10880 12604 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_01100 12751 13962 gene locus_tag LOCUS_01110 12751 13962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_01110 14018 14896 gene locus_tag LOCUS_01120 14018 14896 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_01120 15338 14937 gene locus_tag LOCUS_01130 15338 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 16723 15410 gene locus_tag LOCUS_01140 gene der 16723 15410 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_01140 17925 17044 gene locus_tag LOCUS_01150 gene era 17925 17044 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_01150 18065 21472 gene locus_tag LOCUS_01160 18065 21472 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303138.1 protein_id gnl|my_center|LOCUS_01160 21526 22815 gene locus_tag LOCUS_01170 21526 22815 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_01170 22812 23549 gene locus_tag LOCUS_01180 22812 23549 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_01180 23828 23601 gene locus_tag LOCUS_01190 23828 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 23933 25114 gene locus_tag LOCUS_01200 23933 25114 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01200 25131 25334 gene locus_tag LOCUS_01210 25131 25334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 25457 26824 gene locus_tag LOCUS_01220 25457 26824 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_01220 26855 27655 gene locus_tag LOCUS_01230 26855 27655 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_01230 29971 27797 gene locus_tag LOCUS_01240 gene recQ 29971 27797 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_01240 31265 30036 gene locus_tag LOCUS_01250 gene clpX 31265 30036 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_01250 31938 31273 gene locus_tag LOCUS_01260 gene clpP 31938 31273 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_01260 32172 32567 gene locus_tag LOCUS_01270 32172 32567 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_01270 33130 36102 gene locus_tag LOCUS_01280 33130 36102 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109370.1 protein_id gnl|my_center|LOCUS_01280 36196 37779 gene locus_tag LOCUS_01290 36196 37779 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109369.1 protein_id gnl|my_center|LOCUS_01290 37869 39272 gene locus_tag LOCUS_01300 37869 39272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 39293 40348 gene locus_tag LOCUS_01310 39293 40348 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_01310 40426 41529 gene locus_tag LOCUS_01320 40426 41529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 41554 43941 gene locus_tag LOCUS_01330 gene galB 41554 43941 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_01330 44866 44024 gene locus_tag LOCUS_01340 44866 44024 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763634.1 protein_id gnl|my_center|LOCUS_01340 45574 44882 gene locus_tag LOCUS_01350 45574 44882 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence004 187 879 gene locus_tag LOCUS_01360 187 879 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_01360 1059 1661 gene locus_tag LOCUS_01370 gene pssA 1059 1661 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_01370 1673 2113 gene locus_tag LOCUS_01380 1673 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2421 5342 gene locus_tag LOCUS_01390 2421 5342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108915.1 protein_id gnl|my_center|LOCUS_01390 5391 6617 gene locus_tag LOCUS_01400 5391 6617 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108914.1 protein_id gnl|my_center|LOCUS_01400 6637 8064 gene locus_tag LOCUS_01410 6637 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8087 9454 gene locus_tag LOCUS_01420 8087 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9559 12339 gene locus_tag LOCUS_01430 9559 12339 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_01430 12361 12786 gene locus_tag LOCUS_01440 12361 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 13829 12861 gene locus_tag LOCUS_01450 13829 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 14648 13938 gene locus_tag LOCUS_01460 gene pyrH 14648 13938 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_01460 15756 14866 gene locus_tag LOCUS_01470 15756 14866 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_01470 15942 16481 gene locus_tag LOCUS_01480 15942 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 16511 16675 gene locus_tag LOCUS_01490 16511 16675 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_01490 16758 17246 gene locus_tag LOCUS_01500 16758 17246 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_01500 18615 18448 gene locus_tag LOCUS_01510 18615 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 18574 18816 gene locus_tag LOCUS_01520 18574 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 18832 20499 gene locus_tag LOCUS_01530 18832 20499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 20563 21627 gene locus_tag LOCUS_01540 20563 21627 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_01540 21630 26858 gene locus_tag LOCUS_01550 21630 26858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 26864 27688 gene locus_tag LOCUS_01560 26864 27688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 27708 28025 gene locus_tag LOCUS_01570 27708 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 28386 28586 gene locus_tag LOCUS_01580 28386 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 28777 29076 gene locus_tag LOCUS_01590 28777 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 30223 29486 gene locus_tag LOCUS_01600 30223 29486 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_01600 30618 30238 gene locus_tag LOCUS_01610 30618 30238 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_01610 30707 31159 gene locus_tag LOCUS_01620 30707 31159 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_01620 31220 34174 gene locus_tag LOCUS_01630 31220 34174 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_01630 35901 34480 gene locus_tag LOCUS_01640 35901 34480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 36964 36050 gene locus_tag LOCUS_01650 36964 36050 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_01650 38148 37312 gene locus_tag LOCUS_01660 38148 37312 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_01660 38826 38179 gene locus_tag LOCUS_01670 38826 38179 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_01670 39444 38830 gene locus_tag LOCUS_01680 39444 38830 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 protein_id gnl|my_center|LOCUS_01680 40314 39475 gene locus_tag LOCUS_01690 40314 39475 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_01690 41674 40481 gene locus_tag LOCUS_01700 41674 40481 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_01700 43311 42100 gene locus_tag LOCUS_01710 43311 42100 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence005 35 373 gene locus_tag LOCUS_01720 35 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 333 692 gene locus_tag LOCUS_01730 333 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 773 1699 gene locus_tag LOCUS_01740 773 1699 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_01740 1974 2873 gene locus_tag LOCUS_01750 1974 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2908 5073 gene locus_tag LOCUS_01760 2908 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5070 7253 gene locus_tag LOCUS_01770 5070 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7346 8212 gene locus_tag LOCUS_01780 7346 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8223 9254 gene locus_tag LOCUS_01790 8223 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 9256 10311 gene locus_tag LOCUS_01800 9256 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 10438 11958 gene locus_tag LOCUS_01810 10438 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 11970 12536 gene locus_tag LOCUS_01820 11970 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 12544 13494 gene locus_tag LOCUS_01830 12544 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 13583 14764 gene locus_tag LOCUS_01840 13583 14764 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_01840 14804 15370 gene locus_tag LOCUS_01850 14804 15370 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_01850 15377 15562 gene locus_tag LOCUS_01860 gene rpmF 15377 15562 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_01860 15577 16596 gene locus_tag LOCUS_01870 15577 16596 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_01870 16708 16807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18435 17071 gene locus_tag LOCUS_01880 gene tig 18435 17071 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_01880 18804 21653 gene locus_tag LOCUS_01890 18804 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 22187 25351 gene locus_tag LOCUS_01900 22187 25351 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_01900 25385 27136 gene locus_tag LOCUS_01910 25385 27136 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_01910 27212 28909 gene locus_tag LOCUS_01920 27212 28909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29144 31834 gene locus_tag LOCUS_01930 29144 31834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 31974 32894 gene locus_tag LOCUS_01940 31974 32894 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_01940 32924 35362 gene locus_tag LOCUS_01950 32924 35362 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_01950 35530 36657 gene locus_tag LOCUS_01960 35530 36657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_01960 37032 36805 gene locus_tag LOCUS_01970 37032 36805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 38686 37268 gene locus_tag LOCUS_01980 38686 37268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 39822 38800 gene locus_tag LOCUS_01990 39822 38800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 38844 38943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41569 39863 gene locus_tag LOCUS_02000 41569 39863 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_02000 <43315 41591 gene locus_tag LOCUS_02010 <43315 41591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108938.1:TonB-dependent receptor >Feature sequence006 48 1277 gene locus_tag LOCUS_02020 48 1277 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_02020 1340 1702 gene locus_tag LOCUS_02030 1340 1702 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_02030 1810 3285 gene locus_tag LOCUS_02040 1810 3285 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_02040 3310 5436 gene locus_tag LOCUS_02050 3310 5436 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_02050 5537 7285 gene locus_tag LOCUS_02060 5537 7285 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_02060 7365 9068 gene locus_tag LOCUS_02070 7365 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9290 10432 gene locus_tag LOCUS_02080 9290 10432 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_02080 10458 11210 gene locus_tag LOCUS_02090 10458 11210 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761029.1 protein_id gnl|my_center|LOCUS_02090 11285 11899 gene locus_tag LOCUS_02100 11285 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 11922 12587 gene locus_tag LOCUS_02110 gene ung 11922 12587 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_02110 12648 13232 gene locus_tag LOCUS_02120 12648 13232 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_02120 16545 13663 gene locus_tag LOCUS_02130 16545 13663 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108783.1 protein_id gnl|my_center|LOCUS_02130 17474 16590 gene locus_tag LOCUS_02140 17474 16590 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674971.1 protein_id gnl|my_center|LOCUS_02140 20158 17591 gene locus_tag LOCUS_02150 20158 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 20553 23366 gene locus_tag LOCUS_02160 20553 23366 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_02160 23625 25028 gene locus_tag LOCUS_02170 23625 25028 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108950.1 protein_id gnl|my_center|LOCUS_02170 25068 25763 gene locus_tag LOCUS_02180 25068 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 25783 26526 gene locus_tag LOCUS_02190 25783 26526 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_02190 26615 29230 gene locus_tag LOCUS_02200 26615 29230 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_02200 29376 29888 gene locus_tag LOCUS_02210 29376 29888 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_02210 29925 30437 gene locus_tag LOCUS_02220 29925 30437 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_02220 30550 31050 gene locus_tag LOCUS_02230 30550 31050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 31195 32037 gene locus_tag LOCUS_02240 gene murI 31195 32037 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_02240 32422 33681 gene locus_tag LOCUS_02250 gene metK 32422 33681 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_02250 33706 34746 gene locus_tag LOCUS_02260 33706 34746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 34791 35537 gene locus_tag LOCUS_02270 34791 35537 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_02270 35554 36024 gene locus_tag LOCUS_02280 gene rnpA 35554 36024 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_02280 36346 37647 gene locus_tag LOCUS_02290 gene tyrS 36346 37647 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence007 692 90 gene locus_tag LOCUS_02300 692 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1207 788 gene locus_tag LOCUS_02310 1207 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 1603 2070 gene locus_tag LOCUS_02320 gene greA 1603 2070 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_02320 2096 2494 gene locus_tag LOCUS_02330 2096 2494 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_02330 2779 3249 gene locus_tag LOCUS_02340 2779 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3252 4430 gene locus_tag LOCUS_02350 3252 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4484 5671 gene locus_tag LOCUS_02360 4484 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6315 5698 gene locus_tag LOCUS_02370 6315 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7612 6464 gene locus_tag LOCUS_02380 7612 6464 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_02380 8851 7814 gene locus_tag LOCUS_02390 8851 7814 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_02390 9944 8844 gene locus_tag LOCUS_02400 9944 8844 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_02400 10633 9956 gene locus_tag LOCUS_02410 10633 9956 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_02410 10769 11746 gene locus_tag LOCUS_02420 10769 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 11771 12970 gene locus_tag LOCUS_02430 11771 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 13060 14694 gene locus_tag LOCUS_02440 13060 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 14966 17710 gene locus_tag LOCUS_02450 14966 17710 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_02450 17898 19742 gene locus_tag LOCUS_02460 gene pulA 17898 19742 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_02460 20011 21879 gene locus_tag LOCUS_02470 20011 21879 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_02470 21923 23971 gene locus_tag LOCUS_02480 21923 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 24368 25279 gene locus_tag LOCUS_02490 24368 25279 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02490 25327 26751 gene locus_tag LOCUS_02500 gene gldK 25327 26751 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_02500 26771 27601 gene locus_tag LOCUS_02510 26771 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 27602 29146 gene locus_tag LOCUS_02520 gene gldM 27602 29146 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_02520 29174 30226 gene locus_tag LOCUS_02530 29174 30226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 30297 30899 gene locus_tag LOCUS_02540 30297 30899 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203608.1 protein_id gnl|my_center|LOCUS_02540 30975 33248 gene locus_tag LOCUS_02550 gene priA 30975 33248 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108457.1 protein_id gnl|my_center|LOCUS_02550 33366 35396 gene locus_tag LOCUS_02560 33366 35396 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_02560 36401 36565 gene locus_tag LOCUS_02570 36401 36565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence008 1665 103 gene locus_tag LOCUS_02580 1665 103 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_02580 3368 1704 gene locus_tag LOCUS_02590 3368 1704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_02590 4307 3423 gene locus_tag LOCUS_02600 4307 3423 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 protein_id gnl|my_center|LOCUS_02600 4418 5086 gene locus_tag LOCUS_02610 4418 5086 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_02610 5106 5777 gene locus_tag LOCUS_02620 5106 5777 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_02620 5896 7968 gene locus_tag LOCUS_02630 gene recG 5896 7968 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_02630 8205 9152 gene locus_tag LOCUS_02640 8205 9152 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760846.1 protein_id gnl|my_center|LOCUS_02640 9404 9595 gene locus_tag LOCUS_02650 gene rpsU 9404 9595 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_02650 10364 12115 gene locus_tag LOCUS_02660 10364 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 12273 14093 gene locus_tag LOCUS_02670 12273 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15614 14670 gene locus_tag LOCUS_02680 15614 14670 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_02680 18000 15841 gene locus_tag LOCUS_02690 gene clpA 18000 15841 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_02690 18421 18119 gene locus_tag LOCUS_02700 18421 18119 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852892.1 protein_id gnl|my_center|LOCUS_02700 19133 18471 gene locus_tag LOCUS_02710 gene aat 19133 18471 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_02710 19362 20957 gene locus_tag LOCUS_02720 19362 20957 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840466.1 protein_id gnl|my_center|LOCUS_02720 22909 20963 gene locus_tag LOCUS_02730 22909 20963 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692652.1 protein_id gnl|my_center|LOCUS_02730 24061 23114 gene locus_tag LOCUS_02740 24061 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 26379 24133 gene locus_tag LOCUS_02750 26379 24133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 28077 26473 gene locus_tag LOCUS_02760 28077 26473 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_02760 29872 28241 gene locus_tag LOCUS_02770 29872 28241 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_02770 32114 29904 gene locus_tag LOCUS_02780 32114 29904 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_02780 34624 32279 gene locus_tag LOCUS_02790 34624 32279 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence009 96 488 gene locus_tag LOCUS_02800 96 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 587 2557 gene locus_tag LOCUS_02810 587 2557 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_02810 2785 3375 gene locus_tag LOCUS_02820 gene hisH 2785 3375 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_02820 3401 4132 gene locus_tag LOCUS_02830 gene hisA 3401 4132 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_02830 4119 4880 gene locus_tag LOCUS_02840 gene hisF 4119 4880 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_02840 4904 5524 gene locus_tag LOCUS_02850 gene hisIE 4904 5524 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_02850 5534 6223 gene locus_tag LOCUS_02860 5534 6223 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_02860 6267 7592 gene locus_tag LOCUS_02870 6267 7592 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_02870 7635 8786 gene locus_tag LOCUS_02880 gene lysA 7635 8786 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_02880 8835 9941 gene locus_tag LOCUS_02890 8835 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9943 10764 gene locus_tag LOCUS_02900 9943 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10780 12777 gene locus_tag LOCUS_02910 10780 12777 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_02910 12920 13192 gene locus_tag LOCUS_02920 12920 13192 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_02920 13212 14576 gene locus_tag LOCUS_02930 13212 14576 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_02930 14598 16010 gene locus_tag LOCUS_02940 gene mnmE 14598 16010 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_02940 16306 16620 gene locus_tag LOCUS_02950 16306 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 16818 16648 gene locus_tag LOCUS_02960 16818 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 17764 16823 gene locus_tag LOCUS_02970 17764 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 19905 17689 gene locus_tag LOCUS_02980 19905 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 20539 19928 gene locus_tag LOCUS_02990 20539 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 22671 20542 gene locus_tag LOCUS_03000 22671 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 22904 22668 gene locus_tag LOCUS_03010 22904 22668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 25150 22901 gene locus_tag LOCUS_03020 25150 22901 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_03020 26301 25165 gene locus_tag LOCUS_03030 26301 25165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 29486 26259 gene locus_tag LOCUS_03040 29486 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 30288 29473 gene locus_tag LOCUS_03050 30288 29473 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016393.1 protein_id gnl|my_center|LOCUS_03050 30962 31492 gene locus_tag LOCUS_03060 30962 31492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 31802 32176 gene locus_tag LOCUS_03070 31802 32176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 32205 32684 gene locus_tag LOCUS_03080 32205 32684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 32685 32825 gene locus_tag LOCUS_03090 32685 32825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 32851 33237 gene locus_tag LOCUS_03100 32851 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence010 291 1232 gene locus_tag LOCUS_03110 291 1232 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_03110 1427 3232 gene locus_tag LOCUS_03120 1427 3232 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_03120 3779 4153 gene locus_tag LOCUS_03130 3779 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4231 4800 gene locus_tag LOCUS_03140 4231 4800 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_03140 4797 6137 gene locus_tag LOCUS_03150 4797 6137 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_03150 6112 6873 gene locus_tag LOCUS_03160 gene tpiA 6112 6873 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_03160 6992 7660 gene locus_tag LOCUS_03170 6992 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7742 8335 gene locus_tag LOCUS_03180 gene folE 7742 8335 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_03180 8442 9134 gene locus_tag LOCUS_03190 8442 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9164 9919 gene locus_tag LOCUS_03200 9164 9919 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_03200 11133 10360 gene locus_tag LOCUS_03210 gene lpxA 11133 10360 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783787.1 protein_id gnl|my_center|LOCUS_03210 12612 11272 gene locus_tag LOCUS_03220 12612 11272 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_03220 16030 12779 gene locus_tag LOCUS_03230 16030 12779 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_03230 17344 16142 gene locus_tag LOCUS_03240 17344 16142 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_03240 17862 17587 gene locus_tag LOCUS_03250 17862 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 18662 18423 gene locus_tag LOCUS_03260 18662 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 20036 18738 gene locus_tag LOCUS_03270 20036 18738 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_03270 20916 20161 gene locus_tag LOCUS_03280 20916 20161 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_03280 21113 22525 gene locus_tag LOCUS_03290 21113 22525 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765875.1 protein_id gnl|my_center|LOCUS_03290 23598 22636 gene locus_tag LOCUS_03300 23598 22636 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_03300 25125 23674 gene locus_tag LOCUS_03310 25125 23674 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_03310 26465 25122 gene locus_tag LOCUS_03320 gene trkA 26465 25122 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_03320 28450 26552 gene locus_tag LOCUS_03330 gene dxs 28450 26552 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_03330 28700 29389 gene locus_tag LOCUS_03340 28700 29389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_03340 29459 30892 gene locus_tag LOCUS_03350 29459 30892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence011 597 121 gene locus_tag LOCUS_03360 597 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_03360 750 1169 gene locus_tag LOCUS_03370 750 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 1272 2120 gene locus_tag LOCUS_03380 1272 2120 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_03380 2120 3463 gene locus_tag LOCUS_03390 gene rsxC 2120 3463 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_03390 3582 4577 gene locus_tag LOCUS_03400 3582 4577 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_03400 4574 5149 gene locus_tag LOCUS_03410 4574 5149 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_03410 5162 5743 gene locus_tag LOCUS_03420 5162 5743 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_03420 5793 6392 gene locus_tag LOCUS_03430 gene rsxA 5793 6392 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_03430 6498 7535 gene locus_tag LOCUS_03440 gene galE 6498 7535 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_03440 8613 7645 gene locus_tag LOCUS_03450 8613 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8893 12711 gene locus_tag LOCUS_03460 8893 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 12708 13982 gene locus_tag LOCUS_03470 12708 13982 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_03470 13996 15327 gene locus_tag LOCUS_03480 13996 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 15343 16404 gene locus_tag LOCUS_03490 gene hisC 15343 16404 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879516.1 protein_id gnl|my_center|LOCUS_03490 16407 17135 gene locus_tag LOCUS_03500 16407 17135 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_03500 17167 17982 gene locus_tag LOCUS_03510 17167 17982 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_03510 18012 18956 gene locus_tag LOCUS_03520 gene pyrB 18012 18956 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_03520 18993 19451 gene locus_tag LOCUS_03530 gene pyrI 18993 19451 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_03530 19497 20777 gene locus_tag LOCUS_03540 19497 20777 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_03540 21172 21243 gene locus_tag LOCUS_t00010 21172 21243 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21346 22905 gene locus_tag LOCUS_03550 21346 22905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 23404 22928 gene locus_tag LOCUS_03560 23404 22928 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203605.1 protein_id gnl|my_center|LOCUS_03560 23539 24474 gene locus_tag LOCUS_03570 23539 24474 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_03570 24573 25064 gene locus_tag LOCUS_03580 24573 25064 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_03580 25113 25790 gene locus_tag LOCUS_03590 25113 25790 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_03590 26906 26106 gene locus_tag LOCUS_03600 26906 26106 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_03600 27396 27004 gene locus_tag LOCUS_03610 27396 27004 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_03610 28627 27545 gene locus_tag LOCUS_03620 28627 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 28827 30590 gene locus_tag LOCUS_03630 gene aspS 28827 30590 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence012 506 1984 gene locus_tag LOCUS_03640 506 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 4214 2106 gene locus_tag LOCUS_03650 4214 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4479 7565 gene locus_tag LOCUS_03660 4479 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7643 10762 gene locus_tag LOCUS_03670 7643 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 10894 12768 gene locus_tag LOCUS_03680 10894 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 12986 13059 gene locus_tag LOCUS_t00020 12986 13059 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13153 13239 gene locus_tag LOCUS_t00030 13153 13239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13306 14145 gene locus_tag LOCUS_03690 gene prmC 13306 14145 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_03690 14254 14673 gene locus_tag LOCUS_03700 14254 14673 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_03700 14817 15368 gene locus_tag LOCUS_03710 14817 15368 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_03710 15903 15382 gene locus_tag LOCUS_03720 15903 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 17325 15982 gene locus_tag LOCUS_03730 gene argH 17325 15982 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_03730 17859 17407 gene locus_tag LOCUS_03740 17859 17407 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_03740 18517 17885 gene locus_tag LOCUS_03750 gene pyrE 18517 17885 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_03750 20439 18730 gene locus_tag LOCUS_03760 20439 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 20725 22554 gene locus_tag LOCUS_03770 20725 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 22580 25312 gene locus_tag LOCUS_03780 22580 25312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 25576 27165 gene locus_tag LOCUS_03790 25576 27165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_03790 27281 29002 gene locus_tag LOCUS_03800 27281 29002 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109291.1 protein_id gnl|my_center|LOCUS_03800 29106 29978 gene locus_tag LOCUS_03810 29106 29978 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_03810 30008 30175 gene locus_tag LOCUS_03820 30008 30175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence013 209 4726 gene locus_tag LOCUS_03830 209 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4795 7326 gene locus_tag LOCUS_03840 4795 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8075 7380 gene locus_tag LOCUS_03850 8075 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 10142 8139 gene locus_tag LOCUS_03860 10142 8139 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_03860 11878 10493 gene locus_tag LOCUS_03870 gene glmM 11878 10493 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_03870 12583 11942 gene locus_tag LOCUS_03880 12583 11942 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109033.1 protein_id gnl|my_center|LOCUS_03880 13737 12697 gene locus_tag LOCUS_03890 13737 12697 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_03890 13979 14743 gene locus_tag LOCUS_03900 13979 14743 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_03900 14885 17833 gene locus_tag LOCUS_03910 14885 17833 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_03910 18515 17892 gene locus_tag LOCUS_03920 18515 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 19304 18591 gene locus_tag LOCUS_03930 19304 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21364 19328 gene locus_tag LOCUS_03940 21364 19328 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_03940 21533 22714 gene locus_tag LOCUS_03950 gene purT 21533 22714 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_03950 22758 23171 gene locus_tag LOCUS_03960 22758 23171 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_03960 23159 24124 gene locus_tag LOCUS_03970 23159 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_03970 24135 25247 gene locus_tag LOCUS_03980 24135 25247 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_03980 25310 25825 gene locus_tag LOCUS_03990 25310 25825 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_03990 25972 26568 gene locus_tag LOCUS_04000 25972 26568 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_04000 26775 27158 gene locus_tag LOCUS_04010 26775 27158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 27419 28105 gene locus_tag LOCUS_04020 27419 28105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 >Feature sequence014 3554 1356 gene locus_tag LOCUS_04030 gene rnr 3554 1356 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_04030 4030 3659 gene locus_tag LOCUS_04040 4030 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 4325 5326 gene locus_tag LOCUS_04050 4325 5326 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_04050 5356 6327 gene locus_tag LOCUS_04060 5356 6327 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761715.1 protein_id gnl|my_center|LOCUS_04060 6422 6496 gene locus_tag LOCUS_t00040 6422 6496 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6546 6620 gene locus_tag LOCUS_t00050 6546 6620 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7725 6730 gene locus_tag LOCUS_04070 7725 6730 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_04070 8659 7814 gene locus_tag LOCUS_04080 8659 7814 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_04080 8820 9764 gene locus_tag LOCUS_04090 gene rsmH 8820 9764 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_04090 9770 10246 gene locus_tag LOCUS_04100 9770 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 10243 12402 gene locus_tag LOCUS_04110 10243 12402 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_04110 12461 13912 gene locus_tag LOCUS_04120 12461 13912 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_04120 14149 15417 gene locus_tag LOCUS_04130 gene mraY 14149 15417 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_04130 15464 16795 gene locus_tag LOCUS_04140 gene murD 15464 16795 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_04140 16805 18088 gene locus_tag LOCUS_04150 16805 18088 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_04150 18154 19293 gene locus_tag LOCUS_04160 gene murG 18154 19293 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_04160 19304 20686 gene locus_tag LOCUS_04170 gene murC 19304 20686 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_04170 20805 21779 gene locus_tag LOCUS_04180 20805 21779 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_04180 21808 23259 gene locus_tag LOCUS_04190 gene ftsA 21808 23259 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_04190 23274 24614 gene locus_tag LOCUS_04200 gene ftsZ 23274 24614 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_04200 25399 24674 gene locus_tag LOCUS_04210 gene recO 25399 24674 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_04210 25531 25603 gene locus_tag LOCUS_t00060 25531 25603 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25633 25887 gene locus_tag LOCUS_04220 gene rpsT 25633 25887 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_04220 26209 26138 gene locus_tag LOCUS_t00070 26209 26138 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27844 26285 gene locus_tag LOCUS_04230 27844 26285 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence015 48 1160 gene locus_tag LOCUS_04240 48 1160 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_04240 1435 2724 gene locus_tag LOCUS_04250 1435 2724 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_04250 2832 3449 gene locus_tag LOCUS_04260 2832 3449 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_04260 3446 3955 gene locus_tag LOCUS_04270 3446 3955 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_04270 5318 4068 gene locus_tag LOCUS_04280 gene zinU 5318 4068 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_04280 6773 6081 gene locus_tag LOCUS_04290 gene cmk 6773 6081 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_04290 7756 6809 gene locus_tag LOCUS_04300 gene porQ 7756 6809 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_04300 9432 7762 gene locus_tag LOCUS_04310 gene sulP 9432 7762 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_04310 10335 9550 gene locus_tag LOCUS_04320 10335 9550 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_04320 11033 10332 gene locus_tag LOCUS_04330 11033 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_04330 12039 11065 gene locus_tag LOCUS_04340 12039 11065 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_04340 12779 12057 gene locus_tag LOCUS_04350 12779 12057 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_04350 13748 12837 gene locus_tag LOCUS_04360 13748 12837 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_04360 14512 13736 gene locus_tag LOCUS_04370 14512 13736 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_04370 14736 15830 gene locus_tag LOCUS_04380 14736 15830 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_04380 15864 16664 gene locus_tag LOCUS_04390 15864 16664 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_04390 16731 17615 gene locus_tag LOCUS_04400 16731 17615 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_04400 18373 17720 gene locus_tag LOCUS_04410 18373 17720 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_04410 18537 20891 gene locus_tag LOCUS_04420 18537 20891 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_04420 22313 20997 gene locus_tag LOCUS_04430 gene xylA 22313 20997 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_04430 23862 22372 gene locus_tag LOCUS_04440 23862 22372 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_04440 25303 24077 gene locus_tag LOCUS_04450 25303 24077 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_04450 26726 25326 gene locus_tag LOCUS_04460 26726 25326 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015939.1 protein_id gnl|my_center|LOCUS_04460 26948 27796 gene locus_tag LOCUS_04470 26948 27796 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence016 658 152 gene locus_tag LOCUS_04480 658 152 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_04480 971 2191 gene locus_tag LOCUS_04490 971 2191 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_04490 2219 2761 gene locus_tag LOCUS_04500 2219 2761 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_04500 2764 4302 gene locus_tag LOCUS_04510 2764 4302 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_04510 4550 5881 gene locus_tag LOCUS_04520 gene miaB 4550 5881 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_04520 5930 7756 gene locus_tag LOCUS_04530 5930 7756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_04530 7778 8662 gene locus_tag LOCUS_04540 7778 8662 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_04540 8659 9789 gene locus_tag LOCUS_04550 8659 9789 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_04550 10469 9774 gene locus_tag LOCUS_04560 10469 9774 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 protein_id gnl|my_center|LOCUS_04560 12323 10470 gene locus_tag LOCUS_04570 12323 10470 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_04570 12806 12324 gene locus_tag LOCUS_04580 gene purE 12806 12324 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_04580 13615 12998 gene locus_tag LOCUS_04590 13615 12998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_04590 15241 13682 gene locus_tag LOCUS_04600 gene rpoN 15241 13682 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_04600 15938 15294 gene locus_tag LOCUS_04610 15938 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 17586 16339 gene locus_tag LOCUS_04620 17586 16339 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_04620 18280 17657 gene locus_tag LOCUS_04630 18280 17657 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_04630 19247 18402 gene locus_tag LOCUS_04640 19247 18402 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_04640 20509 19235 gene locus_tag LOCUS_04650 20509 19235 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_04650 23707 21065 gene locus_tag LOCUS_04660 gene mutS 23707 21065 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_04660 23865 24029 gene locus_tag LOCUS_04670 23865 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 23977 24870 gene locus_tag LOCUS_04680 23977 24870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 25229 26566 gene locus_tag LOCUS_04690 25229 26566 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence017 <1 3629 gene locus_tag LOCUS_04700 <1 3629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108531.1:hybrid sensor histidine kinase/response regulator transcription factor 3813 5570 gene locus_tag LOCUS_04710 3813 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5815 8916 gene locus_tag LOCUS_04720 5815 8916 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_04720 8920 10638 gene locus_tag LOCUS_04730 8920 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 10658 11746 gene locus_tag LOCUS_04740 10658 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 11871 13811 gene locus_tag LOCUS_04750 11871 13811 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108524.1 protein_id gnl|my_center|LOCUS_04750 14008 16437 gene locus_tag LOCUS_04760 14008 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 16491 18746 gene locus_tag LOCUS_04770 16491 18746 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_04770 18856 21420 gene locus_tag LOCUS_04780 18856 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 21520 23520 gene locus_tag LOCUS_04790 21520 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 24452 24096 gene locus_tag LOCUS_04800 24452 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 25714 24506 gene locus_tag LOCUS_04810 25714 24506 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_04810 25946 25788 gene locus_tag LOCUS_04820 25946 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence018 360 1217 gene locus_tag LOCUS_04830 360 1217 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763532.1 protein_id gnl|my_center|LOCUS_04830 1219 1833 gene locus_tag LOCUS_04840 1219 1833 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_04840 2391 1882 gene locus_tag LOCUS_04850 2391 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2980 4959 gene locus_tag LOCUS_04860 2980 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5119 5045 gene locus_tag LOCUS_t00080 5119 5045 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5494 7443 gene locus_tag LOCUS_04870 5494 7443 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_04870 7550 8101 gene locus_tag LOCUS_04880 7550 8101 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_04880 10123 8210 gene locus_tag LOCUS_04890 10123 8210 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_04890 12644 10449 gene locus_tag LOCUS_04900 12644 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 13065 13715 gene locus_tag LOCUS_04910 13065 13715 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850333.1 protein_id gnl|my_center|LOCUS_04910 16588 13826 gene locus_tag LOCUS_04920 gene polA 16588 13826 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_04920 16679 17656 gene locus_tag LOCUS_04930 16679 17656 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_04930 18756 17812 gene locus_tag LOCUS_04940 gene deoC 18756 17812 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_04940 19138 18809 gene locus_tag LOCUS_04950 19138 18809 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_04950 19460 19155 gene locus_tag LOCUS_04960 19460 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19916 19464 gene locus_tag LOCUS_04970 gene dtd 19916 19464 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_04970 22400 20361 gene locus_tag LOCUS_04980 gene uvrC 22400 20361 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_04980 23047 22517 gene locus_tag LOCUS_04990 23047 22517 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_04990 24969 23098 gene locus_tag LOCUS_05000 gene mnmG 24969 23098 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_05000 25393 25983 gene locus_tag LOCUS_05010 25393 25983 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence019 745 11 gene locus_tag LOCUS_05020 745 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3308 1242 gene locus_tag LOCUS_05030 gene metG 3308 1242 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_05030 3588 3824 gene locus_tag LOCUS_05040 3588 3824 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_05040 3953 5215 gene locus_tag LOCUS_05050 gene fabF 3953 5215 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_05050 5229 6326 gene locus_tag LOCUS_05060 gene rnc 5229 6326 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_05060 6548 7654 gene locus_tag LOCUS_05070 6548 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7738 8883 gene locus_tag LOCUS_05080 7738 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9245 12103 gene locus_tag LOCUS_05090 gene leuS 9245 12103 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_05090 12212 13192 gene locus_tag LOCUS_05100 12212 13192 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_05100 13158 13736 gene locus_tag LOCUS_05110 13158 13736 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_05110 16075 13790 gene locus_tag LOCUS_05120 16075 13790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_05120 17131 16451 gene locus_tag LOCUS_05130 17131 16451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_05130 18386 17139 gene locus_tag LOCUS_05140 18386 17139 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_05140 21326 18417 gene locus_tag LOCUS_05150 21326 18417 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_05150 22660 21311 gene locus_tag LOCUS_05160 22660 21311 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_05160 24234 23185 gene locus_tag LOCUS_05170 24234 23185 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_05170 24860 24258 gene locus_tag LOCUS_05180 24860 24258 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence020 1719 175 gene locus_tag LOCUS_05190 1719 175 CDS product DUF4975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841481.1 protein_id gnl|my_center|LOCUS_05190 3186 1780 gene locus_tag LOCUS_05200 3186 1780 CDS product DUF4960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763287.1 protein_id gnl|my_center|LOCUS_05200 4946 3201 gene locus_tag LOCUS_05210 4946 3201 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_05210 8138 5055 gene locus_tag LOCUS_05220 8138 5055 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_05220 10557 8377 gene locus_tag LOCUS_05230 10557 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10682 11782 gene locus_tag LOCUS_05240 10682 11782 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_05240 11820 12293 gene locus_tag LOCUS_05250 11820 12293 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_05250 12352 14400 gene locus_tag LOCUS_05260 12352 14400 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_05260 14711 15973 gene locus_tag LOCUS_05270 14711 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 17311 18216 gene locus_tag LOCUS_05280 17311 18216 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_05280 18220 19224 gene locus_tag LOCUS_05290 18220 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 19248 20246 gene locus_tag LOCUS_05300 19248 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 21125 20229 gene locus_tag LOCUS_05310 21125 20229 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_05310 22255 21128 gene locus_tag LOCUS_05320 22255 21128 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203058.1 protein_id gnl|my_center|LOCUS_05320 23594 22278 gene locus_tag LOCUS_05330 23594 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 25007 23601 gene locus_tag LOCUS_05340 25007 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence021 187 549 gene locus_tag LOCUS_05350 187 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963519.1 protein_id gnl|my_center|LOCUS_05350 560 1528 gene locus_tag LOCUS_05360 560 1528 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362003.1 protein_id gnl|my_center|LOCUS_05360 1742 1669 gene locus_tag LOCUS_t00090 1742 1669 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1849 1774 gene locus_tag LOCUS_t00100 1849 1774 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3586 1955 gene locus_tag LOCUS_05370 3586 1955 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_05370 4623 3697 gene locus_tag LOCUS_05380 4623 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4877 5749 gene locus_tag LOCUS_05390 gene prmA 4877 5749 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_05390 5761 6375 gene locus_tag LOCUS_05400 5761 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 7225 6383 gene locus_tag LOCUS_05410 7225 6383 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_05410 8983 7334 gene locus_tag LOCUS_05420 8983 7334 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_05420 9027 9036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9206 9475 gene locus_tag LOCUS_05430 9206 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 9527 10087 gene locus_tag LOCUS_05440 9527 10087 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_05440 10145 13009 gene locus_tag LOCUS_05450 10145 13009 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_05450 13028 13351 gene locus_tag LOCUS_05460 13028 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760554.1 protein_id gnl|my_center|LOCUS_05460 13474 15543 gene locus_tag LOCUS_05470 13474 15543 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107187.1 protein_id gnl|my_center|LOCUS_05470 16947 15865 gene locus_tag LOCUS_05480 gene aroC 16947 15865 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_05480 17628 16996 gene locus_tag LOCUS_05490 17628 16996 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_05490 18046 18552 gene locus_tag LOCUS_05500 18046 18552 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_05500 18566 19045 gene locus_tag LOCUS_05510 gene smpB 18566 19045 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_05510 19099 21864 gene locus_tag LOCUS_05520 gene metH 19099 21864 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_05520 21880 22743 gene locus_tag LOCUS_05530 gene map 21880 22743 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_05530 22757 23770 gene locus_tag LOCUS_05540 gene tsaD 22757 23770 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_05540 23874 24413 gene locus_tag LOCUS_05550 23874 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 24619 24882 gene locus_tag LOCUS_05560 gene rpmB 24619 24882 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_05560 24887 25078 gene locus_tag LOCUS_05570 gene rpmG 24887 25078 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence022 1550 213 gene locus_tag LOCUS_05580 1550 213 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_05580 1694 2131 gene locus_tag LOCUS_05590 gene dut 1694 2131 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_05590 2135 3931 gene locus_tag LOCUS_05600 2135 3931 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_05600 3928 4803 gene locus_tag LOCUS_05610 3928 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4878 5186 gene locus_tag LOCUS_05620 4878 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 5134 6615 gene locus_tag LOCUS_05630 5134 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6778 7245 gene locus_tag LOCUS_05640 gene rimP 6778 7245 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767604.1 protein_id gnl|my_center|LOCUS_05640 7249 8511 gene locus_tag LOCUS_05650 gene nusA 7249 8511 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763665.1 protein_id gnl|my_center|LOCUS_05650 8777 11602 gene locus_tag LOCUS_05660 gene infB 8777 11602 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_05660 11884 12582 gene locus_tag LOCUS_05670 11884 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 12735 14708 gene locus_tag LOCUS_05680 gene gyrB 12735 14708 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_05680 15148 16209 gene locus_tag LOCUS_05690 15148 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 16427 18766 gene locus_tag LOCUS_05700 gene topA 16427 18766 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_05700 18786 19310 gene locus_tag LOCUS_05710 18786 19310 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_05710 19341 21233 gene locus_tag LOCUS_05720 gene speA 19341 21233 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_05720 21366 22136 gene locus_tag LOCUS_05730 gene argB 21366 22136 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_05730 22240 22803 gene locus_tag LOCUS_05740 22240 22803 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_05740 22793 23296 gene locus_tag LOCUS_05750 22793 23296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108812.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence023 2056 1139 gene locus_tag LOCUS_05760 2056 1139 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_05760 3545 2148 gene locus_tag LOCUS_05770 3545 2148 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_05770 4533 3652 gene locus_tag LOCUS_05780 4533 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_05780 5430 4681 gene locus_tag LOCUS_05790 5430 4681 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_05790 5566 5575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5844 6941 gene locus_tag LOCUS_05800 gene gmd 5844 6941 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_05800 7014 8222 gene locus_tag LOCUS_05810 7014 8222 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_05810 9663 8329 gene locus_tag LOCUS_05820 9663 8329 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790434.1 protein_id gnl|my_center|LOCUS_05820 11050 9704 gene locus_tag LOCUS_05830 11050 9704 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_05830 12662 11226 gene locus_tag LOCUS_05840 12662 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 13868 12834 gene locus_tag LOCUS_05850 13868 12834 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763044.1 protein_id gnl|my_center|LOCUS_05850 15135 13903 gene locus_tag LOCUS_05860 15135 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 15360 16193 gene locus_tag LOCUS_05870 15360 16193 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_05870 17467 16211 gene locus_tag LOCUS_05880 17467 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 19242 17578 gene locus_tag LOCUS_05890 19242 17578 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_05890 20111 19302 gene locus_tag LOCUS_05900 20111 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22120 20255 gene locus_tag LOCUS_05910 gene glmS 22120 20255 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence024 1790 477 gene locus_tag LOCUS_05920 1790 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2266 1787 gene locus_tag LOCUS_05930 2266 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2937 3257 gene locus_tag LOCUS_05940 2937 3257 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_05940 3311 6073 gene locus_tag LOCUS_05950 3311 6073 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_05950 7334 6171 gene locus_tag LOCUS_05960 7334 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8916 7486 gene locus_tag LOCUS_05970 gene cls 8916 7486 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_05970 9532 8969 gene locus_tag LOCUS_05980 9532 8969 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817247.1 protein_id gnl|my_center|LOCUS_05980 9869 9537 gene locus_tag LOCUS_05990 gene queD 9869 9537 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_05990 11872 9890 gene locus_tag LOCUS_06000 11872 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 12939 11869 gene locus_tag LOCUS_06010 12939 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 13666 12950 gene locus_tag LOCUS_06020 13666 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 13869 13795 gene locus_tag LOCUS_t00110 13869 13795 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14181 15755 gene locus_tag LOCUS_06030 14181 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15920 16459 gene locus_tag LOCUS_06040 15920 16459 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_06040 16473 17459 gene locus_tag LOCUS_06050 16473 17459 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_06050 17472 17978 gene locus_tag LOCUS_06060 17472 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 17992 18648 gene locus_tag LOCUS_06070 17992 18648 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_06070 18709 19722 gene locus_tag LOCUS_06080 18709 19722 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_06080 19725 20381 gene locus_tag LOCUS_06090 19725 20381 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_06090 21843 20464 gene locus_tag LOCUS_06100 21843 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence025 250 119 gene locus_tag LOCUS_06110 250 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2116 332 gene locus_tag LOCUS_06120 2116 332 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_06120 2287 3048 gene locus_tag LOCUS_06130 2287 3048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_06130 3592 3077 gene locus_tag LOCUS_06140 3592 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5229 3655 gene locus_tag LOCUS_06150 5229 3655 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_06150 5444 6505 gene locus_tag LOCUS_06160 5444 6505 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_06160 6562 6644 gene locus_tag LOCUS_t00120 6562 6644 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6913 7272 gene locus_tag LOCUS_06170 6913 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7277 8410 gene locus_tag LOCUS_06180 7277 8410 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_06180 8436 9395 gene locus_tag LOCUS_06190 8436 9395 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_06190 9470 10384 gene locus_tag LOCUS_06200 gene glsB 9470 10384 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017793.1 protein_id gnl|my_center|LOCUS_06200 10664 12868 gene locus_tag LOCUS_06210 10664 12868 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_06210 12940 14646 gene locus_tag LOCUS_06220 12940 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 14675 16684 gene locus_tag LOCUS_06230 14675 16684 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_06230 16724 18202 gene locus_tag LOCUS_06240 gene hutH 16724 18202 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_06240 18207 19442 gene locus_tag LOCUS_06250 gene hutI 18207 19442 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_06250 20770 19499 gene locus_tag LOCUS_06260 20770 19499 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence026 448 230 gene locus_tag LOCUS_06270 448 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1864 509 gene locus_tag LOCUS_06280 gene xseA 1864 509 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_06280 2694 1951 gene locus_tag LOCUS_06290 2694 1951 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_06290 3630 2740 gene locus_tag LOCUS_06300 3630 2740 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_06300 4432 6138 gene locus_tag LOCUS_06310 4432 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6143 6775 gene locus_tag LOCUS_06320 6143 6775 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 protein_id gnl|my_center|LOCUS_06320 6943 7155 gene locus_tag LOCUS_06330 6943 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7181 9931 gene locus_tag LOCUS_06340 7181 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10249 10521 gene locus_tag LOCUS_06350 10249 10521 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789740.1 protein_id gnl|my_center|LOCUS_06350 10558 12189 gene locus_tag LOCUS_06360 gene groL 10558 12189 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_06360 12933 12358 gene locus_tag LOCUS_06370 12933 12358 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_06370 13737 13201 gene locus_tag LOCUS_06380 13737 13201 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_06380 17572 13847 gene locus_tag LOCUS_06390 gene purL 17572 13847 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_06390 19170 17710 gene locus_tag LOCUS_06400 19170 17710 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_06400 20326 19331 gene locus_tag LOCUS_06410 20326 19331 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760937.1 protein_id gnl|my_center|LOCUS_06410 21159 20332 gene locus_tag LOCUS_06420 21159 20332 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence027 1304 111 gene locus_tag LOCUS_06430 1304 111 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_06430 1915 1319 gene locus_tag LOCUS_06440 1915 1319 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_06440 2459 1980 gene locus_tag LOCUS_06450 2459 1980 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_06450 3384 2665 gene locus_tag LOCUS_06460 3384 2665 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_06460 3711 5165 gene locus_tag LOCUS_06470 gene sufB 3711 5165 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_06470 5250 6110 gene locus_tag LOCUS_06480 5250 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 6128 6892 gene locus_tag LOCUS_06490 gene sufC 6128 6892 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_06490 6894 8237 gene locus_tag LOCUS_06500 gene sufD 6894 8237 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_06500 8357 9571 gene locus_tag LOCUS_06510 8357 9571 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_06510 9737 10366 gene locus_tag LOCUS_06520 9737 10366 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_06520 10391 11302 gene locus_tag LOCUS_06530 10391 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 11319 12302 gene locus_tag LOCUS_06540 11319 12302 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108791.1 protein_id gnl|my_center|LOCUS_06540 16811 12483 gene locus_tag LOCUS_06550 gene rpoC 16811 12483 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_06550 20574 16840 gene locus_tag LOCUS_06560 gene rpoB 20574 16840 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_06560 20958 20833 gene locus_tag LOCUS_06570 20958 20833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence028 194 1336 gene locus_tag LOCUS_06580 194 1336 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_06580 1509 2579 gene locus_tag LOCUS_06590 1509 2579 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_06590 2596 5850 gene locus_tag LOCUS_06600 2596 5850 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_06600 5996 7147 gene locus_tag LOCUS_06610 5996 7147 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_06610 7600 8784 gene locus_tag LOCUS_06620 7600 8784 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_06620 9004 10755 gene locus_tag LOCUS_06630 9004 10755 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_06630 10835 11512 gene locus_tag LOCUS_06640 10835 11512 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_06640 11689 12396 gene locus_tag LOCUS_06650 11689 12396 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_06650 12440 13981 gene locus_tag LOCUS_06660 gene araA 12440 13981 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_06660 14141 15736 gene locus_tag LOCUS_06670 14141 15736 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_06670 15744 17756 gene locus_tag LOCUS_06680 15744 17756 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_06680 17813 19789 gene locus_tag LOCUS_06690 17813 19789 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence029 461 1591 gene locus_tag LOCUS_06700 461 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2311 1706 gene locus_tag LOCUS_06710 2311 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2603 2298 gene locus_tag LOCUS_06720 2603 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4794 2911 gene locus_tag LOCUS_06730 4794 2911 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_06730 4967 5680 gene locus_tag LOCUS_06740 4967 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5698 6222 gene locus_tag LOCUS_06750 5698 6222 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_06750 8419 6602 gene locus_tag LOCUS_06760 gene argS 8419 6602 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_06760 8906 10072 gene locus_tag LOCUS_06770 8906 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10534 10076 gene locus_tag LOCUS_06780 10534 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 12248 10587 gene locus_tag LOCUS_06790 12248 10587 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_06790 12452 16021 gene locus_tag LOCUS_06800 12452 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17321 16131 gene locus_tag LOCUS_06810 17321 16131 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_06810 17791 18978 gene locus_tag LOCUS_06820 17791 18978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_06820 20680 19130 gene locus_tag LOCUS_06830 20680 19130 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence030 102 1484 gene locus_tag LOCUS_06840 102 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1590 2165 gene locus_tag LOCUS_06850 1590 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3526 2516 gene locus_tag LOCUS_06860 3526 2516 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_06860 4011 3586 gene locus_tag LOCUS_06870 4011 3586 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_06870 5269 4016 gene locus_tag LOCUS_06880 5269 4016 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_06880 5378 5839 gene locus_tag LOCUS_06890 gene ndk 5378 5839 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_06890 5873 6337 gene locus_tag LOCUS_06900 5873 6337 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_06900 6347 6958 gene locus_tag LOCUS_06910 6347 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7052 8278 gene locus_tag LOCUS_06920 7052 8278 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_06920 8315 9340 gene locus_tag LOCUS_06930 gene recA 8315 9340 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_06930 10768 9446 gene locus_tag LOCUS_06940 10768 9446 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_06940 11057 11509 gene locus_tag LOCUS_06950 gene coaD 11057 11509 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783477.1 protein_id gnl|my_center|LOCUS_06950 11543 11968 gene locus_tag LOCUS_06960 gene ybeY 11543 11968 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_06960 12548 12036 gene locus_tag LOCUS_06970 12548 12036 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_06970 12782 14947 gene locus_tag LOCUS_06980 12782 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 15300 16655 gene locus_tag LOCUS_06990 15300 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 16932 18185 gene locus_tag LOCUS_07000 16932 18185 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence031 82 2124 gene locus_tag LOCUS_07010 82 2124 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_07010 3682 2249 gene locus_tag LOCUS_07020 3682 2249 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_07020 3828 4550 gene locus_tag LOCUS_07030 3828 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4656 5198 gene locus_tag LOCUS_07040 4656 5198 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_07040 5241 5720 gene locus_tag LOCUS_07050 5241 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 8097 5995 gene locus_tag LOCUS_07060 8097 5995 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_07060 8361 9293 gene locus_tag LOCUS_07070 8361 9293 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_07070 9430 13386 gene locus_tag LOCUS_07080 9430 13386 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097677775.1 protein_id gnl|my_center|LOCUS_07080 14050 15510 gene locus_tag LOCUS_07090 14050 15510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 15543 18560 gene locus_tag LOCUS_07100 15543 18560 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_07100 18577 20226 gene locus_tag LOCUS_07110 18577 20226 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence032 2520 16 gene locus_tag LOCUS_07120 2520 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6024 2638 gene locus_tag LOCUS_07130 6024 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8149 6299 gene locus_tag LOCUS_07140 8149 6299 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767705.1 protein_id gnl|my_center|LOCUS_07140 10264 8207 gene locus_tag LOCUS_07150 10264 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 11276 10335 gene locus_tag LOCUS_07160 11276 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_07160 11458 11775 gene locus_tag LOCUS_07170 11458 11775 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_07170 12220 12029 gene locus_tag LOCUS_07180 12220 12029 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_07180 13204 12227 gene locus_tag LOCUS_07190 13204 12227 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_07190 13505 14416 gene locus_tag LOCUS_07200 13505 14416 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108586.1 protein_id gnl|my_center|LOCUS_07200 14450 17236 gene locus_tag LOCUS_07210 14450 17236 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_07210 17252 18634 gene locus_tag LOCUS_07220 17252 18634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 <20181 18728 gene locus_tag LOCUS_07230 <20181 18728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389785.1:DUF1846 domain-containing protein >Feature sequence033 73 1029 gene locus_tag LOCUS_07240 73 1029 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_07240 2087 1206 gene locus_tag LOCUS_07250 2087 1206 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_07250 3356 2166 gene locus_tag LOCUS_07260 3356 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4374 3430 gene locus_tag LOCUS_07270 4374 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5443 4451 gene locus_tag LOCUS_07280 5443 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 6917 5436 gene locus_tag LOCUS_07290 6917 5436 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061735.1 protein_id gnl|my_center|LOCUS_07290 7104 8120 gene locus_tag LOCUS_07300 7104 8120 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202930.1 protein_id gnl|my_center|LOCUS_07300 9192 8161 gene locus_tag LOCUS_07310 9192 8161 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 protein_id gnl|my_center|LOCUS_07310 10030 9398 gene locus_tag LOCUS_07320 10030 9398 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_07320 10132 11061 gene locus_tag LOCUS_07330 10132 11061 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_07330 13800 11431 gene locus_tag LOCUS_07340 13800 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 14057 13797 gene locus_tag LOCUS_07350 14057 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 14724 14086 gene locus_tag LOCUS_07360 14724 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16942 14870 gene locus_tag LOCUS_07370 gene uvrB 16942 14870 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_07370 17137 17961 gene locus_tag LOCUS_07380 gene bamD 17137 17961 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_07380 18042 18389 gene locus_tag LOCUS_07390 18042 18389 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_07390 18489 18845 gene locus_tag LOCUS_07400 18489 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 19457 19849 gene locus_tag LOCUS_07410 19457 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20056 20129 gene locus_tag LOCUS_t00130 20056 20129 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 1445 162 gene locus_tag LOCUS_07420 1445 162 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_07420 1631 2443 gene locus_tag LOCUS_07430 1631 2443 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_07430 5134 2519 gene locus_tag LOCUS_07440 5134 2519 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_07440 5809 5135 gene locus_tag LOCUS_07450 5809 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6375 5842 gene locus_tag LOCUS_07460 6375 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8288 6525 gene locus_tag LOCUS_07470 8288 6525 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_07470 9030 8311 gene locus_tag LOCUS_07480 9030 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 11525 9081 gene locus_tag LOCUS_07490 11525 9081 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07490 14146 11561 gene locus_tag LOCUS_07500 14146 11561 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_07500 15512 14232 gene locus_tag LOCUS_07510 15512 14232 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_07510 16367 18331 gene locus_tag LOCUS_07520 16367 18331 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_07520 18405 19661 gene locus_tag LOCUS_07530 18405 19661 CDS product DUF4995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766874.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence035 45 1181 gene locus_tag LOCUS_07540 45 1181 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_07540 1181 2878 gene locus_tag LOCUS_07550 1181 2878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765358.1 protein_id gnl|my_center|LOCUS_07550 2990 3856 gene locus_tag LOCUS_07560 2990 3856 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765359.1 protein_id gnl|my_center|LOCUS_07560 3942 4106 gene locus_tag LOCUS_07570 3942 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5846 4137 gene locus_tag LOCUS_07580 5846 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7524 6115 gene locus_tag LOCUS_07590 7524 6115 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_07590 10815 7582 gene locus_tag LOCUS_07600 10815 7582 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_07600 13449 10879 gene locus_tag LOCUS_07610 13449 10879 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107854.1 protein_id gnl|my_center|LOCUS_07610 14620 13613 gene locus_tag LOCUS_07620 14620 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201889.1 protein_id gnl|my_center|LOCUS_07620 15030 16184 gene locus_tag LOCUS_07630 15030 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16688 16452 gene locus_tag LOCUS_07640 16688 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 19242 16729 gene locus_tag LOCUS_07650 gene hrpB 19242 16729 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence036 1601 153 gene locus_tag LOCUS_07660 1601 153 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_07660 1816 2010 gene locus_tag LOCUS_07670 1816 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2069 2692 gene locus_tag LOCUS_07680 2069 2692 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_07680 3892 2987 gene locus_tag LOCUS_07690 3892 2987 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_07690 4206 4859 gene locus_tag LOCUS_07700 gene nth 4206 4859 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_07700 4859 6460 gene locus_tag LOCUS_07710 4859 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10895 6837 gene locus_tag LOCUS_07720 10895 6837 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 protein_id gnl|my_center|LOCUS_07720 11753 11016 gene locus_tag LOCUS_07730 11753 11016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_07730 14606 11772 gene locus_tag LOCUS_07740 gene uvrA 14606 11772 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_07740 15415 14672 gene locus_tag LOCUS_07750 15415 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 15529 16893 gene locus_tag LOCUS_07760 15529 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 16919 17701 gene locus_tag LOCUS_07770 16919 17701 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_07770 17742 19268 gene locus_tag LOCUS_07780 17742 19268 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence037 324 743 gene locus_tag LOCUS_07790 324 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2145 847 gene locus_tag LOCUS_07800 2145 847 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_07800 5424 2263 gene locus_tag LOCUS_07810 5424 2263 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_07810 5654 6904 gene locus_tag LOCUS_07820 5654 6904 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_07820 7924 6914 gene locus_tag LOCUS_07830 7924 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9693 8065 gene locus_tag LOCUS_07840 9693 8065 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_07840 11184 9895 gene locus_tag LOCUS_07850 11184 9895 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 protein_id gnl|my_center|LOCUS_07850 11372 12298 gene locus_tag LOCUS_07860 11372 12298 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763574.1 protein_id gnl|my_center|LOCUS_07860 12320 13381 gene locus_tag LOCUS_07870 gene buk 12320 13381 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765189.1 protein_id gnl|my_center|LOCUS_07870 13888 13715 gene locus_tag LOCUS_07880 13888 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 16584 13942 gene locus_tag LOCUS_07890 16584 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 19090 16793 gene locus_tag LOCUS_07900 19090 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence038 287 1516 gene locus_tag LOCUS_07910 287 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2465 1554 gene locus_tag LOCUS_07920 2465 1554 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_07920 4500 2446 gene locus_tag LOCUS_07930 4500 2446 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107315.1 protein_id gnl|my_center|LOCUS_07930 5369 4518 gene locus_tag LOCUS_07940 5369 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6405 6941 gene locus_tag LOCUS_07950 6405 6941 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202750.1 protein_id gnl|my_center|LOCUS_07950 6931 8283 gene locus_tag LOCUS_07960 6931 8283 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_07960 8315 10087 gene locus_tag LOCUS_07970 8315 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10267 11199 gene locus_tag LOCUS_07980 10267 11199 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764430.1 protein_id gnl|my_center|LOCUS_07980 11317 12306 gene locus_tag LOCUS_07990 11317 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12590 14026 gene locus_tag LOCUS_08000 12590 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence039 1756 641 gene locus_tag LOCUS_08010 1756 641 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_08010 3043 1805 gene locus_tag LOCUS_08020 3043 1805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_08020 4390 3128 gene locus_tag LOCUS_08030 4390 3128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_08030 5145 4426 gene locus_tag LOCUS_08040 5145 4426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_08040 6194 5250 gene locus_tag LOCUS_08050 6194 5250 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_08050 7633 6239 gene locus_tag LOCUS_08060 gene rseP 7633 6239 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_08060 8824 7670 gene locus_tag LOCUS_08070 8824 7670 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_08070 9360 8839 gene locus_tag LOCUS_08080 gene rimM 9360 8839 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657443.1 protein_id gnl|my_center|LOCUS_08080 10802 9498 gene locus_tag LOCUS_08090 gene murA 10802 9498 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_08090 11438 10833 gene locus_tag LOCUS_08100 11438 10833 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_08100 12169 11480 gene locus_tag LOCUS_08110 gene tsaB 12169 11480 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_08110 12450 13313 gene locus_tag LOCUS_08120 12450 13313 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_08120 13573 14070 gene locus_tag LOCUS_08130 gene gmk 13573 14070 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_08130 14067 14636 gene locus_tag LOCUS_08140 gene nadD 14067 14636 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_08140 15329 14760 gene locus_tag LOCUS_08150 15329 14760 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_08150 17804 15537 gene locus_tag LOCUS_08160 17804 15537 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 protein_id gnl|my_center|LOCUS_08160 18034 18888 gene locus_tag LOCUS_08170 18034 18888 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence040 1628 78 gene locus_tag LOCUS_08180 1628 78 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_08180 2567 1662 gene locus_tag LOCUS_08190 2567 1662 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791938.1 protein_id gnl|my_center|LOCUS_08190 2777 2691 gene locus_tag LOCUS_t00140 2777 2691 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2870 2795 gene locus_tag LOCUS_t00150 2870 2795 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3417 2989 gene locus_tag LOCUS_08200 3417 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3759 5348 gene locus_tag LOCUS_08210 gene nadB 3759 5348 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_08210 5515 5754 gene locus_tag LOCUS_08220 5515 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5771 6178 gene locus_tag LOCUS_08230 5771 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 13871 6303 gene locus_tag LOCUS_08240 gene sprA 13871 6303 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_08240 14678 14064 gene locus_tag LOCUS_08250 gene ruvA 14678 14064 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_08250 16757 14766 gene locus_tag LOCUS_08260 16757 14766 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_08260 17558 16767 gene locus_tag LOCUS_08270 17558 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 18770 17766 gene locus_tag LOCUS_08280 18770 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence041 <1 564 gene locus_tag LOCUS_08290 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005894834.1:glutathione peroxidase 598 1539 gene locus_tag LOCUS_08300 gene trxB 598 1539 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_08300 2675 1665 gene locus_tag LOCUS_08310 2675 1665 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_08310 2933 3877 gene locus_tag LOCUS_08320 2933 3877 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_08320 4604 3909 gene locus_tag LOCUS_08330 4604 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5469 4714 gene locus_tag LOCUS_08340 5469 4714 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_08340 5576 6787 gene locus_tag LOCUS_08350 5576 6787 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797457.1 protein_id gnl|my_center|LOCUS_08350 6938 7879 gene locus_tag LOCUS_08360 6938 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8428 7934 gene locus_tag LOCUS_08370 8428 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9906 8569 gene locus_tag LOCUS_08380 gene gdhA 9906 8569 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_08380 10622 11083 gene locus_tag LOCUS_08390 gene rplM 10622 11083 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_08390 11094 11480 gene locus_tag LOCUS_08400 gene rpsI 11094 11480 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_08400 11798 12496 gene locus_tag LOCUS_08410 gene rpsB 11798 12496 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_08410 12620 13615 gene locus_tag LOCUS_08420 gene tsf 12620 13615 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_08420 13717 14334 gene locus_tag LOCUS_08430 13717 14334 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_08430 14431 17982 gene locus_tag LOCUS_08440 14431 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 18499 18696 gene locus_tag LOCUS_08450 gene thiS 18499 18696 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815690.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence042 574 98 gene locus_tag LOCUS_08460 574 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 942 604 gene locus_tag LOCUS_08470 942 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109356.1 protein_id gnl|my_center|LOCUS_08470 1505 1014 gene locus_tag LOCUS_08480 1505 1014 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760363.1 protein_id gnl|my_center|LOCUS_08480 1918 2574 gene locus_tag LOCUS_08490 gene rpe 1918 2574 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_08490 2664 3521 gene locus_tag LOCUS_08500 gene mazG 2664 3521 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_08500 3541 4116 gene locus_tag LOCUS_08510 3541 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4195 5034 gene locus_tag LOCUS_08520 4195 5034 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_08520 5236 5508 gene locus_tag LOCUS_08530 5236 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5648 7096 gene locus_tag LOCUS_08540 5648 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7146 7655 gene locus_tag LOCUS_08550 7146 7655 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_08550 7726 8136 gene locus_tag LOCUS_08560 7726 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8322 8597 gene locus_tag LOCUS_08570 8322 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8634 9365 gene locus_tag LOCUS_08580 gene truA 8634 9365 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_08580 9528 10301 gene locus_tag LOCUS_08590 9528 10301 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_08590 10508 11395 gene locus_tag LOCUS_08600 gene dapA 10508 11395 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_08600 11511 12431 gene locus_tag LOCUS_08610 11511 12431 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_08610 12501 14609 gene locus_tag LOCUS_08620 gene ligA 12501 14609 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_08620 14852 15517 gene locus_tag LOCUS_08630 14852 15517 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109233.1 protein_id gnl|my_center|LOCUS_08630 15530 16360 gene locus_tag LOCUS_08640 gene coaW 15530 16360 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446246.1 protein_id gnl|my_center|LOCUS_08640 16661 18496 gene locus_tag LOCUS_08650 16661 18496 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence043 425 4522 gene locus_tag LOCUS_08660 425 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4801 6753 gene locus_tag LOCUS_08670 4801 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7896 6742 gene locus_tag LOCUS_08680 7896 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8341 8266 gene locus_tag LOCUS_t00160 8341 8266 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9757 8408 gene locus_tag LOCUS_08690 9757 8408 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_08690 10260 15314 gene locus_tag LOCUS_08700 10260 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 15470 15479 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15484 15918 gene locus_tag LOCUS_08710 15484 15918 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_08710 17165 16500 gene locus_tag LOCUS_08720 gene tsaA 17165 16500 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_08720 18399 17200 gene locus_tag LOCUS_08730 18399 17200 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence044 1541 276 gene locus_tag LOCUS_08740 1541 276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250773.1 protein_id gnl|my_center|LOCUS_08740 3102 1711 gene locus_tag LOCUS_08750 3102 1711 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_08750 3297 3133 gene locus_tag LOCUS_08760 3297 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4546 3311 gene locus_tag LOCUS_08770 4546 3311 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765581.1 protein_id gnl|my_center|LOCUS_08770 4693 5076 gene locus_tag LOCUS_08780 gene folB 4693 5076 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_08780 5144 6496 gene locus_tag LOCUS_08790 5144 6496 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_08790 6584 7414 gene locus_tag LOCUS_08800 6584 7414 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_08800 7788 9200 gene locus_tag LOCUS_08810 gene dnaA 7788 9200 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_08810 11078 9429 gene locus_tag LOCUS_08820 11078 9429 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_08820 11821 11459 gene locus_tag LOCUS_08830 11821 11459 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786310.1 protein_id gnl|my_center|LOCUS_08830 12132 11833 gene locus_tag LOCUS_08840 12132 11833 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_08840 15207 12304 gene locus_tag LOCUS_08850 15207 12304 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_08850 17115 15262 gene locus_tag LOCUS_08860 17115 15262 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_08860 18388 17138 gene locus_tag LOCUS_08870 gene hflX 18388 17138 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence045 61 276 gene locus_tag LOCUS_08880 61 276 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_08880 340 1911 gene locus_tag LOCUS_08890 340 1911 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_08890 2022 3053 gene locus_tag LOCUS_08900 gene cydB 2022 3053 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_08900 4434 3130 gene locus_tag LOCUS_08910 gene thrC 4434 3130 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_08910 5746 4517 gene locus_tag LOCUS_08920 5746 4517 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202073.1 protein_id gnl|my_center|LOCUS_08920 8195 5760 gene locus_tag LOCUS_08930 gene thrA 8195 5760 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_08930 9151 8558 gene locus_tag LOCUS_08940 9151 8558 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_08940 9794 9180 gene locus_tag LOCUS_08950 9794 9180 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_08950 10606 9791 gene locus_tag LOCUS_08960 gene thiD 10606 9791 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_08960 11442 10612 gene locus_tag LOCUS_08970 11442 10612 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_08970 12133 11480 gene locus_tag LOCUS_08980 12133 11480 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_08980 12618 12205 gene locus_tag LOCUS_08990 12618 12205 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764781.1 protein_id gnl|my_center|LOCUS_08990 12880 15408 gene locus_tag LOCUS_09000 12880 15408 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_09000 16159 15512 gene locus_tag LOCUS_09010 16159 15512 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760474.1 protein_id gnl|my_center|LOCUS_09010 17655 16357 gene locus_tag LOCUS_09020 17655 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence046 2265 1474 gene locus_tag LOCUS_09030 2265 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3033 2473 gene locus_tag LOCUS_09040 3033 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3255 6317 gene locus_tag LOCUS_09050 3255 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6515 8014 gene locus_tag LOCUS_09060 6515 8014 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_09060 8163 10067 gene locus_tag LOCUS_09070 8163 10067 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_09070 10111 10926 gene locus_tag LOCUS_09080 10111 10926 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_09080 11030 11998 gene locus_tag LOCUS_09090 11030 11998 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_09090 12367 12095 gene locus_tag LOCUS_09100 12367 12095 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_09100 12589 13533 gene locus_tag LOCUS_09110 12589 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 13554 14627 gene locus_tag LOCUS_09120 13554 14627 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence047 852 1577 gene locus_tag LOCUS_09130 852 1577 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_09130 1964 1677 gene locus_tag LOCUS_09140 1964 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2719 2177 gene locus_tag LOCUS_09150 2719 2177 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_09150 3576 2731 gene locus_tag LOCUS_09160 gene ispE 3576 2731 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_09160 5946 3661 gene locus_tag LOCUS_09170 5946 3661 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_09170 6230 6883 gene locus_tag LOCUS_09180 6230 6883 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_09180 7006 7641 gene locus_tag LOCUS_09190 7006 7641 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09190 7644 8258 gene locus_tag LOCUS_09200 7644 8258 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09200 8307 9359 gene locus_tag LOCUS_09210 8307 9359 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_09210 9749 9465 gene locus_tag LOCUS_09220 9749 9465 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_09220 10723 11061 gene locus_tag LOCUS_09230 10723 11061 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_09230 11083 12939 gene locus_tag LOCUS_09240 11083 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 13036 15840 gene locus_tag LOCUS_09250 13036 15840 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_09250 15971 16789 gene locus_tag LOCUS_09260 15971 16789 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_09260 16797 17456 gene locus_tag LOCUS_09270 16797 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence048 119 3298 gene locus_tag LOCUS_09280 119 3298 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_09280 3334 5526 gene locus_tag LOCUS_09290 3334 5526 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109237.1 protein_id gnl|my_center|LOCUS_09290 6592 5621 gene locus_tag LOCUS_09300 6592 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6813 8726 gene locus_tag LOCUS_09310 6813 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9085 8849 gene locus_tag LOCUS_09320 9085 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 10223 9174 gene locus_tag LOCUS_09330 gene ilvC 10223 9174 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_09330 11143 10373 gene locus_tag LOCUS_09340 11143 10373 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_09340 11738 11214 gene locus_tag LOCUS_09350 gene ilvN 11738 11214 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_09350 13494 11785 gene locus_tag LOCUS_09360 gene ilvB 13494 11785 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_09360 15232 13514 gene locus_tag LOCUS_09370 gene ilvD 15232 13514 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_09370 16623 15628 gene locus_tag LOCUS_09380 16623 15628 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_09380 17522 16740 gene locus_tag LOCUS_09390 17522 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence049 2482 386 gene locus_tag LOCUS_09400 2482 386 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_09400 3313 3738 gene locus_tag LOCUS_09410 3313 3738 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_09410 3996 5345 gene locus_tag LOCUS_09420 3996 5345 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_09420 5513 7594 gene locus_tag LOCUS_09430 5513 7594 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_09430 7634 8128 gene locus_tag LOCUS_09440 7634 8128 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_09440 8109 9770 gene locus_tag LOCUS_09450 8109 9770 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_09450 9822 11084 gene locus_tag LOCUS_09460 9822 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11108 13153 gene locus_tag LOCUS_09470 11108 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 13183 13716 gene locus_tag LOCUS_09480 13183 13716 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_09480 14619 13708 gene locus_tag LOCUS_09490 14619 13708 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_09490 15005 14715 gene locus_tag LOCUS_09500 15005 14715 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764453.1 protein_id gnl|my_center|LOCUS_09500 16107 15007 gene locus_tag LOCUS_09510 gene recF 16107 15007 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_09510 16304 17008 gene locus_tag LOCUS_09520 16304 17008 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_09520 17016 17492 gene locus_tag LOCUS_09530 gene ribH 17016 17492 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence050 1382 294 gene locus_tag LOCUS_09540 1382 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1958 1455 gene locus_tag LOCUS_09550 1958 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2848 1991 gene locus_tag LOCUS_09560 gene rfbD 2848 1991 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_09560 3025 4380 gene locus_tag LOCUS_09570 3025 4380 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_09570 6091 4640 gene locus_tag LOCUS_09580 6091 4640 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764494.1 protein_id gnl|my_center|LOCUS_09580 6884 6156 gene locus_tag LOCUS_09590 6884 6156 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_09590 7207 8061 gene locus_tag LOCUS_09600 gene panC 7207 8061 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_09600 8076 8423 gene locus_tag LOCUS_09610 8076 8423 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_09610 8451 9998 gene locus_tag LOCUS_09620 gene dnaB 8451 9998 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_09620 12940 10133 gene locus_tag LOCUS_09630 12940 10133 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_09630 16236 12976 gene locus_tag LOCUS_09640 16236 12976 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_09640 16500 16243 gene locus_tag LOCUS_09650 16500 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 17246 16506 gene locus_tag LOCUS_09660 17246 16506 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence051 7 369 gene locus_tag LOCUS_09670 7 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 657 731 gene locus_tag LOCUS_t00170 657 731 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 853 1782 gene locus_tag LOCUS_09680 gene gluQRS 853 1782 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_09680 1910 2953 gene locus_tag LOCUS_09690 1910 2953 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_09690 2965 6090 gene locus_tag LOCUS_09700 gene vmeV 2965 6090 CDS product multidrug efflux RND transporter permease subunit VmeV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 protein_id gnl|my_center|LOCUS_09700 7396 6092 gene locus_tag LOCUS_09710 7396 6092 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_09710 8310 7420 gene locus_tag LOCUS_09720 8310 7420 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_09720 9117 8374 gene locus_tag LOCUS_09730 9117 8374 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_09730 9578 9411 gene locus_tag LOCUS_09740 9578 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9517 15039 gene locus_tag LOCUS_09750 9517 15039 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_09750 15066 16127 gene locus_tag LOCUS_09760 15066 16127 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_09760 16159 17025 gene locus_tag LOCUS_09770 16159 17025 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence052 3 350 gene locus_tag LOCUS_09780 3 350 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_09780 476 2593 gene locus_tag LOCUS_09790 476 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4678 2675 gene locus_tag LOCUS_09800 4678 2675 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_09800 6906 4744 gene locus_tag LOCUS_09810 6906 4744 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_09810 7203 8708 gene locus_tag LOCUS_09820 7203 8708 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_09820 10324 8771 gene locus_tag LOCUS_09830 10324 8771 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795196.1 protein_id gnl|my_center|LOCUS_09830 12061 10412 gene locus_tag LOCUS_09840 12061 10412 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_09840 15415 12068 gene locus_tag LOCUS_09850 15415 12068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_09850 16378 15458 gene locus_tag LOCUS_09860 16378 15458 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_09860 16968 16432 gene locus_tag LOCUS_09870 16968 16432 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence053 45 272 gene locus_tag LOCUS_09880 45 272 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_09880 299 622 gene locus_tag LOCUS_09890 299 622 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_09890 635 1573 gene locus_tag LOCUS_09900 635 1573 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_09900 1678 2712 gene locus_tag LOCUS_09910 gene ruvB 1678 2712 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_09910 2845 3999 gene locus_tag LOCUS_09920 2845 3999 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_09920 4002 5954 gene locus_tag LOCUS_09930 4002 5954 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761752.1 protein_id gnl|my_center|LOCUS_09930 6209 7600 gene locus_tag LOCUS_09940 6209 7600 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_09940 7803 8777 gene locus_tag LOCUS_09950 7803 8777 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_09950 8872 9981 gene locus_tag LOCUS_09960 8872 9981 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_09960 10108 12876 gene locus_tag LOCUS_09970 10108 12876 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_09970 12902 14545 gene locus_tag LOCUS_09980 12902 14545 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_09980 14722 16245 gene locus_tag LOCUS_09990 14722 16245 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798980.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence054 1344 214 gene locus_tag LOCUS_10000 1344 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2355 1387 gene locus_tag LOCUS_10010 2355 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5024 2373 gene locus_tag LOCUS_10020 5024 2373 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_10020 5476 6525 gene locus_tag LOCUS_10030 5476 6525 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_10030 6522 7094 gene locus_tag LOCUS_10040 6522 7094 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_10040 7113 7736 gene locus_tag LOCUS_10050 gene udk 7113 7736 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_10050 9318 7810 gene locus_tag LOCUS_10060 9318 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9553 10077 gene locus_tag LOCUS_10070 9553 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10269 11171 gene locus_tag LOCUS_10080 10269 11171 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_10080 11171 12724 gene locus_tag LOCUS_10090 11171 12724 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_10090 12721 14055 gene locus_tag LOCUS_10100 12721 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 14068 15216 gene locus_tag LOCUS_10110 14068 15216 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_10110 15229 16158 gene locus_tag LOCUS_10120 15229 16158 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_10120 16213 16911 gene locus_tag LOCUS_10130 16213 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence055 <1 1375 gene locus_tag LOCUS_10140 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791759.1:adenylosuccinate lyase 1581 3089 gene locus_tag LOCUS_10150 1581 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3118 4545 gene locus_tag LOCUS_10160 gene asnS 3118 4545 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_10160 4657 5625 gene locus_tag LOCUS_10170 gene metF 4657 5625 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_10170 5648 6748 gene locus_tag LOCUS_10180 5648 6748 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_10180 6745 8100 gene locus_tag LOCUS_10190 6745 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8184 8564 gene locus_tag LOCUS_10200 8184 8564 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_10200 8655 9194 gene locus_tag LOCUS_10210 gene hpt 8655 9194 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_10210 9289 9861 gene locus_tag LOCUS_10220 9289 9861 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_10220 10274 11593 gene locus_tag LOCUS_10230 10274 11593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_10230 12953 11898 gene locus_tag LOCUS_10240 12953 11898 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_10240 14542 13031 gene locus_tag LOCUS_10250 14542 13031 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_10250 14699 16831 gene locus_tag LOCUS_10260 14699 16831 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence056 1398 271 gene locus_tag LOCUS_10270 gene hemW 1398 271 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_10270 1605 3764 gene locus_tag LOCUS_10280 1605 3764 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_10280 4189 4881 gene locus_tag LOCUS_10290 4189 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4944 6230 gene locus_tag LOCUS_10300 4944 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6654 8288 gene locus_tag LOCUS_10310 6654 8288 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_10310 8347 9522 gene locus_tag LOCUS_10320 8347 9522 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_10320 9534 9998 gene locus_tag LOCUS_10330 gene bcp 9534 9998 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_10330 10020 11855 gene locus_tag LOCUS_10340 10020 11855 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_10340 11988 12839 gene locus_tag LOCUS_10350 gene metA 11988 12839 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_10350 12858 14801 gene locus_tag LOCUS_10360 12858 14801 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_10360 14920 15966 gene locus_tag LOCUS_10370 14920 15966 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108287.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence057 <1 697 gene locus_tag LOCUS_10380 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762585.1:ABC transporter ATP-binding protein 967 1797 gene locus_tag LOCUS_10390 967 1797 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_10390 2963 2166 gene locus_tag LOCUS_10400 2963 2166 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108722.1 protein_id gnl|my_center|LOCUS_10400 5007 2977 gene locus_tag LOCUS_10410 5007 2977 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_10410 6284 5133 gene locus_tag LOCUS_10420 gene fucP 6284 5133 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_10420 8323 6416 gene locus_tag LOCUS_10430 8323 6416 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_10430 9712 8402 gene locus_tag LOCUS_10440 9712 8402 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_10440 10691 9729 gene locus_tag LOCUS_10450 10691 9729 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_10450 12158 10740 gene locus_tag LOCUS_10460 12158 10740 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_10460 12784 12155 gene locus_tag LOCUS_10470 12784 12155 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763992.1 protein_id gnl|my_center|LOCUS_10470 13760 12777 gene locus_tag LOCUS_10480 13760 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759694.1 protein_id gnl|my_center|LOCUS_10480 14742 13774 gene locus_tag LOCUS_10490 14742 13774 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_10490 14829 15557 gene locus_tag LOCUS_10500 14829 15557 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_10500 15891 15538 gene locus_tag LOCUS_10510 15891 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 16288 16037 gene locus_tag LOCUS_10520 16288 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence058 897 112 gene locus_tag LOCUS_10530 897 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2431 968 gene locus_tag LOCUS_10540 2431 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3496 2480 gene locus_tag LOCUS_10550 3496 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4510 3536 gene locus_tag LOCUS_10560 4510 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 5417 4494 gene locus_tag LOCUS_10570 5417 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6199 5588 gene locus_tag LOCUS_10580 6199 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9317 6249 gene locus_tag LOCUS_10590 9317 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 10074 9487 gene locus_tag LOCUS_10600 10074 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10512 12296 gene locus_tag LOCUS_10610 10512 12296 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_10610 12377 13396 gene locus_tag LOCUS_10620 12377 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 13396 14421 gene locus_tag LOCUS_10630 13396 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 14418 15302 gene locus_tag LOCUS_10640 14418 15302 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_10640 15299 15922 gene locus_tag LOCUS_10650 15299 15922 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024668366.1 protein_id gnl|my_center|LOCUS_10650 15919 16335 gene locus_tag LOCUS_10660 15919 16335 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence059 120 191 gene locus_tag LOCUS_t00180 120 191 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 241 1818 gene locus_tag LOCUS_10670 241 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2017 2514 gene locus_tag LOCUS_10680 gene fldA 2017 2514 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765037.1 protein_id gnl|my_center|LOCUS_10680 2560 2922 gene locus_tag LOCUS_10690 2560 2922 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 protein_id gnl|my_center|LOCUS_10690 3275 5734 gene locus_tag LOCUS_10700 3275 5734 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_10700 5750 6736 gene locus_tag LOCUS_10710 5750 6736 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_10710 7851 6715 gene locus_tag LOCUS_10720 gene lpxB 7851 6715 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_10720 8612 7848 gene locus_tag LOCUS_10730 gene surE 8612 7848 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_10730 8712 9479 gene locus_tag LOCUS_10740 8712 9479 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_10740 9480 10403 gene locus_tag LOCUS_10750 9480 10403 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_10750 10422 11126 gene locus_tag LOCUS_10760 10422 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 11155 12504 gene locus_tag LOCUS_10770 11155 12504 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_10770 12543 14807 gene locus_tag LOCUS_10780 12543 14807 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_10780 16230 14896 gene locus_tag LOCUS_10790 16230 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence060 <1 1289 gene locus_tag LOCUS_10800 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775782.1:30S ribosomal protein S1 2091 1369 gene locus_tag LOCUS_10810 gene pflA 2091 1369 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 protein_id gnl|my_center|LOCUS_10810 2192 2350 gene locus_tag LOCUS_10820 2192 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2405 4102 gene locus_tag LOCUS_10830 gene ettA 2405 4102 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_10830 6471 4231 gene locus_tag LOCUS_10840 gene pflB 6471 4231 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 protein_id gnl|my_center|LOCUS_10840 6700 7305 gene locus_tag LOCUS_10850 gene yihA 6700 7305 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_10850 7309 9087 gene locus_tag LOCUS_10860 7309 9087 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_10860 9491 10462 gene locus_tag LOCUS_10870 9491 10462 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986275.1 protein_id gnl|my_center|LOCUS_10870 10498 11586 gene locus_tag LOCUS_10880 10498 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 11647 12027 gene locus_tag LOCUS_10890 gene gcvH 11647 12027 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418363.1 protein_id gnl|my_center|LOCUS_10890 12065 13393 gene locus_tag LOCUS_10900 gene gcvPA 12065 13393 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948419.1 protein_id gnl|my_center|LOCUS_10900 13390 14847 gene locus_tag LOCUS_10910 gene gcvPB 13390 14847 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861288.1 protein_id gnl|my_center|LOCUS_10910 14923 16284 gene locus_tag LOCUS_10920 gene lpdA 14923 16284 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948421.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence061 2591 108 gene locus_tag LOCUS_10930 2591 108 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_10930 3591 2683 gene locus_tag LOCUS_10940 gene miaA 3591 2683 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_10940 4476 3706 gene locus_tag LOCUS_10950 gene lpxA 4476 3706 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_10950 5883 4498 gene locus_tag LOCUS_10960 5883 4498 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_10960 6932 5895 gene locus_tag LOCUS_10970 gene lpxD 6932 5895 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_10970 7941 7114 gene locus_tag LOCUS_10980 gene pyrF 7941 7114 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_10980 9117 8005 gene locus_tag LOCUS_10990 gene prfA 9117 8005 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_10990 10343 9174 gene locus_tag LOCUS_11000 10343 9174 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_11000 11150 10398 gene locus_tag LOCUS_11010 11150 10398 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_11010 11915 11178 gene locus_tag LOCUS_11020 gene ubiE 11915 11178 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_11020 12939 11989 gene locus_tag LOCUS_11030 12939 11989 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_11030 13856 12957 gene locus_tag LOCUS_11040 13856 12957 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_11040 14082 14888 gene locus_tag LOCUS_11050 14082 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 16217 14892 gene locus_tag LOCUS_11060 16217 14892 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence062 643 53 gene locus_tag LOCUS_11070 643 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1023 1122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1142 1333 gene locus_tag LOCUS_11080 1142 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1373 1558 gene locus_tag LOCUS_11090 1373 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3660 4583 gene locus_tag LOCUS_11100 3660 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5150 4755 gene locus_tag LOCUS_11110 5150 4755 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_11110 6504 5377 gene locus_tag LOCUS_11120 6504 5377 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_11120 7786 6641 gene locus_tag LOCUS_11130 7786 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8995 7820 gene locus_tag LOCUS_11140 8995 7820 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_11140 12035 8949 gene locus_tag LOCUS_11150 12035 8949 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_11150 13195 12041 gene locus_tag LOCUS_11160 13195 12041 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108103.1 protein_id gnl|my_center|LOCUS_11160 14270 13518 gene locus_tag LOCUS_11170 14270 13518 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_11170 <16107 14279 gene locus_tag LOCUS_11180 <16107 14279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761732.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence063 111 470 gene locus_tag LOCUS_11190 gene rsfS 111 470 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_11190 482 2512 gene locus_tag LOCUS_11200 gene ftsH 482 2512 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_11200 2505 3377 gene locus_tag LOCUS_11210 2505 3377 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_11210 3952 3467 gene locus_tag LOCUS_11220 3952 3467 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_11220 4658 3975 gene locus_tag LOCUS_11230 gene mtnN 4658 3975 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689868.1 protein_id gnl|my_center|LOCUS_11230 5228 7804 gene locus_tag LOCUS_11240 5228 7804 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_11240 7819 8646 gene locus_tag LOCUS_11250 7819 8646 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_11250 9183 10457 gene locus_tag LOCUS_11260 9183 10457 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108221.1 protein_id gnl|my_center|LOCUS_11260 10454 11524 gene locus_tag LOCUS_11270 10454 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 11608 12546 gene locus_tag LOCUS_11280 11608 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 12624 14732 gene locus_tag LOCUS_11290 12624 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 15841 14900 gene locus_tag LOCUS_11300 15841 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence064 1258 425 gene locus_tag LOCUS_11310 gene menB 1258 425 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_11310 1895 1518 gene locus_tag LOCUS_11320 1895 1518 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_11320 2145 2244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4084 2315 gene locus_tag LOCUS_11330 gene menD 4084 2315 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786027.1 protein_id gnl|my_center|LOCUS_11330 5163 4093 gene locus_tag LOCUS_11340 5163 4093 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_11340 5573 5160 gene locus_tag LOCUS_11350 5573 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6639 5590 gene locus_tag LOCUS_11360 gene aroB 6639 5590 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_11360 7808 6666 gene locus_tag LOCUS_11370 7808 6666 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_11370 10595 8025 gene locus_tag LOCUS_11380 10595 8025 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_11380 12258 10789 gene locus_tag LOCUS_11390 12258 10789 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_11390 14967 12385 gene locus_tag LOCUS_11400 14967 12385 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_11400 15825 15052 gene locus_tag LOCUS_11410 15825 15052 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence065 344 141 gene locus_tag LOCUS_11420 344 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 686 357 gene locus_tag LOCUS_11430 686 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1748 1341 gene locus_tag LOCUS_11440 1748 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2131 1745 gene locus_tag LOCUS_11450 2131 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4248 5273 gene locus_tag LOCUS_11460 4248 5273 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775575.1 protein_id gnl|my_center|LOCUS_11460 5578 6270 gene locus_tag LOCUS_11470 5578 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6654 7619 gene locus_tag LOCUS_11480 gene bla 6654 7619 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_11480 9271 7712 gene locus_tag LOCUS_11490 9271 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10211 9399 gene locus_tag LOCUS_11500 10211 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 11615 10518 gene locus_tag LOCUS_11510 11615 10518 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120046688.1 protein_id gnl|my_center|LOCUS_11510 11995 11621 gene locus_tag LOCUS_11520 11995 11621 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040312278.1 protein_id gnl|my_center|LOCUS_11520 12902 12195 gene locus_tag LOCUS_11530 12902 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 14418 13300 gene locus_tag LOCUS_11540 14418 13300 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007557695.1 protein_id gnl|my_center|LOCUS_11540 15345 14560 gene locus_tag LOCUS_11550 15345 14560 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107183.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence066 149 1237 gene locus_tag LOCUS_11560 149 1237 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_11560 3531 1333 gene locus_tag LOCUS_11570 3531 1333 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767251.1 protein_id gnl|my_center|LOCUS_11570 4099 3509 gene locus_tag LOCUS_11580 4099 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4356 5351 gene locus_tag LOCUS_11590 4356 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6166 5633 gene locus_tag LOCUS_11600 6166 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6772 6179 gene locus_tag LOCUS_11610 gene pnuC 6772 6179 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_11610 9149 6783 gene locus_tag LOCUS_11620 9149 6783 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_11620 9387 9202 gene locus_tag LOCUS_11630 9387 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9362 11068 gene locus_tag LOCUS_11640 9362 11068 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_11640 11259 11540 gene locus_tag LOCUS_11650 11259 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 11811 14222 gene locus_tag LOCUS_11660 11811 14222 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_11660 14295 15662 gene locus_tag LOCUS_11670 14295 15662 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence067 <1 2634 gene locus_tag LOCUS_11680 <1 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796226.1:alanine--tRNA ligase 2728 3339 gene locus_tag LOCUS_11690 2728 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3464 4486 gene locus_tag LOCUS_11700 3464 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4664 8104 gene locus_tag LOCUS_11710 4664 8104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_11710 8192 9682 gene locus_tag LOCUS_11720 8192 9682 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109369.1 protein_id gnl|my_center|LOCUS_11720 9754 11166 gene locus_tag LOCUS_11730 9754 11166 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_11730 11266 13770 gene locus_tag LOCUS_11740 11266 13770 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203126.1 protein_id gnl|my_center|LOCUS_11740 15334 13997 gene locus_tag LOCUS_11750 15334 13997 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence068 118 351 gene locus_tag LOCUS_11760 118 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 364 1458 gene locus_tag LOCUS_11770 364 1458 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831398.1 protein_id gnl|my_center|LOCUS_11770 1461 2843 gene locus_tag LOCUS_11780 1461 2843 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_11780 3480 2887 gene locus_tag LOCUS_11790 3480 2887 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_11790 3715 3503 gene locus_tag LOCUS_11800 3715 3503 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_11800 4474 4325 gene locus_tag LOCUS_11810 4474 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4829 7642 gene locus_tag LOCUS_11820 4829 7642 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_11820 8130 7714 gene locus_tag LOCUS_11830 8130 7714 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_11830 8720 8136 gene locus_tag LOCUS_11840 gene pth 8720 8136 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_11840 9445 8852 gene locus_tag LOCUS_11850 9445 8852 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_11850 9725 10810 gene locus_tag LOCUS_11860 gene nusB 9725 10810 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_11860 10896 11207 gene locus_tag LOCUS_11870 gene yajC 10896 11207 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_11870 11341 12207 gene locus_tag LOCUS_11880 11341 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12212 12778 gene locus_tag LOCUS_11890 gene coaE 12212 12778 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_11890 12902 13342 gene locus_tag LOCUS_11900 12902 13342 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_11900 13364 14173 gene locus_tag LOCUS_11910 gene rsmA 13364 14173 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence069 1032 151 gene locus_tag LOCUS_11920 1032 151 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_11920 3760 1019 gene locus_tag LOCUS_11930 3760 1019 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_11930 3967 5508 gene locus_tag LOCUS_11940 3967 5508 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_11940 5595 6191 gene locus_tag LOCUS_11950 5595 6191 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796621.1 protein_id gnl|my_center|LOCUS_11950 6593 6518 gene locus_tag LOCUS_t00190 6593 6518 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7457 6822 gene locus_tag LOCUS_11960 7457 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 7633 7551 gene locus_tag LOCUS_t00200 7633 7551 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7847 11143 gene locus_tag LOCUS_11970 7847 11143 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555770.1 protein_id gnl|my_center|LOCUS_11970 11599 13281 gene locus_tag LOCUS_11980 11599 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 13296 13484 gene locus_tag LOCUS_11990 13296 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 14159 13632 gene locus_tag LOCUS_12000 14159 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence070 675 223 gene locus_tag LOCUS_12010 675 223 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_12010 1592 660 gene locus_tag LOCUS_12020 1592 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_12020 2985 1717 gene locus_tag LOCUS_12030 gene purD 2985 1717 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 protein_id gnl|my_center|LOCUS_12030 5321 3099 gene locus_tag LOCUS_12040 5321 3099 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108719.1 protein_id gnl|my_center|LOCUS_12040 6846 5311 gene locus_tag LOCUS_12050 6846 5311 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_12050 7497 6883 gene locus_tag LOCUS_12060 7497 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11414 7935 gene locus_tag LOCUS_12070 11414 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 11661 12722 gene locus_tag LOCUS_12080 11661 12722 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_12080 12759 14045 gene locus_tag LOCUS_12090 12759 14045 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence071 1590 199 gene locus_tag LOCUS_12100 1590 199 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_12100 3458 1632 gene locus_tag LOCUS_12110 3458 1632 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_12110 3604 3939 gene locus_tag LOCUS_12120 3604 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3923 4336 gene locus_tag LOCUS_12130 3923 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815012.1 protein_id gnl|my_center|LOCUS_12130 4497 5303 gene locus_tag LOCUS_12140 4497 5303 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789092.1 protein_id gnl|my_center|LOCUS_12140 5310 6641 gene locus_tag LOCUS_12150 5310 6641 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_12150 6641 7453 gene locus_tag LOCUS_12160 6641 7453 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_12160 7464 8630 gene locus_tag LOCUS_12170 7464 8630 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766203.1 protein_id gnl|my_center|LOCUS_12170 8670 9428 gene locus_tag LOCUS_12180 8670 9428 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_12180 9601 10350 gene locus_tag LOCUS_12190 9601 10350 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_12190 10687 13908 gene locus_tag LOCUS_12200 gene mfd 10687 13908 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence072 1066 227 gene locus_tag LOCUS_12210 1066 227 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713630.1 protein_id gnl|my_center|LOCUS_12210 1822 1070 gene locus_tag LOCUS_12220 1822 1070 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_12220 6076 1952 gene locus_tag LOCUS_12230 6076 1952 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461657.1 protein_id gnl|my_center|LOCUS_12230 6366 9605 gene locus_tag LOCUS_12240 6366 9605 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202536.1 protein_id gnl|my_center|LOCUS_12240 9680 11641 gene locus_tag LOCUS_12250 9680 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 12892 11960 gene locus_tag LOCUS_12260 gene rsgA 12892 11960 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_12260 <13670 13091 gene locus_tag LOCUS_12270 <13670 13091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764014.1:ribosome recycling factor >Feature sequence073 676 1215 gene locus_tag LOCUS_12280 676 1215 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202750.1 protein_id gnl|my_center|LOCUS_12280 1319 2764 gene locus_tag LOCUS_12290 1319 2764 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_12290 2886 4658 gene locus_tag LOCUS_12300 2886 4658 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787397.1 protein_id gnl|my_center|LOCUS_12300 5040 6035 gene locus_tag LOCUS_12310 5040 6035 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_12310 6307 9273 gene locus_tag LOCUS_12320 6307 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9299 11707 gene locus_tag LOCUS_12330 9299 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 13424 12531 gene locus_tag LOCUS_12340 13424 12531 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence074 69 1406 gene locus_tag LOCUS_12350 69 1406 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_12350 2622 1801 gene locus_tag LOCUS_12360 2622 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2838 3821 gene locus_tag LOCUS_12370 2838 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3838 4995 gene locus_tag LOCUS_12380 3838 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_12380 6108 5221 gene locus_tag LOCUS_12390 6108 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6144 6153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6906 6223 gene locus_tag LOCUS_12400 6906 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7223 7501 gene locus_tag LOCUS_12410 7223 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7538 8020 gene locus_tag LOCUS_12420 7538 8020 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582494.1 protein_id gnl|my_center|LOCUS_12420 8020 8316 gene locus_tag LOCUS_12430 8020 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8926 9732 gene locus_tag LOCUS_12440 8926 9732 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_12440 9865 10983 gene locus_tag LOCUS_12450 9865 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 10980 11696 gene locus_tag LOCUS_12460 10980 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 13009 11711 gene locus_tag LOCUS_12470 13009 11711 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence075 374 1663 gene locus_tag LOCUS_12480 374 1663 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_12480 1735 2682 gene locus_tag LOCUS_12490 gene cysK 1735 2682 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_12490 2896 4260 gene locus_tag LOCUS_12500 gene nhaD 2896 4260 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_12500 4469 6004 gene locus_tag LOCUS_12510 4469 6004 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 protein_id gnl|my_center|LOCUS_12510 6078 7310 gene locus_tag LOCUS_12520 6078 7310 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_12520 7428 8450 gene locus_tag LOCUS_12530 7428 8450 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_12530 8692 9366 gene locus_tag LOCUS_12540 8692 9366 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_12540 9452 10816 gene locus_tag LOCUS_12550 9452 10816 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_12550 10869 11786 gene locus_tag LOCUS_12560 gene kduI 10869 11786 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_12560 11798 12592 gene locus_tag LOCUS_12570 11798 12592 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence076 151 69 gene locus_tag LOCUS_t00210 151 69 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 305 231 gene locus_tag LOCUS_t00220 305 231 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 705 406 gene locus_tag LOCUS_12580 gene raiA 705 406 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_12580 1682 795 gene locus_tag LOCUS_12590 gene xerC 1682 795 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_12590 2416 1865 gene locus_tag LOCUS_12600 2416 1865 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108496.1 protein_id gnl|my_center|LOCUS_12600 2637 3401 gene locus_tag LOCUS_12610 2637 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3886 6972 gene locus_tag LOCUS_12620 3886 6972 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_12620 7002 8654 gene locus_tag LOCUS_12630 7002 8654 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_12630 9177 8752 gene locus_tag LOCUS_12640 9177 8752 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762588.1 protein_id gnl|my_center|LOCUS_12640 9428 10786 gene locus_tag LOCUS_12650 9428 10786 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_12650 10815 12176 gene locus_tag LOCUS_12660 10815 12176 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_12660 12301 12228 gene locus_tag LOCUS_t00230 12301 12228 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12481 12554 gene locus_tag LOCUS_t00240 12481 12554 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 6771 85 gene locus_tag LOCUS_12670 6771 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10240 6857 gene locus_tag LOCUS_12680 10240 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 12866 10377 gene locus_tag LOCUS_12690 12866 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence078 2983 1745 gene locus_tag LOCUS_12700 2983 1745 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_12700 4114 2987 gene locus_tag LOCUS_12710 gene tgt 4114 2987 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_12710 6537 4111 gene locus_tag LOCUS_12720 gene lon 6537 4111 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_12720 6714 8729 gene locus_tag LOCUS_12730 6714 8729 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658523.1 protein_id gnl|my_center|LOCUS_12730 10699 8891 gene locus_tag LOCUS_12740 10699 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <12567 10782 gene locus_tag LOCUS_12750 <12567 10782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767539.1:DUF4955 domain-containing protein >Feature sequence079 1612 272 gene locus_tag LOCUS_12760 1612 272 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_12760 4915 2726 gene locus_tag LOCUS_12770 4915 2726 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_12770 6249 5011 gene locus_tag LOCUS_12780 6249 5011 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_12780 7147 6302 gene locus_tag LOCUS_12790 gene dapF 7147 6302 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_12790 7473 7829 gene locus_tag LOCUS_12800 7473 7829 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_12800 7859 9136 gene locus_tag LOCUS_12810 7859 9136 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_12810 9310 10974 gene locus_tag LOCUS_12820 gene asnB 9310 10974 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_12820 12117 11107 gene locus_tag LOCUS_12830 12117 11107 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence080 2761 620 gene locus_tag LOCUS_12840 2761 620 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_12840 4116 2890 gene locus_tag LOCUS_12850 4116 2890 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_12850 4892 4245 gene locus_tag LOCUS_12860 gene lptC 4892 4245 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_12860 6194 4908 gene locus_tag LOCUS_12870 6194 4908 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_12870 6438 7550 gene locus_tag LOCUS_12880 6438 7550 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_12880 7630 8943 gene locus_tag LOCUS_12890 7630 8943 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_12890 9077 12463 gene locus_tag LOCUS_12900 gene secA 9077 12463 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence081 <1 2275 gene locus_tag LOCUS_12910 <1 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461677.1:hydratase 2436 3647 gene locus_tag LOCUS_12920 2436 3647 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_12920 3915 4988 gene locus_tag LOCUS_12930 3915 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6558 5278 gene locus_tag LOCUS_12940 6558 5278 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_12940 6798 6619 gene locus_tag LOCUS_12950 6798 6619 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_12950 6941 8737 gene locus_tag LOCUS_12960 6941 8737 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_12960 9886 8711 gene locus_tag LOCUS_12970 9886 8711 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_12970 10029 10256 gene locus_tag LOCUS_12980 10029 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 10171 12159 gene locus_tag LOCUS_12990 10171 12159 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence082 896 156 gene locus_tag LOCUS_13000 896 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_13000 1547 1014 gene locus_tag LOCUS_13010 1547 1014 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_13010 2924 1578 gene locus_tag LOCUS_13020 2924 1578 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_13020 4056 3097 gene locus_tag LOCUS_13030 4056 3097 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107839.1 protein_id gnl|my_center|LOCUS_13030 5310 4120 gene locus_tag LOCUS_13040 gene pdxA 5310 4120 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_13040 6292 5351 gene locus_tag LOCUS_13050 6292 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7509 6469 gene locus_tag LOCUS_13060 gene rlmN 7509 6469 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_13060 7758 9578 gene locus_tag LOCUS_13070 7758 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9656 11023 gene locus_tag LOCUS_13080 9656 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 11354 11569 gene locus_tag LOCUS_13090 11354 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 <12421 11612 gene locus_tag LOCUS_13100 <12421 11612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202220.1:gliding motility lipoprotein GldB >Feature sequence083 134 727 gene locus_tag LOCUS_13110 134 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 807 1796 gene locus_tag LOCUS_13120 807 1796 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_13120 1875 1974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2180 3040 gene locus_tag LOCUS_13130 gene mreC 2180 3040 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_13130 3106 3609 gene locus_tag LOCUS_13140 gene mreD 3106 3609 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_13140 3606 5561 gene locus_tag LOCUS_13150 gene mrdA 3606 5561 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_13150 5573 7036 gene locus_tag LOCUS_13160 gene rodA 5573 7036 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_13160 7712 7140 gene locus_tag LOCUS_13170 7712 7140 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_13170 8291 7734 gene locus_tag LOCUS_13180 8291 7734 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_13180 8730 9200 gene locus_tag LOCUS_13190 8730 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 9279 9809 gene locus_tag LOCUS_13200 9279 9809 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_13200 9938 10159 gene locus_tag LOCUS_13210 9938 10159 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_13210 10556 11872 gene locus_tag LOCUS_13220 10556 11872 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence084 2903 321 gene locus_tag LOCUS_13230 gene feoB 2903 321 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_13230 3149 4108 gene locus_tag LOCUS_13240 gene ftsY 3149 4108 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_13240 4126 5424 gene locus_tag LOCUS_13250 gene rimO 4126 5424 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_13250 5441 5731 gene locus_tag LOCUS_13260 5441 5731 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_13260 5724 7100 gene locus_tag LOCUS_13270 5724 7100 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202863.1 protein_id gnl|my_center|LOCUS_13270 7361 8428 gene locus_tag LOCUS_13280 gene serC 7361 8428 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_13280 8491 9408 gene locus_tag LOCUS_13290 8491 9408 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_13290 9581 10828 gene locus_tag LOCUS_13300 9581 10828 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_13300 10834 11433 gene locus_tag LOCUS_13310 10834 11433 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_13310 11995 11495 gene locus_tag LOCUS_13320 11995 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence085 1843 2859 gene locus_tag LOCUS_13330 1843 2859 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_13330 2886 4190 gene locus_tag LOCUS_13340 2886 4190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_13340 4906 5067 gene locus_tag LOCUS_13350 4906 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5641 5922 gene locus_tag LOCUS_13360 gene citD 5641 5922 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 protein_id gnl|my_center|LOCUS_13360 6077 6946 gene locus_tag LOCUS_13370 gene citE 6077 6946 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_13370 6943 8484 gene locus_tag LOCUS_13380 gene citF 6943 8484 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 protein_id gnl|my_center|LOCUS_13380 8514 9071 gene locus_tag LOCUS_13390 gene citX 8514 9071 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018088.1 protein_id gnl|my_center|LOCUS_13390 9292 9747 gene locus_tag LOCUS_13400 gene tnpA 9292 9747 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_13400 10115 10480 gene locus_tag LOCUS_13410 10115 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13410 10658 11914 gene locus_tag LOCUS_13420 10658 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence086 1045 278 gene locus_tag LOCUS_13430 1045 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2602 1379 gene locus_tag LOCUS_13440 gene pepT 2602 1379 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_13440 4216 2648 gene locus_tag LOCUS_13450 4216 2648 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_13450 4787 4227 gene locus_tag LOCUS_13460 4787 4227 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_13460 5489 4818 gene locus_tag LOCUS_13470 5489 4818 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_13470 5694 6677 gene locus_tag LOCUS_13480 5694 6677 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_13480 6860 9502 gene locus_tag LOCUS_13490 6860 9502 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_13490 9578 11602 gene locus_tag LOCUS_13500 9578 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence087 48 4568 gene locus_tag LOCUS_13510 gene gltB 48 4568 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_13510 4757 6103 gene locus_tag LOCUS_13520 4757 6103 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_13520 7279 6515 gene locus_tag LOCUS_13530 7279 6515 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_13530 7652 7332 gene locus_tag LOCUS_13540 7652 7332 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_13540 8296 9570 gene locus_tag LOCUS_13550 8296 9570 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_13550 9659 10441 gene locus_tag LOCUS_13560 9659 10441 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence088 1034 66 gene locus_tag LOCUS_13570 gene ribD 1034 66 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_13570 1761 1102 gene locus_tag LOCUS_13580 1761 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1928 3427 gene locus_tag LOCUS_13590 1928 3427 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_13590 4609 3632 gene locus_tag LOCUS_13600 gene fmt 4609 3632 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_13600 4744 5313 gene locus_tag LOCUS_13610 4744 5313 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_13610 5380 7149 gene locus_tag LOCUS_13620 5380 7149 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_13620 7176 8612 gene locus_tag LOCUS_13630 7176 8612 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_13630 9322 8666 gene locus_tag LOCUS_13640 9322 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 9885 9319 gene locus_tag LOCUS_13650 9885 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 11610 10060 gene locus_tag LOCUS_13660 11610 10060 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence089 269 784 gene locus_tag LOCUS_13670 gene trxA 269 784 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_13670 877 5253 gene locus_tag LOCUS_13680 877 5253 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_13680 5330 7369 gene locus_tag LOCUS_13690 5330 7369 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_13690 7577 7996 gene locus_tag LOCUS_13700 7577 7996 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_13700 10037 8085 gene locus_tag LOCUS_13710 gene thrS 10037 8085 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_13710 10162 10839 gene locus_tag LOCUS_13720 gene trmD 10162 10839 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_13720 11313 10948 gene locus_tag LOCUS_13730 11313 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence090 692 2227 gene locus_tag LOCUS_13740 692 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2520 3500 gene locus_tag LOCUS_13750 2520 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4321 7629 gene locus_tag LOCUS_13760 4321 7629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_13760 7669 9321 gene locus_tag LOCUS_13770 7669 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9335 11299 gene locus_tag LOCUS_13780 9335 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence091 885 3158 gene locus_tag LOCUS_13790 885 3158 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_13790 3258 4469 gene locus_tag LOCUS_13800 3258 4469 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_13800 4553 5806 gene locus_tag LOCUS_13810 4553 5806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_13810 6036 7697 gene locus_tag LOCUS_13820 6036 7697 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_13820 7730 9388 gene locus_tag LOCUS_13830 7730 9388 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_13830 10248 9592 gene locus_tag LOCUS_13840 10248 9592 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_13840 11098 10307 gene locus_tag LOCUS_13850 gene nagB 11098 10307 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence092 37 615 gene locus_tag LOCUS_13860 37 615 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_13860 791 1786 gene locus_tag LOCUS_13870 791 1786 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_13870 1807 2676 gene locus_tag LOCUS_13880 1807 2676 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_13880 2767 3804 gene locus_tag LOCUS_13890 2767 3804 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_13890 3965 4867 gene locus_tag LOCUS_13900 3965 4867 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_13900 4882 5904 gene locus_tag LOCUS_13910 4882 5904 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_13910 6004 6639 gene locus_tag LOCUS_13920 6004 6639 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461640.1 protein_id gnl|my_center|LOCUS_13920 6703 9243 gene locus_tag LOCUS_13930 6703 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9367 9981 gene locus_tag LOCUS_13940 gene lpxF 9367 9981 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_13940 9988 11220 gene locus_tag LOCUS_13950 9988 11220 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence093 1038 1442 gene locus_tag LOCUS_13960 1038 1442 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_13960 1636 2673 gene locus_tag LOCUS_13970 gene asnA 1636 2673 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_13970 3459 2878 gene locus_tag LOCUS_13980 3459 2878 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_13980 4880 3507 gene locus_tag LOCUS_13990 4880 3507 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_13990 5614 4877 gene locus_tag LOCUS_14000 5614 4877 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_14000 5803 6387 gene locus_tag LOCUS_14010 5803 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 6403 6945 gene locus_tag LOCUS_14020 6403 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6942 8258 gene locus_tag LOCUS_14030 6942 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9073 8471 gene locus_tag LOCUS_14040 9073 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 9369 9175 gene locus_tag LOCUS_14050 9369 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 9511 10680 gene locus_tag LOCUS_14060 9511 10680 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence094 533 1084 gene locus_tag LOCUS_14070 533 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1233 1799 gene locus_tag LOCUS_14080 gene efp 1233 1799 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_14080 2067 3080 gene locus_tag LOCUS_14090 2067 3080 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_14090 3279 3378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3464 3832 gene locus_tag LOCUS_14100 3464 3832 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_14100 3965 4675 gene locus_tag LOCUS_14110 gene radC 3965 4675 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_14110 4987 4694 gene locus_tag LOCUS_14120 4987 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 6152 4935 gene locus_tag LOCUS_14130 6152 4935 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203233.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 7360 6332 gene locus_tag LOCUS_14140 7360 6332 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_14140 7492 8574 gene locus_tag LOCUS_14150 7492 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 8571 9794 gene locus_tag LOCUS_14160 8571 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 9812 10564 gene locus_tag LOCUS_14170 9812 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10572 11108 gene locus_tag LOCUS_14180 10572 11108 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence095 234 2231 gene locus_tag LOCUS_14190 234 2231 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_14190 5299 2519 gene locus_tag LOCUS_14200 5299 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 6039 5440 gene locus_tag LOCUS_14210 6039 5440 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_14210 7871 6090 gene locus_tag LOCUS_14220 gene lepA 7871 6090 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_14220 8029 8364 gene locus_tag LOCUS_14230 8029 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 9861 8704 gene locus_tag LOCUS_14240 gene nagA 9861 8704 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788940.1 protein_id gnl|my_center|LOCUS_14240 11079 9874 gene locus_tag LOCUS_14250 gene nagA 11079 9874 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765558.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence096 882 13 gene locus_tag LOCUS_14260 882 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2919 1021 gene locus_tag LOCUS_14270 2919 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3047 7228 gene locus_tag LOCUS_14280 3047 7228 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_14280 8795 7695 gene locus_tag LOCUS_14290 8795 7695 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_14290 9785 9081 gene locus_tag LOCUS_14300 9785 9081 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_14300 10044 9865 gene locus_tag LOCUS_14310 10044 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 <11053 9969 gene locus_tag LOCUS_14320 <11053 9969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555698.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence097 2618 144 gene locus_tag LOCUS_14330 2618 144 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_14330 2978 3496 gene locus_tag LOCUS_14340 2978 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3504 4007 gene locus_tag LOCUS_14350 3504 4007 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_14350 4049 4522 gene locus_tag LOCUS_14360 4049 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4519 7167 gene locus_tag LOCUS_14370 4519 7167 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_14370 7212 8135 gene locus_tag LOCUS_14380 7212 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8326 8835 gene locus_tag LOCUS_14390 8326 8835 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_14390 8892 9356 gene locus_tag LOCUS_14400 8892 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 9437 9862 gene locus_tag LOCUS_14410 9437 9862 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107465.1 protein_id gnl|my_center|LOCUS_14410 10687 9941 gene locus_tag LOCUS_14420 10687 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence098 533 120 gene locus_tag LOCUS_14430 gene tsaE 533 120 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_14430 2111 558 gene locus_tag LOCUS_14440 2111 558 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_14440 5464 2135 gene locus_tag LOCUS_14450 5464 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5926 5534 gene locus_tag LOCUS_14460 5926 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_14460 7237 5984 gene locus_tag LOCUS_14470 gene aroA 7237 5984 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_14470 7426 7500 gene locus_tag LOCUS_t00250 7426 7500 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7732 8502 gene locus_tag LOCUS_14480 7732 8502 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_14480 8697 10541 gene locus_tag LOCUS_14490 8697 10541 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence099 458 1000 gene locus_tag LOCUS_14500 458 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2840 1320 gene locus_tag LOCUS_14510 2840 1320 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_14510 3090 4646 gene locus_tag LOCUS_14520 3090 4646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_14520 8770 4796 gene locus_tag LOCUS_14530 8770 4796 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_14530 9447 8797 gene locus_tag LOCUS_14540 9447 8797 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_14540 10634 9606 gene locus_tag LOCUS_14550 10634 9606 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence100 61 552 gene locus_tag LOCUS_14560 gene resA 61 552 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_14560 686 2392 gene locus_tag LOCUS_14570 686 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2411 3229 gene locus_tag LOCUS_14580 2411 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3254 3952 gene locus_tag LOCUS_14590 3254 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4010 5908 gene locus_tag LOCUS_14600 4010 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 6439 6074 gene locus_tag LOCUS_14610 6439 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6996 6739 gene locus_tag LOCUS_14620 6996 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7210 8784 gene locus_tag LOCUS_14630 7210 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9115 9774 gene locus_tag LOCUS_14640 9115 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9731 10240 gene locus_tag LOCUS_14650 9731 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence101 576 926 gene locus_tag LOCUS_14660 576 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1032 2375 gene locus_tag LOCUS_14670 1032 2375 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461643.1 protein_id gnl|my_center|LOCUS_14670 2399 3961 gene locus_tag LOCUS_14680 2399 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4070 5062 gene locus_tag LOCUS_14690 4070 5062 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794256.1 protein_id gnl|my_center|LOCUS_14690 5125 7599 gene locus_tag LOCUS_14700 5125 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7596 10169 gene locus_tag LOCUS_14710 7596 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 10313 10510 gene locus_tag LOCUS_14720 10313 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence102 237 1964 gene locus_tag LOCUS_14730 gene recJ 237 1964 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_14730 1970 3874 gene locus_tag LOCUS_14740 1970 3874 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_14740 4070 5422 gene locus_tag LOCUS_14750 gene ffh 4070 5422 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_14750 5436 6314 gene locus_tag LOCUS_14760 gene folD 5436 6314 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_14760 6343 6522 gene locus_tag LOCUS_14770 6343 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 6591 6824 gene locus_tag LOCUS_14780 6591 6824 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_14780 6830 7912 gene locus_tag LOCUS_14790 6830 7912 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_14790 7909 8673 gene locus_tag LOCUS_14800 7909 8673 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_14800 8670 9224 gene locus_tag LOCUS_14810 8670 9224 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_14810 9541 9374 gene locus_tag LOCUS_14820 9541 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9578 9677 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence103 139 66 gene locus_tag LOCUS_t00260 139 66 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1177 332 gene locus_tag LOCUS_14830 1177 332 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_14830 1396 1211 gene locus_tag LOCUS_14840 1396 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3887 1584 gene locus_tag LOCUS_14850 3887 1584 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_14850 8530 3917 gene locus_tag LOCUS_14860 8530 3917 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_14860 8881 10323 gene locus_tag LOCUS_14870 8881 10323 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence104 6407 5061 gene locus_tag LOCUS_14880 6407 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 7402 6413 gene locus_tag LOCUS_14890 7402 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8438 7509 gene locus_tag LOCUS_14900 8438 7509 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence105 94 1110 gene locus_tag LOCUS_14910 94 1110 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_14910 1688 4276 gene locus_tag LOCUS_14920 gene clpB 1688 4276 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_14920 4569 6314 gene locus_tag LOCUS_14930 gene lysS 4569 6314 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_14930 6392 7387 gene locus_tag LOCUS_14940 6392 7387 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_14940 7403 7624 gene locus_tag LOCUS_14950 7403 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7888 9246 gene locus_tag LOCUS_14960 7888 9246 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_14960 9390 10133 gene locus_tag LOCUS_14970 9390 10133 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence106 968 402 gene locus_tag LOCUS_14980 gene pdxT 968 402 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_14980 1864 989 gene locus_tag LOCUS_14990 gene pdxS 1864 989 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138517.1 protein_id gnl|my_center|LOCUS_14990 4038 1903 gene locus_tag LOCUS_15000 4038 1903 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_15000 4933 4046 gene locus_tag LOCUS_15010 gene fabD 4933 4046 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_15010 5120 6004 gene locus_tag LOCUS_15020 5120 6004 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_15020 8571 6145 gene locus_tag LOCUS_15030 8571 6145 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_15030 9255 8629 gene locus_tag LOCUS_15040 gene mtgA 9255 8629 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_15040 <10236 9552 gene locus_tag LOCUS_15050 <10236 9552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765906.1:OmpA family protein >Feature sequence107 1381 218 gene locus_tag LOCUS_15060 1381 218 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760938.1 protein_id gnl|my_center|LOCUS_15060 2646 1426 gene locus_tag LOCUS_15070 2646 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3172 2762 gene locus_tag LOCUS_15080 3172 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3889 3212 gene locus_tag LOCUS_15090 3889 3212 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_15090 4729 3971 gene locus_tag LOCUS_15100 gene fabG 4729 3971 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_15100 5273 4761 gene locus_tag LOCUS_15110 5273 4761 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108963.1 protein_id gnl|my_center|LOCUS_15110 6652 5528 gene locus_tag LOCUS_15120 6652 5528 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_15120 7311 6712 gene locus_tag LOCUS_15130 7311 6712 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_15130 7408 8229 gene locus_tag LOCUS_15140 gene rsmI 7408 8229 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_15140 8290 9144 gene locus_tag LOCUS_15150 8290 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_15150 10171 9266 gene locus_tag LOCUS_15160 10171 9266 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence108 1580 45 gene locus_tag LOCUS_15170 gene rny 1580 45 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_15170 1950 1645 gene locus_tag LOCUS_15180 1950 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2268 1963 gene locus_tag LOCUS_15190 2268 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2980 2348 gene locus_tag LOCUS_15200 2980 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760131.1 protein_id gnl|my_center|LOCUS_15200 3268 4152 gene locus_tag LOCUS_15210 gene rfbA 3268 4152 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_15210 4235 6769 gene locus_tag LOCUS_15220 4235 6769 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_15220 6804 7232 gene locus_tag LOCUS_15230 6804 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_15230 8773 7316 gene locus_tag LOCUS_15240 8773 7316 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_15240 9848 8853 gene locus_tag LOCUS_15250 9848 8853 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence109 60 1619 gene locus_tag LOCUS_15260 60 1619 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_15260 1694 2392 gene locus_tag LOCUS_15270 1694 2392 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_15270 2747 5086 gene locus_tag LOCUS_15280 2747 5086 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_15280 5102 6346 gene locus_tag LOCUS_15290 5102 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7160 6375 gene locus_tag LOCUS_15300 7160 6375 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107473.1 protein_id gnl|my_center|LOCUS_15300 7326 8438 gene locus_tag LOCUS_15310 7326 8438 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_15310 8464 8994 gene locus_tag LOCUS_15320 8464 8994 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107470.1 protein_id gnl|my_center|LOCUS_15320 9794 9090 gene locus_tag LOCUS_15330 9794 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence110 1226 126 gene locus_tag LOCUS_15340 1226 126 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791792.1 protein_id gnl|my_center|LOCUS_15340 3371 1437 gene locus_tag LOCUS_15350 gene mutL 3371 1437 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_15350 3644 3402 gene locus_tag LOCUS_15360 3644 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5495 3813 gene locus_tag LOCUS_15370 5495 3813 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_15370 6929 5517 gene locus_tag LOCUS_15380 6929 5517 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_15380 8485 7061 gene locus_tag LOCUS_15390 8485 7061 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108995.1 protein_id gnl|my_center|LOCUS_15390 <9966 8630 gene locus_tag LOCUS_15400 <9966 8630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791859.1:IMP dehydrogenase >Feature sequence111 <1 1305 gene locus_tag LOCUS_15410 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839735.1:serpin family protein 2345 1374 gene locus_tag LOCUS_15420 2345 1374 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_15420 3938 2352 gene locus_tag LOCUS_15430 gene atpA 3938 2352 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107412.1 protein_id gnl|my_center|LOCUS_15430 4490 3957 gene locus_tag LOCUS_15440 gene atpH 4490 3957 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_15440 5018 4500 gene locus_tag LOCUS_15450 gene atpF 5018 4500 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_15450 5311 5069 gene locus_tag LOCUS_15460 5311 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6371 5361 gene locus_tag LOCUS_15470 gene atpB 6371 5361 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_15470 6851 6423 gene locus_tag LOCUS_15480 6851 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7109 6867 gene locus_tag LOCUS_15490 7109 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8665 7139 gene locus_tag LOCUS_15500 gene atpD 8665 7139 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_15500 <9800 8818 gene locus_tag LOCUS_15510 <9800 8818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004295279.1:6-phosphofructokinase >Feature sequence112 1443 85 gene locus_tag LOCUS_15520 gene hisS 1443 85 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_15520 2732 1455 gene locus_tag LOCUS_15530 2732 1455 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_15530 3309 2839 gene locus_tag LOCUS_15540 3309 2839 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767710.1 protein_id gnl|my_center|LOCUS_15540 3968 3354 gene locus_tag LOCUS_15550 3968 3354 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_15550 6048 4054 gene locus_tag LOCUS_15560 6048 4054 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_15560 6497 6090 gene locus_tag LOCUS_15570 6497 6090 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789808.1 protein_id gnl|my_center|LOCUS_15570 8444 6516 gene locus_tag LOCUS_15580 8444 6516 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_15580 9678 8464 gene locus_tag LOCUS_15590 9678 8464 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence113 841 1884 gene locus_tag LOCUS_15600 841 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1994 3901 gene locus_tag LOCUS_15610 1994 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3999 6077 gene locus_tag LOCUS_15620 3999 6077 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_15620 6282 8267 gene locus_tag LOCUS_15630 6282 8267 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_15630 8413 9537 gene locus_tag LOCUS_15640 8413 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence114 2439 796 gene locus_tag LOCUS_15650 2439 796 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_15650 3290 2442 gene locus_tag LOCUS_15660 gene nadC 3290 2442 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_15660 3523 3317 gene locus_tag LOCUS_15670 3523 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4591 3548 gene locus_tag LOCUS_15680 4591 3548 CDS product DUF4296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660240.1 protein_id gnl|my_center|LOCUS_15680 5190 4579 gene locus_tag LOCUS_15690 5190 4579 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_15690 5600 5220 gene locus_tag LOCUS_15700 5600 5220 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_15700 9302 5679 gene locus_tag LOCUS_15710 gene ileS 9302 5679 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence115 <1 785 gene locus_tag LOCUS_15720 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002292818.1:type I glyceraldehyde-3-phosphate dehydrogenase 950 1876 gene locus_tag LOCUS_15730 gene miaA 950 1876 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_15730 1884 2816 gene locus_tag LOCUS_15740 1884 2816 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785352.1 protein_id gnl|my_center|LOCUS_15740 3772 3071 gene locus_tag LOCUS_15750 3772 3071 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_15750 4068 6014 gene locus_tag LOCUS_15760 4068 6014 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_15760 6036 7307 gene locus_tag LOCUS_15770 6036 7307 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_15770 7350 8765 gene locus_tag LOCUS_15780 7350 8765 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_15780 9210 9428 gene locus_tag LOCUS_15790 9210 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence116 487 586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 752 1663 gene locus_tag LOCUS_15800 752 1663 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_15800 1759 3003 gene locus_tag LOCUS_15810 gene serB 1759 3003 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_15810 4792 3158 gene locus_tag LOCUS_15820 4792 3158 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_15820 6423 4876 gene locus_tag LOCUS_15830 6423 4876 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_15830 7470 6478 gene locus_tag LOCUS_15840 7470 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 9053 7524 gene locus_tag LOCUS_15850 9053 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence117 960 2693 gene locus_tag LOCUS_15860 960 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2709 4889 gene locus_tag LOCUS_15870 2709 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5182 5583 gene locus_tag LOCUS_15880 5182 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5973 5641 gene locus_tag LOCUS_15890 5973 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6978 6022 gene locus_tag LOCUS_15900 6978 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 8191 7004 gene locus_tag LOCUS_15910 8191 7004 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_15910 <9094 8210 gene locus_tag LOCUS_15920 <9094 8210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795082.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence118 427 3573 gene locus_tag LOCUS_15930 427 3573 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_15930 3595 5340 gene locus_tag LOCUS_15940 3595 5340 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_15940 5461 7422 gene locus_tag LOCUS_15950 5461 7422 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_15950 7429 8670 gene locus_tag LOCUS_15960 7429 8670 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence119 <1 893 gene locus_tag LOCUS_15970 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064705.1:patatin-like phospholipase family protein 2994 1408 gene locus_tag LOCUS_15980 2994 1408 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764305.1 protein_id gnl|my_center|LOCUS_15980 3257 5575 gene locus_tag LOCUS_15990 3257 5575 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_15990 5628 7814 gene locus_tag LOCUS_16000 5628 7814 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_16000 8790 8293 gene locus_tag LOCUS_16010 8790 8293 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203406.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence120 193 1998 gene locus_tag LOCUS_16020 193 1998 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_16020 2008 3126 gene locus_tag LOCUS_16030 gene prfB 2008 3126 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_16030 3165 3347 gene locus_tag LOCUS_16040 3165 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3409 3891 gene locus_tag LOCUS_16050 3409 3891 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_16050 5164 3986 gene locus_tag LOCUS_16060 5164 3986 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_16060 5343 5567 gene locus_tag LOCUS_16070 5343 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 5603 6226 gene locus_tag LOCUS_16080 5603 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6615 6238 gene locus_tag LOCUS_16090 gene crcB 6615 6238 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence121 193 921 gene locus_tag LOCUS_16100 193 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1417 1205 gene locus_tag LOCUS_16110 1417 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4284 1543 gene locus_tag LOCUS_16120 4284 1543 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_16120 6386 4803 gene locus_tag LOCUS_16130 6386 4803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_16130 8615 6564 gene locus_tag LOCUS_16140 8615 6564 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence122 121 423 gene locus_tag LOCUS_16150 121 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 428 1105 gene locus_tag LOCUS_16160 428 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1420 2439 gene locus_tag LOCUS_16170 1420 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2852 4045 gene locus_tag LOCUS_16180 2852 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4504 4680 gene locus_tag LOCUS_16190 4504 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4677 5036 gene locus_tag LOCUS_16200 4677 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5306 6634 gene locus_tag LOCUS_16210 5306 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6641 7627 gene locus_tag LOCUS_16220 6641 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8029 8244 gene locus_tag LOCUS_16230 8029 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence123 8174 294 gene locus_tag LOCUS_16240 8174 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence124 1784 474 gene locus_tag LOCUS_16250 1784 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3489 1957 gene locus_tag LOCUS_16260 3489 1957 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_16260 6291 3601 gene locus_tag LOCUS_16270 6291 3601 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765337.1 protein_id gnl|my_center|LOCUS_16270 6889 6437 gene locus_tag LOCUS_16280 6889 6437 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_16280 7230 7538 gene locus_tag LOCUS_16290 7230 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence125 85 573 gene locus_tag LOCUS_16300 85 573 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786521.1 protein_id gnl|my_center|LOCUS_16300 604 1020 gene locus_tag LOCUS_16310 gene ruvX 604 1020 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_16310 1037 1600 gene locus_tag LOCUS_16320 gene def 1037 1600 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_16320 1811 3751 gene locus_tag LOCUS_16330 1811 3751 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_16330 3748 5253 gene locus_tag LOCUS_16340 3748 5253 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_16340 7764 5551 gene locus_tag LOCUS_16350 7764 5551 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence126 186 899 gene locus_tag LOCUS_16360 186 899 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_16360 896 1906 gene locus_tag LOCUS_16370 896 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2321 2330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3143 4132 gene locus_tag LOCUS_16380 gene nadA 3143 4132 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_16380 4152 4877 gene locus_tag LOCUS_16390 4152 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4958 6445 gene locus_tag LOCUS_16400 gene cysS 4958 6445 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_16400 6547 6969 gene locus_tag LOCUS_16410 6547 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 7051 7749 gene locus_tag LOCUS_16420 7051 7749 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence127 <1 1786 gene locus_tag LOCUS_16430 <1 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108773.1:RagB/SusD family nutrient uptake outer membrane protein 1865 2932 gene locus_tag LOCUS_16440 1865 2932 CDS product DUF5017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108772.1 protein_id gnl|my_center|LOCUS_16440 3396 6392 gene locus_tag LOCUS_16450 3396 6392 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_16450 6529 7800 gene locus_tag LOCUS_16460 6529 7800 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence128 263 1078 gene locus_tag LOCUS_16470 263 1078 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_16470 1171 1917 gene locus_tag LOCUS_16480 1171 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1929 2288 gene locus_tag LOCUS_16490 1929 2288 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_16490 2325 3320 gene locus_tag LOCUS_16500 2325 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4481 3393 gene locus_tag LOCUS_16510 gene trpS 4481 3393 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_16510 4857 5339 gene locus_tag LOCUS_16520 4857 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5329 6675 gene locus_tag LOCUS_16530 5329 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 6591 7511 gene locus_tag LOCUS_16540 6591 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence129 2287 71 gene locus_tag LOCUS_16550 2287 71 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107414.1 protein_id gnl|my_center|LOCUS_16550 2481 3263 gene locus_tag LOCUS_16560 2481 3263 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_16560 3416 6127 gene locus_tag LOCUS_16570 3416 6127 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_16570 6233 7414 gene locus_tag LOCUS_16580 6233 7414 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence130 108 662 gene locus_tag LOCUS_16590 108 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 783 1145 gene locus_tag LOCUS_16600 783 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1148 2512 gene locus_tag LOCUS_16610 1148 2512 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_16610 2516 3151 gene locus_tag LOCUS_16620 2516 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4399 3245 gene locus_tag LOCUS_16630 4399 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 6453 4399 gene locus_tag LOCUS_16640 6453 4399 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_16640 7608 6526 gene locus_tag LOCUS_16650 7608 6526 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765612.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence131 99 1790 gene locus_tag LOCUS_16660 gene thiC 99 1790 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_16660 1791 2489 gene locus_tag LOCUS_16670 1791 2489 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107370.1 protein_id gnl|my_center|LOCUS_16670 2505 3647 gene locus_tag LOCUS_16680 gene thiH 2505 3647 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_16680 3750 4910 gene locus_tag LOCUS_16690 3750 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5028 6446 gene locus_tag LOCUS_16700 gene rlmD 5028 6446 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_16700 6463 7596 gene locus_tag LOCUS_16710 6463 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence132 4620 757 gene locus_tag LOCUS_16720 4620 757 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_16720 5050 6123 gene locus_tag LOCUS_16730 5050 6123 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_16730 6189 7622 gene locus_tag LOCUS_16740 6189 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence133 1345 785 gene locus_tag LOCUS_16750 1345 785 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_16750 4024 1499 gene locus_tag LOCUS_16760 4024 1499 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_16760 4176 4820 gene locus_tag LOCUS_16770 4176 4820 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_16770 4856 6037 gene locus_tag LOCUS_16780 4856 6037 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_16780 6178 7431 gene locus_tag LOCUS_16790 gene tilS 6178 7431 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence134 <1 905 gene locus_tag LOCUS_16800 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791746.1:translation elongation factor Ts 1071 1688 gene locus_tag LOCUS_16810 1071 1688 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_16810 1877 5452 gene locus_tag LOCUS_16820 gene porU 1877 5452 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_16820 5612 6793 gene locus_tag LOCUS_16830 gene porV 5612 6793 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_16830 6802 7284 gene locus_tag LOCUS_16840 gene ispF 6802 7284 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence135 4 2001 gene locus_tag LOCUS_16850 gene rho 4 2001 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107884.1 protein_id gnl|my_center|LOCUS_16850 2003 4816 gene locus_tag LOCUS_16860 gene uvrA 2003 4816 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_16860 6075 4915 gene locus_tag LOCUS_16870 gene galK 6075 4915 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_16870 <7366 6166 gene locus_tag LOCUS_16880 <7366 6166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786507.1:MFS transporter >Feature sequence136 171 1844 gene locus_tag LOCUS_16890 171 1844 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_16890 1772 1781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2577 1852 gene locus_tag LOCUS_16900 2577 1852 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_16900 3862 2594 gene locus_tag LOCUS_16910 3862 2594 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_16910 4130 5002 gene locus_tag LOCUS_16920 4130 5002 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_16920 5297 5683 gene locus_tag LOCUS_16930 5297 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5984 6922 gene locus_tag LOCUS_16940 5984 6922 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence137 177 1046 gene locus_tag LOCUS_16950 177 1046 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_16950 1193 2215 gene locus_tag LOCUS_16960 1193 2215 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_16960 2748 4454 gene locus_tag LOCUS_16970 2748 4454 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_16970 6966 4642 gene locus_tag LOCUS_16980 6966 4642 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence138 2100 5393 gene locus_tag LOCUS_16990 2100 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence139 35 1933 gene locus_tag LOCUS_17000 gene yidC 35 1933 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_17000 2078 4246 gene locus_tag LOCUS_17010 2078 4246 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_17010 4277 5692 gene locus_tag LOCUS_17020 4277 5692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_17020 7027 5900 gene locus_tag LOCUS_17030 7027 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107960.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence140 148 1173 gene locus_tag LOCUS_17040 148 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1503 4214 gene locus_tag LOCUS_17050 1503 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4311 5312 gene locus_tag LOCUS_17060 4311 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5326 5493 gene locus_tag LOCUS_17070 5326 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5643 5561 gene locus_tag LOCUS_t00270 5643 5561 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5841 6935 gene locus_tag LOCUS_17080 5841 6935 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence141 1518 286 gene locus_tag LOCUS_17090 1518 286 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_17090 4296 1720 gene locus_tag LOCUS_17100 4296 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5119 4688 gene locus_tag LOCUS_17110 5119 4688 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107247.1 protein_id gnl|my_center|LOCUS_17110 6224 5211 gene locus_tag LOCUS_17120 6224 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence142 126 3341 gene locus_tag LOCUS_17130 126 3341 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203145.1 protein_id gnl|my_center|LOCUS_17130 3384 5318 gene locus_tag LOCUS_17140 3384 5318 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788911.1 protein_id gnl|my_center|LOCUS_17140 5351 6247 gene locus_tag LOCUS_17150 5351 6247 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788909.1 protein_id gnl|my_center|LOCUS_17150 6500 6366 gene locus_tag LOCUS_17160 6500 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence143 480 133 gene locus_tag LOCUS_17170 480 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 721 470 gene locus_tag LOCUS_17180 721 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 957 1307 gene locus_tag LOCUS_17190 957 1307 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_17190 2846 1548 gene locus_tag LOCUS_17200 2846 1548 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_17200 5403 3268 gene locus_tag LOCUS_17210 gene dcp 5403 3268 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_17210 5886 5488 gene locus_tag LOCUS_17220 5886 5488 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_17220 6667 5906 gene locus_tag LOCUS_17230 6667 5906 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence144 1738 551 gene locus_tag LOCUS_17240 1738 551 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_17240 2091 2873 gene locus_tag LOCUS_17250 2091 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2912 3430 gene locus_tag LOCUS_17260 2912 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3427 4110 gene locus_tag LOCUS_17270 3427 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4160 5104 gene locus_tag LOCUS_17280 4160 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6361 5501 gene locus_tag LOCUS_17290 6361 5501 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence145 113 1027 gene locus_tag LOCUS_17300 113 1027 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_17300 1672 1256 gene locus_tag LOCUS_17310 1672 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2116 5220 gene locus_tag LOCUS_17320 2116 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5380 6405 gene locus_tag LOCUS_17330 5380 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence146 1720 155 gene locus_tag LOCUS_17340 1720 155 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_17340 4153 1841 gene locus_tag LOCUS_17350 4153 1841 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_17350 4420 5121 gene locus_tag LOCUS_17360 4420 5121 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_17360 5138 5959 gene locus_tag LOCUS_17370 5138 5959 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence147 >Feature sequence148 25 876 gene locus_tag LOCUS_17380 gene cas7c 25 876 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_17380 884 1555 gene locus_tag LOCUS_17390 gene cas4 884 1555 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_17390 1539 2561 gene locus_tag LOCUS_17400 gene cas1c 1539 2561 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_17400 2565 2855 gene locus_tag LOCUS_17410 gene cas2 2565 2855 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263664.1 protein_id gnl|my_center|LOCUS_17410 3058 3157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3158 5947 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccctacgtgggtgcgtggattgaaac >Feature sequence149 247 74 gene locus_tag LOCUS_17420 247 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 656 456 gene locus_tag LOCUS_17430 656 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2557 689 gene locus_tag LOCUS_17440 2557 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3076 6267 gene locus_tag LOCUS_17450 3076 6267 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence150 <1 1042 gene locus_tag LOCUS_17460 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789293.1:phenylalanine--tRNA ligase subunit alpha 1312 2097 gene locus_tag LOCUS_17470 gene kdsA 1312 2097 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_17470 2094 3089 gene locus_tag LOCUS_17480 2094 3089 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_17480 3100 4371 gene locus_tag LOCUS_17490 gene cls 3100 4371 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766459.1 protein_id gnl|my_center|LOCUS_17490 6059 4485 gene locus_tag LOCUS_17500 6059 4485 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence151 210 2336 gene locus_tag LOCUS_17510 210 2336 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_17510 3686 2403 gene locus_tag LOCUS_17520 3686 2403 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_17520 3852 4268 gene locus_tag LOCUS_17530 3852 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5393 4449 gene locus_tag LOCUS_17540 5393 4449 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_17540 6026 5436 gene locus_tag LOCUS_17550 6026 5436 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence152 644 342 gene locus_tag LOCUS_17560 644 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 901 2685 gene locus_tag LOCUS_17570 901 2685 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_17570 2886 3659 gene locus_tag LOCUS_17580 2886 3659 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_17580 3680 4408 gene locus_tag LOCUS_17590 3680 4408 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_17590 4625 5446 gene locus_tag LOCUS_17600 4625 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5834 6184 gene locus_tag LOCUS_17610 5834 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence153 1282 1968 gene locus_tag LOCUS_17620 1282 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2210 1989 gene locus_tag LOCUS_17630 2210 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2680 2207 gene locus_tag LOCUS_17640 2680 2207 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_17640 2901 2677 gene locus_tag LOCUS_17650 2901 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5194 3107 gene locus_tag LOCUS_17660 5194 3107 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_17660 6084 5575 gene locus_tag LOCUS_17670 gene rplI 6084 5575 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence154 43 2631 gene locus_tag LOCUS_17680 gene gyrA 43 2631 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_17680 2690 3862 gene locus_tag LOCUS_17690 2690 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3913 5172 gene locus_tag LOCUS_17700 3913 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5744 5334 gene locus_tag LOCUS_17710 5744 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5981 5802 gene locus_tag LOCUS_17720 5981 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence155 <1 3278 gene locus_tag LOCUS_17730 <1 3278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582820.1:pectinesterase family protein >Feature sequence156 553 341 gene locus_tag LOCUS_17740 553 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1234 776 gene locus_tag LOCUS_17750 1234 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 <6044 1384 gene locus_tag LOCUS_17760 <6044 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956992.1:toxin TcdB middle/N-terminal domain-containing protein >Feature sequence157 865 3321 gene locus_tag LOCUS_17770 865 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3450 5936 gene locus_tag LOCUS_17780 3450 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence158 2931 40 gene locus_tag LOCUS_17790 2931 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3997 3002 gene locus_tag LOCUS_17800 3997 3002 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_17800 5871 4165 gene locus_tag LOCUS_17810 5871 4165 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107602.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence159 122 2140 gene locus_tag LOCUS_17820 122 2140 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_17820 2218 2655 gene locus_tag LOCUS_17830 gene rpiB 2218 2655 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_17830 2838 5351 gene locus_tag LOCUS_17840 2838 5351 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_17840 5513 5830 gene locus_tag LOCUS_17850 gene rplU 5513 5830 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence160 <1 1049 gene locus_tag LOCUS_17860 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789841.1:3-isopropylmalate dehydrogenase 1930 1424 gene locus_tag LOCUS_17870 1930 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2169 1927 gene locus_tag LOCUS_17880 2169 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2583 3200 gene locus_tag LOCUS_17890 2583 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4040 3234 gene locus_tag LOCUS_17900 4040 3234 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_17900 4242 5858 gene locus_tag LOCUS_17910 4242 5858 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence161 2864 1434 gene locus_tag LOCUS_17920 2864 1434 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_17920 2881 2980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5614 3602 gene locus_tag LOCUS_17930 gene nuoL 5614 3602 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence162 9 1298 gene locus_tag LOCUS_17940 gene serS 9 1298 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_17940 1463 3817 gene locus_tag LOCUS_17950 1463 3817 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_17950 3942 4307 gene locus_tag LOCUS_17960 3942 4307 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_17960 4351 5064 gene locus_tag LOCUS_17970 4351 5064 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence163 787 248 gene locus_tag LOCUS_17980 787 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2804 1275 gene locus_tag LOCUS_17990 2804 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4491 3019 gene locus_tag LOCUS_18000 4491 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5625 4633 gene locus_tag LOCUS_18010 5625 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence164 472 1077 gene locus_tag LOCUS_18020 472 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1858 1957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2050 2787 gene locus_tag LOCUS_18030 2050 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2787 5567 gene locus_tag LOCUS_18040 2787 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence165 <1 1373 gene locus_tag LOCUS_18050 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005680409.1:imelysin family protein 1461 3221 gene locus_tag LOCUS_18060 1461 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3238 5523 gene locus_tag LOCUS_18070 gene ccsA 3238 5523 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence166 617 120 gene locus_tag LOCUS_18080 617 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2204 681 gene locus_tag LOCUS_18090 2204 681 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_18090 2800 2231 gene locus_tag LOCUS_18100 gene ruvC 2800 2231 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062938.1 protein_id gnl|my_center|LOCUS_18100 3451 2810 gene locus_tag LOCUS_18110 3451 2810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_18110 4165 3542 gene locus_tag LOCUS_18120 gene rsmG 4165 3542 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_18120 5525 4338 gene locus_tag LOCUS_18130 gene kbl 5525 4338 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence167 1351 200 gene locus_tag LOCUS_18140 1351 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1501 2352 gene locus_tag LOCUS_18150 gene hisG 1501 2352 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_18150 2379 3668 gene locus_tag LOCUS_18160 gene hisD 2379 3668 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_18160 3674 4714 gene locus_tag LOCUS_18170 gene hisC 3674 4714 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence168 144 965 gene locus_tag LOCUS_18180 gene panB 144 965 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765576.1 protein_id gnl|my_center|LOCUS_18180 965 2161 gene locus_tag LOCUS_18190 965 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2204 2542 gene locus_tag LOCUS_18200 2204 2542 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_18200 2546 3910 gene locus_tag LOCUS_18210 2546 3910 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_18210 4020 4940 gene locus_tag LOCUS_18220 4020 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5098 5388 gene locus_tag LOCUS_18230 5098 5388 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence169 69 1538 gene locus_tag LOCUS_18240 69 1538 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_18240 2160 3023 gene locus_tag LOCUS_18250 2160 3023 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_18250 3095 3550 gene locus_tag LOCUS_18260 3095 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107702.1 protein_id gnl|my_center|LOCUS_18260 3554 4495 gene locus_tag LOCUS_18270 3554 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_18270 4523 5026 gene locus_tag LOCUS_18280 4523 5026 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_18280 5096 5362 gene locus_tag LOCUS_18290 5096 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence170 33 446 gene locus_tag LOCUS_18300 33 446 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_18300 503 1696 gene locus_tag LOCUS_18310 503 1696 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_18310 <5403 1762 gene locus_tag LOCUS_18320 <5403 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459235.1:RecQ family ATP-dependent DNA helicase >Feature sequence171 521 252 gene locus_tag LOCUS_18330 gene rpsO 521 252 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_18330 1680 664 gene locus_tag LOCUS_18340 1680 664 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_18340 5075 1917 gene locus_tag LOCUS_18350 5075 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence172 1155 193 gene locus_tag LOCUS_18360 1155 193 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_18360 2430 1168 gene locus_tag LOCUS_18370 2430 1168 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_18370 3205 2447 gene locus_tag LOCUS_18380 3205 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4003 3245 gene locus_tag LOCUS_18390 gene proC 4003 3245 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_18390 5199 4054 gene locus_tag LOCUS_18400 5199 4054 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence173 1057 785 gene locus_tag LOCUS_18410 1057 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 <5270 1083 gene locus_tag LOCUS_18420 <5270 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674637.1:collagen-like protein 3187 3286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence174 456 773 gene locus_tag LOCUS_18430 456 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18430 3098 1476 gene locus_tag LOCUS_18440 3098 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4991 3129 gene locus_tag LOCUS_18450 4991 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence175 3122 654 gene locus_tag LOCUS_18460 3122 654 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_18460 4543 3272 gene locus_tag LOCUS_18470 gene nqrF 4543 3272 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_18470 5140 4562 gene locus_tag LOCUS_18480 gene nqrE 5140 4562 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence176 136 2430 gene locus_tag LOCUS_18490 136 2430 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766169.1 protein_id gnl|my_center|LOCUS_18490 2728 2534 gene locus_tag LOCUS_18500 2728 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2982 4955 gene locus_tag LOCUS_18510 2982 4955 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence177 314 1144 gene locus_tag LOCUS_18520 314 1144 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_18520 1131 2363 gene locus_tag LOCUS_18530 1131 2363 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_18530 2378 3445 gene locus_tag LOCUS_18540 2378 3445 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_18540 3583 4419 gene locus_tag LOCUS_18550 3583 4419 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence178 861 427 gene locus_tag LOCUS_18560 861 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 988 1569 gene locus_tag LOCUS_18570 988 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1654 2409 gene locus_tag LOCUS_18580 1654 2409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_18580 2393 3217 gene locus_tag LOCUS_18590 2393 3217 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786594.1 protein_id gnl|my_center|LOCUS_18590 3415 5166 gene locus_tag LOCUS_18600 3415 5166 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence179 1116 190 gene locus_tag LOCUS_18610 gene queG 1116 190 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_18610 1715 1164 gene locus_tag LOCUS_18620 1715 1164 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_18620 5104 1772 gene locus_tag LOCUS_18630 5104 1772 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence180 2404 182 gene locus_tag LOCUS_18640 2404 182 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_18640 2606 4072 gene locus_tag LOCUS_18650 2606 4072 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_18650 4981 4127 gene locus_tag LOCUS_18660 4981 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence181 311 3250 gene locus_tag LOCUS_18670 311 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3447 4928 gene locus_tag LOCUS_18680 3447 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence182 1323 586 gene locus_tag LOCUS_18690 1323 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1814 1320 gene locus_tag LOCUS_18700 1814 1320 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_18700 1974 2867 gene locus_tag LOCUS_18710 1974 2867 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676321.1 protein_id gnl|my_center|LOCUS_18710 3110 4678 gene locus_tag LOCUS_18720 3110 4678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence183 1531 98 gene locus_tag LOCUS_18730 1531 98 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_18730 1946 1668 gene locus_tag LOCUS_18740 1946 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2344 2703 gene locus_tag LOCUS_18750 2344 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2939 4522 gene locus_tag LOCUS_18760 2939 4522 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795907.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence184 161 1240 gene locus_tag LOCUS_18770 161 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1968 1345 gene locus_tag LOCUS_18780 1968 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3205 2066 gene locus_tag LOCUS_18790 gene araJ 3205 2066 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_18790 3438 3890 gene locus_tag LOCUS_18800 3438 3890 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_18800 3941 4501 gene locus_tag LOCUS_18810 3941 4501 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence185 4286 237 gene locus_tag LOCUS_18820 4286 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence186 <1 662 gene locus_tag LOCUS_18830 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964066.1:nitroreductase family protein 1300 752 gene locus_tag LOCUS_18840 1300 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4583 1359 gene locus_tag LOCUS_18850 gene carB 4583 1359 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence187 1905 439 gene locus_tag LOCUS_18860 1905 439 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_18860 2357 2214 gene locus_tag LOCUS_18870 2357 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 <4540 2380 gene locus_tag LOCUS_18880 <4540 2380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence188 965 30 gene locus_tag LOCUS_18890 965 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 <4509 1007 gene locus_tag LOCUS_18900 <4509 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459235.1:RecQ family ATP-dependent DNA helicase >Feature sequence189 170 1522 gene locus_tag LOCUS_18910 170 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1549 2943 gene locus_tag LOCUS_18920 1549 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3078 3004 gene locus_tag LOCUS_t00280 3078 3004 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4466 3276 gene locus_tag LOCUS_18930 4466 3276 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence190 3 2345 gene locus_tag LOCUS_18940 3 2345 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_18940 2374 4200 gene locus_tag LOCUS_18950 2374 4200 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence191 96 3836 gene locus_tag LOCUS_18960 gene dnaE 96 3836 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_18960 3966 4280 gene locus_tag LOCUS_18970 gene trxA 3966 4280 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence192 4320 307 gene locus_tag LOCUS_18980 4320 307 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence193 582 1550 gene locus_tag LOCUS_18990 582 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2877 1663 gene locus_tag LOCUS_19000 2877 1663 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765419.1 protein_id gnl|my_center|LOCUS_19000 <4361 2890 gene locus_tag LOCUS_19010 <4361 2890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791502.1:glutamate--tRNA ligase >Feature sequence194 805 1284 gene locus_tag LOCUS_19020 805 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1435 2316 gene locus_tag LOCUS_19030 1435 2316 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788700.1 protein_id gnl|my_center|LOCUS_19030 2313 2816 gene locus_tag LOCUS_19040 2313 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2830 3027 gene locus_tag LOCUS_19050 2830 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3020 3982 gene locus_tag LOCUS_19060 3020 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence195 1360 230 gene locus_tag LOCUS_19070 gene dprA 1360 230 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_19070 2838 1375 gene locus_tag LOCUS_19080 2838 1375 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_19080 3104 4162 gene locus_tag LOCUS_19090 3104 4162 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence196 511 1566 gene locus_tag LOCUS_19100 511 1566 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_19100 4087 1709 gene locus_tag LOCUS_19110 4087 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence197 <1 988 gene locus_tag LOCUS_19120 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108638.1:alpha/beta fold hydrolase 1130 1606 gene locus_tag LOCUS_19130 1130 1606 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_19130 1699 2307 gene locus_tag LOCUS_19140 1699 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2469 3008 gene locus_tag LOCUS_19150 2469 3008 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796886.1 protein_id gnl|my_center|LOCUS_19150 3048 4205 gene locus_tag LOCUS_19160 3048 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence198 748 185 gene locus_tag LOCUS_19170 748 185 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_19170 2263 824 gene locus_tag LOCUS_19180 2263 824 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107307.1 protein_id gnl|my_center|LOCUS_19180 3419 2208 gene locus_tag LOCUS_19190 gene trpB 3419 2208 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_19190 <4299 3464 gene locus_tag LOCUS_19200 <4299 3464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788291.1:tryptophan synthase subunit alpha >Feature sequence199 493 1302 gene locus_tag LOCUS_19210 gene rsmA 493 1302 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_19210 2330 1431 gene locus_tag LOCUS_19220 2330 1431 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_19220 4177 3200 gene locus_tag LOCUS_19230 4177 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence200 1452 1198 gene locus_tag LOCUS_19240 1452 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2751 3521 gene locus_tag LOCUS_19250 2751 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence201 94 2805 gene locus_tag LOCUS_19260 94 2805 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_19260 3252 2875 gene locus_tag LOCUS_19270 3252 2875 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_19270 3978 3268 gene locus_tag LOCUS_19280 3978 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence202 <1 1681 gene locus_tag LOCUS_19290 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793275.1:glycogen/starch synthase >Feature sequence203 836 210 gene locus_tag LOCUS_19300 836 210 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_19300 1582 854 gene locus_tag LOCUS_19310 1582 854 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_19310 2755 1595 gene locus_tag LOCUS_19320 2755 1595 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_19320 <4139 2783 gene locus_tag LOCUS_19330 <4139 2783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787198.1:Na(+)-translocating NADH-quinone reductase subunit A >Feature sequence204 216 434 gene locus_tag LOCUS_19340 216 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 539 805 gene locus_tag LOCUS_19350 539 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 861 1151 gene locus_tag LOCUS_19360 861 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2004 1192 gene locus_tag LOCUS_19370 2004 1192 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_19370 3184 2156 gene locus_tag LOCUS_19380 gene murB 3184 2156 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_19380 3906 3202 gene locus_tag LOCUS_19390 3906 3202 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence205 834 154 gene locus_tag LOCUS_19400 834 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 995 2566 gene locus_tag LOCUS_19410 995 2566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_19410 3771 2593 gene locus_tag LOCUS_19420 3771 2593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence206 1342 2349 gene locus_tag LOCUS_19430 gene trpD 1342 2349 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763093.1 protein_id gnl|my_center|LOCUS_19430 2365 3150 gene locus_tag LOCUS_19440 gene trpC 2365 3150 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202962.1 protein_id gnl|my_center|LOCUS_19440 3226 3984 gene locus_tag LOCUS_19450 3226 3984 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence207 29 2491 gene locus_tag LOCUS_19460 gene pheT 29 2491 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_19460 2576 3313 gene locus_tag LOCUS_19470 2576 3313 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_19470 3398 3649 gene locus_tag LOCUS_19480 3398 3649 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence208 660 19 gene locus_tag LOCUS_19490 660 19 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_19490 2113 689 gene locus_tag LOCUS_19500 2113 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 <3965 2208 gene locus_tag LOCUS_19510 <3965 2208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798520.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence209 3466 65 gene locus_tag LOCUS_19520 3466 65 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202528.1 protein_id gnl|my_center|LOCUS_19520 3826 3488 gene locus_tag LOCUS_19530 3826 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence210 118 1413 gene locus_tag LOCUS_19540 118 1413 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_19540 1505 2698 gene locus_tag LOCUS_19550 1505 2698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_19550 2933 3685 gene locus_tag LOCUS_19560 2933 3685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence211 1575 10 gene locus_tag LOCUS_19570 1575 10 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_19570 2199 1720 gene locus_tag LOCUS_19580 2199 1720 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_19580 3656 2241 gene locus_tag LOCUS_19590 3656 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence212 171 2306 gene locus_tag LOCUS_19600 171 2306 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_19600 3375 3545 gene locus_tag LOCUS_19610 3375 3545 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence213 1881 280 gene locus_tag LOCUS_19620 gene pckA 1881 280 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_19620 2308 2964 gene locus_tag LOCUS_19630 gene upp 2308 2964 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_19630 3595 3284 gene locus_tag LOCUS_19640 3595 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence214 90 1277 gene locus_tag LOCUS_19650 gene obgE 90 1277 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_19650 1270 2100 gene locus_tag LOCUS_19660 gene pgeF 1270 2100 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_19660 2116 3246 gene locus_tag LOCUS_19670 2116 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3696 3337 gene locus_tag LOCUS_19680 gene rplS 3696 3337 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence215 675 121 gene locus_tag LOCUS_19690 gene yfcE 675 121 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_19690 1549 686 gene locus_tag LOCUS_19700 gene lptB 1549 686 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_19700 1740 2438 gene locus_tag LOCUS_19710 1740 2438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_19710 2449 3213 gene locus_tag LOCUS_19720 2449 3213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence216 150 2129 gene locus_tag LOCUS_19730 150 2129 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_19730 2202 3488 gene locus_tag LOCUS_19740 2202 3488 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence217 2112 502 gene locus_tag LOCUS_19750 2112 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3432 2377 gene locus_tag LOCUS_19760 3432 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence218 211 2013 gene locus_tag LOCUS_19770 gene typA 211 2013 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_19770 2499 3218 gene locus_tag LOCUS_19780 2499 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence219 1717 155 gene locus_tag LOCUS_19790 1717 155 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_19790 3449 1725 gene locus_tag LOCUS_19800 3449 1725 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence220 1041 2951 gene locus_tag LOCUS_19810 1041 2951 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267288.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence221 90 587 gene locus_tag LOCUS_19820 90 587 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_19820 611 1228 gene locus_tag LOCUS_19830 gene recR 611 1228 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_19830 1225 1650 gene locus_tag LOCUS_19840 1225 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1664 2854 gene locus_tag LOCUS_19850 1664 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2851 3372 gene locus_tag LOCUS_19860 2851 3372 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence222 309 2708 gene locus_tag LOCUS_19870 309 2708 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202738.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence223 1935 280 gene locus_tag LOCUS_19880 1935 280 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_19880 2110 3201 gene locus_tag LOCUS_19890 gene mnmA 2110 3201 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence224 619 3297 gene locus_tag LOCUS_19900 619 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence225 64 1500 gene locus_tag LOCUS_19910 64 1500 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_19910 2084 3172 gene locus_tag LOCUS_19920 2084 3172 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence226 <1 935 gene locus_tag LOCUS_19930 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768413.1:Y-family DNA polymerase 937 2190 gene locus_tag LOCUS_19940 937 2190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence227 900 28 gene locus_tag LOCUS_19950 900 28 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_19950 3270 1015 gene locus_tag LOCUS_19960 3270 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence228 1762 1106 gene locus_tag LOCUS_19970 gene queC 1762 1106 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_19970 3228 1831 gene locus_tag LOCUS_19980 gene radA 3228 1831 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence229 869 36 gene locus_tag LOCUS_19990 869 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3214 1157 gene locus_tag LOCUS_20000 gene htpG 3214 1157 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence230 1500 559 gene locus_tag LOCUS_20010 1500 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3164 1530 gene locus_tag LOCUS_20020 3164 1530 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence231 <1 670 gene locus_tag LOCUS_20030 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802487.1:MgtC/SapB family protein 746 2905 gene locus_tag LOCUS_20040 746 2905 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence232 749 60 gene locus_tag LOCUS_20050 gene infC 749 60 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_20050 944 1252 gene locus_tag LOCUS_20060 944 1252 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812401.1 protein_id gnl|my_center|LOCUS_20060 1242 1712 gene locus_tag LOCUS_20070 gene rlmH 1242 1712 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_20070 2533 1841 gene locus_tag LOCUS_20080 2533 1841 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762629.1 protein_id gnl|my_center|LOCUS_20080 2865 2584 gene locus_tag LOCUS_20090 2865 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence233 584 1477 gene locus_tag LOCUS_20100 584 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1884 2573 gene locus_tag LOCUS_20110 1884 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence234 1437 307 gene locus_tag LOCUS_20120 gene rfbB 1437 307 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_20120 2342 1464 gene locus_tag LOCUS_20130 gene rfbD 2342 1464 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_20130 2945 2376 gene locus_tag LOCUS_20140 gene rfbC 2945 2376 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence235 2943 1168 gene locus_tag LOCUS_20150 gene sppA 2943 1168 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence236 1009 284 gene locus_tag LOCUS_20160 gene rpsC 1009 284 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_20160 1422 1018 gene locus_tag LOCUS_20170 gene rplV 1422 1018 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_20170 1726 1460 gene locus_tag LOCUS_20180 gene rpsS 1726 1460 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_20180 2568 1744 gene locus_tag LOCUS_20190 gene rplB 2568 1744 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_20190 2921 2577 gene locus_tag LOCUS_20200 gene rplW 2921 2577 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence237 228 1730 gene locus_tag LOCUS_20210 228 1730 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence238 359 1726 gene locus_tag LOCUS_20220 gene mtaB 359 1726 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_20220 1750 2760 gene locus_tag LOCUS_20230 1750 2760 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence239 1283 114 gene locus_tag LOCUS_20240 gene nspC 1283 114 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_20240 2162 1314 gene locus_tag LOCUS_20250 2162 1314 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_20250 <2794 2293 gene locus_tag LOCUS_20260 <2794 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202986.1:30S ribosomal protein S16 >Feature sequence240 3 857 gene locus_tag LOCUS_20270 3 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 921 994 gene locus_tag LOCUS_t00290 921 994 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1010 1198 gene locus_tag LOCUS_20280 gene secE 1010 1198 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_20280 1211 1753 gene locus_tag LOCUS_20290 gene nusG 1211 1753 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_20290 1815 2255 gene locus_tag LOCUS_20300 gene rplK 1815 2255 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence241 <1 680 gene locus_tag LOCUS_20310 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005677723.1:nitrogen-fixing protein NifU 696 1709 gene locus_tag LOCUS_20320 696 1709 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_20320 2706 2452 gene locus_tag LOCUS_20330 2706 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence242 1029 49 gene locus_tag LOCUS_20340 1029 49 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_20340 <2715 1170 gene locus_tag LOCUS_20350 <2715 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783975.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence243 1225 113 gene locus_tag LOCUS_20360 1225 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20360 1241 1340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence244 152 1351 gene locus_tag LOCUS_20370 152 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1354 2547 gene locus_tag LOCUS_20380 1354 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence245 460 1221 gene locus_tag LOCUS_20390 460 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence246 172 699 gene locus_tag LOCUS_20400 172 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 716 1747 gene locus_tag LOCUS_20410 716 1747 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_20410 1802 2404 gene locus_tag LOCUS_20420 1802 2404 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence247 2247 1345 gene locus_tag LOCUS_20430 2247 1345 CDS product DUF4984 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107167.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence248 >Feature sequence249 89 406 gene locus_tag LOCUS_20440 89 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 791 1615 gene locus_tag LOCUS_20450 791 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1970 2296 gene locus_tag LOCUS_20460 1970 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence250 684 2369 gene locus_tag LOCUS_20470 gene ltrA 684 2369 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108208.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence251 2317 44 gene locus_tag LOCUS_20480 2317 44 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108218.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20480 >Feature sequence252 69 1835 gene locus_tag LOCUS_20490 69 1835 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence253 >Feature sequence254 612 79 gene locus_tag LOCUS_20500 612 79 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_20500 1180 701 gene locus_tag LOCUS_20510 1180 701 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_20510 1722 1177 gene locus_tag LOCUS_20520 1722 1177 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_20520 2240 1728 gene locus_tag LOCUS_20530 2240 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence255 2110 989 gene locus_tag LOCUS_20540 2110 989 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777415.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence256 1829 357 gene locus_tag LOCUS_20550 1829 357 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence257 >Feature sequence258 176 763 gene locus_tag LOCUS_20560 gene leuD 176 763 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_20560 745 2274 gene locus_tag LOCUS_20570 745 2274 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence259 46 810 gene locus_tag LOCUS_20580 46 810 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_20580 822 1895 gene locus_tag LOCUS_20590 gene thiL 822 1895 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_20590 2086 2159 gene locus_tag LOCUS_t00300 2086 2159 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence260 2151 37 gene locus_tag LOCUS_20600 2151 37 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence261 36 2240 gene locus_tag LOCUS_20610 36 2240 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence262 205 2 gene locus_tag LOCUS_20620 gene rpsQ 205 2 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_20620 465 271 gene locus_tag LOCUS_20630 gene rpmC 465 271 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_20630 901 473 gene locus_tag LOCUS_20640 gene rplP 901 473 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_20640 1642 917 gene locus_tag LOCUS_20650 gene rpsC 1642 917 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_20650 2055 1651 gene locus_tag LOCUS_20660 gene rplV 2055 1651 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_20660 2225 2091 gene locus_tag LOCUS_20670 2225 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence263 91 1995 gene locus_tag LOCUS_20680 91 1995 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence264 93 752 gene locus_tag LOCUS_20690 93 752 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_20690 799 1896 gene locus_tag LOCUS_20700 799 1896 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107936.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence265 481 1932 gene locus_tag LOCUS_20710 gene pyk 481 1932 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence266 568 170 gene locus_tag LOCUS_20720 568 170 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_20720 822 1949 gene locus_tag LOCUS_20730 gene dnaN 822 1949 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence267 162 13 gene locus_tag LOCUS_20740 162 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 809 426 gene locus_tag LOCUS_20750 809 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1066 824 gene locus_tag LOCUS_20760 1066 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1933 1079 gene locus_tag LOCUS_20770 1933 1079 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence268 >Feature sequence269 1074 2024 gene locus_tag LOCUS_20780 1074 2024 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence270 >Feature sequence271 <1 779 gene locus_tag LOCUS_20790 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202852.1:Nif3-like dinuclear metal center hexameric protein 790 1644 gene locus_tag LOCUS_20800 790 1644 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence272 1809 556 gene locus_tag LOCUS_20810 1809 556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence273 >Feature sequence274 303 1793 gene locus_tag LOCUS_20820 303 1793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence275 51 1220 gene locus_tag LOCUS_20830 gene porV 51 1220 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_20830 1221 1727 gene locus_tag LOCUS_20840 gene ispF 1221 1727 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence276 >Feature sequence277 93 299 gene locus_tag LOCUS_20850 93 299 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_20850 452 1432 gene locus_tag LOCUS_20860 gene argC 452 1432 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_20860 1573 1962 gene locus_tag LOCUS_20870 1573 1962 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence278 <1954 283 gene locus_tag LOCUS_20880 <1954 283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765170.1:Na/Pi cotransporter family protein >Feature sequence279 813 337 gene locus_tag LOCUS_20890 813 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20890 1851 1084 gene locus_tag LOCUS_20900 1851 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence280 <1904 256 gene locus_tag LOCUS_20910 <1904 256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence281 >Feature sequence282 >Feature sequence283 59 1240 gene locus_tag LOCUS_20920 59 1240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_20920 1768 1262 gene locus_tag LOCUS_20930 1768 1262 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence284 >Feature sequence285 >Feature sequence286 1799 186 gene locus_tag LOCUS_20940 1799 186 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203546.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence287 584 1696 gene locus_tag LOCUS_20950 584 1696 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080474.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence288 1520 276 gene locus_tag LOCUS_20960 1520 276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence289 616 11 gene locus_tag LOCUS_20970 gene rpsD 616 11 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_20970 1089 700 gene locus_tag LOCUS_20980 gene rpsK 1089 700 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_20980 1553 1173 gene locus_tag LOCUS_20990 gene rpsM 1553 1173 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence290 1130 63 gene locus_tag LOCUS_21000 1130 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence291 637 188 gene locus_tag LOCUS_21010 637 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1122 658 gene locus_tag LOCUS_21020 1122 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1414 1136 gene locus_tag LOCUS_21030 1414 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence292 237 1511 gene locus_tag LOCUS_21040 237 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence293 <1606 63 gene locus_tag LOCUS_21050 <1606 63 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763175.1:CTP synthase >Feature sequence294 22 1503 gene locus_tag LOCUS_21060 gene proS 22 1503 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence295 <1 1483 gene locus_tag LOCUS_21070 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002303183.1:glycosyl hydrolase family 28 protein >Feature sequence296 300 1136 gene locus_tag LOCUS_21080 300 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence297 <1 1521 gene locus_tag LOCUS_21090 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765900.1:carboxypeptidase regulatory-like domain-containing protein >Feature sequence298 <1537 110 gene locus_tag LOCUS_21100 <1537 110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086847632.1:RICIN domain-containing protein >Feature sequence299 <1526 756 gene locus_tag LOCUS_21110 <1526 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788072.1:RluA family pseudouridine synthase >Feature sequence300 666 172 gene locus_tag LOCUS_21120 666 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1448 1065 gene locus_tag LOCUS_21130 1448 1065 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763908.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence301 146 745 gene locus_tag LOCUS_21140 146 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 756 1139 gene locus_tag LOCUS_21150 756 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence302 510 34 gene locus_tag LOCUS_21160 510 34 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_21160 1368 574 gene locus_tag LOCUS_21170 1368 574 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence303 1123 71 gene locus_tag LOCUS_21180 1123 71 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence304 921 337 gene locus_tag LOCUS_21190 gene rplC 921 337 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_21190 1284 979 gene locus_tag LOCUS_21200 gene rpsJ 1284 979 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence305 663 58 gene locus_tag LOCUS_21210 663 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence306 1278 370 gene locus_tag LOCUS_21220 1278 370 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence307 >Feature sequence308 >Feature sequence309 344 1123 gene locus_tag LOCUS_21230 344 1123 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence310 >Feature sequence311 1221 163 gene locus_tag LOCUS_21240 1221 163 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence312 343 182 gene locus_tag LOCUS_21250 343 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence313 1126 89 gene locus_tag LOCUS_21260 1126 89 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence314 >Feature sequence315 <1 1061 gene locus_tag LOCUS_21270 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788241.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence316 >Feature sequence317 >Feature sequence318 1150 200 gene locus_tag LOCUS_21280 1150 200 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence319 >Feature sequence320 605 87 gene locus_tag LOCUS_21290 605 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence321 >Feature sequence322 697 95 gene locus_tag LOCUS_21300 697 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence323 138 1091 gene locus_tag LOCUS_21310 138 1091 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence324 708 301 gene locus_tag LOCUS_21320 708 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence325 >Feature sequence326 487 912 gene locus_tag LOCUS_21330 gene ssb 487 912 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence327 475 1017 gene locus_tag LOCUS_21340 475 1017 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence328 827 84 gene locus_tag LOCUS_21350 gene kdsB 827 84 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence329 678 367 gene locus_tag LOCUS_21360 678 367 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008628599.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence330 >Feature sequence331 >Feature sequence332 >Feature sequence333 >Feature sequence334 <1042 204 gene locus_tag LOCUS_21370 <1042 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766742.1:mannonate dehydratase >Feature sequence335 75 845 gene locus_tag LOCUS_21380 75 845 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence336 104 988 gene locus_tag LOCUS_21390 104 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence337 65 442 gene locus_tag LOCUS_21400 65 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence338 190 885 gene locus_tag LOCUS_21410 190 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence339 >Feature sequence340 106 585 gene locus_tag LOCUS_21420 106 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420