>Feature sequence01 935 81 gene locus_tag LOCUS_00010 gene amrB 935 81 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_00010 1685 1350 gene locus_tag LOCUS_00020 1685 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2300 1731 gene locus_tag LOCUS_00030 2300 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2595 2305 gene locus_tag LOCUS_00040 2595 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3283 3675 gene locus_tag LOCUS_00050 3283 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3751 4041 gene locus_tag LOCUS_00060 3751 4041 CDS product DUF4134 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028728589.1 protein_id gnl|my_center|LOCUS_00060 4086 4475 gene locus_tag LOCUS_00070 4086 4475 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322059.1 protein_id gnl|my_center|LOCUS_00070 4485 4784 gene locus_tag LOCUS_00080 4485 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322060.1 protein_id gnl|my_center|LOCUS_00080 4816 7716 gene locus_tag LOCUS_00090 4816 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199142.1 protein_id gnl|my_center|LOCUS_00090 7829 10399 gene locus_tag LOCUS_00100 7829 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203017.1 protein_id gnl|my_center|LOCUS_00100 10522 11244 gene locus_tag LOCUS_00110 10522 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322064.1 protein_id gnl|my_center|LOCUS_00110 11248 11991 gene locus_tag LOCUS_00120 11248 11991 CDS product DUF5045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310178.1 protein_id gnl|my_center|LOCUS_00120 12028 13194 gene locus_tag LOCUS_00130 12028 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310177.1 protein_id gnl|my_center|LOCUS_00130 13224 13841 gene locus_tag LOCUS_00140 gene traK 13224 13841 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310175.1 protein_id gnl|my_center|LOCUS_00140 13862 14191 gene locus_tag LOCUS_00150 13862 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14193 15449 gene locus_tag LOCUS_00160 gene traM 14193 15449 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310172.1 protein_id gnl|my_center|LOCUS_00160 15479 16327 gene locus_tag LOCUS_00170 gene traN 15479 16327 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310170.1 protein_id gnl|my_center|LOCUS_00170 16338 16862 gene locus_tag LOCUS_00180 16338 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310169.1 protein_id gnl|my_center|LOCUS_00180 16882 17553 gene locus_tag LOCUS_00190 16882 17553 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310168.1 protein_id gnl|my_center|LOCUS_00190 17573 19144 gene locus_tag LOCUS_00200 17573 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19171 20019 gene locus_tag LOCUS_00210 19171 20019 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203045.1 protein_id gnl|my_center|LOCUS_00210 20019 20303 gene locus_tag LOCUS_00220 20019 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009017568.1 protein_id gnl|my_center|LOCUS_00220 20317 22392 gene locus_tag LOCUS_00230 20317 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22759 27630 gene locus_tag LOCUS_00240 22759 27630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27653 29086 gene locus_tag LOCUS_00250 27653 29086 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308692.1 protein_id gnl|my_center|LOCUS_00250 29122 29727 gene locus_tag LOCUS_00260 29122 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323427.1 protein_id gnl|my_center|LOCUS_00260 29855 32572 gene locus_tag LOCUS_00270 29855 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32776 33849 gene locus_tag LOCUS_00280 32776 33849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35351 34617 gene locus_tag LOCUS_00290 35351 34617 CDS product DUF4099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203043.1 protein_id gnl|my_center|LOCUS_00290 35796 36560 gene locus_tag LOCUS_00300 35796 36560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36617 37819 gene locus_tag LOCUS_00310 36617 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37823 40279 gene locus_tag LOCUS_00320 37823 40279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40803 41546 gene locus_tag LOCUS_00330 40803 41546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308684.1 protein_id gnl|my_center|LOCUS_00330 41650 42270 gene locus_tag LOCUS_00340 41650 42270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42279 44504 gene locus_tag LOCUS_00350 42279 44504 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310166.1 protein_id gnl|my_center|LOCUS_00350 46250 44595 gene locus_tag LOCUS_00360 46250 44595 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_00360 46837 46580 gene locus_tag LOCUS_00370 46837 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47091 46834 gene locus_tag LOCUS_00380 47091 46834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47614 47222 gene locus_tag LOCUS_00390 47614 47222 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_00390 47863 47681 gene locus_tag LOCUS_00400 47863 47681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 48782 48357 gene locus_tag LOCUS_00410 48782 48357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49355 48807 gene locus_tag LOCUS_00420 49355 48807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49637 49374 gene locus_tag LOCUS_00430 49637 49374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00430 49834 49553 gene locus_tag LOCUS_00440 49834 49553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51995 49974 gene locus_tag LOCUS_00450 51995 49974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52026 52226 gene locus_tag LOCUS_00460 52026 52226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54504 52501 gene locus_tag LOCUS_00470 54504 52501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58219 54524 gene locus_tag LOCUS_00480 58219 54524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064932.1 protein_id gnl|my_center|LOCUS_00480 58513 58364 gene locus_tag LOCUS_00490 58513 58364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 59242 58526 gene locus_tag LOCUS_00500 59242 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59682 60152 gene locus_tag LOCUS_00510 59682 60152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 60171 60944 gene locus_tag LOCUS_00520 60171 60944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63781 61685 gene locus_tag LOCUS_00530 63781 61685 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_00530 69920 63789 gene locus_tag LOCUS_00540 69920 63789 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 protein_id gnl|my_center|LOCUS_00540 72006 69928 gene locus_tag LOCUS_00550 72006 69928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 79174 71996 gene locus_tag LOCUS_00560 79174 71996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 84090 79195 gene locus_tag LOCUS_00570 84090 79195 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229642.1 protein_id gnl|my_center|LOCUS_00570 86904 84112 gene locus_tag LOCUS_00580 86904 84112 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041505.1 protein_id gnl|my_center|LOCUS_00580 87567 88451 gene locus_tag LOCUS_00590 87567 88451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 88615 88448 gene locus_tag LOCUS_00600 88615 88448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 90219 88915 gene locus_tag LOCUS_00610 gene ltrA 90219 88915 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108396.1 protein_id gnl|my_center|LOCUS_00610 92022 90799 gene locus_tag LOCUS_00620 92022 90799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 92379 93302 gene locus_tag LOCUS_00630 92379 93302 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_00630 93977 93714 gene locus_tag LOCUS_00640 93977 93714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 94118 96064 gene locus_tag LOCUS_00650 94118 96064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 98766 96838 gene locus_tag LOCUS_00660 98766 96838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 100979 98958 gene locus_tag LOCUS_00670 100979 98958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 101321 102361 gene locus_tag LOCUS_00680 101321 102361 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_00680 102388 103248 gene locus_tag LOCUS_00690 102388 103248 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_00690 105199 103979 gene locus_tag LOCUS_00700 105199 103979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 106040 106948 gene locus_tag LOCUS_00710 106040 106948 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_00710 107174 108328 gene locus_tag LOCUS_00720 107174 108328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 110201 109557 gene locus_tag LOCUS_00730 110201 109557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 111871 110228 gene locus_tag LOCUS_00740 111871 110228 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_00740 112326 112009 gene locus_tag LOCUS_00750 112326 112009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 114673 113276 gene locus_tag LOCUS_00760 114673 113276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 115332 114856 gene locus_tag LOCUS_00770 115332 114856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 116759 115458 gene locus_tag LOCUS_00780 116759 115458 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_00780 117631 117059 gene locus_tag LOCUS_00790 117631 117059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 118925 117636 gene locus_tag LOCUS_00800 118925 117636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 119812 118922 gene locus_tag LOCUS_00810 119812 118922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 120034 119819 gene locus_tag LOCUS_00820 120034 119819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 120552 120034 gene locus_tag LOCUS_00830 120552 120034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 121643 120933 gene locus_tag LOCUS_00840 121643 120933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 122341 122027 gene locus_tag LOCUS_00850 122341 122027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 122667 122518 gene locus_tag LOCUS_00860 122667 122518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 123397 124206 gene locus_tag LOCUS_00870 123397 124206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 124209 124892 gene locus_tag LOCUS_00880 124209 124892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 124898 125785 gene locus_tag LOCUS_00890 124898 125785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 128312 125892 gene locus_tag LOCUS_00900 128312 125892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 129966 128422 gene locus_tag LOCUS_00910 129966 128422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 128453 128462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 132259 130814 gene locus_tag LOCUS_00920 132259 130814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 132728 132300 gene locus_tag LOCUS_00930 132728 132300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 133718 132741 gene locus_tag LOCUS_00940 133718 132741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 133994 133818 gene locus_tag LOCUS_00950 133994 133818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 134191 134625 gene locus_tag LOCUS_00960 134191 134625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 137150 134691 gene locus_tag LOCUS_00970 137150 134691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 139365 138505 gene locus_tag LOCUS_00980 139365 138505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 140336 139521 gene locus_tag LOCUS_00990 140336 139521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 140652 141104 gene locus_tag LOCUS_01000 140652 141104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 141124 141630 gene locus_tag LOCUS_01010 141124 141630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 141670 143688 gene locus_tag LOCUS_01020 141670 143688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 147903 144169 gene locus_tag LOCUS_01030 147903 144169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 148408 148749 gene locus_tag LOCUS_01040 148408 148749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 >Feature sequence02 74 1138 gene locus_tag LOCUS_01050 74 1138 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_01050 1786 1286 gene locus_tag LOCUS_01060 1786 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108812.1 protein_id gnl|my_center|LOCUS_01060 2291 1776 gene locus_tag LOCUS_01070 2291 1776 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_01070 3181 2411 gene locus_tag LOCUS_01080 gene argB 3181 2411 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_01080 5155 3263 gene locus_tag LOCUS_01090 gene speA 5155 3263 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_01090 5753 5226 gene locus_tag LOCUS_01100 5753 5226 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_01100 8115 5785 gene locus_tag LOCUS_01110 gene topA 8115 5785 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_01110 8768 8241 gene locus_tag LOCUS_01120 8768 8241 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108496.1 protein_id gnl|my_center|LOCUS_01120 10341 8887 gene locus_tag LOCUS_01130 10341 8887 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_01130 11666 10524 gene locus_tag LOCUS_01140 11666 10524 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_01140 11899 14217 gene locus_tag LOCUS_01150 gene pnp 11899 14217 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765197.1 protein_id gnl|my_center|LOCUS_01150 14476 14402 gene locus_tag LOCUS_t00010 14476 14402 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14600 14526 gene locus_tag LOCUS_t00020 14600 14526 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14900 16537 gene locus_tag LOCUS_01160 14900 16537 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_01160 16691 17158 gene locus_tag LOCUS_01170 gene rimP 16691 17158 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_01170 17162 18424 gene locus_tag LOCUS_01180 gene nusA 17162 18424 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763665.1 protein_id gnl|my_center|LOCUS_01180 18487 21333 gene locus_tag LOCUS_01190 gene infB 18487 21333 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_01190 21472 22923 gene locus_tag LOCUS_01200 gene sufB 21472 22923 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_01200 23336 24091 gene locus_tag LOCUS_01210 gene sufC 23336 24091 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_01210 24106 25449 gene locus_tag LOCUS_01220 gene sufD 24106 25449 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_01220 25461 26675 gene locus_tag LOCUS_01230 25461 26675 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_01230 27098 27706 gene locus_tag LOCUS_01240 27098 27706 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_01240 30319 27908 gene locus_tag LOCUS_01250 30319 27908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 32435 30387 gene locus_tag LOCUS_01260 32435 30387 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_01260 35466 32470 gene locus_tag LOCUS_01270 35466 32470 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_01270 35710 35456 gene locus_tag LOCUS_01280 35710 35456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01280 37773 36217 gene locus_tag LOCUS_01290 37773 36217 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_01290 38109 38025 gene locus_tag LOCUS_t00030 38109 38025 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38339 39427 gene locus_tag LOCUS_01300 38339 39427 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_01300 39909 39508 gene locus_tag LOCUS_01310 39909 39508 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_01310 40563 40096 gene locus_tag LOCUS_01320 gene greA 40563 40096 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_01320 44235 40750 gene locus_tag LOCUS_01330 44235 40750 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_01330 44498 44947 gene locus_tag LOCUS_01340 44498 44947 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_01340 45154 46461 gene locus_tag LOCUS_01350 45154 46461 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_01350 47679 46693 gene locus_tag LOCUS_01360 47679 46693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 47854 48420 gene locus_tag LOCUS_01370 gene xpt 47854 48420 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786581.1 protein_id gnl|my_center|LOCUS_01370 49545 48466 gene locus_tag LOCUS_01380 49545 48466 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_01380 50166 50023 gene locus_tag LOCUS_01390 50166 50023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 51006 52763 gene locus_tag LOCUS_01400 51006 52763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_01400 54714 53068 gene locus_tag LOCUS_01410 54714 53068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 57977 54732 gene locus_tag LOCUS_01420 57977 54732 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_01420 61163 58791 gene locus_tag LOCUS_01430 61163 58791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 62634 61228 gene locus_tag LOCUS_01440 62634 61228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 64416 62677 gene locus_tag LOCUS_01450 64416 62677 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_01450 67624 64445 gene locus_tag LOCUS_01460 67624 64445 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_01460 69826 67883 gene locus_tag LOCUS_01470 69826 67883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 72928 69839 gene locus_tag LOCUS_01480 72928 69839 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_01480 74823 73177 gene locus_tag LOCUS_01490 74823 73177 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_01490 76822 74816 gene locus_tag LOCUS_01500 76822 74816 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_01500 80827 76907 gene locus_tag LOCUS_01510 80827 76907 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_01510 81079 82284 gene locus_tag LOCUS_01520 81079 82284 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_01520 82350 83783 gene locus_tag LOCUS_01530 82350 83783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 83821 84945 gene locus_tag LOCUS_01540 83821 84945 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_01540 84955 85917 gene locus_tag LOCUS_01550 84955 85917 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_01550 86181 87581 gene locus_tag LOCUS_01560 86181 87581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 87618 88328 gene locus_tag LOCUS_01570 87618 88328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_01570 88499 89269 gene locus_tag LOCUS_01580 gene trmB 88499 89269 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_01580 90530 89529 gene locus_tag LOCUS_01590 gene rhuM 90530 89529 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_01590 90941 93298 gene locus_tag LOCUS_01600 90941 93298 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_01600 94223 94795 gene locus_tag LOCUS_01610 94223 94795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 94796 95668 gene locus_tag LOCUS_01620 94796 95668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 95665 95868 gene locus_tag LOCUS_01630 95665 95868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 96337 98718 gene locus_tag LOCUS_01640 96337 98718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 98727 100205 gene locus_tag LOCUS_01650 98727 100205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_01650 101138 100281 gene locus_tag LOCUS_01660 101138 100281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 102260 101166 gene locus_tag LOCUS_01670 102260 101166 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_01670 102595 102257 gene locus_tag LOCUS_01680 102595 102257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 105310 102758 gene locus_tag LOCUS_01690 105310 102758 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_01690 106243 105398 gene locus_tag LOCUS_01700 106243 105398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 106690 107544 gene locus_tag LOCUS_01710 106690 107544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 107690 109186 gene locus_tag LOCUS_01720 gene gpmI 107690 109186 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_01720 109247 109912 gene locus_tag LOCUS_01730 gene ung 109247 109912 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_01730 110007 110642 gene locus_tag LOCUS_01740 110007 110642 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_01740 111618 110725 gene locus_tag LOCUS_01750 111618 110725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 114005 111633 gene locus_tag LOCUS_01760 114005 111633 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_01760 116064 114094 gene locus_tag LOCUS_01770 gene gyrB 116064 114094 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_01770 116627 116373 gene locus_tag LOCUS_01780 gene rpsT 116627 116373 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_01780 116736 116664 gene locus_tag LOCUS_t00040 116736 116664 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 116861 117586 gene locus_tag LOCUS_01790 gene recO 116861 117586 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_01790 118984 117650 gene locus_tag LOCUS_01800 gene ftsZ 118984 117650 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_01800 120517 119072 gene locus_tag LOCUS_01810 gene ftsA 120517 119072 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_01810 121351 120557 gene locus_tag LOCUS_01820 121351 120557 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_01820 122728 121352 gene locus_tag LOCUS_01830 gene murC 122728 121352 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_01830 123834 122728 gene locus_tag LOCUS_01840 gene murG 123834 122728 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_01840 125203 123926 gene locus_tag LOCUS_01850 125203 123926 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_01850 126579 125242 gene locus_tag LOCUS_01860 gene murD 126579 125242 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_01860 127891 126623 gene locus_tag LOCUS_01870 gene mraY 127891 126623 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_01870 129379 127916 gene locus_tag LOCUS_01880 129379 127916 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_01880 131620 129461 gene locus_tag LOCUS_01890 131620 129461 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_01890 132153 131617 gene locus_tag LOCUS_01900 132153 131617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 133064 132150 gene locus_tag LOCUS_01910 gene rsmH 133064 132150 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_01910 133420 134247 gene locus_tag LOCUS_01920 133420 134247 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_01920 134320 135315 gene locus_tag LOCUS_01930 134320 135315 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_01930 136832 135495 gene locus_tag LOCUS_01940 136832 135495 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_01940 137001 137438 gene locus_tag LOCUS_01950 gene dut 137001 137438 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_01950 137512 139332 gene locus_tag LOCUS_01960 137512 139332 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_01960 139638 140534 gene locus_tag LOCUS_01970 139638 140534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 140585 142366 gene locus_tag LOCUS_01980 140585 142366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 142769 143647 gene locus_tag LOCUS_01990 142769 143647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 143716 144789 gene locus_tag LOCUS_02000 143716 144789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 144817 145950 gene locus_tag LOCUS_02010 144817 145950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 145968 146930 gene locus_tag LOCUS_02020 145968 146930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 147248 147024 gene locus_tag LOCUS_02030 147248 147024 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_02030 148384 147263 gene locus_tag LOCUS_02040 148384 147263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence03 296 1579 gene locus_tag LOCUS_02050 296 1579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_02050 2828 1740 gene locus_tag LOCUS_02060 2828 1740 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108601.1 protein_id gnl|my_center|LOCUS_02060 3304 2840 gene locus_tag LOCUS_02070 3304 2840 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_02070 5801 3321 gene locus_tag LOCUS_02080 5801 3321 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_02080 6346 6131 gene locus_tag LOCUS_02090 6346 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6533 8644 gene locus_tag LOCUS_02100 6533 8644 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_02100 8821 10185 gene locus_tag LOCUS_02110 8821 10185 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_02110 10231 11427 gene locus_tag LOCUS_02120 10231 11427 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_02120 11506 12297 gene locus_tag LOCUS_02130 11506 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 13014 12334 gene locus_tag LOCUS_02140 13014 12334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_02140 15485 13089 gene locus_tag LOCUS_02150 15485 13089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_02150 16788 15535 gene locus_tag LOCUS_02160 16788 15535 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_02160 18135 16792 gene locus_tag LOCUS_02170 18135 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18366 18557 gene locus_tag LOCUS_02180 18366 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18946 20766 gene locus_tag LOCUS_02190 gene argS 18946 20766 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_02190 20921 21394 gene locus_tag LOCUS_02200 20921 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 21507 22064 gene locus_tag LOCUS_02210 21507 22064 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_02210 22106 23116 gene locus_tag LOCUS_02220 22106 23116 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202064.1 protein_id gnl|my_center|LOCUS_02220 23237 23839 gene locus_tag LOCUS_02230 23237 23839 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_02230 23913 24251 gene locus_tag LOCUS_02240 23913 24251 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_02240 24254 24565 gene locus_tag LOCUS_02250 24254 24565 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005820814.1 protein_id gnl|my_center|LOCUS_02250 24944 28288 gene locus_tag LOCUS_02260 24944 28288 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_02260 28302 29699 gene locus_tag LOCUS_02270 28302 29699 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_02270 29714 31174 gene locus_tag LOCUS_02280 29714 31174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 31260 32237 gene locus_tag LOCUS_02290 31260 32237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766236.1 protein_id gnl|my_center|LOCUS_02290 32239 33138 gene locus_tag LOCUS_02300 32239 33138 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_02300 33196 34059 gene locus_tag LOCUS_02310 33196 34059 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_02310 34074 35414 gene locus_tag LOCUS_02320 34074 35414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_02320 37510 36269 gene locus_tag LOCUS_02330 37510 36269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 38090 37932 gene locus_tag LOCUS_02340 38090 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 39179 38190 gene locus_tag LOCUS_02350 gene ribD 39179 38190 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_02350 40426 39191 gene locus_tag LOCUS_02360 40426 39191 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_02360 40769 41647 gene locus_tag LOCUS_02370 gene prmC 40769 41647 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_02370 41724 42215 gene locus_tag LOCUS_02380 41724 42215 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_02380 42265 42996 gene locus_tag LOCUS_02390 42265 42996 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_02390 43108 43740 gene locus_tag LOCUS_02400 gene pyrE 43108 43740 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_02400 43760 44221 gene locus_tag LOCUS_02410 43760 44221 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_02410 44236 45573 gene locus_tag LOCUS_02420 gene argH 44236 45573 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_02420 45592 46218 gene locus_tag LOCUS_02430 45592 46218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 46322 46395 gene locus_tag LOCUS_t00050 46322 46395 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46415 46502 gene locus_tag LOCUS_t00060 46415 46502 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46620 47525 gene locus_tag LOCUS_02440 46620 47525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 47568 49118 gene locus_tag LOCUS_02450 47568 49118 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_02450 49979 52045 gene locus_tag LOCUS_02460 gene metG 49979 52045 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_02460 52821 52138 gene locus_tag LOCUS_02470 52821 52138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 54142 52958 gene locus_tag LOCUS_02480 54142 52958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_02480 55789 54332 gene locus_tag LOCUS_02490 55789 54332 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_02490 58889 55812 gene locus_tag LOCUS_02500 58889 55812 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_02500 59630 60487 gene locus_tag LOCUS_02510 59630 60487 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_02510 61570 60563 gene locus_tag LOCUS_02520 61570 60563 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_02520 61627 61699 gene locus_tag LOCUS_t00070 61627 61699 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64859 61845 gene locus_tag LOCUS_02530 gene secDF 64859 61845 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_02530 66076 64979 gene locus_tag LOCUS_02540 66076 64979 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_02540 67021 66083 gene locus_tag LOCUS_02550 67021 66083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 67250 67525 gene locus_tag LOCUS_02560 67250 67525 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_02560 68436 67633 gene locus_tag LOCUS_02570 68436 67633 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_02570 69420 68605 gene locus_tag LOCUS_02580 69420 68605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 70271 69438 gene locus_tag LOCUS_02590 70271 69438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 71218 70286 gene locus_tag LOCUS_02600 71218 70286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 74174 71517 gene locus_tag LOCUS_02610 74174 71517 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_02610 74813 74292 gene locus_tag LOCUS_02620 74813 74292 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_02620 74968 74897 gene locus_tag LOCUS_t00080 74968 74897 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 76336 75035 gene locus_tag LOCUS_02630 gene tyrS 76336 75035 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_02630 77094 76651 gene locus_tag LOCUS_02640 gene rnpA 77094 76651 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_02640 77866 77117 gene locus_tag LOCUS_02650 77866 77117 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_02650 80176 78902 gene locus_tag LOCUS_02660 gene metK 80176 78902 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_02660 81250 80294 gene locus_tag LOCUS_02670 gene xerD 81250 80294 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_02670 81375 81809 gene locus_tag LOCUS_02680 gene aroQ 81375 81809 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_02680 81839 82477 gene locus_tag LOCUS_02690 81839 82477 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_02690 83812 82583 gene locus_tag LOCUS_02700 83812 82583 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_02700 84234 83899 gene locus_tag LOCUS_02710 gene rbfA 84234 83899 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_02710 85101 84265 gene locus_tag LOCUS_02720 gene murI 85101 84265 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_02720 85652 85098 gene locus_tag LOCUS_02730 85652 85098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 86233 85766 gene locus_tag LOCUS_02740 86233 85766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 86865 86344 gene locus_tag LOCUS_02750 86865 86344 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_02750 89504 86868 gene locus_tag LOCUS_02760 89504 86868 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_02760 90305 89556 gene locus_tag LOCUS_02770 90305 89556 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_02770 90943 90305 gene locus_tag LOCUS_02780 90943 90305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 92337 90976 gene locus_tag LOCUS_02790 92337 90976 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_02790 94151 92538 gene locus_tag LOCUS_02800 gene pckA 94151 92538 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_02800 94549 95208 gene locus_tag LOCUS_02810 gene upp 94549 95208 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_02810 97264 95753 gene locus_tag LOCUS_02820 97264 95753 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_02820 97634 99295 gene locus_tag LOCUS_02830 97634 99295 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_02830 99563 100558 gene locus_tag LOCUS_02840 99563 100558 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_02840 100549 101568 gene locus_tag LOCUS_02850 100549 101568 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_02850 101622 102956 gene locus_tag LOCUS_02860 gene miaB 101622 102956 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_02860 103081 104934 gene locus_tag LOCUS_02870 103081 104934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_02870 104976 105899 gene locus_tag LOCUS_02880 104976 105899 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_02880 105938 106693 gene locus_tag LOCUS_02890 105938 106693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_02890 106736 107758 gene locus_tag LOCUS_02900 106736 107758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 107882 108805 gene locus_tag LOCUS_02910 107882 108805 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_02910 108802 109800 gene locus_tag LOCUS_02920 108802 109800 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_02920 109800 110639 gene locus_tag LOCUS_02930 109800 110639 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765269.1 protein_id gnl|my_center|LOCUS_02930 110729 111892 gene locus_tag LOCUS_02940 gene glf 110729 111892 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_02940 111934 113823 gene locus_tag LOCUS_02950 111934 113823 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 protein_id gnl|my_center|LOCUS_02950 115546 114395 gene locus_tag LOCUS_02960 115546 114395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 116418 115522 gene locus_tag LOCUS_02970 116418 115522 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940255.1 protein_id gnl|my_center|LOCUS_02970 117014 116415 gene locus_tag LOCUS_02980 117014 116415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 117380 117676 gene locus_tag LOCUS_02990 117380 117676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 117681 117923 gene locus_tag LOCUS_03000 117681 117923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 118002 118304 gene locus_tag LOCUS_03010 118002 118304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 120281 119127 gene locus_tag LOCUS_03020 120281 119127 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence04 548 1594 gene locus_tag LOCUS_03030 548 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1609 1833 gene locus_tag LOCUS_03040 1609 1833 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_03040 2304 1924 gene locus_tag LOCUS_03050 2304 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2837 2361 gene locus_tag LOCUS_03060 gene ribH 2837 2361 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_03060 3561 2866 gene locus_tag LOCUS_03070 3561 2866 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_03070 3771 4868 gene locus_tag LOCUS_03080 gene recF 3771 4868 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_03080 5154 5444 gene locus_tag LOCUS_03090 5154 5444 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764453.1 protein_id gnl|my_center|LOCUS_03090 6008 5463 gene locus_tag LOCUS_03100 6008 5463 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_03100 7745 6012 gene locus_tag LOCUS_03110 7745 6012 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_03110 8237 7785 gene locus_tag LOCUS_03120 8237 7785 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_03120 10329 8242 gene locus_tag LOCUS_03130 10329 8242 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_03130 11100 10426 gene locus_tag LOCUS_03140 11100 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12126 11107 gene locus_tag LOCUS_03150 12126 11107 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_03150 12699 12148 gene locus_tag LOCUS_03160 12699 12148 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_03160 13273 12794 gene locus_tag LOCUS_03170 13273 12794 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785734.1 protein_id gnl|my_center|LOCUS_03170 14232 13261 gene locus_tag LOCUS_03180 14232 13261 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_03180 14831 14268 gene locus_tag LOCUS_03190 14831 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 15162 15088 gene locus_tag LOCUS_t00090 15162 15088 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17928 15355 gene locus_tag LOCUS_03200 17928 15355 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_03200 18717 18037 gene locus_tag LOCUS_03210 18717 18037 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_03210 19580 18759 gene locus_tag LOCUS_03220 gene thiD 19580 18759 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_03220 20119 19589 gene locus_tag LOCUS_03230 20119 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 20760 20675 gene locus_tag LOCUS_t00100 20760 20675 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21969 21094 gene locus_tag LOCUS_03240 21969 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 22080 22760 gene locus_tag LOCUS_03250 gene tsaA 22080 22760 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03250 24189 22786 gene locus_tag LOCUS_03260 24189 22786 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_03260 24399 24326 gene locus_tag LOCUS_t00110 24399 24326 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 25619 24510 gene locus_tag LOCUS_03270 gene thiL 25619 24510 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_03270 26410 25646 gene locus_tag LOCUS_03280 26410 25646 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_03280 27515 26340 gene locus_tag LOCUS_03290 gene lpxK 27515 26340 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_03290 29364 27580 gene locus_tag LOCUS_03300 gene sppA 29364 27580 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_03300 29616 30428 gene locus_tag LOCUS_03310 29616 30428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 32132 30705 gene locus_tag LOCUS_03320 32132 30705 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_03320 32497 33840 gene locus_tag LOCUS_03330 32497 33840 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_03330 33990 34262 gene locus_tag LOCUS_03340 33990 34262 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789740.1 protein_id gnl|my_center|LOCUS_03340 34338 35966 gene locus_tag LOCUS_03350 gene groL 34338 35966 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_03350 36333 36548 gene locus_tag LOCUS_03360 36333 36548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 36529 38076 gene locus_tag LOCUS_03370 36529 38076 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_03370 38153 38902 gene locus_tag LOCUS_03380 38153 38902 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_03380 38984 40594 gene locus_tag LOCUS_03390 gene guaA 38984 40594 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764459.1 protein_id gnl|my_center|LOCUS_03390 41062 40634 gene locus_tag LOCUS_03400 gene mscL 41062 40634 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_03400 41415 42446 gene locus_tag LOCUS_03410 gene gap 41415 42446 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_03410 42581 43570 gene locus_tag LOCUS_03420 gene miaA 42581 43570 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_03420 43635 44564 gene locus_tag LOCUS_03430 43635 44564 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759992.1 protein_id gnl|my_center|LOCUS_03430 45318 44614 gene locus_tag LOCUS_03440 45318 44614 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_03440 45532 47475 gene locus_tag LOCUS_03450 45532 47475 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_03450 47494 48762 gene locus_tag LOCUS_03460 47494 48762 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_03460 48800 50230 gene locus_tag LOCUS_03470 48800 50230 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_03470 52131 50341 gene locus_tag LOCUS_03480 52131 50341 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109159.1 protein_id gnl|my_center|LOCUS_03480 54183 52153 gene locus_tag LOCUS_03490 54183 52153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 54350 54180 gene locus_tag LOCUS_03500 54350 54180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 56136 54427 gene locus_tag LOCUS_03510 56136 54427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 59436 56161 gene locus_tag LOCUS_03520 59436 56161 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_03520 61483 60554 gene locus_tag LOCUS_03530 61483 60554 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_03530 63379 61655 gene locus_tag LOCUS_03540 63379 61655 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109114.1 protein_id gnl|my_center|LOCUS_03540 65450 63420 gene locus_tag LOCUS_03550 65450 63420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 68806 65498 gene locus_tag LOCUS_03560 68806 65498 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_03560 72641 69240 gene locus_tag LOCUS_03570 72641 69240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 72927 73628 gene locus_tag LOCUS_03580 72927 73628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 75500 73707 gene locus_tag LOCUS_03590 75500 73707 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_03590 78184 75560 gene locus_tag LOCUS_03600 78184 75560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 78464 79060 gene locus_tag LOCUS_03610 78464 79060 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_03610 79710 79057 gene locus_tag LOCUS_03620 gene rpe 79710 79057 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_03620 80452 81456 gene locus_tag LOCUS_03630 gene trpD 80452 81456 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_03630 81633 82439 gene locus_tag LOCUS_03640 gene trpC 81633 82439 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_03640 82625 83245 gene locus_tag LOCUS_03650 82625 83245 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_03650 83282 84058 gene locus_tag LOCUS_03660 gene trpA 83282 84058 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_03660 84172 85371 gene locus_tag LOCUS_03670 gene trpB 84172 85371 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_03670 85394 86827 gene locus_tag LOCUS_03680 85394 86827 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107307.1 protein_id gnl|my_center|LOCUS_03680 86852 87418 gene locus_tag LOCUS_03690 86852 87418 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_03690 88631 87651 gene locus_tag LOCUS_03700 88631 87651 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_03700 88924 89601 gene locus_tag LOCUS_03710 88924 89601 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_03710 89666 90220 gene locus_tag LOCUS_03720 89666 90220 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_03720 90281 91867 gene locus_tag LOCUS_03730 90281 91867 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_03730 92059 93873 gene locus_tag LOCUS_03740 92059 93873 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_03740 93941 95059 gene locus_tag LOCUS_03750 gene fmt 93941 95059 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_03750 95090 95662 gene locus_tag LOCUS_03760 95090 95662 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_03760 96663 96082 gene locus_tag LOCUS_03770 96663 96082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 97387 98970 gene locus_tag LOCUS_03780 97387 98970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 99281 99847 gene locus_tag LOCUS_03790 99281 99847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 99880 100161 gene locus_tag LOCUS_03800 99880 100161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 100381 100776 gene locus_tag LOCUS_03810 100381 100776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 100956 103604 gene locus_tag LOCUS_03820 100956 103604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 103742 104017 gene locus_tag LOCUS_03830 103742 104017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 104212 104138 gene locus_tag LOCUS_t00120 104212 104138 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 104804 104409 gene locus_tag LOCUS_03840 104804 104409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 105613 104840 gene locus_tag LOCUS_03850 105613 104840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_03850 106151 105687 gene locus_tag LOCUS_03860 106151 105687 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_03860 107578 106205 gene locus_tag LOCUS_03870 107578 106205 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_03870 108862 107762 gene locus_tag LOCUS_03880 gene pdxA 108862 107762 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_03880 109708 108863 gene locus_tag LOCUS_03890 109708 108863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 111233 110166 gene locus_tag LOCUS_03900 gene rlmN 111233 110166 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_03900 111370 115152 gene locus_tag LOCUS_03910 111370 115152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 115163 116497 gene locus_tag LOCUS_03920 115163 116497 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_03920 116725 117693 gene locus_tag LOCUS_03930 116725 117693 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_03930 117699 117941 gene locus_tag LOCUS_03940 117699 117941 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_03940 117931 118686 gene locus_tag LOCUS_03950 117931 118686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 119129 118716 gene locus_tag LOCUS_03960 119129 118716 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_03960 120319 119180 gene locus_tag LOCUS_03970 120319 119180 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence05 377 640 gene locus_tag LOCUS_03980 377 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1533 652 gene locus_tag LOCUS_03990 1533 652 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 protein_id gnl|my_center|LOCUS_03990 2772 1588 gene locus_tag LOCUS_04000 2772 1588 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445149.1 protein_id gnl|my_center|LOCUS_04000 3911 4201 gene locus_tag LOCUS_04010 3911 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4252 5079 gene locus_tag LOCUS_04020 4252 5079 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_04020 5417 5124 gene locus_tag LOCUS_04030 5417 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5574 6176 gene locus_tag LOCUS_04040 5574 6176 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_04040 6447 7316 gene locus_tag LOCUS_04050 6447 7316 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_04050 7374 8396 gene locus_tag LOCUS_04060 7374 8396 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_04060 8456 8842 gene locus_tag LOCUS_04070 8456 8842 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_04070 8953 10656 gene locus_tag LOCUS_04080 8953 10656 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_04080 11102 11281 gene locus_tag LOCUS_04090 11102 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11765 12109 gene locus_tag LOCUS_04100 11765 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 12176 14095 gene locus_tag LOCUS_04110 12176 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 14910 14143 gene locus_tag LOCUS_04120 14910 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 15477 15304 gene locus_tag LOCUS_04130 15477 15304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 15543 16208 gene locus_tag LOCUS_04140 15543 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16463 17797 gene locus_tag LOCUS_04150 16463 17797 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_04150 17843 19024 gene locus_tag LOCUS_04160 17843 19024 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_04160 19188 19961 gene locus_tag LOCUS_04170 19188 19961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_04170 20061 21299 gene locus_tag LOCUS_04180 20061 21299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_04180 21402 22127 gene locus_tag LOCUS_04190 21402 22127 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_04190 22854 22201 gene locus_tag LOCUS_04200 22854 22201 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802487.1 protein_id gnl|my_center|LOCUS_04200 23029 24726 gene locus_tag LOCUS_04210 gene ettA 23029 24726 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_04210 26182 25022 gene locus_tag LOCUS_04220 26182 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 28134 26224 gene locus_tag LOCUS_04230 28134 26224 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_04230 29479 28844 gene locus_tag LOCUS_04240 gene ppaX 29479 28844 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 protein_id gnl|my_center|LOCUS_04240 30655 29531 gene locus_tag LOCUS_04250 30655 29531 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_04250 30890 31168 gene locus_tag LOCUS_04260 30890 31168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 31189 31800 gene locus_tag LOCUS_04270 31189 31800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 32547 31816 gene locus_tag LOCUS_04280 32547 31816 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_04280 34077 32557 gene locus_tag LOCUS_04290 34077 32557 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_04290 34801 34118 gene locus_tag LOCUS_04300 34801 34118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 35056 37104 gene locus_tag LOCUS_04310 35056 37104 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202778.1 protein_id gnl|my_center|LOCUS_04310 38832 37180 gene locus_tag LOCUS_04320 38832 37180 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_04320 41571 38875 gene locus_tag LOCUS_04330 41571 38875 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765337.1 protein_id gnl|my_center|LOCUS_04330 44403 41758 gene locus_tag LOCUS_04340 44403 41758 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_04340 44749 45186 gene locus_tag LOCUS_04350 44749 45186 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_04350 45425 47410 gene locus_tag LOCUS_04360 45425 47410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 48563 48090 gene locus_tag LOCUS_04370 48563 48090 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_04370 49001 49942 gene locus_tag LOCUS_04380 49001 49942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201889.1 protein_id gnl|my_center|LOCUS_04380 51519 50077 gene locus_tag LOCUS_04390 51519 50077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 52748 51723 gene locus_tag LOCUS_04400 52748 51723 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_04400 52994 54031 gene locus_tag LOCUS_04410 52994 54031 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_04410 54295 55950 gene locus_tag LOCUS_04420 54295 55950 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_04420 55987 56280 gene locus_tag LOCUS_04430 55987 56280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 56431 56895 gene locus_tag LOCUS_04440 56431 56895 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789670.1 protein_id gnl|my_center|LOCUS_04440 57075 57773 gene locus_tag LOCUS_04450 gene mtnN 57075 57773 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 protein_id gnl|my_center|LOCUS_04450 57798 58283 gene locus_tag LOCUS_04460 57798 58283 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_04460 59218 58307 gene locus_tag LOCUS_04470 59218 58307 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_04470 61078 59276 gene locus_tag LOCUS_04480 gene typA 61078 59276 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_04480 61262 61531 gene locus_tag LOCUS_04490 gene rpsO 61262 61531 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_04490 61732 62202 gene locus_tag LOCUS_04500 61732 62202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 62224 62706 gene locus_tag LOCUS_04510 62224 62706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 63151 64155 gene locus_tag LOCUS_04520 63151 64155 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_04520 65803 64325 gene locus_tag LOCUS_04530 65803 64325 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_04530 67727 66078 gene locus_tag LOCUS_04540 67727 66078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766136.1 protein_id gnl|my_center|LOCUS_04540 68234 67740 gene locus_tag LOCUS_04550 68234 67740 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_04550 69513 68275 gene locus_tag LOCUS_04560 69513 68275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 70633 69620 gene locus_tag LOCUS_04570 70633 69620 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_04570 70921 71514 gene locus_tag LOCUS_04580 70921 71514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 71638 71808 gene locus_tag LOCUS_04590 71638 71808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 71814 72332 gene locus_tag LOCUS_04600 71814 72332 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203468.1 protein_id gnl|my_center|LOCUS_04600 72906 72295 gene locus_tag LOCUS_04610 72906 72295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 73638 73009 gene locus_tag LOCUS_04620 73638 73009 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107703.1 protein_id gnl|my_center|LOCUS_04620 74537 73755 gene locus_tag LOCUS_04630 74537 73755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 74760 74984 gene locus_tag LOCUS_04640 74760 74984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 75724 75005 gene locus_tag LOCUS_04650 75724 75005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 76388 75744 gene locus_tag LOCUS_04660 76388 75744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 78034 76430 gene locus_tag LOCUS_04670 78034 76430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 78584 78048 gene locus_tag LOCUS_04680 78584 78048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 80180 78627 gene locus_tag LOCUS_04690 80180 78627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 81327 80164 gene locus_tag LOCUS_04700 81327 80164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 81941 81336 gene locus_tag LOCUS_04710 81941 81336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 82920 81967 gene locus_tag LOCUS_04720 82920 81967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 83710 83021 gene locus_tag LOCUS_04730 83710 83021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 84103 83732 gene locus_tag LOCUS_04740 84103 83732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 84959 84618 gene locus_tag LOCUS_04750 84959 84618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 87516 85930 gene locus_tag LOCUS_04760 87516 85930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_04760 87681 88973 gene locus_tag LOCUS_04770 87681 88973 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_04770 90524 89238 gene locus_tag LOCUS_04780 90524 89238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 92159 90561 gene locus_tag LOCUS_04790 92159 90561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 93116 92652 gene locus_tag LOCUS_04800 93116 92652 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108669.1 protein_id gnl|my_center|LOCUS_04800 94215 95213 gene locus_tag LOCUS_04810 94215 95213 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_04810 95218 98415 gene locus_tag LOCUS_04820 95218 98415 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460042.1 protein_id gnl|my_center|LOCUS_04820 98648 100780 gene locus_tag LOCUS_04830 98648 100780 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_04830 102303 100912 gene locus_tag LOCUS_04840 102303 100912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 102464 103042 gene locus_tag LOCUS_04850 102464 103042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 106072 103670 gene locus_tag LOCUS_04860 106072 103670 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_04860 109251 106237 gene locus_tag LOCUS_04870 109251 106237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 110914 109328 gene locus_tag LOCUS_04880 110914 109328 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840507.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence06 3425 87 gene locus_tag LOCUS_04890 gene secA 3425 87 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_04890 3954 3595 gene locus_tag LOCUS_04900 3954 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5365 4004 gene locus_tag LOCUS_04910 5365 4004 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_04910 5510 6745 gene locus_tag LOCUS_04920 5510 6745 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_04920 6789 7454 gene locus_tag LOCUS_04930 gene lptC 6789 7454 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_04930 7474 8745 gene locus_tag LOCUS_04940 7474 8745 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_04940 8921 11071 gene locus_tag LOCUS_04950 8921 11071 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_04950 11634 11206 gene locus_tag LOCUS_04960 11634 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_04960 14250 11716 gene locus_tag LOCUS_04970 14250 11716 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_04970 15189 14314 gene locus_tag LOCUS_04980 gene rfbA 15189 14314 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_04980 15418 16068 gene locus_tag LOCUS_04990 15418 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760131.1 protein_id gnl|my_center|LOCUS_04990 16158 16451 gene locus_tag LOCUS_05000 16158 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 16463 16762 gene locus_tag LOCUS_05010 16463 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 16789 18324 gene locus_tag LOCUS_05020 gene rny 16789 18324 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_05020 18379 19140 gene locus_tag LOCUS_05030 18379 19140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_05030 20251 19583 gene locus_tag LOCUS_05040 20251 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 22075 20432 gene locus_tag LOCUS_05050 gene hcp 22075 20432 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062937.1 protein_id gnl|my_center|LOCUS_05050 24628 22364 gene locus_tag LOCUS_05060 gene ccsA 24628 22364 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_05060 26493 24790 gene locus_tag LOCUS_05070 26493 24790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 27893 26664 gene locus_tag LOCUS_05080 27893 26664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 29294 27993 gene locus_tag LOCUS_05090 29294 27993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_05090 29665 30621 gene locus_tag LOCUS_05100 29665 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 31383 30754 gene locus_tag LOCUS_05110 31383 30754 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_05110 32565 31438 gene locus_tag LOCUS_05120 gene cls 32565 31438 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_05120 33744 32764 gene locus_tag LOCUS_05130 33744 32764 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_05130 34569 33820 gene locus_tag LOCUS_05140 gene kdsA 34569 33820 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879994.1 protein_id gnl|my_center|LOCUS_05140 36970 34646 gene locus_tag LOCUS_05150 36970 34646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 37183 38133 gene locus_tag LOCUS_05160 37183 38133 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_05160 38506 41589 gene locus_tag LOCUS_05170 38506 41589 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_05170 41609 43285 gene locus_tag LOCUS_05180 41609 43285 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_05180 43328 45361 gene locus_tag LOCUS_05190 43328 45361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 45380 48055 gene locus_tag LOCUS_05200 45380 48055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 48130 49680 gene locus_tag LOCUS_05210 48130 49680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 49908 51206 gene locus_tag LOCUS_05220 49908 51206 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_05220 51348 52631 gene locus_tag LOCUS_05230 51348 52631 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_05230 52956 53978 gene locus_tag LOCUS_05240 52956 53978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 54294 57431 gene locus_tag LOCUS_05250 54294 57431 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_05250 57494 59287 gene locus_tag LOCUS_05260 57494 59287 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_05260 59321 60961 gene locus_tag LOCUS_05270 59321 60961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 60975 62531 gene locus_tag LOCUS_05280 60975 62531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 62775 64058 gene locus_tag LOCUS_05290 62775 64058 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_05290 64120 65226 gene locus_tag LOCUS_05300 64120 65226 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_05300 65247 66419 gene locus_tag LOCUS_05310 65247 66419 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_05310 66548 67891 gene locus_tag LOCUS_05320 66548 67891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_05320 67933 69114 gene locus_tag LOCUS_05330 67933 69114 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_05330 69278 69895 gene locus_tag LOCUS_05340 69278 69895 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_05340 69922 70548 gene locus_tag LOCUS_05350 69922 70548 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_05350 71482 71832 gene locus_tag LOCUS_05360 71482 71832 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_05360 71823 72548 gene locus_tag LOCUS_05370 71823 72548 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_05370 72568 74139 gene locus_tag LOCUS_05380 72568 74139 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760950.1 protein_id gnl|my_center|LOCUS_05380 74142 75227 gene locus_tag LOCUS_05390 gene nuoH 74142 75227 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109091.1 protein_id gnl|my_center|LOCUS_05390 75262 75792 gene locus_tag LOCUS_05400 75262 75792 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109090.1 protein_id gnl|my_center|LOCUS_05400 75808 76335 gene locus_tag LOCUS_05410 75808 76335 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_05410 76332 76640 gene locus_tag LOCUS_05420 gene nuoK 76332 76640 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_05420 76647 78602 gene locus_tag LOCUS_05430 gene nuoL 76647 78602 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_05430 78636 80135 gene locus_tag LOCUS_05440 78636 80135 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_05440 80151 81602 gene locus_tag LOCUS_05450 80151 81602 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_05450 81836 82021 gene locus_tag LOCUS_05460 81836 82021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 82259 83092 gene locus_tag LOCUS_05470 82259 83092 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_05470 84424 83141 gene locus_tag LOCUS_05480 84424 83141 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence07 848 390 gene locus_tag LOCUS_05490 848 390 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_05490 1104 2132 gene locus_tag LOCUS_05500 gene holA 1104 2132 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_05500 3178 3699 gene locus_tag LOCUS_05510 3178 3699 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_05510 3973 3818 gene locus_tag LOCUS_05520 3973 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4186 4962 gene locus_tag LOCUS_05530 4186 4962 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_05530 5084 5992 gene locus_tag LOCUS_05540 5084 5992 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_05540 6006 6287 gene locus_tag LOCUS_05550 6006 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6751 7587 gene locus_tag LOCUS_05560 6751 7587 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_05560 7671 8840 gene locus_tag LOCUS_05570 7671 8840 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_05570 9006 10073 gene locus_tag LOCUS_05580 9006 10073 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_05580 10086 10883 gene locus_tag LOCUS_05590 10086 10883 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_05590 11306 12784 gene locus_tag LOCUS_05600 11306 12784 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_05600 13683 14339 gene locus_tag LOCUS_05610 13683 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 14462 15814 gene locus_tag LOCUS_05620 gene ffh 14462 15814 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_05620 15906 16784 gene locus_tag LOCUS_05630 gene folD 15906 16784 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_05630 16957 19557 gene locus_tag LOCUS_05640 16957 19557 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_05640 20010 21767 gene locus_tag LOCUS_05650 gene ilvD 20010 21767 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_05650 21858 23573 gene locus_tag LOCUS_05660 gene ilvB 21858 23573 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_05660 23680 24225 gene locus_tag LOCUS_05670 gene ilvN 23680 24225 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_05670 24343 25146 gene locus_tag LOCUS_05680 24343 25146 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_05680 25344 26387 gene locus_tag LOCUS_05690 gene ilvC 25344 26387 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_05690 28550 26637 gene locus_tag LOCUS_05700 28550 26637 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_05700 30326 28605 gene locus_tag LOCUS_05710 gene recJ 30326 28605 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_05710 31871 30660 gene locus_tag LOCUS_05720 31871 30660 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_05720 33415 32009 gene locus_tag LOCUS_05730 33415 32009 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_05730 33624 34475 gene locus_tag LOCUS_05740 33624 34475 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_05740 35294 34620 gene locus_tag LOCUS_05750 gene trmD 35294 34620 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_05750 35617 37887 gene locus_tag LOCUS_05760 35617 37887 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_05760 37890 39236 gene locus_tag LOCUS_05770 37890 39236 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_05770 39540 39911 gene locus_tag LOCUS_05780 39540 39911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 40961 39942 gene locus_tag LOCUS_05790 gene hemW 40961 39942 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_05790 41307 43469 gene locus_tag LOCUS_05800 41307 43469 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_05800 43706 45199 gene locus_tag LOCUS_05810 43706 45199 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_05810 45259 45957 gene locus_tag LOCUS_05820 45259 45957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_05820 46215 46018 gene locus_tag LOCUS_05830 46215 46018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 46406 46750 gene locus_tag LOCUS_05840 gene rpsF 46406 46750 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_05840 46753 47022 gene locus_tag LOCUS_05850 gene rpsR 46753 47022 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_05850 47043 47573 gene locus_tag LOCUS_05860 gene rplI 47043 47573 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_05860 47856 48743 gene locus_tag LOCUS_05870 gene fabD 47856 48743 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_05870 48833 51025 gene locus_tag LOCUS_05880 48833 51025 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_05880 52082 52390 gene locus_tag LOCUS_05890 52082 52390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 52450 52680 gene locus_tag LOCUS_05900 52450 52680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 54200 53064 gene locus_tag LOCUS_05910 gene hxsC 54200 53064 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457560.1 protein_id gnl|my_center|LOCUS_05910 55676 54207 gene locus_tag LOCUS_05920 gene hxsB 55676 54207 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_05920 56210 55884 gene locus_tag LOCUS_05930 56210 55884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 56917 57753 gene locus_tag LOCUS_05940 56917 57753 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_05940 57735 60635 gene locus_tag LOCUS_05950 57735 60635 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_05950 60963 62525 gene locus_tag LOCUS_05960 60963 62525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_05960 62764 64326 gene locus_tag LOCUS_05970 62764 64326 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_05970 64786 64469 gene locus_tag LOCUS_05980 64786 64469 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_05980 64920 67007 gene locus_tag LOCUS_05990 64920 67007 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_05990 68673 67102 gene locus_tag LOCUS_06000 68673 67102 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_06000 69238 68954 gene locus_tag LOCUS_06010 69238 68954 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_06010 69439 70230 gene locus_tag LOCUS_06020 69439 70230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 70382 70909 gene locus_tag LOCUS_06030 70382 70909 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_06030 71249 72622 gene locus_tag LOCUS_06040 gene pyk 71249 72622 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_06040 72741 73541 gene locus_tag LOCUS_06050 72741 73541 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_06050 73595 75499 gene locus_tag LOCUS_06060 gene glmS 73595 75499 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_06060 75605 77488 gene locus_tag LOCUS_06070 75605 77488 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_06070 77555 78640 gene locus_tag LOCUS_06080 gene carA 77555 78640 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_06080 78702 81935 gene locus_tag LOCUS_06090 gene carB 78702 81935 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_06090 82122 83897 gene locus_tag LOCUS_06100 82122 83897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764485.1 protein_id gnl|my_center|LOCUS_06100 84135 84287 gene locus_tag LOCUS_06110 84135 84287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence08 519 992 gene locus_tag LOCUS_06120 519 992 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_06120 1005 2432 gene locus_tag LOCUS_06130 1005 2432 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103878196.1 protein_id gnl|my_center|LOCUS_06130 2593 4065 gene locus_tag LOCUS_06140 2593 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4406 5521 gene locus_tag LOCUS_06150 4406 5521 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_06150 5556 7304 gene locus_tag LOCUS_06160 5556 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7329 9233 gene locus_tag LOCUS_06170 7329 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9248 11200 gene locus_tag LOCUS_06180 9248 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 11751 12557 gene locus_tag LOCUS_06190 11751 12557 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_06190 13186 12722 gene locus_tag LOCUS_06200 13186 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 14656 13643 gene locus_tag LOCUS_06210 14656 13643 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_06210 16140 14920 gene locus_tag LOCUS_06220 gene fucP 16140 14920 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_06220 17745 16183 gene locus_tag LOCUS_06230 17745 16183 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_06230 21129 18025 gene locus_tag LOCUS_06240 21129 18025 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_06240 21473 21781 gene locus_tag LOCUS_06250 21473 21781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 22683 21859 gene locus_tag LOCUS_06260 22683 21859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 23353 22859 gene locus_tag LOCUS_06270 gene rplQ 23353 22859 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_06270 24341 23385 gene locus_tag LOCUS_06280 24341 23385 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_06280 24998 24393 gene locus_tag LOCUS_06290 gene rpsD 24998 24393 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_06290 25445 25056 gene locus_tag LOCUS_06300 gene rpsK 25445 25056 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_06300 25847 25467 gene locus_tag LOCUS_06310 gene rpsM 25847 25467 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_06310 26299 26081 gene locus_tag LOCUS_06320 gene infA 26299 26081 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_06320 27924 26587 gene locus_tag LOCUS_06330 gene secY 27924 26587 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_06330 28375 27929 gene locus_tag LOCUS_06340 gene rplO 28375 27929 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_06340 28578 28402 gene locus_tag LOCUS_06350 gene rpmD 28578 28402 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_06350 29107 28595 gene locus_tag LOCUS_06360 gene rpsE 29107 28595 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_06360 29458 29114 gene locus_tag LOCUS_06370 gene rplR 29458 29114 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_06370 30049 29477 gene locus_tag LOCUS_06380 gene rplF 30049 29477 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_06380 30459 30064 gene locus_tag LOCUS_06390 gene rpsH 30459 30064 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_06390 30836 30534 gene locus_tag LOCUS_06400 gene rpsN 30836 30534 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_06400 31396 30842 gene locus_tag LOCUS_06410 gene rplE 31396 30842 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_06410 31713 31396 gene locus_tag LOCUS_06420 gene rplX 31713 31396 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_06420 32099 31734 gene locus_tag LOCUS_06430 gene rplN 32099 31734 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_06430 32368 32102 gene locus_tag LOCUS_06440 gene rpsQ 32368 32102 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_06440 32565 32371 gene locus_tag LOCUS_06450 gene rpmC 32565 32371 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_06450 32996 32568 gene locus_tag LOCUS_06460 gene rplP 32996 32568 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_06460 33744 33013 gene locus_tag LOCUS_06470 gene rpsC 33744 33013 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_06470 34158 33754 gene locus_tag LOCUS_06480 gene rplV 34158 33754 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_06480 34460 34194 gene locus_tag LOCUS_06490 gene rpsS 34460 34194 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_06490 35298 34471 gene locus_tag LOCUS_06500 gene rplB 35298 34471 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_06500 35600 35307 gene locus_tag LOCUS_06510 gene rplW 35600 35307 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_06510 36247 35618 gene locus_tag LOCUS_06520 gene rplD 36247 35618 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_06520 36861 36247 gene locus_tag LOCUS_06530 gene rplC 36861 36247 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762034.1 protein_id gnl|my_center|LOCUS_06530 37186 36881 gene locus_tag LOCUS_06540 gene rpsJ 37186 36881 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_06540 39412 37298 gene locus_tag LOCUS_06550 gene fusA 39412 37298 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_06550 39916 39440 gene locus_tag LOCUS_06560 gene rpsG 39916 39440 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_06560 40478 40098 gene locus_tag LOCUS_06570 gene rpsL 40478 40098 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_06570 41048 40722 gene locus_tag LOCUS_06580 41048 40722 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_06580 45614 41280 gene locus_tag LOCUS_06590 gene rpoC 45614 41280 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_06590 49458 45646 gene locus_tag LOCUS_06600 gene rpoB 49458 45646 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_06600 49947 49570 gene locus_tag LOCUS_06610 gene rplL 49947 49570 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_06610 50522 50004 gene locus_tag LOCUS_06620 gene rplJ 50522 50004 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_06620 51233 50541 gene locus_tag LOCUS_06630 gene rplA 51233 50541 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_06630 51695 51255 gene locus_tag LOCUS_06640 gene rplK 51695 51255 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_06640 52296 51754 gene locus_tag LOCUS_06650 gene nusG 52296 51754 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_06650 52497 52309 gene locus_tag LOCUS_06660 gene secE 52497 52309 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_06660 52586 52513 gene locus_tag LOCUS_t00130 52586 52513 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 53846 52650 gene locus_tag LOCUS_06670 gene tuf 53846 52650 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_06670 53986 53914 gene locus_tag LOCUS_t00140 53986 53914 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54073 54000 gene locus_tag LOCUS_t00150 54073 54000 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54168 54086 gene locus_tag LOCUS_t00160 54168 54086 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 54259 54185 gene locus_tag LOCUS_t00170 54259 54185 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54670 54359 gene locus_tag LOCUS_06680 gene raiA 54670 54359 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_06680 55566 54682 gene locus_tag LOCUS_06690 gene xerC 55566 54682 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_06690 55838 55647 gene locus_tag LOCUS_06700 gene rpsU 55838 55647 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_06700 57762 55975 gene locus_tag LOCUS_06710 57762 55975 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_06710 58009 59001 gene locus_tag LOCUS_06720 58009 59001 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_06720 59221 60075 gene locus_tag LOCUS_06730 59221 60075 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_06730 60339 61541 gene locus_tag LOCUS_06740 60339 61541 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_06740 61595 62119 gene locus_tag LOCUS_06750 61595 62119 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_06750 63483 62221 gene locus_tag LOCUS_06760 63483 62221 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_06760 65102 63585 gene locus_tag LOCUS_06770 gene gltX 65102 63585 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_06770 65221 67320 gene locus_tag LOCUS_06780 65221 67320 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_06780 67539 69167 gene locus_tag LOCUS_06790 67539 69167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 71609 69339 gene locus_tag LOCUS_06800 gene priA 71609 69339 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_06800 72392 71781 gene locus_tag LOCUS_06810 72392 71781 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_06810 73455 72421 gene locus_tag LOCUS_06820 73455 72421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 74688 73603 gene locus_tag LOCUS_06830 74688 73603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 75456 74728 gene locus_tag LOCUS_06840 75456 74728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 76922 75462 gene locus_tag LOCUS_06850 gene gldK 76922 75462 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_06850 77923 76961 gene locus_tag LOCUS_06860 77923 76961 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_06860 79313 78297 gene locus_tag LOCUS_06870 79313 78297 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_06870 79968 79282 gene locus_tag LOCUS_06880 79968 79282 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_06880 81670 80450 gene locus_tag LOCUS_06890 81670 80450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 82008 82895 gene locus_tag LOCUS_06900 gene bla 82008 82895 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence09 96 178 gene locus_tag LOCUS_t00180 96 178 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 203 287 gene locus_tag LOCUS_t00190 203 287 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 307 380 gene locus_tag LOCUS_t00200 307 380 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 412 948 gene locus_tag LOCUS_06910 412 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 977 1324 gene locus_tag LOCUS_06920 977 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1386 2693 gene locus_tag LOCUS_06930 1386 2693 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_06930 2790 3368 gene locus_tag LOCUS_06940 2790 3368 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_06940 3355 4500 gene locus_tag LOCUS_06950 3355 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5243 4506 gene locus_tag LOCUS_06960 5243 4506 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_06960 6159 5314 gene locus_tag LOCUS_06970 gene murQ 6159 5314 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_06970 6882 6277 gene locus_tag LOCUS_06980 6882 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7383 8141 gene locus_tag LOCUS_06990 7383 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 8597 8148 gene locus_tag LOCUS_07000 8597 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11119 8792 gene locus_tag LOCUS_07010 11119 8792 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_07010 16341 11293 gene locus_tag LOCUS_07020 16341 11293 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_07020 17035 16478 gene locus_tag LOCUS_07030 17035 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 17902 17129 gene locus_tag LOCUS_07040 17902 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18133 20202 gene locus_tag LOCUS_07050 18133 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 21236 20247 gene locus_tag LOCUS_07060 21236 20247 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_07060 22106 21285 gene locus_tag LOCUS_07070 22106 21285 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_07070 22919 22152 gene locus_tag LOCUS_07080 22919 22152 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_07080 23223 23702 gene locus_tag LOCUS_07090 23223 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 23699 24406 gene locus_tag LOCUS_07100 23699 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 24424 27039 gene locus_tag LOCUS_07110 24424 27039 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_07110 27137 28618 gene locus_tag LOCUS_07120 27137 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 29055 28708 gene locus_tag LOCUS_07130 29055 28708 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_07130 29335 29039 gene locus_tag LOCUS_07140 29335 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 30211 29843 gene locus_tag LOCUS_07150 30211 29843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 30497 30204 gene locus_tag LOCUS_07160 30497 30204 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_07160 30717 31208 gene locus_tag LOCUS_07170 30717 31208 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_07170 31216 32013 gene locus_tag LOCUS_07180 31216 32013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 32015 34585 gene locus_tag LOCUS_07190 32015 34585 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_07190 34690 35706 gene locus_tag LOCUS_07200 34690 35706 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785146.1 protein_id gnl|my_center|LOCUS_07200 35977 35708 gene locus_tag LOCUS_07210 35977 35708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 36003 36401 gene locus_tag LOCUS_07220 36003 36401 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_07220 38666 36453 gene locus_tag LOCUS_07230 38666 36453 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_07230 38855 40273 gene locus_tag LOCUS_07240 38855 40273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 40308 40994 gene locus_tag LOCUS_07250 gene mtrA 40308 40994 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929974.1 protein_id gnl|my_center|LOCUS_07250 41400 40978 gene locus_tag LOCUS_07260 41400 40978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 42314 41415 gene locus_tag LOCUS_07270 42314 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 42839 42333 gene locus_tag LOCUS_07280 42839 42333 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_07280 43885 42980 gene locus_tag LOCUS_07290 43885 42980 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061473548.1 protein_id gnl|my_center|LOCUS_07290 45909 43885 gene locus_tag LOCUS_07300 45909 43885 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107315.1 protein_id gnl|my_center|LOCUS_07300 46611 45931 gene locus_tag LOCUS_07310 46611 45931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 46923 47984 gene locus_tag LOCUS_07320 46923 47984 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_07320 49151 48075 gene locus_tag LOCUS_07330 gene hisB 49151 48075 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_07330 49855 49178 gene locus_tag LOCUS_07340 49855 49178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 50677 49928 gene locus_tag LOCUS_07350 50677 49928 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_07350 50868 52982 gene locus_tag LOCUS_07360 50868 52982 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_07360 53603 53163 gene locus_tag LOCUS_07370 53603 53163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 53732 54535 gene locus_tag LOCUS_07380 53732 54535 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_07380 54967 54599 gene locus_tag LOCUS_07390 54967 54599 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_07390 55817 55479 gene locus_tag LOCUS_07400 55817 55479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 56136 55912 gene locus_tag LOCUS_07410 56136 55912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 56922 58091 gene locus_tag LOCUS_07420 56922 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 58490 58242 gene locus_tag LOCUS_07430 58490 58242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 58531 58803 gene locus_tag LOCUS_07440 58531 58803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 58794 59135 gene locus_tag LOCUS_07450 58794 59135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 60813 59227 gene locus_tag LOCUS_07460 60813 59227 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_07460 61210 63339 gene locus_tag LOCUS_07470 61210 63339 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_07470 63609 63682 gene locus_tag LOCUS_t00210 63609 63682 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 63943 64857 gene locus_tag LOCUS_07480 63943 64857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 65499 67031 gene locus_tag LOCUS_07490 65499 67031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 67905 67393 gene locus_tag LOCUS_07500 67905 67393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 68715 68143 gene locus_tag LOCUS_07510 68715 68143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 69240 68998 gene locus_tag LOCUS_07520 69240 68998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 69440 69829 gene locus_tag LOCUS_07530 69440 69829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 70009 71394 gene locus_tag LOCUS_07540 70009 71394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109060.1 protein_id gnl|my_center|LOCUS_07540 71391 72269 gene locus_tag LOCUS_07550 71391 72269 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_07550 72263 72649 gene locus_tag LOCUS_07560 72263 72649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 72876 73019 gene locus_tag LOCUS_07570 72876 73019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 73422 73694 gene locus_tag LOCUS_07580 73422 73694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 73685 74029 gene locus_tag LOCUS_07590 73685 74029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 74516 74779 gene locus_tag LOCUS_07600 74516 74779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 74776 75186 gene locus_tag LOCUS_07610 74776 75186 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_07610 75806 76393 gene locus_tag LOCUS_07620 gene rfbC 75806 76393 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_07620 76759 77976 gene locus_tag LOCUS_07630 76759 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 77982 79034 gene locus_tag LOCUS_07640 77982 79034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 79015 80100 gene locus_tag LOCUS_07650 79015 80100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 80331 80918 gene locus_tag LOCUS_07660 gene rfbC 80331 80918 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_07660 81022 81549 gene locus_tag LOCUS_07670 81022 81549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence10 1516 206 gene locus_tag LOCUS_07680 1516 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2507 1524 gene locus_tag LOCUS_07690 2507 1524 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_07690 4111 2522 gene locus_tag LOCUS_07700 4111 2522 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_07700 7448 4128 gene locus_tag LOCUS_07710 7448 4128 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_07710 9332 7872 gene locus_tag LOCUS_07720 9332 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10032 9337 gene locus_tag LOCUS_07730 10032 9337 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_07730 10279 10533 gene locus_tag LOCUS_07740 10279 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 11797 10586 gene locus_tag LOCUS_07750 11797 10586 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_07750 12909 12055 gene locus_tag LOCUS_07760 12909 12055 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_07760 13348 17073 gene locus_tag LOCUS_07770 gene purL 13348 17073 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814911.1 protein_id gnl|my_center|LOCUS_07770 17078 17617 gene locus_tag LOCUS_07780 17078 17617 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_07780 17707 18279 gene locus_tag LOCUS_07790 17707 18279 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_07790 18483 20153 gene locus_tag LOCUS_07800 18483 20153 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_07800 20457 22667 gene locus_tag LOCUS_07810 20457 22667 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_07810 22706 23878 gene locus_tag LOCUS_07820 22706 23878 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_07820 23895 25421 gene locus_tag LOCUS_07830 23895 25421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 25604 27337 gene locus_tag LOCUS_07840 25604 27337 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764603.1 protein_id gnl|my_center|LOCUS_07840 27509 29950 gene locus_tag LOCUS_07850 27509 29950 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_07850 30311 30180 gene locus_tag LOCUS_07860 30311 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 30551 32116 gene locus_tag LOCUS_07870 30551 32116 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_07870 35078 32220 gene locus_tag LOCUS_07880 35078 32220 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_07880 36798 35290 gene locus_tag LOCUS_07890 36798 35290 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022472115.1 protein_id gnl|my_center|LOCUS_07890 37301 37053 gene locus_tag LOCUS_07900 37301 37053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 39538 37391 gene locus_tag LOCUS_07910 39538 37391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 40636 39593 gene locus_tag LOCUS_07920 40636 39593 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_07920 43377 40666 gene locus_tag LOCUS_07930 43377 40666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 45304 43478 gene locus_tag LOCUS_07940 45304 43478 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_07940 48523 45326 gene locus_tag LOCUS_07950 48523 45326 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107217.1 protein_id gnl|my_center|LOCUS_07950 50395 48599 gene locus_tag LOCUS_07960 50395 48599 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_07960 53512 50423 gene locus_tag LOCUS_07970 53512 50423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_07970 55464 53548 gene locus_tag LOCUS_07980 55464 53548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 58659 55771 gene locus_tag LOCUS_07990 58659 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 60835 58958 gene locus_tag LOCUS_08000 60835 58958 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_08000 62773 60908 gene locus_tag LOCUS_08010 gene pulA 62773 60908 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_08010 65127 62992 gene locus_tag LOCUS_08020 65127 62992 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_08020 67979 65304 gene locus_tag LOCUS_08030 67979 65304 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_08030 69492 68152 gene locus_tag LOCUS_08040 69492 68152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_08040 70515 69514 gene locus_tag LOCUS_08050 70515 69514 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_08050 70883 73975 gene locus_tag LOCUS_08060 70883 73975 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108938.1 protein_id gnl|my_center|LOCUS_08060 74069 75730 gene locus_tag LOCUS_08070 gene susD 74069 75730 CDS product starch-binding outer membrane lipoprotein SusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767005.1 protein_id gnl|my_center|LOCUS_08070 75762 77021 gene locus_tag LOCUS_08080 75762 77021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 77044 78516 gene locus_tag LOCUS_08090 77044 78516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 80277 79024 gene locus_tag LOCUS_08100 80277 79024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157309541.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence11 52 3327 gene locus_tag LOCUS_08110 52 3327 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_08110 3356 4966 gene locus_tag LOCUS_08120 3356 4966 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_08120 4990 5868 gene locus_tag LOCUS_08130 4990 5868 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762845.1 protein_id gnl|my_center|LOCUS_08130 5882 7180 gene locus_tag LOCUS_08140 5882 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7219 8358 gene locus_tag LOCUS_08150 7219 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8887 9135 gene locus_tag LOCUS_08160 8887 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10494 9253 gene locus_tag LOCUS_08170 10494 9253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_08170 12110 11577 gene locus_tag LOCUS_08180 12110 11577 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_08180 12795 12355 gene locus_tag LOCUS_08190 12795 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13490 14041 gene locus_tag LOCUS_08200 13490 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 14068 14820 gene locus_tag LOCUS_08210 14068 14820 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100241.1 protein_id gnl|my_center|LOCUS_08210 15018 17150 gene locus_tag LOCUS_08220 15018 17150 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_08220 17165 17449 gene locus_tag LOCUS_08230 17165 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 17642 17560 gene locus_tag LOCUS_t00220 17642 17560 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17824 18939 gene locus_tag LOCUS_08240 17824 18939 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_08240 19020 20252 gene locus_tag LOCUS_08250 19020 20252 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_08250 23383 20522 gene locus_tag LOCUS_08260 23383 20522 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_08260 23489 25051 gene locus_tag LOCUS_08270 23489 25051 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_08270 25070 25756 gene locus_tag LOCUS_08280 25070 25756 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762560.1 protein_id gnl|my_center|LOCUS_08280 25840 27222 gene locus_tag LOCUS_08290 25840 27222 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_08290 27461 30283 gene locus_tag LOCUS_08300 27461 30283 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_08300 31008 31871 gene locus_tag LOCUS_08310 31008 31871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 34366 31997 gene locus_tag LOCUS_08320 gene bglX 34366 31997 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108030.1 protein_id gnl|my_center|LOCUS_08320 34677 36341 gene locus_tag LOCUS_08330 34677 36341 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_08330 38793 36529 gene locus_tag LOCUS_08340 38793 36529 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_08340 39382 42606 gene locus_tag LOCUS_08350 39382 42606 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_08350 42645 44192 gene locus_tag LOCUS_08360 42645 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 44286 45683 gene locus_tag LOCUS_08370 44286 45683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 45812 46930 gene locus_tag LOCUS_08380 45812 46930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 47123 48019 gene locus_tag LOCUS_08390 47123 48019 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_08390 49088 48342 gene locus_tag LOCUS_08400 49088 48342 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_08400 49518 49156 gene locus_tag LOCUS_08410 49518 49156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 50528 49674 gene locus_tag LOCUS_08420 50528 49674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 52634 50730 gene locus_tag LOCUS_08430 gene dnaK 52634 50730 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_08430 53995 52964 gene locus_tag LOCUS_08440 gene recA 53995 52964 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 protein_id gnl|my_center|LOCUS_08440 55242 54016 gene locus_tag LOCUS_08450 55242 54016 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_08450 55953 55345 gene locus_tag LOCUS_08460 55953 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 56557 56177 gene locus_tag LOCUS_08470 gene crcB 56557 56177 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_08470 57184 57807 gene locus_tag LOCUS_08480 57184 57807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 59493 58681 gene locus_tag LOCUS_08490 59493 58681 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_08490 60176 59487 gene locus_tag LOCUS_08500 60176 59487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 61442 60228 gene locus_tag LOCUS_08510 61442 60228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 61622 62161 gene locus_tag LOCUS_08520 61622 62161 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760363.1 protein_id gnl|my_center|LOCUS_08520 62198 62596 gene locus_tag LOCUS_08530 62198 62596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 62657 63124 gene locus_tag LOCUS_08540 62657 63124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 64434 63268 gene locus_tag LOCUS_08550 64434 63268 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_08550 65590 64892 gene locus_tag LOCUS_08560 65590 64892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 66078 65602 gene locus_tag LOCUS_08570 66078 65602 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_08570 66302 67456 gene locus_tag LOCUS_08580 66302 67456 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_08580 68849 67401 gene locus_tag LOCUS_08590 68849 67401 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_08590 69240 69704 gene locus_tag LOCUS_08600 gene greA 69240 69704 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_08600 71718 69775 gene locus_tag LOCUS_08610 71718 69775 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_08610 72278 71736 gene locus_tag LOCUS_08620 72278 71736 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_08620 73520 74161 gene locus_tag LOCUS_08630 73520 74161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 74341 74820 gene locus_tag LOCUS_08640 74341 74820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 74817 75308 gene locus_tag LOCUS_08650 74817 75308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 75289 75516 gene locus_tag LOCUS_08660 75289 75516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 77743 75833 gene locus_tag LOCUS_08670 77743 75833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 77918 77760 gene locus_tag LOCUS_08680 77918 77760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence12 <1 2740 gene locus_tag LOCUS_08690 <1 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796226.1:alanine--tRNA ligase 3017 4147 gene locus_tag LOCUS_08700 3017 4147 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_08700 4208 4720 gene locus_tag LOCUS_08710 4208 4720 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_08710 4867 6072 gene locus_tag LOCUS_08720 4867 6072 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_08720 7111 6128 gene locus_tag LOCUS_08730 7111 6128 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_08730 7883 7410 gene locus_tag LOCUS_08740 7883 7410 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_08740 8847 7939 gene locus_tag LOCUS_08750 8847 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 9631 8819 gene locus_tag LOCUS_08760 9631 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 10361 9594 gene locus_tag LOCUS_08770 10361 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 11419 10451 gene locus_tag LOCUS_08780 11419 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 12330 11797 gene locus_tag LOCUS_08790 12330 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 13521 12937 gene locus_tag LOCUS_08800 13521 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 15276 13762 gene locus_tag LOCUS_08810 15276 13762 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_08810 16445 15288 gene locus_tag LOCUS_08820 16445 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 17132 16461 gene locus_tag LOCUS_08830 17132 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 17487 17137 gene locus_tag LOCUS_08840 17487 17137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 18219 17521 gene locus_tag LOCUS_08850 18219 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 18973 18224 gene locus_tag LOCUS_08860 18973 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 19415 18978 gene locus_tag LOCUS_08870 19415 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 20086 19418 gene locus_tag LOCUS_08880 20086 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 20321 20100 gene locus_tag LOCUS_08890 20321 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 21342 22511 gene locus_tag LOCUS_08900 21342 22511 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_08900 22548 22820 gene locus_tag LOCUS_08910 22548 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 23555 26041 gene locus_tag LOCUS_08920 23555 26041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 26051 26542 gene locus_tag LOCUS_08930 26051 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 27973 26627 gene locus_tag LOCUS_08940 gene mobV 27973 26627 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202347.1 protein_id gnl|my_center|LOCUS_08940 29114 28164 gene locus_tag LOCUS_08950 29114 28164 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_08950 30647 29391 gene locus_tag LOCUS_08960 30647 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 31400 31029 gene locus_tag LOCUS_08970 31400 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 32620 31397 gene locus_tag LOCUS_08980 32620 31397 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200755826.1 protein_id gnl|my_center|LOCUS_08980 33232 34371 gene locus_tag LOCUS_08990 gene araJ 33232 34371 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_08990 34433 36574 gene locus_tag LOCUS_09000 gene dcp 34433 36574 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_09000 36591 38777 gene locus_tag LOCUS_09010 36591 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 39834 38836 gene locus_tag LOCUS_09020 39834 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 41386 39893 gene locus_tag LOCUS_09030 41386 39893 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_09030 42368 41424 gene locus_tag LOCUS_09040 42368 41424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 43087 42422 gene locus_tag LOCUS_09050 43087 42422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 43192 44628 gene locus_tag LOCUS_09060 gene potA 43192 44628 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_09060 44744 45445 gene locus_tag LOCUS_09070 44744 45445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_09070 45442 46263 gene locus_tag LOCUS_09080 45442 46263 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_09080 46260 47651 gene locus_tag LOCUS_09090 46260 47651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202988.1 protein_id gnl|my_center|LOCUS_09090 47803 47885 gene locus_tag LOCUS_t00230 47803 47885 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 49468 47996 gene locus_tag LOCUS_09100 49468 47996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 51139 49610 gene locus_tag LOCUS_09110 51139 49610 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_09110 51217 51696 gene locus_tag LOCUS_09120 51217 51696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 51702 52511 gene locus_tag LOCUS_09130 51702 52511 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_09130 52606 53136 gene locus_tag LOCUS_09140 52606 53136 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_09140 54608 53184 gene locus_tag LOCUS_09150 gene cls 54608 53184 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_09150 56641 54680 gene locus_tag LOCUS_09160 56641 54680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 56849 59383 gene locus_tag LOCUS_09170 56849 59383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 59612 60121 gene locus_tag LOCUS_09180 59612 60121 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_09180 60118 60723 gene locus_tag LOCUS_09190 60118 60723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 60814 62007 gene locus_tag LOCUS_09200 60814 62007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 62327 63061 gene locus_tag LOCUS_09210 62327 63061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 63084 63764 gene locus_tag LOCUS_09220 63084 63764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 65318 64185 gene locus_tag LOCUS_09230 65318 64185 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_09230 66565 65474 gene locus_tag LOCUS_09240 66565 65474 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_09240 67222 67821 gene locus_tag LOCUS_09250 67222 67821 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759907.1 protein_id gnl|my_center|LOCUS_09250 68085 70472 gene locus_tag LOCUS_09260 68085 70472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 70469 71518 gene locus_tag LOCUS_09270 gene mcrC 70469 71518 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_09270 71724 71978 gene locus_tag LOCUS_09280 71724 71978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence13 <1 686 gene locus_tag LOCUS_09290 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108662.1:relaxase/mobilization nuclease domain-containing protein 686 1474 gene locus_tag LOCUS_09300 686 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303091.1 protein_id gnl|my_center|LOCUS_09300 1655 3748 gene locus_tag LOCUS_09310 1655 3748 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_09310 4716 5294 gene locus_tag LOCUS_09320 4716 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5985 9011 gene locus_tag LOCUS_09330 5985 9011 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_09330 9024 10415 gene locus_tag LOCUS_09340 9024 10415 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_09340 10442 11668 gene locus_tag LOCUS_09350 10442 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 11842 14523 gene locus_tag LOCUS_09360 11842 14523 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693992.1 protein_id gnl|my_center|LOCUS_09360 14552 15424 gene locus_tag LOCUS_09370 14552 15424 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_09370 15776 16771 gene locus_tag LOCUS_09380 15776 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 17250 16840 gene locus_tag LOCUS_09390 gene folK 17250 16840 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_09390 18528 17344 gene locus_tag LOCUS_09400 gene queA 18528 17344 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_09400 19258 18542 gene locus_tag LOCUS_09410 gene truB 19258 18542 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_09410 20113 19268 gene locus_tag LOCUS_09420 20113 19268 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_09420 20380 20153 gene locus_tag LOCUS_09430 20380 20153 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_09430 21284 20406 gene locus_tag LOCUS_09440 21284 20406 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_09440 22317 21535 gene locus_tag LOCUS_09450 gene lpxA 22317 21535 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783787.1 protein_id gnl|my_center|LOCUS_09450 23742 22348 gene locus_tag LOCUS_09460 23742 22348 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_09460 27036 23770 gene locus_tag LOCUS_09470 27036 23770 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_09470 28281 27070 gene locus_tag LOCUS_09480 28281 27070 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_09480 29898 28456 gene locus_tag LOCUS_09490 29898 28456 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_09490 30010 30558 gene locus_tag LOCUS_09500 30010 30558 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_09500 30568 32661 gene locus_tag LOCUS_09510 30568 32661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 32808 33455 gene locus_tag LOCUS_09520 32808 33455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 33528 34121 gene locus_tag LOCUS_09530 gene folE 33528 34121 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_09530 34271 35023 gene locus_tag LOCUS_09540 34271 35023 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_09540 36014 35127 gene locus_tag LOCUS_09550 36014 35127 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_09550 36354 36187 gene locus_tag LOCUS_09560 36354 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 38733 36379 gene locus_tag LOCUS_09570 38733 36379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 38828 39118 gene locus_tag LOCUS_09580 38828 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 39510 39253 gene locus_tag LOCUS_09590 39510 39253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09590 40290 39811 gene locus_tag LOCUS_09600 40290 39811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 40699 41907 gene locus_tag LOCUS_09610 40699 41907 CDS product zinc-dependent metalloproteinase lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013547570.1 protein_id gnl|my_center|LOCUS_09610 41954 43198 gene locus_tag LOCUS_09620 gene aroA 41954 43198 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_09620 43588 43971 gene locus_tag LOCUS_09630 43588 43971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_09630 44038 44838 gene locus_tag LOCUS_09640 44038 44838 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759703.1 protein_id gnl|my_center|LOCUS_09640 44887 48039 gene locus_tag LOCUS_09650 44887 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 48740 48138 gene locus_tag LOCUS_09660 48740 48138 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_09660 49048 48737 gene locus_tag LOCUS_09670 49048 48737 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763960.1 protein_id gnl|my_center|LOCUS_09670 49365 50918 gene locus_tag LOCUS_09680 49365 50918 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_09680 50973 51383 gene locus_tag LOCUS_09690 gene tsaE 50973 51383 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_09690 51769 51455 gene locus_tag LOCUS_09700 gene trxA 51769 51455 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_09700 55517 51807 gene locus_tag LOCUS_09710 gene dnaE 55517 51807 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_09710 55683 56363 gene locus_tag LOCUS_09720 55683 56363 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_09720 56435 57166 gene locus_tag LOCUS_09730 gene pssA 56435 57166 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_09730 57985 57275 gene locus_tag LOCUS_09740 gene pyrH 57985 57275 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_09740 58755 58003 gene locus_tag LOCUS_09750 58755 58003 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_09750 59167 58793 gene locus_tag LOCUS_09760 59167 58793 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_09760 59271 59717 gene locus_tag LOCUS_09770 59271 59717 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_09770 60575 59718 gene locus_tag LOCUS_09780 60575 59718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_09780 61405 60641 gene locus_tag LOCUS_09790 gene rsmI 61405 60641 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_09790 61600 62085 gene locus_tag LOCUS_09800 61600 62085 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_09800 62100 63227 gene locus_tag LOCUS_09810 62100 63227 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_09810 63306 63379 gene locus_tag LOCUS_t00240 63306 63379 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 64336 63428 gene locus_tag LOCUS_09820 64336 63428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 64767 65459 gene locus_tag LOCUS_09830 64767 65459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 66867 65620 gene locus_tag LOCUS_09840 66867 65620 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence14 969 3668 gene locus_tag LOCUS_09850 969 3668 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765337.1 protein_id gnl|my_center|LOCUS_09850 3681 5297 gene locus_tag LOCUS_09860 3681 5297 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_09860 6042 6287 gene locus_tag LOCUS_09870 6042 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6235 6507 gene locus_tag LOCUS_09880 6235 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8713 7391 gene locus_tag LOCUS_09890 8713 7391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_09890 9178 10053 gene locus_tag LOCUS_09900 9178 10053 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_09900 10357 11280 gene locus_tag LOCUS_09910 10357 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 11362 11691 gene locus_tag LOCUS_09920 11362 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 13590 12451 gene locus_tag LOCUS_09930 13590 12451 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_09930 13894 15915 gene locus_tag LOCUS_09940 13894 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 16985 16095 gene locus_tag LOCUS_09950 16985 16095 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_09950 17069 17641 gene locus_tag LOCUS_09960 17069 17641 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_09960 17709 18377 gene locus_tag LOCUS_09970 17709 18377 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_09970 19164 18592 gene locus_tag LOCUS_09980 19164 18592 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_09980 19548 19282 gene locus_tag LOCUS_09990 19548 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 22258 19577 gene locus_tag LOCUS_10000 22258 19577 CDS product DUF6298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765768.1 protein_id gnl|my_center|LOCUS_10000 23022 22390 gene locus_tag LOCUS_10010 23022 22390 CDS product DUF3826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765811.1 protein_id gnl|my_center|LOCUS_10010 24783 23068 gene locus_tag LOCUS_10020 24783 23068 CDS product thrombospondin type 3 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765812.1 protein_id gnl|my_center|LOCUS_10020 24874 25086 gene locus_tag LOCUS_10030 24874 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 25055 27601 gene locus_tag LOCUS_10040 25055 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 27697 30462 gene locus_tag LOCUS_10050 27697 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 30853 30605 gene locus_tag LOCUS_10060 30853 30605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 33526 31337 gene locus_tag LOCUS_10070 33526 31337 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765813.1 protein_id gnl|my_center|LOCUS_10070 35737 33563 gene locus_tag LOCUS_10080 35737 33563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10080 36875 35712 gene locus_tag LOCUS_10090 36875 35712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10090 38416 36902 gene locus_tag LOCUS_10100 38416 36902 CDS product DUF4992 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765818.1 protein_id gnl|my_center|LOCUS_10100 39296 38523 gene locus_tag LOCUS_10110 39296 38523 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_10110 42396 39532 gene locus_tag LOCUS_10120 42396 39532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 45127 42569 gene locus_tag LOCUS_10130 45127 42569 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765772.1 protein_id gnl|my_center|LOCUS_10130 46568 45177 gene locus_tag LOCUS_10140 46568 45177 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 protein_id gnl|my_center|LOCUS_10140 49873 46703 gene locus_tag LOCUS_10150 49873 46703 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_10150 52797 49978 gene locus_tag LOCUS_10160 52797 49978 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_10160 54422 52995 gene locus_tag LOCUS_10170 54422 52995 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147306.1 protein_id gnl|my_center|LOCUS_10170 55235 54618 gene locus_tag LOCUS_10180 55235 54618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 55575 55339 gene locus_tag LOCUS_10190 55575 55339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 56392 55778 gene locus_tag LOCUS_10200 56392 55778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 57624 56506 gene locus_tag LOCUS_10210 57624 56506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_10210 61143 57868 gene locus_tag LOCUS_10220 61143 57868 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107554.1 protein_id gnl|my_center|LOCUS_10220 66049 62060 gene locus_tag LOCUS_10230 66049 62060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 66400 66200 gene locus_tag LOCUS_10240 66400 66200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 66731 66462 gene locus_tag LOCUS_10250 66731 66462 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence15 2414 270 gene locus_tag LOCUS_10260 2414 270 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_10260 2795 3451 gene locus_tag LOCUS_10270 2795 3451 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817347.1 protein_id gnl|my_center|LOCUS_10270 3694 4518 gene locus_tag LOCUS_10280 3694 4518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_10280 4583 5446 gene locus_tag LOCUS_10290 4583 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5512 5883 gene locus_tag LOCUS_10300 5512 5883 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_10300 6074 6790 gene locus_tag LOCUS_10310 6074 6790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_10310 6876 8165 gene locus_tag LOCUS_10320 6876 8165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_10320 8242 9489 gene locus_tag LOCUS_10330 8242 9489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_10330 9646 10764 gene locus_tag LOCUS_10340 9646 10764 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_10340 11593 10802 gene locus_tag LOCUS_10350 gene nagB 11593 10802 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_10350 12131 11679 gene locus_tag LOCUS_10360 12131 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 13671 12442 gene locus_tag LOCUS_10370 13671 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 14117 15499 gene locus_tag LOCUS_10380 14117 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 16831 15605 gene locus_tag LOCUS_10390 16831 15605 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_10390 17374 18348 gene locus_tag LOCUS_10400 17374 18348 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_10400 18459 21320 gene locus_tag LOCUS_10410 gene leuS 18459 21320 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_10410 21477 22433 gene locus_tag LOCUS_10420 21477 22433 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_10420 22480 23130 gene locus_tag LOCUS_10430 22480 23130 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_10430 24441 26447 gene locus_tag LOCUS_10440 24441 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 26444 27169 gene locus_tag LOCUS_10450 26444 27169 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674022.1 protein_id gnl|my_center|LOCUS_10450 27172 28254 gene locus_tag LOCUS_10460 27172 28254 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120712.1 protein_id gnl|my_center|LOCUS_10460 30008 28251 gene locus_tag LOCUS_10470 30008 28251 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_10470 31281 30034 gene locus_tag LOCUS_10480 31281 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 32406 31291 gene locus_tag LOCUS_10490 32406 31291 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_10490 33412 32453 gene locus_tag LOCUS_10500 33412 32453 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_10500 33491 34462 gene locus_tag LOCUS_10510 33491 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 36761 34830 gene locus_tag LOCUS_10520 36761 34830 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_10520 38050 37058 gene locus_tag LOCUS_10530 gene nadA 38050 37058 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_10530 39685 38600 gene locus_tag LOCUS_10540 39685 38600 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_10540 40380 39778 gene locus_tag LOCUS_10550 40380 39778 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_10550 40605 40841 gene locus_tag LOCUS_10560 40605 40841 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_10560 40864 42126 gene locus_tag LOCUS_10570 gene fabF 40864 42126 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_10570 42116 43198 gene locus_tag LOCUS_10580 gene rnc 42116 43198 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_10580 43408 44916 gene locus_tag LOCUS_10590 43408 44916 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_10590 44980 46947 gene locus_tag LOCUS_10600 44980 46947 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_10600 47011 47766 gene locus_tag LOCUS_10610 47011 47766 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_10610 48790 47834 gene locus_tag LOCUS_10620 48790 47834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 49504 48803 gene locus_tag LOCUS_10630 49504 48803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 49403 49600 gene locus_tag LOCUS_10640 49403 49600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 50412 49705 gene locus_tag LOCUS_10650 50412 49705 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_10650 52548 50680 gene locus_tag LOCUS_10660 52548 50680 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_10660 53107 52601 gene locus_tag LOCUS_10670 gene purE 53107 52601 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_10670 53741 53133 gene locus_tag LOCUS_10680 53741 53133 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_10680 55323 53800 gene locus_tag LOCUS_10690 gene rpoN 55323 53800 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_10690 55970 55326 gene locus_tag LOCUS_10700 55970 55326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 57878 56793 gene locus_tag LOCUS_10710 57878 56793 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_10710 58813 57941 gene locus_tag LOCUS_10720 58813 57941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 59106 60371 gene locus_tag LOCUS_10730 59106 60371 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_10730 60371 60802 gene locus_tag LOCUS_10740 60371 60802 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_10740 60837 61376 gene locus_tag LOCUS_10750 60837 61376 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_10750 62003 62203 gene locus_tag LOCUS_10760 62003 62203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 62302 63204 gene locus_tag LOCUS_10770 62302 63204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 63227 64162 gene locus_tag LOCUS_10780 63227 64162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 64249 65142 gene locus_tag LOCUS_10790 64249 65142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 65157 66506 gene locus_tag LOCUS_10800 65157 66506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence16 1903 398 gene locus_tag LOCUS_10810 1903 398 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_10810 4649 2505 gene locus_tag LOCUS_10820 4649 2505 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_10820 5391 4747 gene locus_tag LOCUS_10830 5391 4747 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_10830 6300 5554 gene locus_tag LOCUS_10840 6300 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7192 6428 gene locus_tag LOCUS_10850 7192 6428 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763964.1 protein_id gnl|my_center|LOCUS_10850 7548 9038 gene locus_tag LOCUS_10860 gene cysS 7548 9038 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_10860 10948 9086 gene locus_tag LOCUS_10870 10948 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11074 12213 gene locus_tag LOCUS_10880 11074 12213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_10880 12258 14921 gene locus_tag LOCUS_10890 gene mutS 12258 14921 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_10890 15865 15002 gene locus_tag LOCUS_10900 gene lgt 15865 15002 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_10900 16987 15884 gene locus_tag LOCUS_10910 gene ychF 16987 15884 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_10910 19301 17115 gene locus_tag LOCUS_10920 19301 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 20187 19261 gene locus_tag LOCUS_10930 20187 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_10930 20858 20469 gene locus_tag LOCUS_10940 20858 20469 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392799.1 protein_id gnl|my_center|LOCUS_10940 21082 20918 gene locus_tag LOCUS_10950 21082 20918 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_10950 24146 21444 gene locus_tag LOCUS_10960 gene polA 24146 21444 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_10960 24314 25291 gene locus_tag LOCUS_10970 24314 25291 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_10970 26326 25391 gene locus_tag LOCUS_10980 gene deoC 26326 25391 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_10980 26741 26382 gene locus_tag LOCUS_10990 26741 26382 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_10990 27243 26791 gene locus_tag LOCUS_11000 gene dtd 27243 26791 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_11000 29224 27377 gene locus_tag LOCUS_11010 gene uvrC 29224 27377 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_11010 29889 29359 gene locus_tag LOCUS_11020 29889 29359 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_11020 32011 30140 gene locus_tag LOCUS_11030 gene mnmG 32011 30140 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_11030 32333 32926 gene locus_tag LOCUS_11040 32333 32926 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_11040 32959 34941 gene locus_tag LOCUS_11050 32959 34941 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_11050 34957 35715 gene locus_tag LOCUS_11060 34957 35715 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_11060 36406 37980 gene locus_tag LOCUS_11070 36406 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 38103 39056 gene locus_tag LOCUS_11080 38103 39056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 39885 40589 gene locus_tag LOCUS_11090 39885 40589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 40741 41259 gene locus_tag LOCUS_11100 40741 41259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 42665 41208 gene locus_tag LOCUS_11110 42665 41208 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_11110 43297 44586 gene locus_tag LOCUS_11120 43297 44586 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_11120 44788 45939 gene locus_tag LOCUS_11130 44788 45939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_11130 46039 48048 gene locus_tag LOCUS_11140 46039 48048 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_11140 48186 49769 gene locus_tag LOCUS_11150 48186 49769 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_11150 50207 51046 gene locus_tag LOCUS_11160 50207 51046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 52136 51165 gene locus_tag LOCUS_11170 52136 51165 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_11170 52406 52239 gene locus_tag LOCUS_11180 52406 52239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 52410 53444 gene locus_tag LOCUS_11190 gene ruvB 52410 53444 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_11190 53467 53952 gene locus_tag LOCUS_11200 gene coaD 53467 53952 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_11200 53972 54406 gene locus_tag LOCUS_11210 gene ybeY 53972 54406 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_11210 55551 54562 gene locus_tag LOCUS_11220 gene dusB 55551 54562 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_11220 56774 55644 gene locus_tag LOCUS_11230 gene dprA 56774 55644 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_11230 58079 56787 gene locus_tag LOCUS_11240 58079 56787 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_11240 58630 58217 gene locus_tag LOCUS_11250 58630 58217 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_11250 58805 59566 gene locus_tag LOCUS_11260 gene dapB 58805 59566 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_11260 59576 61024 gene locus_tag LOCUS_11270 gene lepB 59576 61024 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_11270 61042 61482 gene locus_tag LOCUS_11280 61042 61482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 61669 62286 gene locus_tag LOCUS_11290 61669 62286 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_11290 62970 62338 gene locus_tag LOCUS_11300 62970 62338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 63883 63407 gene locus_tag LOCUS_11310 63883 63407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 64822 63896 gene locus_tag LOCUS_11320 64822 63896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence17 61 951 gene locus_tag LOCUS_11330 61 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 927 1253 gene locus_tag LOCUS_11340 927 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1462 1471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1672 2025 gene locus_tag LOCUS_11350 1672 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2315 3763 gene locus_tag LOCUS_11360 2315 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3760 4851 gene locus_tag LOCUS_11370 3760 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4868 5089 gene locus_tag LOCUS_11380 4868 5089 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_11380 5794 6366 gene locus_tag LOCUS_11390 5794 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 7039 6452 gene locus_tag LOCUS_11400 7039 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 7792 7067 gene locus_tag LOCUS_11410 7792 7067 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_11410 11022 7825 gene locus_tag LOCUS_11420 11022 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 11893 11222 gene locus_tag LOCUS_11430 11893 11222 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_11430 13032 12010 gene locus_tag LOCUS_11440 13032 12010 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_11440 13289 13071 gene locus_tag LOCUS_11450 13289 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 13415 14491 gene locus_tag LOCUS_11460 13415 14491 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_11460 14582 16078 gene locus_tag LOCUS_11470 14582 16078 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_11470 16097 17407 gene locus_tag LOCUS_11480 16097 17407 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_11480 17450 18145 gene locus_tag LOCUS_11490 17450 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 18262 18948 gene locus_tag LOCUS_11500 18262 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 19052 20353 gene locus_tag LOCUS_11510 19052 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 21326 20511 gene locus_tag LOCUS_11520 21326 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 21528 23237 gene locus_tag LOCUS_11530 21528 23237 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_11530 23302 24075 gene locus_tag LOCUS_11540 gene nudC 23302 24075 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_11540 24120 25295 gene locus_tag LOCUS_11550 24120 25295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_11550 25854 25408 gene locus_tag LOCUS_11560 25854 25408 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_11560 26064 27191 gene locus_tag LOCUS_11570 gene dnaN 26064 27191 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_11570 27243 28106 gene locus_tag LOCUS_11580 27243 28106 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_11580 28185 29435 gene locus_tag LOCUS_11590 gene coaBC 28185 29435 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_11590 29461 30300 gene locus_tag LOCUS_11600 29461 30300 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_11600 30395 32068 gene locus_tag LOCUS_11610 gene recN 30395 32068 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_11610 32088 33719 gene locus_tag LOCUS_11620 32088 33719 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107737.1 protein_id gnl|my_center|LOCUS_11620 34862 33828 gene locus_tag LOCUS_11630 gene hisC 34862 33828 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_11630 36199 34916 gene locus_tag LOCUS_11640 gene hisD 36199 34916 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_11640 37135 36284 gene locus_tag LOCUS_11650 gene hisG 37135 36284 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_11650 37284 38501 gene locus_tag LOCUS_11660 37284 38501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 39241 38705 gene locus_tag LOCUS_11670 39241 38705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 40228 39368 gene locus_tag LOCUS_11680 40228 39368 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_11680 41352 40246 gene locus_tag LOCUS_11690 41352 40246 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_11690 42488 41505 gene locus_tag LOCUS_11700 42488 41505 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760615.1 protein_id gnl|my_center|LOCUS_11700 43123 42518 gene locus_tag LOCUS_11710 gene yihA 43123 42518 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_11710 45037 43214 gene locus_tag LOCUS_11720 45037 43214 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_11720 45189 47426 gene locus_tag LOCUS_11730 45189 47426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 47783 48655 gene locus_tag LOCUS_11740 47783 48655 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_11740 48777 50195 gene locus_tag LOCUS_11750 gene mnmE 48777 50195 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_11750 50507 51439 gene locus_tag LOCUS_11760 50507 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 51564 52670 gene locus_tag LOCUS_11770 51564 52670 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109328.1 protein_id gnl|my_center|LOCUS_11770 52835 53629 gene locus_tag LOCUS_11780 52835 53629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 53699 54097 gene locus_tag LOCUS_11790 53699 54097 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202325.1 protein_id gnl|my_center|LOCUS_11790 54109 55503 gene locus_tag LOCUS_11800 54109 55503 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203629.1 protein_id gnl|my_center|LOCUS_11800 55589 56659 gene locus_tag LOCUS_11810 55589 56659 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461658.1 protein_id gnl|my_center|LOCUS_11810 57085 59283 gene locus_tag LOCUS_11820 57085 59283 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016255537.1 protein_id gnl|my_center|LOCUS_11820 60639 59410 gene locus_tag LOCUS_11830 60639 59410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 61413 60646 gene locus_tag LOCUS_11840 61413 60646 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_11840 62192 61416 gene locus_tag LOCUS_11850 62192 61416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101009.1 protein_id gnl|my_center|LOCUS_11850 63268 62186 gene locus_tag LOCUS_11860 63268 62186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence18 1712 237 gene locus_tag LOCUS_11870 1712 237 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_11870 3445 1751 gene locus_tag LOCUS_11880 3445 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4589 3561 gene locus_tag LOCUS_11890 4589 3561 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_11890 5730 4768 gene locus_tag LOCUS_11900 5730 4768 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_11900 7089 5803 gene locus_tag LOCUS_11910 7089 5803 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_11910 7515 7252 gene locus_tag LOCUS_11920 7515 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11920 7661 7464 gene locus_tag LOCUS_11930 7661 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8149 8583 gene locus_tag LOCUS_11940 8149 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 8588 8962 gene locus_tag LOCUS_11950 8588 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 9012 9452 gene locus_tag LOCUS_11960 9012 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 9817 10044 gene locus_tag LOCUS_11970 9817 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10145 10375 gene locus_tag LOCUS_11980 10145 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 12407 10989 gene locus_tag LOCUS_11990 12407 10989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_11990 14263 12647 gene locus_tag LOCUS_12000 14263 12647 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764305.1 protein_id gnl|my_center|LOCUS_12000 14594 16873 gene locus_tag LOCUS_12010 14594 16873 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_12010 16953 19118 gene locus_tag LOCUS_12020 16953 19118 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_12020 19613 19335 gene locus_tag LOCUS_12030 19613 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 20222 19761 gene locus_tag LOCUS_12040 20222 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 22402 21080 gene locus_tag LOCUS_12050 22402 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 24069 22405 gene locus_tag LOCUS_12060 24069 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 25126 24344 gene locus_tag LOCUS_12070 25126 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 26851 25190 gene locus_tag LOCUS_12080 26851 25190 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_12080 27416 26862 gene locus_tag LOCUS_12090 27416 26862 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_12090 28222 27440 gene locus_tag LOCUS_12100 gene proC 28222 27440 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_12100 30466 28391 gene locus_tag LOCUS_12110 30466 28391 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_12110 31501 30488 gene locus_tag LOCUS_12120 31501 30488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 32080 31559 gene locus_tag LOCUS_12130 32080 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 32454 32086 gene locus_tag LOCUS_12140 32454 32086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 32950 33558 gene locus_tag LOCUS_12150 32950 33558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 33734 34039 gene locus_tag LOCUS_12160 33734 34039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 34177 35748 gene locus_tag LOCUS_12170 34177 35748 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_12170 37101 35959 gene locus_tag LOCUS_12180 37101 35959 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_12180 38211 37210 gene locus_tag LOCUS_12190 gene argC 38211 37210 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_12190 39415 38213 gene locus_tag LOCUS_12200 39415 38213 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_12200 40103 39492 gene locus_tag LOCUS_12210 40103 39492 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_12210 40681 40193 gene locus_tag LOCUS_12220 gene argR 40681 40193 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_12220 41023 42342 gene locus_tag LOCUS_12230 41023 42342 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_12230 42437 42649 gene locus_tag LOCUS_12240 42437 42649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 42573 43493 gene locus_tag LOCUS_12250 42573 43493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 44538 43780 gene locus_tag LOCUS_12260 44538 43780 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_12260 56897 44673 gene locus_tag LOCUS_12270 56897 44673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 58038 56911 gene locus_tag LOCUS_12280 58038 56911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 59032 58142 gene locus_tag LOCUS_12290 59032 58142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 61384 59555 gene locus_tag LOCUS_12300 61384 59555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 62026 61424 gene locus_tag LOCUS_12310 62026 61424 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence19 104 1036 gene locus_tag LOCUS_12320 gene trxB 104 1036 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_12320 1145 1236 gene locus_tag LOCUS_t00250 1145 1236 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1289 2182 gene locus_tag LOCUS_12330 1289 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2197 2547 gene locus_tag LOCUS_12340 2197 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2547 4898 gene locus_tag LOCUS_12350 2547 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4953 5870 gene locus_tag LOCUS_12360 4953 5870 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_12360 5936 6565 gene locus_tag LOCUS_12370 5936 6565 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_12370 7090 7177 gene locus_tag LOCUS_t00260 7090 7177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7205 7277 gene locus_tag LOCUS_t00270 7205 7277 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7348 7420 gene locus_tag LOCUS_t00280 7348 7420 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7523 8767 gene locus_tag LOCUS_12380 7523 8767 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_12380 11176 8840 gene locus_tag LOCUS_12390 11176 8840 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_12390 12190 11264 gene locus_tag LOCUS_12400 12190 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784529.1 protein_id gnl|my_center|LOCUS_12400 14254 12191 gene locus_tag LOCUS_12410 14254 12191 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_12410 15208 14291 gene locus_tag LOCUS_12420 gene metA 15208 14291 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_12420 15526 16269 gene locus_tag LOCUS_12430 gene kdsB 15526 16269 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_12430 16304 17653 gene locus_tag LOCUS_12440 gene tilS 16304 17653 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_12440 17650 19320 gene locus_tag LOCUS_12450 17650 19320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 19438 20310 gene locus_tag LOCUS_12460 19438 20310 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_12460 20423 22501 gene locus_tag LOCUS_12470 20423 22501 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_12470 22573 25782 gene locus_tag LOCUS_12480 22573 25782 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_12480 25857 28844 gene locus_tag LOCUS_12490 25857 28844 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_12490 28952 29569 gene locus_tag LOCUS_12500 28952 29569 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_12500 30085 29663 gene locus_tag LOCUS_12510 30085 29663 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763211.1 protein_id gnl|my_center|LOCUS_12510 30125 30134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31061 32194 gene locus_tag LOCUS_12520 31061 32194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 33040 33414 gene locus_tag LOCUS_12530 33040 33414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 33712 35427 gene locus_tag LOCUS_12540 33712 35427 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_12540 35491 36132 gene locus_tag LOCUS_12550 35491 36132 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_12550 38173 36686 gene locus_tag LOCUS_12560 38173 36686 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_12560 38636 38283 gene locus_tag LOCUS_12570 38636 38283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 39057 38743 gene locus_tag LOCUS_12580 39057 38743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 41085 39325 gene locus_tag LOCUS_12590 gene aspS 41085 39325 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_12590 41658 41257 gene locus_tag LOCUS_12600 41658 41257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 42149 41760 gene locus_tag LOCUS_12610 42149 41760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 42750 42208 gene locus_tag LOCUS_12620 42750 42208 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_12620 44126 42771 gene locus_tag LOCUS_12630 44126 42771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 44627 44346 gene locus_tag LOCUS_12640 44627 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 45866 44829 gene locus_tag LOCUS_12650 gene galE 45866 44829 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_12650 46031 48031 gene locus_tag LOCUS_12660 46031 48031 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763412.1 protein_id gnl|my_center|LOCUS_12660 48506 48084 gene locus_tag LOCUS_12670 48506 48084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 50087 48564 gene locus_tag LOCUS_12680 50087 48564 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_12680 51550 50276 gene locus_tag LOCUS_12690 gene nqrF 51550 50276 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_12690 52144 51569 gene locus_tag LOCUS_12700 gene nqrE 52144 51569 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_12700 52820 52194 gene locus_tag LOCUS_12710 52820 52194 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_12710 53435 52833 gene locus_tag LOCUS_12720 53435 52833 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_12720 54611 53454 gene locus_tag LOCUS_12730 54611 53454 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_12730 55993 54638 gene locus_tag LOCUS_12740 55993 54638 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_12740 56346 60545 gene locus_tag LOCUS_12750 56346 60545 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence20 2840 1950 gene locus_tag LOCUS_12760 2840 1950 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_12760 4022 2907 gene locus_tag LOCUS_12770 4022 2907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_12770 4368 4634 gene locus_tag LOCUS_12780 4368 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6564 4663 gene locus_tag LOCUS_12790 6564 4663 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107965.1 protein_id gnl|my_center|LOCUS_12790 8960 6693 gene locus_tag LOCUS_12800 8960 6693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_12800 9598 10716 gene locus_tag LOCUS_12810 gene dinB 9598 10716 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760075.1 protein_id gnl|my_center|LOCUS_12810 13919 11112 gene locus_tag LOCUS_12820 13919 11112 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_12820 14182 15600 gene locus_tag LOCUS_12830 gene aspA 14182 15600 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_12830 16614 15763 gene locus_tag LOCUS_12840 16614 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 16931 16857 gene locus_tag LOCUS_t00290 16931 16857 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17192 19105 gene locus_tag LOCUS_12850 17192 19105 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_12850 19119 20330 gene locus_tag LOCUS_12860 19119 20330 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_12860 20518 21636 gene locus_tag LOCUS_12870 20518 21636 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_12870 21890 22726 gene locus_tag LOCUS_12880 21890 22726 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_12880 22757 23401 gene locus_tag LOCUS_12890 22757 23401 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_12890 23402 24049 gene locus_tag LOCUS_12900 23402 24049 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765212.1 protein_id gnl|my_center|LOCUS_12900 24083 24931 gene locus_tag LOCUS_12910 24083 24931 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_12910 24987 25901 gene locus_tag LOCUS_12920 24987 25901 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_12920 25943 27364 gene locus_tag LOCUS_12930 25943 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 27731 27564 gene locus_tag LOCUS_12940 27731 27564 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_12940 27954 28700 gene locus_tag LOCUS_12950 27954 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 30881 28782 gene locus_tag LOCUS_12960 30881 28782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 33462 31039 gene locus_tag LOCUS_12970 33462 31039 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_12970 36465 33568 gene locus_tag LOCUS_12980 36465 33568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 39088 36704 gene locus_tag LOCUS_12990 39088 36704 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_12990 40535 39189 gene locus_tag LOCUS_13000 40535 39189 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_13000 40925 42094 gene locus_tag LOCUS_13010 40925 42094 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_13010 44547 42151 gene locus_tag LOCUS_13020 44547 42151 CDS product TlpA family protein disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767534.1 protein_id gnl|my_center|LOCUS_13020 47218 44612 gene locus_tag LOCUS_13030 47218 44612 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_13030 49870 47333 gene locus_tag LOCUS_13040 49870 47333 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_13040 51655 50051 gene locus_tag LOCUS_13050 51655 50051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 52275 51664 gene locus_tag LOCUS_13060 52275 51664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 54081 52591 gene locus_tag LOCUS_13070 54081 52591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 54665 54102 gene locus_tag LOCUS_13080 54665 54102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 56129 54837 gene locus_tag LOCUS_13090 56129 54837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 58126 56282 gene locus_tag LOCUS_13100 58126 56282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence21 170 1237 gene locus_tag LOCUS_13110 170 1237 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_13110 1234 1881 gene locus_tag LOCUS_13120 1234 1881 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_13120 2475 2083 gene locus_tag LOCUS_13130 2475 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3048 2794 gene locus_tag LOCUS_13140 3048 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3274 4794 gene locus_tag LOCUS_13150 3274 4794 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_13150 4879 5298 gene locus_tag LOCUS_13160 4879 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 5718 5380 gene locus_tag LOCUS_13170 5718 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5962 5708 gene locus_tag LOCUS_13180 5962 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 6395 6874 gene locus_tag LOCUS_13190 6395 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 7424 6930 gene locus_tag LOCUS_13200 7424 6930 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_13200 7659 8153 gene locus_tag LOCUS_13210 gene fldA 7659 8153 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793355.1 protein_id gnl|my_center|LOCUS_13210 8234 8587 gene locus_tag LOCUS_13220 8234 8587 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 protein_id gnl|my_center|LOCUS_13220 8939 13327 gene locus_tag LOCUS_13230 8939 13327 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202977.1 protein_id gnl|my_center|LOCUS_13230 13330 14019 gene locus_tag LOCUS_13240 13330 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202978.1 protein_id gnl|my_center|LOCUS_13240 14019 14609 gene locus_tag LOCUS_13250 14019 14609 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 protein_id gnl|my_center|LOCUS_13250 14719 15009 gene locus_tag LOCUS_13260 14719 15009 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778408.1 protein_id gnl|my_center|LOCUS_13260 15072 15557 gene locus_tag LOCUS_13270 15072 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 15593 17767 gene locus_tag LOCUS_13280 15593 17767 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 protein_id gnl|my_center|LOCUS_13280 18973 17945 gene locus_tag LOCUS_13290 18973 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 19478 18981 gene locus_tag LOCUS_13300 19478 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 19657 19812 gene locus_tag LOCUS_13310 19657 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 20927 19980 gene locus_tag LOCUS_13320 gene cysK 20927 19980 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_13320 22254 20959 gene locus_tag LOCUS_13330 22254 20959 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_13330 23582 22689 gene locus_tag LOCUS_13340 23582 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291991.1 protein_id gnl|my_center|LOCUS_13340 24092 23646 gene locus_tag LOCUS_13350 24092 23646 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786482.1 protein_id gnl|my_center|LOCUS_13350 24683 24159 gene locus_tag LOCUS_13360 24683 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 25200 24700 gene locus_tag LOCUS_13370 25200 24700 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_13370 25404 26936 gene locus_tag LOCUS_13380 25404 26936 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992604.1 protein_id gnl|my_center|LOCUS_13380 27966 27022 gene locus_tag LOCUS_13390 27966 27022 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_13390 28086 28901 gene locus_tag LOCUS_13400 28086 28901 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_13400 28918 29916 gene locus_tag LOCUS_13410 28918 29916 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_13410 30492 30205 gene locus_tag LOCUS_13420 30492 30205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 33289 30506 gene locus_tag LOCUS_13430 33289 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 34002 33301 gene locus_tag LOCUS_13440 34002 33301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 35361 34015 gene locus_tag LOCUS_13450 35361 34015 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837651.1 protein_id gnl|my_center|LOCUS_13450 35799 35365 gene locus_tag LOCUS_13460 35799 35365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 36876 35821 gene locus_tag LOCUS_13470 36876 35821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 38301 37405 gene locus_tag LOCUS_13480 38301 37405 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_13480 39370 38408 gene locus_tag LOCUS_13490 39370 38408 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_13490 41014 39557 gene locus_tag LOCUS_13500 41014 39557 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_13500 42388 41045 gene locus_tag LOCUS_13510 gene trkA 42388 41045 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_13510 44277 42385 gene locus_tag LOCUS_13520 gene dxs 44277 42385 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_13520 44489 45862 gene locus_tag LOCUS_13530 44489 45862 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_13530 45988 47271 gene locus_tag LOCUS_13540 45988 47271 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766478.1 protein_id gnl|my_center|LOCUS_13540 48410 47358 gene locus_tag LOCUS_13550 48410 47358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 49477 48431 gene locus_tag LOCUS_13560 49477 48431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 50297 49479 gene locus_tag LOCUS_13570 50297 49479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 50816 50322 gene locus_tag LOCUS_13580 50816 50322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 51584 50973 gene locus_tag LOCUS_13590 51584 50973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 52720 51587 gene locus_tag LOCUS_13600 52720 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 53205 52768 gene locus_tag LOCUS_13610 53205 52768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 56563 54836 gene locus_tag LOCUS_13620 56563 54836 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764485.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence22 480 1040 gene locus_tag LOCUS_13630 480 1040 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_13630 2833 1172 gene locus_tag LOCUS_13640 2833 1172 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_13640 3763 2912 gene locus_tag LOCUS_13650 gene nadC 3763 2912 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_13650 4051 3830 gene locus_tag LOCUS_13660 4051 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5042 4083 gene locus_tag LOCUS_13670 5042 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5761 5045 gene locus_tag LOCUS_13680 5761 5045 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_13680 6148 5765 gene locus_tag LOCUS_13690 6148 5765 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_13690 9871 6260 gene locus_tag LOCUS_13700 gene ileS 9871 6260 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_13700 12052 10058 gene locus_tag LOCUS_13710 12052 10058 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_13710 13198 12059 gene locus_tag LOCUS_13720 13198 12059 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_13720 13376 14236 gene locus_tag LOCUS_13730 gene ispE 13376 14236 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_13730 14264 14878 gene locus_tag LOCUS_13740 14264 14878 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763213.1 protein_id gnl|my_center|LOCUS_13740 15530 15027 gene locus_tag LOCUS_13750 15530 15027 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_13750 17626 15620 gene locus_tag LOCUS_13760 17626 15620 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841441.1 protein_id gnl|my_center|LOCUS_13760 17834 19696 gene locus_tag LOCUS_13770 gene recQ 17834 19696 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_13770 19850 19674 gene locus_tag LOCUS_13780 19850 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 20917 19943 gene locus_tag LOCUS_13790 20917 19943 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_13790 22510 20924 gene locus_tag LOCUS_13800 gene atpA 22510 20924 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_13800 23070 22534 gene locus_tag LOCUS_13810 23070 22534 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_13810 23579 23079 gene locus_tag LOCUS_13820 gene atpF 23579 23079 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_13820 23953 23714 gene locus_tag LOCUS_13830 23953 23714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 25150 24041 gene locus_tag LOCUS_13840 gene atpB 25150 24041 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_13840 25642 25199 gene locus_tag LOCUS_13850 25642 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 25918 25679 gene locus_tag LOCUS_13860 gene atpC 25918 25679 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_13860 27463 25937 gene locus_tag LOCUS_13870 gene atpD 27463 25937 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_13870 28650 27673 gene locus_tag LOCUS_13880 gene pfkA 28650 27673 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_13880 30235 28787 gene locus_tag LOCUS_13890 gene nhaD 30235 28787 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_13890 30685 32469 gene locus_tag LOCUS_13900 gene rpsA 30685 32469 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_13900 32875 34014 gene locus_tag LOCUS_13910 32875 34014 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798126.1 protein_id gnl|my_center|LOCUS_13910 34035 34871 gene locus_tag LOCUS_13920 34035 34871 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761029.1 protein_id gnl|my_center|LOCUS_13920 34957 35739 gene locus_tag LOCUS_13930 34957 35739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 36691 36398 gene locus_tag LOCUS_13940 gene rplT 36691 36398 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_13940 36979 36782 gene locus_tag LOCUS_13950 gene rpmI 36979 36782 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_13950 37728 37057 gene locus_tag LOCUS_13960 gene infC 37728 37057 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_13960 39840 37888 gene locus_tag LOCUS_13970 gene thrS 39840 37888 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_13970 40070 39834 gene locus_tag LOCUS_13980 40070 39834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 40127 41158 gene locus_tag LOCUS_13990 40127 41158 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_13990 43403 41832 gene locus_tag LOCUS_14000 43403 41832 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_14000 43579 43806 gene locus_tag LOCUS_14010 43579 43806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 44072 46291 gene locus_tag LOCUS_14020 44072 46291 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_14020 48314 46350 gene locus_tag LOCUS_14030 48314 46350 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_14030 48976 48419 gene locus_tag LOCUS_14040 gene def 48976 48419 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_14040 49389 48976 gene locus_tag LOCUS_14050 gene ruvX 49389 48976 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_14050 49912 49427 gene locus_tag LOCUS_14060 49912 49427 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_14060 50176 50388 gene locus_tag LOCUS_14070 50176 50388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 50401 50757 gene locus_tag LOCUS_14080 50401 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 50773 51036 gene locus_tag LOCUS_14090 50773 51036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 52072 51293 gene locus_tag LOCUS_14100 52072 51293 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_14100 53165 52110 gene locus_tag LOCUS_14110 gene murB 53165 52110 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_14110 54025 53198 gene locus_tag LOCUS_14120 54025 53198 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769737.1 protein_id gnl|my_center|LOCUS_14120 54170 55210 gene locus_tag LOCUS_14130 gene pheS 54170 55210 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_14130 55237 55794 gene locus_tag LOCUS_14140 55237 55794 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence23 1171 233 gene locus_tag LOCUS_14150 1171 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2037 1204 gene locus_tag LOCUS_14160 2037 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3026 2088 gene locus_tag LOCUS_14170 3026 2088 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_14170 5705 3066 gene locus_tag LOCUS_14180 5705 3066 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_14180 5883 5958 gene locus_tag LOCUS_t00300 5883 5958 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6961 6002 gene locus_tag LOCUS_14190 6961 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7385 6963 gene locus_tag LOCUS_14200 7385 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 8037 10007 gene locus_tag LOCUS_14210 8037 10007 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_14210 10089 11699 gene locus_tag LOCUS_14220 10089 11699 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_14220 12476 11811 gene locus_tag LOCUS_14230 gene aat 12476 11811 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_14230 14805 12520 gene locus_tag LOCUS_14240 gene clpA 14805 12520 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_14240 15167 14865 gene locus_tag LOCUS_14250 gene clpS 15167 14865 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279894.1 protein_id gnl|my_center|LOCUS_14250 15684 15178 gene locus_tag LOCUS_14260 15684 15178 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797099.1 protein_id gnl|my_center|LOCUS_14260 16066 18123 gene locus_tag LOCUS_14270 16066 18123 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_14270 19252 18269 gene locus_tag LOCUS_14280 19252 18269 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_14280 19607 20836 gene locus_tag LOCUS_14290 19607 20836 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_14290 20853 22316 gene locus_tag LOCUS_14300 20853 22316 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_14300 23102 24367 gene locus_tag LOCUS_14310 23102 24367 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_14310 24379 24912 gene locus_tag LOCUS_14320 24379 24912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 25093 25593 gene locus_tag LOCUS_14330 25093 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 25627 27768 gene locus_tag LOCUS_14340 25627 27768 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_14340 30711 27985 gene locus_tag LOCUS_14350 30711 27985 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_14350 31898 30726 gene locus_tag LOCUS_14360 31898 30726 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_14360 33334 32135 gene locus_tag LOCUS_14370 33334 32135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 35858 33900 gene locus_tag LOCUS_14380 35858 33900 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_14380 36089 37465 gene locus_tag LOCUS_14390 36089 37465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 39156 37708 gene locus_tag LOCUS_14400 39156 37708 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_14400 40159 39779 gene locus_tag LOCUS_14410 40159 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 40162 40261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40539 40736 gene locus_tag LOCUS_14420 40539 40736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 41471 41148 gene locus_tag LOCUS_14430 41471 41148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 43327 42098 gene locus_tag LOCUS_14440 43327 42098 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_14440 43523 44053 gene locus_tag LOCUS_14450 43523 44053 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796886.1 protein_id gnl|my_center|LOCUS_14450 45381 44140 gene locus_tag LOCUS_14460 45381 44140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_14460 46881 45694 gene locus_tag LOCUS_14470 46881 45694 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_14470 47830 46895 gene locus_tag LOCUS_14480 47830 46895 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_14480 47951 49219 gene locus_tag LOCUS_14490 47951 49219 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_14490 52763 50301 gene locus_tag LOCUS_14500 52763 50301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 53928 53032 gene locus_tag LOCUS_14510 53928 53032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 54624 53995 gene locus_tag LOCUS_14520 54624 53995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence24 192 1379 gene locus_tag LOCUS_14530 192 1379 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_14530 1562 3286 gene locus_tag LOCUS_14540 1562 3286 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_14540 3490 4170 gene locus_tag LOCUS_14550 3490 4170 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_14550 4198 4896 gene locus_tag LOCUS_14560 4198 4896 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_14560 4962 6503 gene locus_tag LOCUS_14570 gene araA 4962 6503 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_14570 6592 8184 gene locus_tag LOCUS_14580 6592 8184 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_14580 8267 9838 gene locus_tag LOCUS_14590 8267 9838 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_14590 9945 11966 gene locus_tag LOCUS_14600 9945 11966 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_14600 12241 12684 gene locus_tag LOCUS_14610 gene rpiB 12241 12684 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_14610 14354 13173 gene locus_tag LOCUS_14620 14354 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 17071 14435 gene locus_tag LOCUS_14630 gene gyrA 17071 14435 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_14630 17357 20035 gene locus_tag LOCUS_14640 17357 20035 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765726.1 protein_id gnl|my_center|LOCUS_14640 20200 20273 gene locus_tag LOCUS_t00310 20200 20273 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20305 20376 gene locus_tag LOCUS_t00320 20305 20376 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20505 23108 gene locus_tag LOCUS_14650 20505 23108 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_14650 23163 24002 gene locus_tag LOCUS_14660 23163 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 24777 24559 gene locus_tag LOCUS_14670 24777 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 24998 25189 gene locus_tag LOCUS_14680 24998 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 25200 26132 gene locus_tag LOCUS_14690 25200 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 26975 27532 gene locus_tag LOCUS_14700 26975 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 27558 28712 gene locus_tag LOCUS_14710 27558 28712 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_14710 28699 29568 gene locus_tag LOCUS_14720 28699 29568 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_14720 29598 30410 gene locus_tag LOCUS_14730 29598 30410 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672882.1 protein_id gnl|my_center|LOCUS_14730 32103 30541 gene locus_tag LOCUS_14740 32103 30541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_14740 32434 32189 gene locus_tag LOCUS_14750 32434 32189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 32472 33314 gene locus_tag LOCUS_14760 32472 33314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 33319 33948 gene locus_tag LOCUS_14770 33319 33948 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107947.1 protein_id gnl|my_center|LOCUS_14770 34346 35521 gene locus_tag LOCUS_14780 34346 35521 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_14780 36243 35518 gene locus_tag LOCUS_14790 36243 35518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 37057 36224 gene locus_tag LOCUS_14800 37057 36224 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_14800 37766 37086 gene locus_tag LOCUS_14810 37766 37086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 37781 37966 gene locus_tag LOCUS_14820 37781 37966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 39064 38003 gene locus_tag LOCUS_14830 gene leuB 39064 38003 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_14830 40686 39088 gene locus_tag LOCUS_14840 40686 39088 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_14840 41279 40689 gene locus_tag LOCUS_14850 gene leuD 41279 40689 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_14850 42724 41330 gene locus_tag LOCUS_14860 gene leuC 42724 41330 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_14860 44250 42748 gene locus_tag LOCUS_14870 44250 42748 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_14870 46206 44707 gene locus_tag LOCUS_14880 gene dnaB 46206 44707 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_14880 48676 46193 gene locus_tag LOCUS_14890 48676 46193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 49595 48684 gene locus_tag LOCUS_14900 49595 48684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 50798 49617 gene locus_tag LOCUS_14910 50798 49617 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_14910 51468 50851 gene locus_tag LOCUS_14920 51468 50851 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_14920 51582 54185 gene locus_tag LOCUS_14930 51582 54185 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_14930 54364 54963 gene locus_tag LOCUS_14940 54364 54963 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795926.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence25 1307 888 gene locus_tag LOCUS_14950 1307 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1746 1468 gene locus_tag LOCUS_14960 1746 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3045 1927 gene locus_tag LOCUS_14970 3045 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6366 3322 gene locus_tag LOCUS_14980 6366 3322 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_14980 7582 6416 gene locus_tag LOCUS_14990 7582 6416 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_14990 9095 7587 gene locus_tag LOCUS_15000 9095 7587 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_15000 9492 9103 gene locus_tag LOCUS_15010 9492 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 10559 11257 gene locus_tag LOCUS_15020 10559 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 12573 12145 gene locus_tag LOCUS_15030 12573 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 12771 12592 gene locus_tag LOCUS_15040 12771 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 13227 15848 gene locus_tag LOCUS_15050 13227 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 16368 15961 gene locus_tag LOCUS_15060 16368 15961 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528816.1 protein_id gnl|my_center|LOCUS_15060 16845 16408 gene locus_tag LOCUS_15070 16845 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 17762 19231 gene locus_tag LOCUS_15080 17762 19231 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_15080 19468 20280 gene locus_tag LOCUS_15090 19468 20280 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_15090 20340 20873 gene locus_tag LOCUS_15100 20340 20873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 23124 20983 gene locus_tag LOCUS_15110 23124 20983 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_15110 23955 23176 gene locus_tag LOCUS_15120 23955 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25463 24216 gene locus_tag LOCUS_15130 25463 24216 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_15130 26513 25497 gene locus_tag LOCUS_15140 26513 25497 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_15140 27400 26516 gene locus_tag LOCUS_15150 27400 26516 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_15150 28980 27562 gene locus_tag LOCUS_15160 gene mtaB 28980 27562 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_15160 29347 29111 gene locus_tag LOCUS_15170 29347 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 29748 30920 gene locus_tag LOCUS_15180 29748 30920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_15180 33709 31160 gene locus_tag LOCUS_15190 33709 31160 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_15190 33997 36237 gene locus_tag LOCUS_15200 33997 36237 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_15200 36409 37593 gene locus_tag LOCUS_15210 36409 37593 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_15210 37627 38799 gene locus_tag LOCUS_15220 37627 38799 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_15220 41063 38877 gene locus_tag LOCUS_15230 41063 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 41400 41122 gene locus_tag LOCUS_15240 41400 41122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15240 41642 41403 gene locus_tag LOCUS_15250 41642 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15250 41813 43168 gene locus_tag LOCUS_15260 41813 43168 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_15260 43514 43678 gene locus_tag LOCUS_15270 43514 43678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15270 45121 43814 gene locus_tag LOCUS_15280 45121 43814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789653.1 protein_id gnl|my_center|LOCUS_15280 46726 45230 gene locus_tag LOCUS_15290 46726 45230 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762615.1 protein_id gnl|my_center|LOCUS_15290 47966 46962 gene locus_tag LOCUS_15300 47966 46962 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_15300 48298 49671 gene locus_tag LOCUS_15310 48298 49671 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_15310 50828 49821 gene locus_tag LOCUS_15320 50828 49821 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_15320 51400 53493 gene locus_tag LOCUS_15330 51400 53493 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_15330 53875 54042 gene locus_tag LOCUS_15340 53875 54042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence26 2403 1993 gene locus_tag LOCUS_15350 2403 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2688 4085 gene locus_tag LOCUS_15360 2688 4085 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_15360 4072 4791 gene locus_tag LOCUS_15370 4072 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5196 9002 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccataaaggtacgattagaac 9028 9127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9137 11900 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccataaaggtacgattagaac 12378 12115 gene locus_tag LOCUS_15380 gene cas2 12378 12115 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_15380 13396 12380 gene locus_tag LOCUS_15390 gene cas1b 13396 12380 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_15390 13911 13393 gene locus_tag LOCUS_15400 gene cas4 13911 13393 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_15400 15033 13966 gene locus_tag LOCUS_15410 15033 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_15410 16243 15056 gene locus_tag LOCUS_15420 16243 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768970.1 protein_id gnl|my_center|LOCUS_15420 18517 16376 gene locus_tag LOCUS_15430 18517 16376 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_15430 19085 18531 gene locus_tag LOCUS_15440 19085 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_15440 19811 19104 gene locus_tag LOCUS_15450 gene cas6 19811 19104 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_15450 19978 19808 gene locus_tag LOCUS_15460 19978 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 20978 20055 gene locus_tag LOCUS_15470 20978 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 22690 21440 gene locus_tag LOCUS_15480 22690 21440 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_15480 23177 22821 gene locus_tag LOCUS_15490 23177 22821 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_15490 23632 24471 gene locus_tag LOCUS_15500 gene dapF 23632 24471 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_15500 24534 25766 gene locus_tag LOCUS_15510 24534 25766 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_15510 25947 28136 gene locus_tag LOCUS_15520 25947 28136 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_15520 29179 28433 gene locus_tag LOCUS_15530 29179 28433 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_15530 30675 29368 gene locus_tag LOCUS_15540 gene eno 30675 29368 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_15540 31155 30841 gene locus_tag LOCUS_15550 31155 30841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 32137 31430 gene locus_tag LOCUS_15560 32137 31430 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_15560 32360 33988 gene locus_tag LOCUS_15570 gene tet(35) 32360 33988 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_15570 34147 34689 gene locus_tag LOCUS_15580 34147 34689 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_15580 35778 34771 gene locus_tag LOCUS_15590 gene mutY 35778 34771 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_15590 37067 35814 gene locus_tag LOCUS_15600 37067 35814 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_15600 38369 37107 gene locus_tag LOCUS_15610 38369 37107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 38822 38418 gene locus_tag LOCUS_15620 38822 38418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 39057 40646 gene locus_tag LOCUS_15630 gene nadB 39057 40646 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_15630 48307 40769 gene locus_tag LOCUS_15640 gene sprA 48307 40769 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_15640 48940 48326 gene locus_tag LOCUS_15650 gene ruvA 48940 48326 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_15650 49391 50290 gene locus_tag LOCUS_15660 49391 50290 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence27 273 1253 gene locus_tag LOCUS_15670 273 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1306 1743 gene locus_tag LOCUS_15680 1306 1743 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_15680 1783 2880 gene locus_tag LOCUS_15690 1783 2880 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_15690 3029 4507 gene locus_tag LOCUS_15700 3029 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5604 4579 gene locus_tag LOCUS_15710 5604 4579 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_15710 5797 7155 gene locus_tag LOCUS_15720 5797 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 7208 7927 gene locus_tag LOCUS_15730 gene ispD 7208 7927 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 protein_id gnl|my_center|LOCUS_15730 7944 9029 gene locus_tag LOCUS_15740 7944 9029 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_15740 9048 9965 gene locus_tag LOCUS_15750 9048 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 10815 9994 gene locus_tag LOCUS_15760 10815 9994 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_15760 12258 10822 gene locus_tag LOCUS_15770 12258 10822 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_15770 12827 12264 gene locus_tag LOCUS_15780 12827 12264 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107243.1 protein_id gnl|my_center|LOCUS_15780 13133 14506 gene locus_tag LOCUS_15790 13133 14506 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_15790 14740 14994 gene locus_tag LOCUS_15800 14740 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 15157 17508 gene locus_tag LOCUS_15810 15157 17508 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_15810 18491 17715 gene locus_tag LOCUS_15820 18491 17715 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_15820 19756 18488 gene locus_tag LOCUS_15830 19756 18488 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_15830 20725 20246 gene locus_tag LOCUS_15840 gene ispF 20725 20246 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_15840 21895 20762 gene locus_tag LOCUS_15850 gene porV 21895 20762 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_15850 25598 21960 gene locus_tag LOCUS_15860 25598 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 26241 25624 gene locus_tag LOCUS_15870 26241 25624 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_15870 27357 26362 gene locus_tag LOCUS_15880 gene tsf 27357 26362 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_15880 28236 27466 gene locus_tag LOCUS_15890 gene rpsB 28236 27466 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_15890 28781 28395 gene locus_tag LOCUS_15900 gene rpsI 28781 28395 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_15900 29253 28792 gene locus_tag LOCUS_15910 gene rplM 29253 28792 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_15910 30914 29601 gene locus_tag LOCUS_15920 30914 29601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 33717 30949 gene locus_tag LOCUS_15930 33717 30949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 37265 33720 gene locus_tag LOCUS_15940 37265 33720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 38474 37284 gene locus_tag LOCUS_15950 38474 37284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 39752 38478 gene locus_tag LOCUS_15960 39752 38478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 40658 39762 gene locus_tag LOCUS_15970 40658 39762 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_15970 42259 40682 gene locus_tag LOCUS_15980 42259 40682 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_15980 45583 42278 gene locus_tag LOCUS_15990 45583 42278 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165360391.1 protein_id gnl|my_center|LOCUS_15990 45925 45797 gene locus_tag LOCUS_16000 45925 45797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence28 1 450 gene locus_tag LOCUS_16010 1 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 461 1156 gene locus_tag LOCUS_16020 461 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1159 1839 gene locus_tag LOCUS_16030 1159 1839 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_16030 1842 2063 gene locus_tag LOCUS_16040 1842 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2501 2426 gene locus_tag LOCUS_t00330 2501 2426 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2759 5992 gene locus_tag LOCUS_16050 2759 5992 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_16050 6349 7326 gene locus_tag LOCUS_16060 gene ftsY 6349 7326 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_16060 7330 8631 gene locus_tag LOCUS_16070 gene rimO 7330 8631 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_16070 8690 8980 gene locus_tag LOCUS_16080 8690 8980 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_16080 8977 10401 gene locus_tag LOCUS_16090 8977 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 11555 10482 gene locus_tag LOCUS_16100 11555 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 12335 11682 gene locus_tag LOCUS_16110 gene queC 12335 11682 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972958.1 protein_id gnl|my_center|LOCUS_16110 13872 12388 gene locus_tag LOCUS_16120 gene radA 13872 12388 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_16120 14197 15444 gene locus_tag LOCUS_16130 14197 15444 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_16130 15685 17379 gene locus_tag LOCUS_16140 15685 17379 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_16140 17695 18630 gene locus_tag LOCUS_16150 17695 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 18636 19103 gene locus_tag LOCUS_16160 18636 19103 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879705.1 protein_id gnl|my_center|LOCUS_16160 19229 20377 gene locus_tag LOCUS_16170 19229 20377 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_16170 21298 20495 gene locus_tag LOCUS_16180 21298 20495 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107473.1 protein_id gnl|my_center|LOCUS_16180 21898 21344 gene locus_tag LOCUS_16190 gene rfbC 21898 21344 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_16190 22119 23159 gene locus_tag LOCUS_16200 22119 23159 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_16200 23268 23804 gene locus_tag LOCUS_16210 23268 23804 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_16210 24034 24672 gene locus_tag LOCUS_16220 gene hisH 24034 24672 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_16220 24689 25402 gene locus_tag LOCUS_16230 gene hisA 24689 25402 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_16230 25502 26284 gene locus_tag LOCUS_16240 gene hisF 25502 26284 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_16240 26329 26976 gene locus_tag LOCUS_16250 gene hisIE 26329 26976 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_16250 27008 27724 gene locus_tag LOCUS_16260 27008 27724 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_16260 27752 29074 gene locus_tag LOCUS_16270 27752 29074 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_16270 29214 30371 gene locus_tag LOCUS_16280 gene lysA 29214 30371 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_16280 30639 31589 gene locus_tag LOCUS_16290 30639 31589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 31698 32426 gene locus_tag LOCUS_16300 31698 32426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 32459 35035 gene locus_tag LOCUS_16310 gene hrpB 32459 35035 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_16310 35397 35239 gene locus_tag LOCUS_16320 35397 35239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 35629 35441 gene locus_tag LOCUS_16330 gene rpmG 35629 35441 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_16330 35898 35635 gene locus_tag LOCUS_16340 gene rpmB 35898 35635 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_16340 36558 36052 gene locus_tag LOCUS_16350 36558 36052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 37589 36564 gene locus_tag LOCUS_16360 gene tsaD 37589 36564 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_16360 38561 37701 gene locus_tag LOCUS_16370 gene map 38561 37701 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_16370 39290 38670 gene locus_tag LOCUS_16380 39290 38670 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_16380 42130 39326 gene locus_tag LOCUS_16390 gene metH 42130 39326 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_16390 42735 42256 gene locus_tag LOCUS_16400 gene smpB 42735 42256 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_16400 43338 42829 gene locus_tag LOCUS_16410 43338 42829 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_16410 43580 44281 gene locus_tag LOCUS_16420 43580 44281 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_16420 44297 45310 gene locus_tag LOCUS_16430 44297 45310 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence29 1122 319 gene locus_tag LOCUS_16440 1122 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_16440 3848 1371 gene locus_tag LOCUS_16450 3848 1371 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_16450 4659 3925 gene locus_tag LOCUS_16460 gene mtgA 4659 3925 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_16460 5384 4695 gene locus_tag LOCUS_16470 5384 4695 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_16470 5671 7152 gene locus_tag LOCUS_16480 gene proS 5671 7152 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_16480 7239 7622 gene locus_tag LOCUS_16490 7239 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 7779 8171 gene locus_tag LOCUS_16500 7779 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 9110 8247 gene locus_tag LOCUS_16510 9110 8247 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765359.1 protein_id gnl|my_center|LOCUS_16510 10908 9214 gene locus_tag LOCUS_16520 10908 9214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765358.1 protein_id gnl|my_center|LOCUS_16520 12050 10938 gene locus_tag LOCUS_16530 12050 10938 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_16530 13477 12149 gene locus_tag LOCUS_16540 13477 12149 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_16540 14419 13631 gene locus_tag LOCUS_16550 14419 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 14418 14555 gene locus_tag LOCUS_16560 14418 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 14998 16224 gene locus_tag LOCUS_16570 14998 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 16240 18153 gene locus_tag LOCUS_16580 16240 18153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 18720 18391 gene locus_tag LOCUS_16590 18720 18391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 19007 18711 gene locus_tag LOCUS_16600 19007 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 19806 19363 gene locus_tag LOCUS_16610 19806 19363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 20341 19799 gene locus_tag LOCUS_16620 20341 19799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 22101 20662 gene locus_tag LOCUS_16630 22101 20662 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_16630 24061 22310 gene locus_tag LOCUS_16640 24061 22310 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_16640 24304 24624 gene locus_tag LOCUS_16650 24304 24624 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_16650 24704 25174 gene locus_tag LOCUS_16660 gene rlmH 24704 25174 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_16660 25214 28111 gene locus_tag LOCUS_16670 gene uvrA 25214 28111 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_16670 28764 28447 gene locus_tag LOCUS_16680 28764 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 29306 29001 gene locus_tag LOCUS_16690 29306 29001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 29446 29853 gene locus_tag LOCUS_16700 29446 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 30110 30784 gene locus_tag LOCUS_16710 30110 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 31835 31152 gene locus_tag LOCUS_16720 31835 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108324.1 protein_id gnl|my_center|LOCUS_16720 31916 32218 gene locus_tag LOCUS_16730 31916 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 32300 33358 gene locus_tag LOCUS_16740 32300 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 33796 34815 gene locus_tag LOCUS_16750 33796 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 35989 35591 gene locus_tag LOCUS_16760 35989 35591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 36293 35973 gene locus_tag LOCUS_16770 36293 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 36755 37663 gene locus_tag LOCUS_16780 36755 37663 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_16780 37689 38000 gene locus_tag LOCUS_16790 37689 38000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 38041 38535 gene locus_tag LOCUS_16800 38041 38535 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_16800 38839 39972 gene locus_tag LOCUS_16810 38839 39972 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_16810 40603 42648 gene locus_tag LOCUS_16820 40603 42648 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964269.1 protein_id gnl|my_center|LOCUS_16820 42977 43186 gene locus_tag LOCUS_16830 42977 43186 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798527.1 protein_id gnl|my_center|LOCUS_16830 43492 44340 gene locus_tag LOCUS_16840 43492 44340 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence30 1261 485 gene locus_tag LOCUS_16850 1261 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1689 1315 gene locus_tag LOCUS_16860 1689 1315 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_16860 5807 1776 gene locus_tag LOCUS_16870 5807 1776 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201933.1 protein_id gnl|my_center|LOCUS_16870 6062 9136 gene locus_tag LOCUS_16880 6062 9136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_16880 9200 10762 gene locus_tag LOCUS_16890 9200 10762 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_16890 10797 11714 gene locus_tag LOCUS_16900 10797 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 11744 12946 gene locus_tag LOCUS_16910 11744 12946 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_16910 13024 14250 gene locus_tag LOCUS_16920 13024 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 14298 16643 gene locus_tag LOCUS_16930 14298 16643 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_16930 17982 16783 gene locus_tag LOCUS_16940 gene ilvA 17982 16783 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_16940 18152 21901 gene locus_tag LOCUS_16950 18152 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 22335 24296 gene locus_tag LOCUS_16960 22335 24296 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_16960 25199 24381 gene locus_tag LOCUS_16970 25199 24381 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_16970 25425 27500 gene locus_tag LOCUS_16980 25425 27500 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_16980 27639 28139 gene locus_tag LOCUS_16990 27639 28139 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_16990 28185 28946 gene locus_tag LOCUS_17000 28185 28946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 28974 29882 gene locus_tag LOCUS_17010 28974 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 30410 30760 gene locus_tag LOCUS_17020 30410 30760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 30711 31436 gene locus_tag LOCUS_17030 30711 31436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 32135 33382 gene locus_tag LOCUS_17040 32135 33382 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_17040 33426 34631 gene locus_tag LOCUS_17050 33426 34631 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_17050 34719 37988 gene locus_tag LOCUS_17060 34719 37988 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_17060 38182 40083 gene locus_tag LOCUS_17070 38182 40083 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_17070 40413 41741 gene locus_tag LOCUS_17080 40413 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 41899 44088 gene locus_tag LOCUS_17090 41899 44088 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence31 792 343 gene locus_tag LOCUS_17100 792 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1037 798 gene locus_tag LOCUS_17110 1037 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2228 1212 gene locus_tag LOCUS_17120 2228 1212 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_17120 2610 2416 gene locus_tag LOCUS_17130 2610 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4170 2875 gene locus_tag LOCUS_17140 gene xseA 4170 2875 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_17140 5628 4210 gene locus_tag LOCUS_17150 5628 4210 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_17150 5934 7307 gene locus_tag LOCUS_17160 5934 7307 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_17160 7327 7950 gene locus_tag LOCUS_17170 7327 7950 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_17170 8031 9200 gene locus_tag LOCUS_17180 gene purT 8031 9200 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_17180 9203 9643 gene locus_tag LOCUS_17190 9203 9643 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_17190 9655 10596 gene locus_tag LOCUS_17200 9655 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_17200 11263 10685 gene locus_tag LOCUS_17210 11263 10685 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_17210 12633 11260 gene locus_tag LOCUS_17220 12633 11260 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_17220 13367 12630 gene locus_tag LOCUS_17230 13367 12630 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_17230 13658 16891 gene locus_tag LOCUS_17240 gene carB 13658 16891 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_17240 17037 19196 gene locus_tag LOCUS_17250 17037 19196 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_17250 19203 21185 gene locus_tag LOCUS_17260 19203 21185 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_17260 21924 21472 gene locus_tag LOCUS_17270 21924 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 22411 21914 gene locus_tag LOCUS_17280 22411 21914 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_17280 23274 22540 gene locus_tag LOCUS_17290 23274 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 23409 24824 gene locus_tag LOCUS_17300 23409 24824 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_17300 24828 25349 gene locus_tag LOCUS_17310 24828 25349 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_17310 25905 25387 gene locus_tag LOCUS_17320 25905 25387 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_17320 26451 25987 gene locus_tag LOCUS_17330 26451 25987 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_17330 27065 26448 gene locus_tag LOCUS_17340 27065 26448 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_17340 27621 27109 gene locus_tag LOCUS_17350 27621 27109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 28347 27634 gene locus_tag LOCUS_17360 28347 27634 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_17360 28458 28370 gene locus_tag LOCUS_t00340 28458 28370 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29437 28598 gene locus_tag LOCUS_17370 29437 28598 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_17370 30438 29464 gene locus_tag LOCUS_17380 30438 29464 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_17380 31205 30480 gene locus_tag LOCUS_17390 31205 30480 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_17390 31404 32255 gene locus_tag LOCUS_17400 gene porQ 31404 32255 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_17400 32297 32989 gene locus_tag LOCUS_17410 gene cmk 32297 32989 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_17410 34314 33400 gene locus_tag LOCUS_17420 34314 33400 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_17420 35347 34304 gene locus_tag LOCUS_17430 35347 34304 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_17430 40842 35410 gene locus_tag LOCUS_17440 40842 35410 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202133.1 protein_id gnl|my_center|LOCUS_17440 41047 43542 gene locus_tag LOCUS_17450 41047 43542 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence32 51 830 gene locus_tag LOCUS_17460 51 830 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108662.1 protein_id gnl|my_center|LOCUS_17460 830 1615 gene locus_tag LOCUS_17470 830 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303091.1 protein_id gnl|my_center|LOCUS_17470 2309 1689 gene locus_tag LOCUS_17480 2309 1689 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_17480 3120 2311 gene locus_tag LOCUS_17490 3120 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3673 3125 gene locus_tag LOCUS_17500 3673 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4534 4166 gene locus_tag LOCUS_17510 4534 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5215 4538 gene locus_tag LOCUS_17520 5215 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5349 5161 gene locus_tag LOCUS_17530 5349 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 6324 5536 gene locus_tag LOCUS_17540 6324 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6989 6480 gene locus_tag LOCUS_17550 6989 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 8108 8983 gene locus_tag LOCUS_17560 8108 8983 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767195.1 protein_id gnl|my_center|LOCUS_17560 9090 10589 gene locus_tag LOCUS_17570 gene rhaB 9090 10589 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_17570 10756 12009 gene locus_tag LOCUS_17580 10756 12009 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_17580 12133 13164 gene locus_tag LOCUS_17590 gene rhaT 12133 13164 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_17590 14163 13294 gene locus_tag LOCUS_17600 gene rhaD 14163 13294 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_17600 14481 17060 gene locus_tag LOCUS_17610 14481 17060 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_17610 17088 18215 gene locus_tag LOCUS_17620 17088 18215 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_17620 18304 19695 gene locus_tag LOCUS_17630 18304 19695 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_17630 19870 20619 gene locus_tag LOCUS_17640 19870 20619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_17640 20764 21606 gene locus_tag LOCUS_17650 20764 21606 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_17650 23754 21853 gene locus_tag LOCUS_17660 23754 21853 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203546.1 protein_id gnl|my_center|LOCUS_17660 24053 23913 gene locus_tag LOCUS_17670 24053 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 24279 24106 gene locus_tag LOCUS_17680 24279 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 24685 25056 gene locus_tag LOCUS_17690 24685 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 25338 27020 gene locus_tag LOCUS_17700 25338 27020 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_17700 27839 27294 gene locus_tag LOCUS_17710 27839 27294 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_17710 28661 27897 gene locus_tag LOCUS_17720 28661 27897 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_17720 29740 28658 gene locus_tag LOCUS_17730 29740 28658 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_17730 29974 29744 gene locus_tag LOCUS_17740 29974 29744 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_17740 30223 30044 gene locus_tag LOCUS_17750 30223 30044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 31640 30417 gene locus_tag LOCUS_17760 31640 30417 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_17760 32828 31743 gene locus_tag LOCUS_17770 gene trpS 32828 31743 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_17770 34698 32947 gene locus_tag LOCUS_17780 34698 32947 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764485.1 protein_id gnl|my_center|LOCUS_17780 36025 34880 gene locus_tag LOCUS_17790 36025 34880 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764801.1 protein_id gnl|my_center|LOCUS_17790 38740 36044 gene locus_tag LOCUS_17800 38740 36044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 39264 38764 gene locus_tag LOCUS_17810 39264 38764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764799.1 protein_id gnl|my_center|LOCUS_17810 42852 39361 gene locus_tag LOCUS_17820 42852 39361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 43277 43074 gene locus_tag LOCUS_17830 43277 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence33 510 58 gene locus_tag LOCUS_17840 510 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1384 674 gene locus_tag LOCUS_17850 1384 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2547 1390 gene locus_tag LOCUS_17860 2547 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3692 2730 gene locus_tag LOCUS_17870 3692 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3934 6042 gene locus_tag LOCUS_17880 3934 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6600 6109 gene locus_tag LOCUS_17890 6600 6109 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766217.1 protein_id gnl|my_center|LOCUS_17890 7391 6654 gene locus_tag LOCUS_17900 7391 6654 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766218.1 protein_id gnl|my_center|LOCUS_17900 9493 7403 gene locus_tag LOCUS_17910 9493 7403 CDS product subtilase family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766219.1 protein_id gnl|my_center|LOCUS_17910 11573 9525 gene locus_tag LOCUS_17920 11573 9525 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766220.1 protein_id gnl|my_center|LOCUS_17920 14279 11595 gene locus_tag LOCUS_17930 14279 11595 CDS product DUF4458 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766221.1 protein_id gnl|my_center|LOCUS_17930 15862 14279 gene locus_tag LOCUS_17940 15862 14279 CDS product DUF5003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766222.1 protein_id gnl|my_center|LOCUS_17940 16783 15881 gene locus_tag LOCUS_17950 16783 15881 CDS product DUF4984 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107167.1 protein_id gnl|my_center|LOCUS_17950 18325 16799 gene locus_tag LOCUS_17960 18325 16799 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_17960 21223 18344 gene locus_tag LOCUS_17970 21223 18344 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_17970 21694 24165 gene locus_tag LOCUS_17980 21694 24165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 27153 24310 gene locus_tag LOCUS_17990 27153 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 29771 27345 gene locus_tag LOCUS_18000 gene galB 29771 27345 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_18000 30917 29832 gene locus_tag LOCUS_18010 30917 29832 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_18010 33430 31121 gene locus_tag LOCUS_18020 33430 31121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 33772 33449 gene locus_tag LOCUS_18030 33772 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 34077 34004 gene locus_tag LOCUS_t00350 34077 34004 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 34233 34308 gene locus_tag LOCUS_t00360 34233 34308 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34461 35273 gene locus_tag LOCUS_18040 34461 35273 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_18040 36687 35332 gene locus_tag LOCUS_18050 36687 35332 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_18050 38083 36719 gene locus_tag LOCUS_18060 38083 36719 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_18060 38750 38250 gene locus_tag LOCUS_18070 38750 38250 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_18070 38904 38755 gene locus_tag LOCUS_18080 38904 38755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 40053 38926 gene locus_tag LOCUS_18090 gene prfB 40053 38926 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_18090 41900 40092 gene locus_tag LOCUS_18100 41900 40092 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_18100 42096 43160 gene locus_tag LOCUS_18110 42096 43160 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence34 560 967 gene locus_tag LOCUS_18120 560 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2362 1091 gene locus_tag LOCUS_18130 gene uxuA 2362 1091 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_18130 3985 2396 gene locus_tag LOCUS_18140 3985 2396 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_18140 5550 4234 gene locus_tag LOCUS_18150 5550 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 8034 5743 gene locus_tag LOCUS_18160 8034 5743 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_18160 9114 8113 gene locus_tag LOCUS_18170 9114 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 10946 9171 gene locus_tag LOCUS_18180 10946 9171 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_18180 14181 11005 gene locus_tag LOCUS_18190 14181 11005 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_18190 15315 14209 gene locus_tag LOCUS_18200 15315 14209 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_18200 19651 15608 gene locus_tag LOCUS_18210 19651 15608 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789596.1 protein_id gnl|my_center|LOCUS_18210 19866 21152 gene locus_tag LOCUS_18220 19866 21152 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_18220 22915 21209 gene locus_tag LOCUS_18230 22915 21209 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_18230 24508 23153 gene locus_tag LOCUS_18240 24508 23153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 26098 24551 gene locus_tag LOCUS_18250 26098 24551 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_18250 27683 26157 gene locus_tag LOCUS_18260 27683 26157 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_18260 30614 27696 gene locus_tag LOCUS_18270 30614 27696 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_18270 30896 31045 gene locus_tag LOCUS_18280 30896 31045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 32687 31437 gene locus_tag LOCUS_18290 32687 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 33065 35425 gene locus_tag LOCUS_18300 33065 35425 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_18300 35438 36031 gene locus_tag LOCUS_18310 gene pnuC 35438 36031 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_18310 37596 36181 gene locus_tag LOCUS_18320 gene dnaA 37596 36181 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_18320 38805 37906 gene locus_tag LOCUS_18330 38805 37906 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_18330 40139 38856 gene locus_tag LOCUS_18340 40139 38856 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_18340 40611 40234 gene locus_tag LOCUS_18350 gene folB 40611 40234 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_18350 41307 40639 gene locus_tag LOCUS_18360 41307 40639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence35 1078 20 gene locus_tag LOCUS_18370 1078 20 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_18370 2738 1395 gene locus_tag LOCUS_18380 2738 1395 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_18380 7460 2937 gene locus_tag LOCUS_18390 gene gltB 7460 2937 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_18390 9477 7690 gene locus_tag LOCUS_18400 gene asnB 9477 7690 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 protein_id gnl|my_center|LOCUS_18400 10664 9945 gene locus_tag LOCUS_18410 10664 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_18410 12128 10866 gene locus_tag LOCUS_18420 12128 10866 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_18420 12651 12295 gene locus_tag LOCUS_18430 12651 12295 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_18430 16141 12998 gene locus_tag LOCUS_18440 16141 12998 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_18440 18494 16152 gene locus_tag LOCUS_18450 18494 16152 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_18450 20510 18519 gene locus_tag LOCUS_18460 20510 18519 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_18460 21532 20567 gene locus_tag LOCUS_18470 21532 20567 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_18470 21956 23176 gene locus_tag LOCUS_18480 21956 23176 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_18480 23213 24661 gene locus_tag LOCUS_18490 23213 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 24711 27710 gene locus_tag LOCUS_18500 24711 27710 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_18500 27763 29412 gene locus_tag LOCUS_18510 27763 29412 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_18510 29566 30357 gene locus_tag LOCUS_18520 gene nagB 29566 30357 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_18520 30609 32255 gene locus_tag LOCUS_18530 30609 32255 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762102.1 protein_id gnl|my_center|LOCUS_18530 32248 33804 gene locus_tag LOCUS_18540 32248 33804 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_18540 33857 35080 gene locus_tag LOCUS_18550 33857 35080 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 protein_id gnl|my_center|LOCUS_18550 35168 36328 gene locus_tag LOCUS_18560 35168 36328 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_18560 37330 36722 gene locus_tag LOCUS_18570 37330 36722 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_18570 37471 37674 gene locus_tag LOCUS_18580 37471 37674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 37812 38258 gene locus_tag LOCUS_18590 37812 38258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 38493 40574 gene locus_tag LOCUS_18600 38493 40574 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764484.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence36 68 1819 gene locus_tag LOCUS_18610 68 1819 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787397.1 protein_id gnl|my_center|LOCUS_18610 2024 3136 gene locus_tag LOCUS_18620 2024 3136 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_18620 3144 4553 gene locus_tag LOCUS_18630 3144 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4581 6053 gene locus_tag LOCUS_18640 4581 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6007 12714 gene locus_tag LOCUS_18650 6007 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 14153 12849 gene locus_tag LOCUS_18660 14153 12849 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_18660 14409 17849 gene locus_tag LOCUS_18670 14409 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 18344 19882 gene locus_tag LOCUS_18680 18344 19882 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_18680 20436 19996 gene locus_tag LOCUS_18690 20436 19996 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_18690 21572 20787 gene locus_tag LOCUS_18700 21572 20787 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_18700 22016 22969 gene locus_tag LOCUS_18710 22016 22969 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_18710 23267 23028 gene locus_tag LOCUS_18720 23267 23028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 23734 24858 gene locus_tag LOCUS_18730 23734 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 27019 25688 gene locus_tag LOCUS_18740 27019 25688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 27652 27353 gene locus_tag LOCUS_18750 27652 27353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 28556 27726 gene locus_tag LOCUS_18760 28556 27726 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_18760 29081 30187 gene locus_tag LOCUS_18770 gene ald 29081 30187 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_18770 30604 33693 gene locus_tag LOCUS_18780 30604 33693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_18780 33802 35292 gene locus_tag LOCUS_18790 33802 35292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 35323 36492 gene locus_tag LOCUS_18800 35323 36492 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_18800 38065 36623 gene locus_tag LOCUS_18810 38065 36623 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_18810 38772 38092 gene locus_tag LOCUS_18820 38772 38092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence37 97 705 gene locus_tag LOCUS_18830 97 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 821 1345 gene locus_tag LOCUS_18840 821 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1441 1893 gene locus_tag LOCUS_18850 1441 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4646 1959 gene locus_tag LOCUS_18860 4646 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303161.1 protein_id gnl|my_center|LOCUS_18860 8809 4823 gene locus_tag LOCUS_18870 8809 4823 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107573.1 protein_id gnl|my_center|LOCUS_18870 10305 8845 gene locus_tag LOCUS_18880 10305 8845 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 protein_id gnl|my_center|LOCUS_18880 12841 10361 gene locus_tag LOCUS_18890 12841 10361 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_18890 14271 12976 gene locus_tag LOCUS_18900 14271 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 16756 14243 gene locus_tag LOCUS_18910 16756 14243 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_18910 21050 16770 gene locus_tag LOCUS_18920 21050 16770 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765809.1 protein_id gnl|my_center|LOCUS_18920 21225 23321 gene locus_tag LOCUS_18930 gene recG 21225 23321 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_18930 23476 23796 gene locus_tag LOCUS_18940 23476 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 24033 24983 gene locus_tag LOCUS_18950 24033 24983 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760846.1 protein_id gnl|my_center|LOCUS_18950 26461 25079 gene locus_tag LOCUS_18960 gene rseP 26461 25079 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_18960 27724 26564 gene locus_tag LOCUS_18970 27724 26564 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_18970 28257 27736 gene locus_tag LOCUS_18980 gene rimM 28257 27736 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_18980 29599 28289 gene locus_tag LOCUS_18990 gene murA 29599 28289 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_18990 30229 29630 gene locus_tag LOCUS_19000 30229 29630 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_19000 30906 30259 gene locus_tag LOCUS_19010 gene tsaB 30906 30259 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_19010 31056 31922 gene locus_tag LOCUS_19020 31056 31922 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_19020 32065 32640 gene locus_tag LOCUS_19030 gene gmk 32065 32640 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_19030 32644 33216 gene locus_tag LOCUS_19040 gene nadD 32644 33216 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761100.1 protein_id gnl|my_center|LOCUS_19040 33272 35179 gene locus_tag LOCUS_19050 33272 35179 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556298.1 protein_id gnl|my_center|LOCUS_19050 35182 36327 gene locus_tag LOCUS_19060 35182 36327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 36337 37341 gene locus_tag LOCUS_19070 36337 37341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 37376 38281 gene locus_tag LOCUS_19080 37376 38281 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_19080 38286 38930 gene locus_tag LOCUS_19090 38286 38930 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence38 404 3511 gene locus_tag LOCUS_19100 404 3511 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_19100 3567 4970 gene locus_tag LOCUS_19110 3567 4970 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_19110 5012 5776 gene locus_tag LOCUS_19120 5012 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5811 7349 gene locus_tag LOCUS_19130 5811 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 7377 8726 gene locus_tag LOCUS_19140 7377 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8808 10103 gene locus_tag LOCUS_19150 8808 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 10584 12575 gene locus_tag LOCUS_19160 10584 12575 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_19160 14192 12711 gene locus_tag LOCUS_19170 14192 12711 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_19170 14509 15534 gene locus_tag LOCUS_19180 14509 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 16329 15727 gene locus_tag LOCUS_19190 gene rsxA 16329 15727 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_19190 16919 16335 gene locus_tag LOCUS_19200 16919 16335 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_19200 17600 16926 gene locus_tag LOCUS_19210 17600 16926 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_19210 18615 17614 gene locus_tag LOCUS_19220 18615 17614 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_19220 20038 18686 gene locus_tag LOCUS_19230 gene rsxC 20038 18686 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_19230 20989 20042 gene locus_tag LOCUS_19240 20989 20042 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_19240 21485 21072 gene locus_tag LOCUS_19250 21485 21072 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793421.1 protein_id gnl|my_center|LOCUS_19250 21716 22165 gene locus_tag LOCUS_19260 21716 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_19260 23717 22272 gene locus_tag LOCUS_19270 23717 22272 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_19270 24468 23830 gene locus_tag LOCUS_19280 24468 23830 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776695.1 protein_id gnl|my_center|LOCUS_19280 25775 24525 gene locus_tag LOCUS_19290 25775 24525 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_19290 25906 26742 gene locus_tag LOCUS_19300 25906 26742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 26777 26998 gene locus_tag LOCUS_19310 26777 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 27406 27477 gene locus_tag LOCUS_t00370 27406 27477 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28840 27848 gene locus_tag LOCUS_19320 28840 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 30332 28965 gene locus_tag LOCUS_19330 gene hisS 30332 28965 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_19330 31703 30429 gene locus_tag LOCUS_19340 31703 30429 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_19340 32191 31727 gene locus_tag LOCUS_19350 32191 31727 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_19350 32897 32268 gene locus_tag LOCUS_19360 32897 32268 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_19360 33509 32991 gene locus_tag LOCUS_19370 33509 32991 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_19370 34338 33568 gene locus_tag LOCUS_19380 34338 33568 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_19380 34806 35420 gene locus_tag LOCUS_19390 34806 35420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 36150 35533 gene locus_tag LOCUS_19400 36150 35533 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_19400 36310 38598 gene locus_tag LOCUS_19410 36310 38598 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence39 189 1196 gene locus_tag LOCUS_19420 189 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2740 1226 gene locus_tag LOCUS_19430 2740 1226 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_19430 2907 3446 gene locus_tag LOCUS_19440 gene hpt 2907 3446 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_19440 3635 3802 gene locus_tag LOCUS_19450 3635 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3848 4420 gene locus_tag LOCUS_19460 3848 4420 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_19460 4584 5744 gene locus_tag LOCUS_19470 gene obgE 4584 5744 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_19470 5750 6589 gene locus_tag LOCUS_19480 gene pgeF 5750 6589 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_19480 6746 7945 gene locus_tag LOCUS_19490 6746 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 8292 8092 gene locus_tag LOCUS_19500 8292 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 9498 8314 gene locus_tag LOCUS_19510 9498 8314 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_19510 9710 9934 gene locus_tag LOCUS_19520 9710 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 10439 10074 gene locus_tag LOCUS_19530 gene rplS 10439 10074 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_19530 10708 11484 gene locus_tag LOCUS_19540 10708 11484 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_19540 11553 12431 gene locus_tag LOCUS_19550 11553 12431 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_19550 14190 12520 gene locus_tag LOCUS_19560 14190 12520 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_19560 18504 14398 gene locus_tag LOCUS_19570 18504 14398 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_19570 19038 20387 gene locus_tag LOCUS_19580 19038 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 20557 23655 gene locus_tag LOCUS_19590 20557 23655 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_19590 23675 25639 gene locus_tag LOCUS_19600 23675 25639 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_19600 25669 28551 gene locus_tag LOCUS_19610 25669 28551 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_19610 28607 30391 gene locus_tag LOCUS_19620 28607 30391 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_19620 30436 31461 gene locus_tag LOCUS_19630 30436 31461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 31467 33728 gene locus_tag LOCUS_19640 31467 33728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 34347 35732 gene locus_tag LOCUS_19650 34347 35732 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_19650 35796 37019 gene locus_tag LOCUS_19660 35796 37019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence40 543 737 gene locus_tag LOCUS_19670 543 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 727 1314 gene locus_tag LOCUS_19680 727 1314 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108121.1 protein_id gnl|my_center|LOCUS_19680 1847 3076 gene locus_tag LOCUS_19690 1847 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3117 4235 gene locus_tag LOCUS_19700 gene fucP 3117 4235 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_19700 4494 5663 gene locus_tag LOCUS_19710 4494 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263489.1 protein_id gnl|my_center|LOCUS_19710 5663 6811 gene locus_tag LOCUS_19720 5663 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 6875 8050 gene locus_tag LOCUS_19730 6875 8050 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108365.1 protein_id gnl|my_center|LOCUS_19730 8022 12050 gene locus_tag LOCUS_19740 8022 12050 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108364.1 protein_id gnl|my_center|LOCUS_19740 12344 12565 gene locus_tag LOCUS_19750 12344 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 13015 13293 gene locus_tag LOCUS_19760 13015 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 13589 13864 gene locus_tag LOCUS_19770 13589 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 14179 14340 gene locus_tag LOCUS_19780 14179 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 15111 14368 gene locus_tag LOCUS_19790 15111 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 15711 15160 gene locus_tag LOCUS_19800 15711 15160 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767469.1 protein_id gnl|my_center|LOCUS_19800 19279 15845 gene locus_tag LOCUS_19810 19279 15845 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_19810 20143 19427 gene locus_tag LOCUS_19820 20143 19427 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_19820 21174 20269 gene locus_tag LOCUS_19830 21174 20269 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_19830 21651 21223 gene locus_tag LOCUS_19840 21651 21223 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_19840 22619 21672 gene locus_tag LOCUS_19850 22619 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_19850 24006 22738 gene locus_tag LOCUS_19860 gene purD 24006 22738 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_19860 26408 24081 gene locus_tag LOCUS_19870 26408 24081 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_19870 28025 26445 gene locus_tag LOCUS_19880 28025 26445 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_19880 28950 28009 gene locus_tag LOCUS_19890 28950 28009 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_19890 33600 29113 gene locus_tag LOCUS_19900 33600 29113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 34996 33611 gene locus_tag LOCUS_19910 34996 33611 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_19910 35170 36321 gene locus_tag LOCUS_19920 35170 36321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence41 1625 174 gene locus_tag LOCUS_19930 gene xylE 1625 174 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107448.1 protein_id gnl|my_center|LOCUS_19930 1832 2788 gene locus_tag LOCUS_19940 gene metF 1832 2788 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_19940 2789 3901 gene locus_tag LOCUS_19950 2789 3901 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_19950 4289 5680 gene locus_tag LOCUS_19960 gene ricT 4289 5680 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766922.1 protein_id gnl|my_center|LOCUS_19960 5701 6183 gene locus_tag LOCUS_19970 5701 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 7685 6222 gene locus_tag LOCUS_19980 gene rodA 7685 6222 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_19980 9574 7724 gene locus_tag LOCUS_19990 gene mrdA 9574 7724 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_19990 10135 9638 gene locus_tag LOCUS_20000 gene mreD 10135 9638 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_20000 11037 10165 gene locus_tag LOCUS_20010 gene mreC 11037 10165 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_20010 12058 11069 gene locus_tag LOCUS_20020 12058 11069 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_20020 12873 12280 gene locus_tag LOCUS_20030 12873 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 13415 15931 gene locus_tag LOCUS_20040 gene clpB 13415 15931 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_20040 19578 16042 gene locus_tag LOCUS_20050 19578 16042 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227589.1 protein_id gnl|my_center|LOCUS_20050 21499 19709 gene locus_tag LOCUS_20060 21499 19709 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107562.1 protein_id gnl|my_center|LOCUS_20060 23570 21534 gene locus_tag LOCUS_20070 23570 21534 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107563.1 protein_id gnl|my_center|LOCUS_20070 25766 23769 gene locus_tag LOCUS_20080 25766 23769 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_20080 26385 27632 gene locus_tag LOCUS_20090 gene hflX 26385 27632 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_20090 27661 29517 gene locus_tag LOCUS_20100 27661 29517 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_20100 29561 31219 gene locus_tag LOCUS_20110 29561 31219 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_20110 33945 31339 gene locus_tag LOCUS_20120 33945 31339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 34274 35164 gene locus_tag LOCUS_20130 34274 35164 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_20130 35608 36255 gene locus_tag LOCUS_20140 35608 36255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence42 407 186 gene locus_tag LOCUS_20150 407 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 514 2871 gene locus_tag LOCUS_20160 514 2871 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_20160 3049 4614 gene locus_tag LOCUS_20170 3049 4614 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_20170 4639 4788 gene locus_tag LOCUS_20180 4639 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4799 5224 gene locus_tag LOCUS_20190 4799 5224 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_20190 6223 5333 gene locus_tag LOCUS_20200 6223 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 6469 7251 gene locus_tag LOCUS_20210 gene pstB 6469 7251 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_20210 7306 7518 gene locus_tag LOCUS_20220 gene thiS 7306 7518 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_20220 7661 8470 gene locus_tag LOCUS_20230 gene moeB 7661 8470 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_20230 8541 8930 gene locus_tag LOCUS_20240 8541 8930 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_20240 8945 11419 gene locus_tag LOCUS_20250 8945 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 11438 11893 gene locus_tag LOCUS_20260 11438 11893 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927175.1 protein_id gnl|my_center|LOCUS_20260 11871 12857 gene locus_tag LOCUS_20270 11871 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 12901 15048 gene locus_tag LOCUS_20280 12901 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 15067 16062 gene locus_tag LOCUS_20290 gene hemB 15067 16062 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 protein_id gnl|my_center|LOCUS_20290 16195 17469 gene locus_tag LOCUS_20300 gene hemL 16195 17469 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880497.1 protein_id gnl|my_center|LOCUS_20300 17613 17957 gene locus_tag LOCUS_20310 17613 17957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 17942 18115 gene locus_tag LOCUS_20320 17942 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 18683 18453 gene locus_tag LOCUS_20330 18683 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 19371 18733 gene locus_tag LOCUS_20340 19371 18733 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_20340 19870 21183 gene locus_tag LOCUS_20350 19870 21183 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203161.1 protein_id gnl|my_center|LOCUS_20350 21180 24635 gene locus_tag LOCUS_20360 21180 24635 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114994.1 protein_id gnl|my_center|LOCUS_20360 24831 25736 gene locus_tag LOCUS_20370 gene cysD 24831 25736 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_20370 25832 27103 gene locus_tag LOCUS_20380 25832 27103 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_20380 27126 27851 gene locus_tag LOCUS_20390 27126 27851 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_20390 28062 28943 gene locus_tag LOCUS_20400 gene pstC 28062 28943 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_20400 28953 29792 gene locus_tag LOCUS_20410 gene pstA 28953 29792 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925923.1 protein_id gnl|my_center|LOCUS_20410 30209 29865 gene locus_tag LOCUS_20420 30209 29865 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785327.1 protein_id gnl|my_center|LOCUS_20420 31128 30271 gene locus_tag LOCUS_20430 gene panC 31128 30271 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_20430 31297 32109 gene locus_tag LOCUS_20440 31297 32109 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_20440 32145 33599 gene locus_tag LOCUS_20450 32145 33599 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_20450 33633 33779 gene locus_tag LOCUS_20460 33633 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence43 269 586 gene locus_tag LOCUS_20470 269 586 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_20470 1594 635 gene locus_tag LOCUS_20480 1594 635 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_20480 4047 1762 gene locus_tag LOCUS_20490 4047 1762 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_20490 5468 4110 gene locus_tag LOCUS_20500 5468 4110 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_20500 6242 5556 gene locus_tag LOCUS_20510 6242 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 7211 6300 gene locus_tag LOCUS_20520 7211 6300 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_20520 8039 7275 gene locus_tag LOCUS_20530 8039 7275 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_20530 8140 8904 gene locus_tag LOCUS_20540 gene surE 8140 8904 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_20540 8901 10364 gene locus_tag LOCUS_20550 gene lpxB 8901 10364 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_20550 10556 11470 gene locus_tag LOCUS_20560 10556 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 12399 11626 gene locus_tag LOCUS_20570 12399 11626 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_20570 14591 12504 gene locus_tag LOCUS_20580 gene ftsH 14591 12504 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_20580 15021 14662 gene locus_tag LOCUS_20590 gene rsfS 15021 14662 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_20590 15251 15350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15430 15501 gene locus_tag LOCUS_t00380 15430 15501 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17388 15619 gene locus_tag LOCUS_20600 17388 15619 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_20600 17464 17473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18549 17623 gene locus_tag LOCUS_20610 18549 17623 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_20610 20331 18868 gene locus_tag LOCUS_20620 20331 18868 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_20620 21419 20421 gene locus_tag LOCUS_20630 21419 20421 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_20630 21648 22457 gene locus_tag LOCUS_20640 gene rsmA 21648 22457 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_20640 22470 23030 gene locus_tag LOCUS_20650 gene frr 22470 23030 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_20650 23065 23997 gene locus_tag LOCUS_20660 gene rsgA 23065 23997 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_20660 24046 24960 gene locus_tag LOCUS_20670 24046 24960 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_20670 25422 25026 gene locus_tag LOCUS_tm00010 25422 25026 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 26263 25784 gene locus_tag LOCUS_20680 26263 25784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 27516 26266 gene locus_tag LOCUS_20690 27516 26266 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_20690 28228 30582 gene locus_tag LOCUS_20700 28228 30582 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_20700 30599 32110 gene locus_tag LOCUS_20710 30599 32110 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_20710 32147 33181 gene locus_tag LOCUS_20720 32147 33181 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence44 1522 77 gene locus_tag LOCUS_20730 1522 77 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_20730 3506 1656 gene locus_tag LOCUS_20740 3506 1656 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_20740 5148 4216 gene locus_tag LOCUS_20750 5148 4216 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_20750 5673 5503 gene locus_tag LOCUS_20760 5673 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6061 5726 gene locus_tag LOCUS_20770 6061 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 6306 6124 gene locus_tag LOCUS_20780 6306 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 6785 6339 gene locus_tag LOCUS_20790 6785 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 8182 6941 gene locus_tag LOCUS_20800 8182 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 9972 8218 gene locus_tag LOCUS_20810 9972 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 13215 9991 gene locus_tag LOCUS_20820 13215 9991 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_20820 14807 13659 gene locus_tag LOCUS_20830 14807 13659 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_20830 15968 14973 gene locus_tag LOCUS_20840 15968 14973 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_20840 17137 15974 gene locus_tag LOCUS_20850 17137 15974 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_20850 17922 17188 gene locus_tag LOCUS_20860 17922 17188 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784340.1 protein_id gnl|my_center|LOCUS_20860 18303 18148 gene locus_tag LOCUS_20870 gene rpmH 18303 18148 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_20870 18525 19091 gene locus_tag LOCUS_20880 gene efp 18525 19091 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_20880 19155 20213 gene locus_tag LOCUS_20890 19155 20213 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_20890 20266 20955 gene locus_tag LOCUS_20900 gene radC 20266 20955 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_20900 21058 21378 gene locus_tag LOCUS_20910 21058 21378 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_20910 21440 22204 gene locus_tag LOCUS_20920 21440 22204 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_20920 23202 22240 gene locus_tag LOCUS_20930 23202 22240 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_20930 24564 23362 gene locus_tag LOCUS_20940 24564 23362 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_20940 25656 24610 gene locus_tag LOCUS_20950 gene pta 25656 24610 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_20950 26658 25888 gene locus_tag LOCUS_20960 gene cdaA 26658 25888 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_20960 27500 26655 gene locus_tag LOCUS_20970 gene folP 27500 26655 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_20970 27959 27720 gene locus_tag LOCUS_20980 27959 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 28085 29386 gene locus_tag LOCUS_20990 28085 29386 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_20990 30825 29704 gene locus_tag LOCUS_21000 30825 29704 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_21000 31644 31075 gene locus_tag LOCUS_21010 gene pdxT 31644 31075 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 protein_id gnl|my_center|LOCUS_21010 32586 31711 gene locus_tag LOCUS_21020 gene pdxS 32586 31711 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence45 1886 150 gene locus_tag LOCUS_21030 1886 150 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_21030 4710 2161 gene locus_tag LOCUS_21040 4710 2161 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_21040 5427 4780 gene locus_tag LOCUS_21050 5427 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5711 6217 gene locus_tag LOCUS_21060 gene phoE 5711 6217 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_21060 6276 7031 gene locus_tag LOCUS_21070 6276 7031 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_21070 8750 7137 gene locus_tag LOCUS_21080 8750 7137 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764305.1 protein_id gnl|my_center|LOCUS_21080 9475 10347 gene locus_tag LOCUS_21090 gene rfbD 9475 10347 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_21090 10444 11577 gene locus_tag LOCUS_21100 gene rfbB 10444 11577 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_21100 11848 12810 gene locus_tag LOCUS_21110 11848 12810 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 protein_id gnl|my_center|LOCUS_21110 12859 14004 gene locus_tag LOCUS_21120 12859 14004 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_21120 14017 15741 gene locus_tag LOCUS_21130 14017 15741 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798980.1 protein_id gnl|my_center|LOCUS_21130 15924 17420 gene locus_tag LOCUS_21140 15924 17420 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_21140 17472 18599 gene locus_tag LOCUS_21150 17472 18599 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766782.1 protein_id gnl|my_center|LOCUS_21150 18596 19579 gene locus_tag LOCUS_21160 18596 19579 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_21160 20659 19613 gene locus_tag LOCUS_21170 gene aroB 20659 19613 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_21170 20919 23831 gene locus_tag LOCUS_21180 20919 23831 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_21180 24655 24062 gene locus_tag LOCUS_21190 24655 24062 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_21190 24949 25146 gene locus_tag LOCUS_21200 24949 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 25876 25454 gene locus_tag LOCUS_21210 25876 25454 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_21210 26376 25879 gene locus_tag LOCUS_21220 gene pth 26376 25879 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_21220 27106 26501 gene locus_tag LOCUS_21230 27106 26501 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_21230 27391 28458 gene locus_tag LOCUS_21240 gene nusB 27391 28458 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_21240 28538 28852 gene locus_tag LOCUS_21250 gene yajC 28538 28852 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_21250 28845 29825 gene locus_tag LOCUS_21260 28845 29825 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_21260 29867 30442 gene locus_tag LOCUS_21270 gene coaE 29867 30442 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_21270 30454 30903 gene locus_tag LOCUS_21280 30454 30903 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_21280 32403 31045 gene locus_tag LOCUS_21290 32403 31045 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence46 756 118 gene locus_tag LOCUS_21300 756 118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786122.1 protein_id gnl|my_center|LOCUS_21300 3447 844 gene locus_tag LOCUS_21310 3447 844 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_21310 3813 4355 gene locus_tag LOCUS_21320 3813 4355 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_21320 4445 5113 gene locus_tag LOCUS_21330 4445 5113 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_21330 5150 5986 gene locus_tag LOCUS_21340 5150 5986 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_21340 5959 6375 gene locus_tag LOCUS_21350 5959 6375 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764781.1 protein_id gnl|my_center|LOCUS_21350 6652 7743 gene locus_tag LOCUS_21360 6652 7743 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_21360 7806 11942 gene locus_tag LOCUS_21370 7806 11942 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_21370 12099 15011 gene locus_tag LOCUS_21380 12099 15011 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918674.1 protein_id gnl|my_center|LOCUS_21380 15013 17514 gene locus_tag LOCUS_21390 gene galB 15013 17514 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_21390 17847 20183 gene locus_tag LOCUS_21400 17847 20183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 20205 20780 gene locus_tag LOCUS_21410 20205 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 22395 21019 gene locus_tag LOCUS_21420 22395 21019 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_21420 23198 22626 gene locus_tag LOCUS_21430 23198 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 23776 23216 gene locus_tag LOCUS_21440 23776 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 24257 24829 gene locus_tag LOCUS_21450 24257 24829 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785920.1 protein_id gnl|my_center|LOCUS_21450 25077 25730 gene locus_tag LOCUS_21460 25077 25730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108670.1 protein_id gnl|my_center|LOCUS_21460 25699 26133 gene locus_tag LOCUS_21470 25699 26133 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108669.1 protein_id gnl|my_center|LOCUS_21470 26753 27607 gene locus_tag LOCUS_21480 26753 27607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 27669 28583 gene locus_tag LOCUS_21490 27669 28583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 28641 29606 gene locus_tag LOCUS_21500 28641 29606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 29638 31134 gene locus_tag LOCUS_21510 29638 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 31512 31760 gene locus_tag LOCUS_21520 31512 31760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 32564 32370 gene locus_tag LOCUS_21530 32564 32370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence47 986 615 gene locus_tag LOCUS_21540 986 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1235 2815 gene locus_tag LOCUS_21550 1235 2815 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_21550 3717 2878 gene locus_tag LOCUS_21560 3717 2878 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108722.1 protein_id gnl|my_center|LOCUS_21560 5568 3760 gene locus_tag LOCUS_21570 5568 3760 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_21570 6036 7655 gene locus_tag LOCUS_21580 6036 7655 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109291.1 protein_id gnl|my_center|LOCUS_21580 9468 7810 gene locus_tag LOCUS_21590 9468 7810 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_21590 9623 10492 gene locus_tag LOCUS_21600 9623 10492 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_21600 10757 11674 gene locus_tag LOCUS_21610 10757 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 11806 15288 gene locus_tag LOCUS_21620 11806 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 15338 16234 gene locus_tag LOCUS_21630 15338 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 16291 17352 gene locus_tag LOCUS_21640 16291 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 17480 18349 gene locus_tag LOCUS_21650 17480 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 18353 19999 gene locus_tag LOCUS_21660 18353 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 20035 20604 gene locus_tag LOCUS_21670 20035 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 20635 21603 gene locus_tag LOCUS_21680 20635 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 21677 23743 gene locus_tag LOCUS_21690 21677 23743 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_21690 23759 24160 gene locus_tag LOCUS_21700 23759 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 24260 25588 gene locus_tag LOCUS_21710 24260 25588 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_21710 25693 26244 gene locus_tag LOCUS_21720 25693 26244 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_21720 26255 26905 gene locus_tag LOCUS_21730 26255 26905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 26978 29473 gene locus_tag LOCUS_21740 26978 29473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 29583 29682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29743 31857 gene locus_tag LOCUS_21750 29743 31857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 32348 32118 gene locus_tag LOCUS_21760 32348 32118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence48 1303 794 gene locus_tag LOCUS_21770 1303 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2824 1334 gene locus_tag LOCUS_21780 2824 1334 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_21780 3405 2830 gene locus_tag LOCUS_21790 gene ruvC 3405 2830 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_21790 4055 3441 gene locus_tag LOCUS_21800 4055 3441 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_21800 4749 4123 gene locus_tag LOCUS_21810 gene rsmG 4749 4123 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_21810 4945 5628 gene locus_tag LOCUS_21820 4945 5628 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_21820 5665 6483 gene locus_tag LOCUS_21830 gene panB 5665 6483 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765576.1 protein_id gnl|my_center|LOCUS_21830 6553 7773 gene locus_tag LOCUS_21840 6553 7773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202766.1 protein_id gnl|my_center|LOCUS_21840 7962 8957 gene locus_tag LOCUS_21850 7962 8957 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_21850 8998 9867 gene locus_tag LOCUS_21860 8998 9867 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_21860 9896 10972 gene locus_tag LOCUS_21870 9896 10972 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_21870 11057 12055 gene locus_tag LOCUS_21880 11057 12055 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_21880 12203 13240 gene locus_tag LOCUS_21890 12203 13240 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_21890 13271 14008 gene locus_tag LOCUS_21900 13271 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 14083 16647 gene locus_tag LOCUS_21910 14083 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 16697 17401 gene locus_tag LOCUS_21920 gene lpxF 16697 17401 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_21920 17448 18722 gene locus_tag LOCUS_21930 17448 18722 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_21930 18842 20824 gene locus_tag LOCUS_21940 18842 20824 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_21940 20856 22889 gene locus_tag LOCUS_21950 20856 22889 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_21950 24681 23044 gene locus_tag LOCUS_21960 24681 23044 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_21960 25575 24736 gene locus_tag LOCUS_21970 25575 24736 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_21970 28188 25957 gene locus_tag LOCUS_21980 28188 25957 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_21980 28540 28199 gene locus_tag LOCUS_21990 28540 28199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760554.1 protein_id gnl|my_center|LOCUS_21990 31223 28575 gene locus_tag LOCUS_22000 31223 28575 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769700.1 protein_id gnl|my_center|LOCUS_22000 31871 31314 gene locus_tag LOCUS_22010 31871 31314 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence49 121 927 gene locus_tag LOCUS_22020 121 927 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_22020 1622 1158 gene locus_tag LOCUS_22030 1622 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1595 1906 gene locus_tag LOCUS_22040 1595 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2067 2267 gene locus_tag LOCUS_22050 2067 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2404 2586 gene locus_tag LOCUS_22060 2404 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3317 3087 gene locus_tag LOCUS_22070 3317 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4839 3511 gene locus_tag LOCUS_22080 4839 3511 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_22080 5372 5602 gene locus_tag LOCUS_22090 5372 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 5604 6131 gene locus_tag LOCUS_22100 5604 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 6186 6554 gene locus_tag LOCUS_22110 6186 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 6727 10254 gene locus_tag LOCUS_22120 6727 10254 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_22120 12322 10343 gene locus_tag LOCUS_22130 12322 10343 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_22130 13194 12322 gene locus_tag LOCUS_22140 13194 12322 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_22140 13425 14306 gene locus_tag LOCUS_22150 13425 14306 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_22150 15328 14417 gene locus_tag LOCUS_22160 gene cynR 15328 14417 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952470.1 protein_id gnl|my_center|LOCUS_22160 17024 15573 gene locus_tag LOCUS_22170 17024 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 18719 17031 gene locus_tag LOCUS_22180 18719 17031 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_22180 18992 20074 gene locus_tag LOCUS_22190 gene mnmA 18992 20074 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_22190 20693 20151 gene locus_tag LOCUS_22200 20693 20151 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_22200 22218 20686 gene locus_tag LOCUS_22210 22218 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 23314 22277 gene locus_tag LOCUS_22220 23314 22277 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763044.1 protein_id gnl|my_center|LOCUS_22220 24702 23380 gene locus_tag LOCUS_22230 24702 23380 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870126.1 protein_id gnl|my_center|LOCUS_22230 24892 25767 gene locus_tag LOCUS_22240 24892 25767 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_22240 25801 27663 gene locus_tag LOCUS_22250 25801 27663 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence50 270 1562 gene locus_tag LOCUS_22260 270 1562 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_22260 3633 1651 gene locus_tag LOCUS_22270 gene ligA 3633 1651 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_22270 4217 3687 gene locus_tag LOCUS_22280 4217 3687 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476078.1 protein_id gnl|my_center|LOCUS_22280 5792 4455 gene locus_tag LOCUS_22290 5792 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6065 6946 gene locus_tag LOCUS_22300 6065 6946 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_22300 7024 7428 gene locus_tag LOCUS_22310 7024 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7476 8426 gene locus_tag LOCUS_22320 7476 8426 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_22320 8534 9643 gene locus_tag LOCUS_22330 gene wecB 8534 9643 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_22330 10691 9783 gene locus_tag LOCUS_22340 10691 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 10840 11616 gene locus_tag LOCUS_22350 10840 11616 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_22350 11706 12920 gene locus_tag LOCUS_22360 11706 12920 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_22360 13128 15185 gene locus_tag LOCUS_22370 gene htpG 13128 15185 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_22370 15370 15915 gene locus_tag LOCUS_22380 15370 15915 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 protein_id gnl|my_center|LOCUS_22380 16351 15980 gene locus_tag LOCUS_22390 16351 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 17878 16418 gene locus_tag LOCUS_22400 17878 16418 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_22400 18044 18193 gene locus_tag LOCUS_22410 18044 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 18213 18836 gene locus_tag LOCUS_22420 18213 18836 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_22420 18842 19489 gene locus_tag LOCUS_22430 gene nth 18842 19489 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_22430 20696 19572 gene locus_tag LOCUS_22440 gene aroC 20696 19572 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_22440 21326 20724 gene locus_tag LOCUS_22450 21326 20724 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_22450 21619 21335 gene locus_tag LOCUS_22460 21619 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 21909 22301 gene locus_tag LOCUS_22470 21909 22301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 22885 22496 gene locus_tag LOCUS_22480 22885 22496 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_22480 23428 23039 gene locus_tag LOCUS_22490 23428 23039 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765741.1 protein_id gnl|my_center|LOCUS_22490 24928 24038 gene locus_tag LOCUS_22500 24928 24038 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_22500 25315 25094 gene locus_tag LOCUS_22510 25315 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 26509 25472 gene locus_tag LOCUS_22520 26509 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 26831 26547 gene locus_tag LOCUS_22530 26831 26547 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence51 1151 258 gene locus_tag LOCUS_22540 1151 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2014 1181 gene locus_tag LOCUS_22550 2014 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2724 2095 gene locus_tag LOCUS_22560 2724 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4626 3262 gene locus_tag LOCUS_22570 4626 3262 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_22570 4911 4639 gene locus_tag LOCUS_22580 4911 4639 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_22580 6113 5061 gene locus_tag LOCUS_22590 gene mltG 6113 5061 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_22590 6311 7723 gene locus_tag LOCUS_22600 6311 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 8463 7756 gene locus_tag LOCUS_22610 8463 7756 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_22610 8736 9815 gene locus_tag LOCUS_22620 8736 9815 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_22620 9975 10418 gene locus_tag LOCUS_22630 9975 10418 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_22630 10486 12585 gene locus_tag LOCUS_22640 10486 12585 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_22640 12627 13706 gene locus_tag LOCUS_22650 12627 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 13730 14956 gene locus_tag LOCUS_22660 13730 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 15036 16355 gene locus_tag LOCUS_22670 15036 16355 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_22670 16642 17712 gene locus_tag LOCUS_22680 gene serC 16642 17712 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_22680 17726 18643 gene locus_tag LOCUS_22690 17726 18643 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_22690 18748 20082 gene locus_tag LOCUS_22700 18748 20082 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_22700 20195 20782 gene locus_tag LOCUS_22710 20195 20782 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_22710 22979 20934 gene locus_tag LOCUS_22720 gene uvrB 22979 20934 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_22720 23138 24004 gene locus_tag LOCUS_22730 gene bamD 23138 24004 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_22730 24058 24408 gene locus_tag LOCUS_22740 24058 24408 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_22740 24423 24890 gene locus_tag LOCUS_22750 24423 24890 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107333.1 protein_id gnl|my_center|LOCUS_22750 25030 25560 gene locus_tag LOCUS_22760 25030 25560 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202986.1 protein_id gnl|my_center|LOCUS_22760 25651 27135 gene locus_tag LOCUS_22770 25651 27135 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203395.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence52 271 1008 gene locus_tag LOCUS_22780 271 1008 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_22780 2575 1112 gene locus_tag LOCUS_22790 2575 1112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_22790 3650 2685 gene locus_tag LOCUS_22800 gene kduI 3650 2685 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_22800 5033 3678 gene locus_tag LOCUS_22810 5033 3678 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_22810 7749 5272 gene locus_tag LOCUS_22820 7749 5272 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_22820 8601 7777 gene locus_tag LOCUS_22830 8601 7777 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_22830 11063 8649 gene locus_tag LOCUS_22840 11063 8649 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_22840 11378 12055 gene locus_tag LOCUS_22850 11378 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 13201 12203 gene locus_tag LOCUS_22860 13201 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 13823 13263 gene locus_tag LOCUS_22870 13823 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 16434 13837 gene locus_tag LOCUS_22880 16434 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 16956 16453 gene locus_tag LOCUS_22890 16956 16453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 17574 17173 gene locus_tag LOCUS_22900 17574 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 18438 21545 gene locus_tag LOCUS_22910 18438 21545 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_22910 21559 23364 gene locus_tag LOCUS_22920 21559 23364 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 protein_id gnl|my_center|LOCUS_22920 24110 23679 gene locus_tag LOCUS_22930 24110 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 24265 24567 gene locus_tag LOCUS_22940 24265 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 25770 25345 gene locus_tag LOCUS_22950 25770 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence53 392 2089 gene locus_tag LOCUS_22960 gene sulP 392 2089 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_22960 2940 2200 gene locus_tag LOCUS_22970 2940 2200 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_22970 4540 2972 gene locus_tag LOCUS_22980 4540 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6224 4545 gene locus_tag LOCUS_22990 6224 4545 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108284.1 protein_id gnl|my_center|LOCUS_22990 6901 6356 gene locus_tag LOCUS_23000 gene yfcE 6901 6356 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_23000 7203 9644 gene locus_tag LOCUS_23010 gene thrA 7203 9644 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_23010 9658 10977 gene locus_tag LOCUS_23020 9658 10977 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_23020 11053 12354 gene locus_tag LOCUS_23030 gene thrC 11053 12354 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_23030 12483 13439 gene locus_tag LOCUS_23040 12483 13439 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_23040 14557 13526 gene locus_tag LOCUS_23050 14557 13526 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_23050 15805 14597 gene locus_tag LOCUS_23060 15805 14597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_23060 15973 16647 gene locus_tag LOCUS_23070 15973 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 17917 16739 gene locus_tag LOCUS_23080 17917 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 19192 18185 gene locus_tag LOCUS_23090 19192 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 20127 21716 gene locus_tag LOCUS_23100 20127 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 22664 22275 gene locus_tag LOCUS_23110 22664 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 23854 22841 gene locus_tag LOCUS_23120 23854 22841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 25402 23858 gene locus_tag LOCUS_23130 25402 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence54 740 1057 gene locus_tag LOCUS_23140 gene rplU 740 1057 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_23140 1077 1367 gene locus_tag LOCUS_23150 gene rpmA 1077 1367 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_23150 1652 2944 gene locus_tag LOCUS_23160 gene serS 1652 2944 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_23160 3147 5492 gene locus_tag LOCUS_23170 3147 5492 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_23170 6976 5618 gene locus_tag LOCUS_23180 6976 5618 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_23180 7562 6969 gene locus_tag LOCUS_23190 7562 6969 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_23190 8467 7655 gene locus_tag LOCUS_23200 8467 7655 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_23200 9170 8610 gene locus_tag LOCUS_23210 9170 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 10159 9227 gene locus_tag LOCUS_23220 gene mazG 10159 9227 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_23220 10641 13322 gene locus_tag LOCUS_23230 10641 13322 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_23230 13411 14694 gene locus_tag LOCUS_23240 13411 14694 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_23240 14760 15764 gene locus_tag LOCUS_23250 14760 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 16473 16898 gene locus_tag LOCUS_23260 16473 16898 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_23260 17201 17398 gene locus_tag LOCUS_23270 17201 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 17486 18259 gene locus_tag LOCUS_23280 17486 18259 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_23280 18365 20059 gene locus_tag LOCUS_23290 gene thiC 18365 20059 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_23290 20064 21203 gene locus_tag LOCUS_23300 gene thiH 20064 21203 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_23300 22895 21324 gene locus_tag LOCUS_23310 22895 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 24349 23231 gene locus_tag LOCUS_23320 gene fucP 24349 23231 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence55 544 1125 gene locus_tag LOCUS_23330 544 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1673 1386 gene locus_tag LOCUS_23340 1673 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1912 3378 gene locus_tag LOCUS_23350 1912 3378 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_23350 3424 4257 gene locus_tag LOCUS_23360 3424 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 4626 6845 gene locus_tag LOCUS_23370 4626 6845 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_23370 6847 7362 gene locus_tag LOCUS_23380 gene nrdG 6847 7362 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867062.1 protein_id gnl|my_center|LOCUS_23380 7810 7409 gene locus_tag LOCUS_23390 7810 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 8126 8995 gene locus_tag LOCUS_23400 8126 8995 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_23400 9055 10344 gene locus_tag LOCUS_23410 9055 10344 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_23410 10369 10851 gene locus_tag LOCUS_23420 gene cdd 10369 10851 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_23420 12443 11031 gene locus_tag LOCUS_23430 12443 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 13208 12516 gene locus_tag LOCUS_23440 13208 12516 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_23440 13489 13205 gene locus_tag LOCUS_23450 13489 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 14148 13582 gene locus_tag LOCUS_23460 14148 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 14348 14274 gene locus_tag LOCUS_t00390 14348 14274 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14464 14390 gene locus_tag LOCUS_t00400 14464 14390 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16238 15048 gene locus_tag LOCUS_23470 16238 15048 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_23470 16457 17473 gene locus_tag LOCUS_23480 16457 17473 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_23480 18296 17556 gene locus_tag LOCUS_23490 18296 17556 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_23490 18555 20987 gene locus_tag LOCUS_23500 gene lon 18555 20987 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_23500 20990 22117 gene locus_tag LOCUS_23510 gene tgt 20990 22117 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_23510 22131 23372 gene locus_tag LOCUS_23520 22131 23372 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence56 99 1115 gene locus_tag LOCUS_23530 99 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323439.1 protein_id gnl|my_center|LOCUS_23530 1126 1608 gene locus_tag LOCUS_23540 1126 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1634 2362 gene locus_tag LOCUS_23550 1634 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2422 2796 gene locus_tag LOCUS_23560 2422 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3109 4629 gene locus_tag LOCUS_23570 gene mobV 3109 4629 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323434.1 protein_id gnl|my_center|LOCUS_23570 5946 4888 gene locus_tag LOCUS_23580 5946 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 8698 5999 gene locus_tag LOCUS_23590 8698 5999 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_23590 9628 9975 gene locus_tag LOCUS_23600 9628 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 9975 10934 gene locus_tag LOCUS_23610 9975 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 11223 12572 gene locus_tag LOCUS_23620 11223 12572 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_23620 14640 12838 gene locus_tag LOCUS_23630 14640 12838 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_23630 16114 14633 gene locus_tag LOCUS_23640 16114 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 17931 16630 gene locus_tag LOCUS_23650 17931 16630 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_23650 18583 18089 gene locus_tag LOCUS_23660 18583 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 18685 19917 gene locus_tag LOCUS_23670 18685 19917 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_23670 20376 21029 gene locus_tag LOCUS_23680 20376 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 21054 21842 gene locus_tag LOCUS_23690 21054 21842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 22683 22123 gene locus_tag LOCUS_23700 22683 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence57 1050 154 gene locus_tag LOCUS_23710 gene pyrB 1050 154 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_23710 1307 3547 gene locus_tag LOCUS_23720 1307 3547 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_23720 3722 6190 gene locus_tag LOCUS_23730 gene pheT 3722 6190 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_23730 6230 6973 gene locus_tag LOCUS_23740 6230 6973 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_23740 6979 7257 gene locus_tag LOCUS_23750 6979 7257 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_23750 7920 7534 gene locus_tag LOCUS_23760 7920 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 8023 9816 gene locus_tag LOCUS_23770 gene lepA 8023 9816 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_23770 9857 10456 gene locus_tag LOCUS_23780 9857 10456 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_23780 12206 10542 gene locus_tag LOCUS_23790 12206 10542 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_23790 13985 12318 gene locus_tag LOCUS_23800 13985 12318 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_23800 15375 14128 gene locus_tag LOCUS_23810 15375 14128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_23810 16714 15503 gene locus_tag LOCUS_23820 16714 15503 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_23820 16972 17469 gene locus_tag LOCUS_23830 16972 17469 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_23830 17506 18180 gene locus_tag LOCUS_23840 17506 18180 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_23840 19949 18228 gene locus_tag LOCUS_23850 19949 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 20835 19972 gene locus_tag LOCUS_23860 20835 19972 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_23860 21253 20864 gene locus_tag LOCUS_23870 21253 20864 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_23870 21983 21549 gene locus_tag LOCUS_23880 21983 21549 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766752.1 protein_id gnl|my_center|LOCUS_23880 22873 22322 gene locus_tag LOCUS_23890 22873 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence58 1411 98 gene locus_tag LOCUS_23900 1411 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1721 2674 gene locus_tag LOCUS_23910 1721 2674 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_23910 2937 3542 gene locus_tag LOCUS_23920 2937 3542 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_23920 5270 3606 gene locus_tag LOCUS_23930 5270 3606 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_23930 5463 6152 gene locus_tag LOCUS_23940 5463 6152 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_23940 6526 8775 gene locus_tag LOCUS_23950 gene pflB 6526 8775 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_23950 8942 9583 gene locus_tag LOCUS_23960 gene pflA 8942 9583 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_23960 9963 9580 gene locus_tag LOCUS_23970 9963 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 11263 10007 gene locus_tag LOCUS_23980 11263 10007 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_23980 12669 11353 gene locus_tag LOCUS_23990 12669 11353 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464097.1 protein_id gnl|my_center|LOCUS_23990 14315 12696 gene locus_tag LOCUS_24000 14315 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 15500 14319 gene locus_tag LOCUS_24010 15500 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 16856 15519 gene locus_tag LOCUS_24020 16856 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 19532 17028 gene locus_tag LOCUS_24030 19532 17028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 22142 19674 gene locus_tag LOCUS_24040 22142 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence59 1661 600 gene locus_tag LOCUS_24050 1661 600 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_24050 3325 1787 gene locus_tag LOCUS_24060 3325 1787 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_24060 3663 3403 gene locus_tag LOCUS_24070 3663 3403 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763429.1 protein_id gnl|my_center|LOCUS_24070 3963 4787 gene locus_tag LOCUS_24080 3963 4787 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_24080 4903 5409 gene locus_tag LOCUS_24090 4903 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5435 5620 gene locus_tag LOCUS_24100 5435 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 5642 6070 gene locus_tag LOCUS_24110 5642 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6120 6260 gene locus_tag LOCUS_24120 6120 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6355 6747 gene locus_tag LOCUS_24130 6355 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7750 6731 gene locus_tag LOCUS_24140 7750 6731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796357.1 protein_id gnl|my_center|LOCUS_24140 10359 7957 gene locus_tag LOCUS_24150 10359 7957 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_24150 10668 11036 gene locus_tag LOCUS_24160 10668 11036 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784727.1 protein_id gnl|my_center|LOCUS_24160 11489 11040 gene locus_tag LOCUS_24170 11489 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 11866 12234 gene locus_tag LOCUS_24180 11866 12234 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788387.1 protein_id gnl|my_center|LOCUS_24180 12394 14184 gene locus_tag LOCUS_24190 12394 14184 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_24190 14889 14338 gene locus_tag LOCUS_24200 14889 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 15211 16284 gene locus_tag LOCUS_24210 15211 16284 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108586.1 protein_id gnl|my_center|LOCUS_24210 16428 19259 gene locus_tag LOCUS_24220 16428 19259 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_24220 19293 20681 gene locus_tag LOCUS_24230 19293 20681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence60 7 525 gene locus_tag LOCUS_24240 7 525 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_24240 555 740 gene locus_tag LOCUS_24250 gene rpmF 555 740 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_24250 740 1753 gene locus_tag LOCUS_24260 740 1753 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_24260 1899 2780 gene locus_tag LOCUS_24270 gene era 1899 2780 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_24270 3014 4327 gene locus_tag LOCUS_24280 gene der 3014 4327 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_24280 4367 4765 gene locus_tag LOCUS_24290 4367 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 5610 4837 gene locus_tag LOCUS_24300 5610 4837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_24300 6360 5614 gene locus_tag LOCUS_24310 6360 5614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_24310 6494 7318 gene locus_tag LOCUS_24320 gene lptB 6494 7318 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_24320 7451 8809 gene locus_tag LOCUS_24330 gene tig 7451 8809 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_24330 8944 9606 gene locus_tag LOCUS_24340 gene clpP 8944 9606 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_24340 9723 10901 gene locus_tag LOCUS_24350 gene clpX 9723 10901 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_24350 10978 13158 gene locus_tag LOCUS_24360 gene recQ 10978 13158 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_24360 13292 14746 gene locus_tag LOCUS_24370 gene guaB 13292 14746 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_24370 14761 15765 gene locus_tag LOCUS_24380 14761 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 15809 17239 gene locus_tag LOCUS_24390 15809 17239 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_24390 17329 18891 gene locus_tag LOCUS_24400 17329 18891 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_24400 18934 20805 gene locus_tag LOCUS_24410 gene mutL 18934 20805 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_24410 21008 22129 gene locus_tag LOCUS_24420 21008 22129 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760698.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence61 1178 69 gene locus_tag LOCUS_24430 gene mcrC 1178 69 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 protein_id gnl|my_center|LOCUS_24430 2376 1180 gene locus_tag LOCUS_24440 2376 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2552 2785 gene locus_tag LOCUS_24450 2552 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2782 3060 gene locus_tag LOCUS_24460 2782 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4926 3160 gene locus_tag LOCUS_24470 4926 3160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_24470 6572 5292 gene locus_tag LOCUS_24480 6572 5292 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444660.1 protein_id gnl|my_center|LOCUS_24480 9751 6593 gene locus_tag LOCUS_24490 9751 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11023 9803 gene locus_tag LOCUS_24500 11023 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11301 11549 gene locus_tag LOCUS_24510 11301 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 11802 13844 gene locus_tag LOCUS_24520 11802 13844 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_24520 14100 13789 gene locus_tag LOCUS_24530 14100 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 15832 14234 gene locus_tag LOCUS_24540 15832 14234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_24540 16922 15930 gene locus_tag LOCUS_24550 16922 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 17196 18068 gene locus_tag LOCUS_24560 gene prmA 17196 18068 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_24560 18966 18178 gene locus_tag LOCUS_24570 18966 18178 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766156.1 protein_id gnl|my_center|LOCUS_24570 20745 19096 gene locus_tag LOCUS_24580 20745 19096 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence62 43 1029 gene locus_tag LOCUS_24590 43 1029 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_24590 1144 2094 gene locus_tag LOCUS_24600 1144 2094 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_24600 2106 2840 gene locus_tag LOCUS_24610 gene ubiE 2106 2840 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_24610 2853 3599 gene locus_tag LOCUS_24620 2853 3599 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_24620 3641 4807 gene locus_tag LOCUS_24630 3641 4807 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_24630 4825 5934 gene locus_tag LOCUS_24640 gene prfA 4825 5934 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_24640 5990 6832 gene locus_tag LOCUS_24650 gene pyrF 5990 6832 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_24650 7035 8069 gene locus_tag LOCUS_24660 gene lpxD 7035 8069 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_24660 8083 9465 gene locus_tag LOCUS_24670 8083 9465 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_24670 9481 10251 gene locus_tag LOCUS_24680 gene lpxA 9481 10251 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_24680 10351 11253 gene locus_tag LOCUS_24690 gene miaA 10351 11253 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_24690 12256 11546 gene locus_tag LOCUS_24700 12256 11546 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763963.1 protein_id gnl|my_center|LOCUS_24700 12499 14745 gene locus_tag LOCUS_24710 12499 14745 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_24710 15080 15772 gene locus_tag LOCUS_24720 15080 15772 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_24720 15813 16268 gene locus_tag LOCUS_24730 gene queF 15813 16268 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_24730 17156 16335 gene locus_tag LOCUS_24740 gene menB 17156 16335 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_24740 19068 17260 gene locus_tag LOCUS_24750 gene menD 19068 17260 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786027.1 protein_id gnl|my_center|LOCUS_24750 20355 19177 gene locus_tag LOCUS_24760 20355 19177 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_24760 20799 20359 gene locus_tag LOCUS_24770 20799 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence63 768 121 gene locus_tag LOCUS_24780 768 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2783 957 gene locus_tag LOCUS_24790 2783 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203476.1 protein_id gnl|my_center|LOCUS_24790 3698 2805 gene locus_tag LOCUS_24800 3698 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4708 3803 gene locus_tag LOCUS_24810 4708 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 5618 4869 gene locus_tag LOCUS_24820 5618 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6265 8430 gene locus_tag LOCUS_24830 6265 8430 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_24830 10019 8493 gene locus_tag LOCUS_24840 10019 8493 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_24840 10022 10031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10331 11206 gene locus_tag LOCUS_24850 10331 11206 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_24850 12059 11385 gene locus_tag LOCUS_24860 12059 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 13540 12182 gene locus_tag LOCUS_24870 13540 12182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_24870 14352 13621 gene locus_tag LOCUS_24880 14352 13621 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_24880 15806 14424 gene locus_tag LOCUS_24890 15806 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 15974 16366 gene locus_tag LOCUS_24900 15974 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 16394 19234 gene locus_tag LOCUS_24910 gene uvrA 16394 19234 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_24910 19346 19549 gene locus_tag LOCUS_24920 19346 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 19903 19754 gene locus_tag LOCUS_24930 19903 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence64 1804 146 gene locus_tag LOCUS_24940 1804 146 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_24940 1982 3514 gene locus_tag LOCUS_24950 1982 3514 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_24950 3553 4044 gene locus_tag LOCUS_24960 3553 4044 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_24960 4054 4665 gene locus_tag LOCUS_24970 gene recR 4054 4665 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_24970 4680 5114 gene locus_tag LOCUS_24980 4680 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 5145 6257 gene locus_tag LOCUS_24990 5145 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 6320 6829 gene locus_tag LOCUS_25000 6320 6829 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001631030.1 protein_id gnl|my_center|LOCUS_25000 6929 7003 gene locus_tag LOCUS_t00410 6929 7003 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7039 7113 gene locus_tag LOCUS_t00420 7039 7113 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7171 8607 gene locus_tag LOCUS_25010 7171 8607 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_25010 8607 10634 gene locus_tag LOCUS_25020 8607 10634 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_25020 11611 10694 gene locus_tag LOCUS_25030 11611 10694 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_25030 12422 11679 gene locus_tag LOCUS_25040 gene truA 12422 11679 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_25040 12646 13533 gene locus_tag LOCUS_25050 gene dapA 12646 13533 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_25050 13565 14452 gene locus_tag LOCUS_25060 13565 14452 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_25060 14590 15993 gene locus_tag LOCUS_25070 gene uxaC 14590 15993 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_25070 16099 17418 gene locus_tag LOCUS_25080 16099 17418 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_25080 18074 17478 gene locus_tag LOCUS_25090 18074 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 18256 19155 gene locus_tag LOCUS_25100 18256 19155 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence65 4483 482 gene locus_tag LOCUS_25110 4483 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 5925 4717 gene locus_tag LOCUS_25120 5925 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 6324 6935 gene locus_tag LOCUS_25130 6324 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 7004 7690 gene locus_tag LOCUS_25140 7004 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 8852 7776 gene locus_tag LOCUS_25150 8852 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 9285 9034 gene locus_tag LOCUS_25160 9285 9034 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_25160 9918 10017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11580 10186 gene locus_tag LOCUS_25170 11580 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 12845 11625 gene locus_tag LOCUS_25180 12845 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 15658 13058 gene locus_tag LOCUS_25190 15658 13058 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_25190 16153 17223 gene locus_tag LOCUS_25200 16153 17223 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_25200 17441 17917 gene locus_tag LOCUS_25210 17441 17917 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_25210 17932 18555 gene locus_tag LOCUS_25220 gene udk 17932 18555 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence66 103 2481 gene locus_tag LOCUS_25230 103 2481 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_25230 2672 3139 gene locus_tag LOCUS_25240 2672 3139 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_25240 3208 4956 gene locus_tag LOCUS_25250 3208 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 5045 6073 gene locus_tag LOCUS_25260 5045 6073 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_25260 6998 6360 gene locus_tag LOCUS_25270 6998 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 7445 9307 gene locus_tag LOCUS_25280 7445 9307 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_25280 9433 10362 gene locus_tag LOCUS_25290 9433 10362 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_25290 12197 10491 gene locus_tag LOCUS_25300 12197 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 12339 14300 gene locus_tag LOCUS_25310 12339 14300 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712488.1 protein_id gnl|my_center|LOCUS_25310 14454 15599 gene locus_tag LOCUS_25320 14454 15599 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_25320 16986 15688 gene locus_tag LOCUS_25330 16986 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence67 3293 87 gene locus_tag LOCUS_25340 3293 87 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_25340 6898 3566 gene locus_tag LOCUS_25350 6898 3566 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_25350 8377 7178 gene locus_tag LOCUS_25360 8377 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_25360 9018 8374 gene locus_tag LOCUS_25370 9018 8374 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_25370 10434 9061 gene locus_tag LOCUS_25380 10434 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 11270 10515 gene locus_tag LOCUS_25390 11270 10515 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_25390 11894 11331 gene locus_tag LOCUS_25400 11894 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 13283 11982 gene locus_tag LOCUS_25410 13283 11982 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_25410 13457 13984 gene locus_tag LOCUS_25420 13457 13984 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_25420 14015 14587 gene locus_tag LOCUS_25430 14015 14587 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_25430 15441 14794 gene locus_tag LOCUS_25440 15441 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence68 101 655 gene locus_tag LOCUS_25450 101 655 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_25450 2257 896 gene locus_tag LOCUS_25460 2257 896 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_25460 5964 2674 gene locus_tag LOCUS_25470 gene mfd 5964 2674 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_25470 6130 6229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6986 6246 gene locus_tag LOCUS_25480 6986 6246 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_25480 7743 7081 gene locus_tag LOCUS_25490 7743 7081 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760542.1 protein_id gnl|my_center|LOCUS_25490 8951 7893 gene locus_tag LOCUS_25500 8951 7893 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_25500 9928 9107 gene locus_tag LOCUS_25510 9928 9107 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_25510 11307 9973 gene locus_tag LOCUS_25520 11307 9973 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_25520 12168 11377 gene locus_tag LOCUS_25530 12168 11377 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766210.1 protein_id gnl|my_center|LOCUS_25530 12774 12349 gene locus_tag LOCUS_25540 12774 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815012.1 protein_id gnl|my_center|LOCUS_25540 13105 12758 gene locus_tag LOCUS_25550 13105 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 13174 15087 gene locus_tag LOCUS_25560 13174 15087 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence69 68 1321 gene locus_tag LOCUS_25570 68 1321 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_25570 1475 1942 gene locus_tag LOCUS_25580 1475 1942 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_25580 1946 2782 gene locus_tag LOCUS_25590 gene djlA 1946 2782 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417332.1 protein_id gnl|my_center|LOCUS_25590 3720 2893 gene locus_tag LOCUS_25600 3720 2893 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_25600 4542 3802 gene locus_tag LOCUS_25610 4542 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 4870 6000 gene locus_tag LOCUS_25620 4870 6000 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_25620 6023 6898 gene locus_tag LOCUS_25630 6023 6898 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_25630 7097 8005 gene locus_tag LOCUS_25640 7097 8005 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_25640 10598 8142 gene locus_tag LOCUS_25650 10598 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 10875 12632 gene locus_tag LOCUS_25660 10875 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 12900 13652 gene locus_tag LOCUS_25670 12900 13652 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_25670 14525 13953 gene locus_tag LOCUS_25680 14525 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence70 227 1126 gene locus_tag LOCUS_25690 227 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1292 2800 gene locus_tag LOCUS_25700 1292 2800 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_25700 2923 3906 gene locus_tag LOCUS_25710 2923 3906 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_25710 3912 5075 gene locus_tag LOCUS_25720 3912 5075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_25720 5075 6337 gene locus_tag LOCUS_25730 5075 6337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_25730 7563 6460 gene locus_tag LOCUS_25740 7563 6460 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_25740 7731 9863 gene locus_tag LOCUS_25750 7731 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 10827 11453 gene locus_tag LOCUS_25760 10827 11453 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_25760 11761 12507 gene locus_tag LOCUS_25770 11761 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 13704 12916 gene locus_tag LOCUS_25780 13704 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303091.1 protein_id gnl|my_center|LOCUS_25780 14483 13704 gene locus_tag LOCUS_25790 14483 13704 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108662.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence71 1514 324 gene locus_tag LOCUS_25800 1514 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3757 1520 gene locus_tag LOCUS_25810 3757 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5890 3797 gene locus_tag LOCUS_25820 5890 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 7004 5892 gene locus_tag LOCUS_25830 7004 5892 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 protein_id gnl|my_center|LOCUS_25830 7287 7009 gene locus_tag LOCUS_25840 7287 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 7746 7889 gene locus_tag LOCUS_25850 7746 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 7949 8107 gene locus_tag LOCUS_25860 7949 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 8253 8690 gene locus_tag LOCUS_25870 8253 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 8921 9079 gene locus_tag LOCUS_25880 8921 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 9061 9456 gene locus_tag LOCUS_25890 9061 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 9738 12320 gene locus_tag LOCUS_25900 9738 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 12335 12895 gene locus_tag LOCUS_25910 12335 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 13076 14026 gene locus_tag LOCUS_25920 13076 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence72 155 2686 gene locus_tag LOCUS_25930 gene feoB 155 2686 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_25930 4144 2963 gene locus_tag LOCUS_25940 4144 2963 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_25940 4304 5170 gene locus_tag LOCUS_25950 4304 5170 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_25950 6446 5676 gene locus_tag LOCUS_25960 6446 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25960 7919 6480 gene locus_tag LOCUS_25970 7919 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25970 9739 7925 gene locus_tag LOCUS_25980 9739 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 10764 9745 gene locus_tag LOCUS_25990 10764 9745 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_25990 11662 11408 gene locus_tag LOCUS_26000 11662 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 12081 12935 gene locus_tag LOCUS_26010 12081 12935 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 protein_id gnl|my_center|LOCUS_26010 13362 13075 gene locus_tag LOCUS_26020 13362 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence73 673 1047 gene locus_tag LOCUS_26030 673 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1112 1693 gene locus_tag LOCUS_26040 1112 1693 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323418.1 protein_id gnl|my_center|LOCUS_26040 1690 2187 gene locus_tag LOCUS_26050 1690 2187 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_26050 3110 2367 gene locus_tag LOCUS_26060 3110 2367 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_26060 3240 4172 gene locus_tag LOCUS_26070 3240 4172 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_26070 4290 5132 gene locus_tag LOCUS_26080 4290 5132 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_26080 5846 5406 gene locus_tag LOCUS_26090 5846 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 6613 5963 gene locus_tag LOCUS_26100 6613 5963 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_26100 7312 6689 gene locus_tag LOCUS_26110 7312 6689 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_26110 8206 7376 gene locus_tag LOCUS_26120 8206 7376 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_26120 8829 8203 gene locus_tag LOCUS_26130 8829 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 9853 9113 gene locus_tag LOCUS_26140 9853 9113 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640660.1 protein_id gnl|my_center|LOCUS_26140 10099 9854 gene locus_tag LOCUS_26150 10099 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 10503 10126 gene locus_tag LOCUS_26160 10503 10126 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_26160 10827 10528 gene locus_tag LOCUS_26170 gene trxA 10827 10528 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_26170 11579 10830 gene locus_tag LOCUS_26180 11579 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence74 1094 1507 gene locus_tag LOCUS_26190 1094 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1689 1615 gene locus_tag LOCUS_t00430 1689 1615 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1767 1694 gene locus_tag LOCUS_t00440 1767 1694 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1844 1773 gene locus_tag LOCUS_t00450 1844 1773 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1929 1858 gene locus_tag LOCUS_t00460 1929 1858 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2018 1936 gene locus_tag LOCUS_t00470 2018 1936 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2100 2027 gene locus_tag LOCUS_t00480 2100 2027 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2180 2109 gene locus_tag LOCUS_t00490 2180 2109 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2272 2186 gene locus_tag LOCUS_t00500 2272 2186 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2354 2279 gene locus_tag LOCUS_t00510 2354 2279 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2445 2360 gene locus_tag LOCUS_t00520 2445 2360 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3465 2791 gene locus_tag LOCUS_26200 3465 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4262 3927 gene locus_tag LOCUS_26210 4262 3927 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005820814.1 protein_id gnl|my_center|LOCUS_26210 4597 4259 gene locus_tag LOCUS_26220 4597 4259 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_26220 5394 4888 gene locus_tag LOCUS_26230 5394 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5855 5511 gene locus_tag LOCUS_26240 5855 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 6613 5861 gene locus_tag LOCUS_26250 6613 5861 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_26250 7123 6773 gene locus_tag LOCUS_26260 7123 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 7935 7558 gene locus_tag LOCUS_26270 7935 7558 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_26270 9099 10421 gene locus_tag LOCUS_26280 9099 10421 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_26280 10601 12043 gene locus_tag LOCUS_26290 10601 12043 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence75 175 1569 gene locus_tag LOCUS_26300 175 1569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_26300 1672 2721 gene locus_tag LOCUS_26310 gene gutB 1672 2721 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_26310 2890 3774 gene locus_tag LOCUS_26320 2890 3774 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_26320 3898 4632 gene locus_tag LOCUS_26330 3898 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4688 5077 gene locus_tag LOCUS_26340 4688 5077 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_26340 5592 5260 gene locus_tag LOCUS_26350 5592 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 6231 5683 gene locus_tag LOCUS_26360 6231 5683 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791456.1 protein_id gnl|my_center|LOCUS_26360 7274 6483 gene locus_tag LOCUS_26370 7274 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 7586 8047 gene locus_tag LOCUS_26380 gene bcp 7586 8047 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_26380 8078 8584 gene locus_tag LOCUS_26390 8078 8584 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_26390 9165 8620 gene locus_tag LOCUS_26400 9165 8620 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_26400 9922 9206 gene locus_tag LOCUS_26410 9922 9206 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_26410 10083 10835 gene locus_tag LOCUS_26420 gene yaaA 10083 10835 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109003.1 protein_id gnl|my_center|LOCUS_26420 11169 10990 gene locus_tag LOCUS_26430 11169 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 11912 11250 gene locus_tag LOCUS_26440 11912 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence76 3097 377 gene locus_tag LOCUS_26450 gene ppdK 3097 377 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_26450 3888 5339 gene locus_tag LOCUS_26460 gene rlmD 3888 5339 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_26460 5365 6555 gene locus_tag LOCUS_26470 5365 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 7908 6625 gene locus_tag LOCUS_26480 7908 6625 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_26480 8047 9651 gene locus_tag LOCUS_26490 8047 9651 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_26490 9707 11644 gene locus_tag LOCUS_26500 gene yidC 9707 11644 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence77 1178 18 gene locus_tag LOCUS_26510 gene galK 1178 18 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_26510 2600 1275 gene locus_tag LOCUS_26520 2600 1275 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_26520 3937 2852 gene locus_tag LOCUS_26530 3937 2852 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_26530 5287 4049 gene locus_tag LOCUS_26540 5287 4049 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_26540 6551 5388 gene locus_tag LOCUS_26550 gene dnaJ 6551 5388 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_26550 7277 6636 gene locus_tag LOCUS_26560 7277 6636 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_26560 9014 7398 gene locus_tag LOCUS_26570 9014 7398 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_26570 9245 10192 gene locus_tag LOCUS_26580 9245 10192 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence78 2179 110 gene locus_tag LOCUS_26590 2179 110 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_26590 2463 4067 gene locus_tag LOCUS_26600 2463 4067 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764305.1 protein_id gnl|my_center|LOCUS_26600 4151 4354 gene locus_tag LOCUS_26610 4151 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 5095 4427 gene locus_tag LOCUS_26620 5095 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 5902 5210 gene locus_tag LOCUS_26630 5902 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 6212 7120 gene locus_tag LOCUS_26640 6212 7120 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_26640 7482 8618 gene locus_tag LOCUS_26650 7482 8618 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_26650 8674 9297 gene locus_tag LOCUS_26660 8674 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 10146 9373 gene locus_tag LOCUS_26670 10146 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence79 1358 156 gene locus_tag LOCUS_26680 1358 156 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_26680 2582 1374 gene locus_tag LOCUS_26690 2582 1374 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_26690 3725 2616 gene locus_tag LOCUS_26700 gene gmd 3725 2616 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_26700 4515 3790 gene locus_tag LOCUS_26710 4515 3790 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_26710 5995 4640 gene locus_tag LOCUS_26720 5995 4640 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_26720 7078 6080 gene locus_tag LOCUS_26730 7078 6080 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_26730 8933 7203 gene locus_tag LOCUS_26740 gene lysS 8933 7203 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence80 537 2891 gene locus_tag LOCUS_26750 537 2891 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202740.1 protein_id gnl|my_center|LOCUS_26750 2891 3838 gene locus_tag LOCUS_26760 2891 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 3851 4714 gene locus_tag LOCUS_26770 3851 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_26770 4707 5582 gene locus_tag LOCUS_26780 4707 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794270.1 protein_id gnl|my_center|LOCUS_26780 5608 7071 gene locus_tag LOCUS_26790 5608 7071 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence81 1251 286 gene locus_tag LOCUS_26800 1251 286 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_26800 2163 1288 gene locus_tag LOCUS_26810 2163 1288 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_26810 2850 2248 gene locus_tag LOCUS_26820 2850 2248 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_26820 3025 3723 gene locus_tag LOCUS_26830 3025 3723 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_26830 5552 3831 gene locus_tag LOCUS_26840 5552 3831 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_26840 5879 8176 gene locus_tag LOCUS_26850 gene rnr 5879 8176 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence82 2916 76 gene locus_tag LOCUS_26860 2916 76 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_26860 3493 2957 gene locus_tag LOCUS_26870 3493 2957 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_26870 5280 3505 gene locus_tag LOCUS_26880 5280 3505 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_26880 5317 5326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6144 5377 gene locus_tag LOCUS_26890 6144 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6605 7723 gene locus_tag LOCUS_26900 6605 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence83 <1 1669 gene locus_tag LOCUS_26910 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107693.1:glycogen/starch synthase 1775 4333 gene locus_tag LOCUS_26920 1775 4333 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_26920 5493 4555 gene locus_tag LOCUS_26930 5493 4555 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_26930 6170 5577 gene locus_tag LOCUS_26940 6170 5577 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_26940 6294 7469 gene locus_tag LOCUS_26950 gene nspC 6294 7469 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence84 116 1045 gene locus_tag LOCUS_26960 116 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1313 2494 gene locus_tag LOCUS_26970 1313 2494 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_26970 2491 3600 gene locus_tag LOCUS_26980 2491 3600 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_26980 3646 4506 gene locus_tag LOCUS_26990 3646 4506 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_26990 4614 5564 gene locus_tag LOCUS_27000 4614 5564 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_27000 5616 6422 gene locus_tag LOCUS_27010 5616 6422 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291581.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence85 56 262 gene locus_tag LOCUS_27020 56 262 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_27020 414 782 gene locus_tag LOCUS_27030 414 782 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_27030 786 1727 gene locus_tag LOCUS_27040 786 1727 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_27040 3322 1859 gene locus_tag LOCUS_27050 3322 1859 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_27050 5559 3421 gene locus_tag LOCUS_27060 5559 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 5780 7063 gene locus_tag LOCUS_27070 5780 7063 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence86 113 188 gene locus_tag LOCUS_t00530 113 188 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 317 1663 gene locus_tag LOCUS_27080 gene purB 317 1663 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_27080 1760 3193 gene locus_tag LOCUS_27090 1760 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3349 4776 gene locus_tag LOCUS_27100 gene asnS 3349 4776 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_27100 6937 6188 gene locus_tag LOCUS_27110 6937 6188 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence87 238 1113 gene locus_tag LOCUS_27120 238 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3513 1258 gene locus_tag LOCUS_27130 3513 1258 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_27130 4898 3675 gene locus_tag LOCUS_27140 gene pepT 4898 3675 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_27140 5006 4931 gene locus_tag LOCUS_t00540 5006 4931 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5264 6301 gene locus_tag LOCUS_27150 gene asnA 5264 6301 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence88 59 1786 gene locus_tag LOCUS_27160 59 1786 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_27160 2028 3398 gene locus_tag LOCUS_27170 gene nhaD 2028 3398 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_27170 5631 3745 gene locus_tag LOCUS_27180 5631 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 6339 5884 gene locus_tag LOCUS_27190 6339 5884 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760274.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence89 216 827 gene locus_tag LOCUS_27200 216 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 853 2316 gene locus_tag LOCUS_27210 853 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2334 3140 gene locus_tag LOCUS_27220 2334 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3165 5327 gene locus_tag LOCUS_27230 3165 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 5445 6353 gene locus_tag LOCUS_27240 5445 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence90 846 1331 gene locus_tag LOCUS_27250 846 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 1328 2176 gene locus_tag LOCUS_27260 1328 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 3080 4012 gene locus_tag LOCUS_27270 3080 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence91 <1 1982 gene locus_tag LOCUS_27280 <1 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403216.1:TonB-dependent receptor 2045 3574 gene locus_tag LOCUS_27290 2045 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3977 5026 gene locus_tag LOCUS_27300 3977 5026 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence92 101 1861 gene locus_tag LOCUS_27310 101 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1899 3197 gene locus_tag LOCUS_27320 1899 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3417 4751 gene locus_tag LOCUS_27330 3417 4751 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790434.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence93 1249 851 gene locus_tag LOCUS_27340 1249 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1639 1358 gene locus_tag LOCUS_27350 1639 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2073 1783 gene locus_tag LOCUS_27360 2073 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3086 2298 gene locus_tag LOCUS_27370 3086 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4143 3130 gene locus_tag LOCUS_27380 4143 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence94 1869 811 gene locus_tag LOCUS_27390 1869 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2338 3090 gene locus_tag LOCUS_27400 2338 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence95 1895 60 gene locus_tag LOCUS_27410 1895 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2584 2132 gene locus_tag LOCUS_27420 2584 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence96 1214 207 gene locus_tag LOCUS_27430 1214 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2103 1216 gene locus_tag LOCUS_27440 2103 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440