>Feature sequence01 792 574 gene locus_tag LOCUS_00010 792 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1250 1549 gene locus_tag LOCUS_00020 1250 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1564 1971 gene locus_tag LOCUS_00030 1564 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1965 2189 gene locus_tag LOCUS_00040 1965 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2399 3166 gene locus_tag LOCUS_00050 gene sigG 2399 3166 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_00050 3743 3174 gene locus_tag LOCUS_00060 3743 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4671 3703 gene locus_tag LOCUS_00070 4671 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6971 4671 gene locus_tag LOCUS_00080 gene spoIIE 6971 4671 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_00080 7204 8424 gene locus_tag LOCUS_00090 7204 8424 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_00090 8430 9101 gene locus_tag LOCUS_00100 8430 9101 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_00100 10065 9196 gene locus_tag LOCUS_00110 10065 9196 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_00110 10964 10062 gene locus_tag LOCUS_00120 gene sdaAA 10964 10062 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489453.1 protein_id gnl|my_center|LOCUS_00120 11638 10976 gene locus_tag LOCUS_00130 gene sdaAB 11638 10976 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 protein_id gnl|my_center|LOCUS_00130 12824 12195 gene locus_tag LOCUS_00140 12824 12195 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_00140 14204 12828 gene locus_tag LOCUS_00150 14204 12828 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_00150 15966 14197 gene locus_tag LOCUS_00160 15966 14197 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_00160 16303 15986 gene locus_tag LOCUS_00170 16303 15986 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_00170 17285 16296 gene locus_tag LOCUS_00180 17285 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17882 17301 gene locus_tag LOCUS_00190 17882 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18391 17909 gene locus_tag LOCUS_00200 18391 17909 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_00200 20346 18421 gene locus_tag LOCUS_00210 20346 18421 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_00210 20657 20343 gene locus_tag LOCUS_00220 20657 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21305 20676 gene locus_tag LOCUS_00230 gene upp 21305 20676 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966163.1 protein_id gnl|my_center|LOCUS_00230 21760 21305 gene locus_tag LOCUS_00240 gene rpiB 21760 21305 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869538.1 protein_id gnl|my_center|LOCUS_00240 22826 21786 gene locus_tag LOCUS_00250 22826 21786 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_00250 23902 22823 gene locus_tag LOCUS_00260 gene prfA 23902 22823 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_00260 25263 23887 gene locus_tag LOCUS_00270 25263 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26075 25260 gene locus_tag LOCUS_00280 26075 25260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27100 26072 gene locus_tag LOCUS_00290 27100 26072 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_00290 27400 27203 gene locus_tag LOCUS_00300 gene rpmE 27400 27203 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_00300 29365 27494 gene locus_tag LOCUS_00310 29365 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29637 29933 gene locus_tag LOCUS_00320 29637 29933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29935 30219 gene locus_tag LOCUS_00330 29935 30219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30327 30617 gene locus_tag LOCUS_00340 30327 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30628 31497 gene locus_tag LOCUS_00350 30628 31497 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_00350 32991 31609 gene locus_tag LOCUS_00360 32991 31609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 34471 32978 gene locus_tag LOCUS_00370 34471 32978 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_00370 35161 34484 gene locus_tag LOCUS_00380 35161 34484 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_00380 37651 35297 gene locus_tag LOCUS_00390 37651 35297 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_00390 38898 37723 gene locus_tag LOCUS_00400 38898 37723 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_00400 39286 39092 gene locus_tag LOCUS_00410 39286 39092 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_00410 39518 39327 gene locus_tag LOCUS_00420 39518 39327 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_00420 41797 39791 gene locus_tag LOCUS_00430 gene recG 41797 39791 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_00430 43510 41876 gene locus_tag LOCUS_00440 43510 41876 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_00440 43900 43547 gene locus_tag LOCUS_00450 43900 43547 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_00450 44725 43982 gene locus_tag LOCUS_00460 44725 43982 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_00460 45567 44899 gene locus_tag LOCUS_00470 gene nagB 45567 44899 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_00470 46502 45564 gene locus_tag LOCUS_00480 46502 45564 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_00480 47193 46636 gene locus_tag LOCUS_00490 47193 46636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_00490 47941 47180 gene locus_tag LOCUS_00500 47941 47180 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_00500 48878 47925 gene locus_tag LOCUS_00510 48878 47925 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_00510 49575 48880 gene locus_tag LOCUS_00520 49575 48880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 49670 50431 gene locus_tag LOCUS_00530 49670 50431 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_00530 50428 51030 gene locus_tag LOCUS_00540 50428 51030 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_00540 51027 52883 gene locus_tag LOCUS_00550 gene uvrC 51027 52883 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_00550 53563 53009 gene locus_tag LOCUS_00560 gene scpB 53563 53009 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_00560 54367 53570 gene locus_tag LOCUS_00570 54367 53570 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_00570 55035 54379 gene locus_tag LOCUS_00580 55035 54379 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965916.1 protein_id gnl|my_center|LOCUS_00580 56249 55107 gene locus_tag LOCUS_00590 56249 55107 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_00590 59190 56392 gene locus_tag LOCUS_00600 59190 56392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60323 59430 gene locus_tag LOCUS_00610 60323 59430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_00610 61234 60320 gene locus_tag LOCUS_00620 61234 60320 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_00620 62119 61739 gene locus_tag LOCUS_00630 62119 61739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62773 62306 gene locus_tag LOCUS_00640 62773 62306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 63020 62850 gene locus_tag LOCUS_00650 63020 62850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64788 63211 gene locus_tag LOCUS_00660 64788 63211 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_00660 65598 64888 gene locus_tag LOCUS_00670 65598 64888 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_00670 65801 67108 gene locus_tag LOCUS_00680 65801 67108 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393140.1 protein_id gnl|my_center|LOCUS_00680 67179 68615 gene locus_tag LOCUS_00690 67179 68615 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_00690 68612 69139 gene locus_tag LOCUS_00700 68612 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 69147 69716 gene locus_tag LOCUS_00710 69147 69716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 71280 69808 gene locus_tag LOCUS_00720 71280 69808 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_00720 72506 71370 gene locus_tag LOCUS_00730 72506 71370 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_00730 72568 73389 gene locus_tag LOCUS_00740 72568 73389 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_00740 73861 73394 gene locus_tag LOCUS_00750 73861 73394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 73936 75363 gene locus_tag LOCUS_00760 73936 75363 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_00760 75366 76202 gene locus_tag LOCUS_00770 75366 76202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 77012 76320 gene locus_tag LOCUS_00780 77012 76320 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_00780 78622 77009 gene locus_tag LOCUS_00790 78622 77009 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_00790 79751 78732 gene locus_tag LOCUS_00800 79751 78732 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_00800 79936 80904 gene locus_tag LOCUS_00810 79936 80904 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_00810 81219 82247 gene locus_tag LOCUS_00820 gene pheS 81219 82247 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_00820 82263 84659 gene locus_tag LOCUS_00830 gene pheT 82263 84659 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_00830 84663 85139 gene locus_tag LOCUS_00840 84663 85139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 85201 85737 gene locus_tag LOCUS_00850 85201 85737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 85837 86325 gene locus_tag LOCUS_00860 85837 86325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 87817 86339 gene locus_tag LOCUS_00870 gene malQ 87817 86339 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_00870 87879 89468 gene locus_tag LOCUS_00880 87879 89468 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_00880 89465 90346 gene locus_tag LOCUS_00890 89465 90346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 90383 91330 gene locus_tag LOCUS_00900 90383 91330 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_00900 91501 92526 gene locus_tag LOCUS_00910 91501 92526 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_00910 92528 93010 gene locus_tag LOCUS_00920 gene moaC 92528 93010 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_00920 93007 93966 gene locus_tag LOCUS_00930 gene moaA 93007 93966 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 protein_id gnl|my_center|LOCUS_00930 93971 94900 gene locus_tag LOCUS_00940 93971 94900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 94986 95888 gene locus_tag LOCUS_00950 gene modA 94986 95888 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_00950 95962 96630 gene locus_tag LOCUS_00960 gene modB 95962 96630 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_00960 96627 97694 gene locus_tag LOCUS_00970 96627 97694 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_00970 97713 98279 gene locus_tag LOCUS_00980 97713 98279 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_00980 99375 98350 gene locus_tag LOCUS_00990 99375 98350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 99878 99390 gene locus_tag LOCUS_01000 gene coaD 99878 99390 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_01000 100435 99875 gene locus_tag LOCUS_01010 gene rsmD 100435 99875 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_01010 101783 100542 gene locus_tag LOCUS_01020 101783 100542 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_01020 102713 102159 gene locus_tag LOCUS_01030 102713 102159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 102819 104720 gene locus_tag LOCUS_01040 102819 104720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 105372 104704 gene locus_tag LOCUS_01050 105372 104704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 107566 105365 gene locus_tag LOCUS_01060 107566 105365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 108219 107572 gene locus_tag LOCUS_01070 108219 107572 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_01070 109445 108216 gene locus_tag LOCUS_01080 gene tyrS 109445 108216 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_01080 111332 109575 gene locus_tag LOCUS_01090 111332 109575 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_01090 112114 111329 gene locus_tag LOCUS_01100 112114 111329 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_01100 113033 112137 gene locus_tag LOCUS_01110 113033 112137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 113698 113153 gene locus_tag LOCUS_01120 113698 113153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_01120 114269 113685 gene locus_tag LOCUS_01130 114269 113685 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108270.1 protein_id gnl|my_center|LOCUS_01130 117057 114469 gene locus_tag LOCUS_01140 gene clpB 117057 114469 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_01140 117721 117074 gene locus_tag LOCUS_01150 117721 117074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 118471 117845 gene locus_tag LOCUS_01160 gene pnuC 118471 117845 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_01160 121129 118733 gene locus_tag LOCUS_01170 121129 118733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 121342 122418 gene locus_tag LOCUS_01180 121342 122418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 122509 123186 gene locus_tag LOCUS_01190 122509 123186 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_01190 125837 123261 gene locus_tag LOCUS_01200 125837 123261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 126357 125986 gene locus_tag LOCUS_01210 126357 125986 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350529.1 protein_id gnl|my_center|LOCUS_01210 127559 126447 gene locus_tag LOCUS_01220 gene mtnA 127559 126447 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_01220 127744 128385 gene locus_tag LOCUS_01230 127744 128385 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_01230 128411 129427 gene locus_tag LOCUS_01240 128411 129427 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_01240 130676 129537 gene locus_tag LOCUS_01250 130676 129537 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_01250 131521 130703 gene locus_tag LOCUS_01260 131521 130703 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_01260 132795 131653 gene locus_tag LOCUS_01270 gene metK 132795 131653 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_01270 133042 132773 gene locus_tag LOCUS_01280 133042 132773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 133350 133886 gene locus_tag LOCUS_01290 133350 133886 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_01290 133920 135305 gene locus_tag LOCUS_01300 gene potA 133920 135305 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_01300 135317 136129 gene locus_tag LOCUS_01310 135317 136129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_01310 136126 136983 gene locus_tag LOCUS_01320 136126 136983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_01320 136998 138083 gene locus_tag LOCUS_01330 136998 138083 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_01330 138226 139152 gene locus_tag LOCUS_01340 138226 139152 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_01340 139097 139474 gene locus_tag LOCUS_01350 139097 139474 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_01350 141223 139544 gene locus_tag LOCUS_01360 141223 139544 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_01360 144916 141350 gene locus_tag LOCUS_01370 gene nifJ 144916 141350 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_01370 146263 145031 gene locus_tag LOCUS_01380 146263 145031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 146632 147207 gene locus_tag LOCUS_01390 146632 147207 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_01390 147204 147773 gene locus_tag LOCUS_01400 147204 147773 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_01400 148759 147833 gene locus_tag LOCUS_01410 gene arcC 148759 147833 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986908.1 protein_id gnl|my_center|LOCUS_01410 150090 148882 gene locus_tag LOCUS_01420 150090 148882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 150721 150542 gene locus_tag LOCUS_01430 150721 150542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 151739 150948 gene locus_tag LOCUS_01440 151739 150948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_01440 152632 151727 gene locus_tag LOCUS_01450 152632 151727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_01450 153656 152664 gene locus_tag LOCUS_01460 153656 152664 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_01460 155269 154094 gene locus_tag LOCUS_01470 155269 154094 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_01470 156393 155281 gene locus_tag LOCUS_01480 156393 155281 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_01480 157069 156512 gene locus_tag LOCUS_01490 157069 156512 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_01490 159107 157137 gene locus_tag LOCUS_01500 gene tkt 159107 157137 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_01500 159731 159309 gene locus_tag LOCUS_01510 159731 159309 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_01510 159943 160098 gene locus_tag LOCUS_01520 159943 160098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 160115 161452 gene locus_tag LOCUS_01530 160115 161452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 163090 161462 gene locus_tag LOCUS_01540 gene tndX 163090 161462 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_01540 163257 163087 gene locus_tag LOCUS_01550 163257 163087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 163531 163914 gene locus_tag LOCUS_01560 163531 163914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 164275 163994 gene locus_tag LOCUS_01570 164275 163994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 166429 164501 gene locus_tag LOCUS_01580 166429 164501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_01580 167116 166436 gene locus_tag LOCUS_01590 167116 166436 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_01590 167847 167188 gene locus_tag LOCUS_01600 gene udg 167847 167188 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_01600 170588 167850 gene locus_tag LOCUS_01610 170588 167850 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_01610 170773 170849 gene locus_tag LOCUS_t00010 170773 170849 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 171344 171030 gene locus_tag LOCUS_01620 171344 171030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 171330 171755 gene locus_tag LOCUS_01630 171330 171755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 173569 171842 gene locus_tag LOCUS_01640 173569 171842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 174774 173644 gene locus_tag LOCUS_01650 174774 173644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 175773 174799 gene locus_tag LOCUS_01660 175773 174799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 176506 175787 gene locus_tag LOCUS_01670 176506 175787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 178225 176609 gene locus_tag LOCUS_01680 178225 176609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 179076 178240 gene locus_tag LOCUS_01690 179076 178240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 180710 179883 gene locus_tag LOCUS_01700 180710 179883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 181655 180786 gene locus_tag LOCUS_01710 181655 180786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 182519 181788 gene locus_tag LOCUS_01720 gene rgbR 182519 181788 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_01720 182811 183350 gene locus_tag LOCUS_01730 182811 183350 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434284.1 protein_id gnl|my_center|LOCUS_01730 183444 184277 gene locus_tag LOCUS_01740 183444 184277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 184474 184701 gene locus_tag LOCUS_01750 184474 184701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 184833 186272 gene locus_tag LOCUS_01760 184833 186272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 186327 186677 gene locus_tag LOCUS_01770 186327 186677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 187038 188204 gene locus_tag LOCUS_01780 187038 188204 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964358.1 protein_id gnl|my_center|LOCUS_01780 188253 189368 gene locus_tag LOCUS_01790 gene alr 188253 189368 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_01790 190955 189435 gene locus_tag LOCUS_01800 190955 189435 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_01800 191325 190939 gene locus_tag LOCUS_01810 gene acpS 191325 190939 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_01810 191801 191319 gene locus_tag LOCUS_01820 191801 191319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 192021 193709 gene locus_tag LOCUS_01830 192021 193709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 194087 193920 gene locus_tag LOCUS_01840 194087 193920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 194306 195145 gene locus_tag LOCUS_01850 194306 195145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 195235 195873 gene locus_tag LOCUS_01860 195235 195873 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398264.1 protein_id gnl|my_center|LOCUS_01860 197311 195959 gene locus_tag LOCUS_01870 197311 195959 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_01870 198774 197440 gene locus_tag LOCUS_01880 198774 197440 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388389.1 protein_id gnl|my_center|LOCUS_01880 199687 198962 gene locus_tag LOCUS_01890 199687 198962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 200018 200950 gene locus_tag LOCUS_01900 gene cysK 200018 200950 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_01900 201474 201043 gene locus_tag LOCUS_01910 gene iscR 201474 201043 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_01910 201668 202966 gene locus_tag LOCUS_01920 201668 202966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 203736 203230 gene locus_tag LOCUS_01930 203736 203230 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_01930 203933 204292 gene locus_tag LOCUS_01940 203933 204292 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918377.1 protein_id gnl|my_center|LOCUS_01940 204289 204507 gene locus_tag LOCUS_01950 204289 204507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 204512 206353 gene locus_tag LOCUS_01960 204512 206353 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01960 207847 206426 gene locus_tag LOCUS_01970 207847 206426 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_01970 209172 208006 gene locus_tag LOCUS_01980 209172 208006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_01980 209858 209169 gene locus_tag LOCUS_01990 209858 209169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_01990 211544 209871 gene locus_tag LOCUS_02000 211544 209871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 211693 211830 gene locus_tag LOCUS_02010 211693 211830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 211888 212202 gene locus_tag LOCUS_02020 211888 212202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02020 212346 213179 gene locus_tag LOCUS_02030 212346 213179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 213659 213240 gene locus_tag LOCUS_02040 213659 213240 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_02040 214628 213906 gene locus_tag LOCUS_02050 214628 213906 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896717.1 protein_id gnl|my_center|LOCUS_02050 215301 214615 gene locus_tag LOCUS_02060 215301 214615 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_02060 216204 215395 gene locus_tag LOCUS_02070 216204 215395 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_02070 216989 216450 gene locus_tag LOCUS_02080 gene raiA 216989 216450 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_02080 217715 217320 gene locus_tag LOCUS_02090 217715 217320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 217801 218046 gene locus_tag LOCUS_02100 217801 218046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 218854 218036 gene locus_tag LOCUS_02110 218854 218036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 218957 220513 gene locus_tag LOCUS_02120 218957 220513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 220788 221282 gene locus_tag LOCUS_02130 gene infC 220788 221282 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_02130 221317 221514 gene locus_tag LOCUS_02140 gene rpmI 221317 221514 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_02140 221529 221885 gene locus_tag LOCUS_02150 gene rplT 221529 221885 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_02150 222512 222255 gene locus_tag LOCUS_02160 222512 222255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 223290 222559 gene locus_tag LOCUS_02170 223290 222559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 223946 223287 gene locus_tag LOCUS_02180 223946 223287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 224233 223943 gene locus_tag LOCUS_02190 224233 223943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 224582 224412 gene locus_tag LOCUS_02200 224582 224412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 225263 225027 gene locus_tag LOCUS_02210 225263 225027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 225991 225413 gene locus_tag LOCUS_02220 225991 225413 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_02220 227049 226324 gene locus_tag LOCUS_02230 227049 226324 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921670.1 protein_id gnl|my_center|LOCUS_02230 227228 227998 gene locus_tag LOCUS_02240 227228 227998 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 protein_id gnl|my_center|LOCUS_02240 227998 228534 gene locus_tag LOCUS_02250 227998 228534 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_02250 228565 229146 gene locus_tag LOCUS_02260 228565 229146 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 protein_id gnl|my_center|LOCUS_02260 229424 229233 gene locus_tag LOCUS_02270 gene rpmB 229424 229233 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_02270 229984 229523 gene locus_tag LOCUS_02280 gene trmL 229984 229523 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_02280 230133 231968 gene locus_tag LOCUS_02290 230133 231968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 232480 232040 gene locus_tag LOCUS_02300 232480 232040 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_02300 232542 233870 gene locus_tag LOCUS_02310 232542 233870 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_02310 236654 234318 gene locus_tag LOCUS_02320 236654 234318 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392842.1 protein_id gnl|my_center|LOCUS_02320 237248 236658 gene locus_tag LOCUS_02330 237248 236658 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_02330 237940 237254 gene locus_tag LOCUS_02340 gene cmk 237940 237254 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_02340 239153 237933 gene locus_tag LOCUS_02350 239153 237933 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_02350 240022 239150 gene locus_tag LOCUS_02360 240022 239150 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_02360 240786 240007 gene locus_tag LOCUS_02370 gene surE 240786 240007 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939419.1 protein_id gnl|my_center|LOCUS_02370 243398 240948 gene locus_tag LOCUS_02380 gene feoB 243398 240948 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_02380 243936 243481 gene locus_tag LOCUS_02390 243936 243481 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_02390 244130 245398 gene locus_tag LOCUS_02400 244130 245398 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_02400 245708 245635 gene locus_tag LOCUS_t00020 245708 245635 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 3951 3601 gene locus_tag LOCUS_02410 3951 3601 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_02410 5388 4786 gene locus_tag LOCUS_02420 5388 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5940 5401 gene locus_tag LOCUS_02430 5940 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9288 6097 gene locus_tag LOCUS_02440 9288 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10522 9557 gene locus_tag LOCUS_02450 10522 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11318 10458 gene locus_tag LOCUS_02460 11318 10458 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 protein_id gnl|my_center|LOCUS_02460 11736 11661 gene locus_tag LOCUS_t00030 11736 11661 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11896 12414 gene locus_tag LOCUS_02470 11896 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12390 13793 gene locus_tag LOCUS_02480 12390 13793 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_02480 13790 14740 gene locus_tag LOCUS_02490 gene holB 13790 14740 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_02490 14737 16035 gene locus_tag LOCUS_02500 14737 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 16244 16414 gene locus_tag LOCUS_02510 16244 16414 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_02510 17697 16654 gene locus_tag LOCUS_02520 17697 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18321 17704 gene locus_tag LOCUS_02530 18321 17704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 19374 18325 gene locus_tag LOCUS_02540 19374 18325 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_02540 20128 19451 gene locus_tag LOCUS_02550 20128 19451 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_02550 21761 20358 gene locus_tag LOCUS_02560 21761 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 21993 22910 gene locus_tag LOCUS_02570 21993 22910 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_02570 22994 24136 gene locus_tag LOCUS_02580 22994 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 24729 24307 gene locus_tag LOCUS_02590 gene mscL 24729 24307 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_02590 24732 24902 gene locus_tag LOCUS_02600 24732 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 25662 24895 gene locus_tag LOCUS_02610 25662 24895 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_02610 26666 25659 gene locus_tag LOCUS_02620 gene ansA 26666 25659 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_02620 27280 26663 gene locus_tag LOCUS_02630 27280 26663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 27999 27277 gene locus_tag LOCUS_02640 27999 27277 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766589.1 protein_id gnl|my_center|LOCUS_02640 28321 28923 gene locus_tag LOCUS_02650 28321 28923 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419808.1 protein_id gnl|my_center|LOCUS_02650 28958 30670 gene locus_tag LOCUS_02660 28958 30670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_02660 30663 31580 gene locus_tag LOCUS_02670 30663 31580 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462918.1 protein_id gnl|my_center|LOCUS_02670 31841 32680 gene locus_tag LOCUS_02680 31841 32680 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804394.1 protein_id gnl|my_center|LOCUS_02680 32690 33532 gene locus_tag LOCUS_02690 32690 33532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 33551 34408 gene locus_tag LOCUS_02700 33551 34408 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751612.1 protein_id gnl|my_center|LOCUS_02700 34423 35253 gene locus_tag LOCUS_02710 34423 35253 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_02710 35258 35758 gene locus_tag LOCUS_02720 35258 35758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 37582 35933 gene locus_tag LOCUS_02730 37582 35933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_02730 39415 37589 gene locus_tag LOCUS_02740 39415 37589 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_02740 39462 39626 gene locus_tag LOCUS_02750 39462 39626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 41026 39623 gene locus_tag LOCUS_02760 41026 39623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681074.1 protein_id gnl|my_center|LOCUS_02760 41236 42066 gene locus_tag LOCUS_02770 41236 42066 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379058.1 protein_id gnl|my_center|LOCUS_02770 42174 43208 gene locus_tag LOCUS_02780 42174 43208 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_02780 43217 44899 gene locus_tag LOCUS_02790 43217 44899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 44893 45645 gene locus_tag LOCUS_02800 44893 45645 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_02800 45715 45797 gene locus_tag LOCUS_t00040 45715 45797 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46044 46448 gene locus_tag LOCUS_02810 46044 46448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 46445 47599 gene locus_tag LOCUS_02820 46445 47599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 47817 48737 gene locus_tag LOCUS_02830 47817 48737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 49954 48809 gene locus_tag LOCUS_02840 49954 48809 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_02840 50200 50907 gene locus_tag LOCUS_02850 50200 50907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 51823 51071 gene locus_tag LOCUS_02860 51823 51071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 52440 51910 gene locus_tag LOCUS_02870 52440 51910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 52820 52575 gene locus_tag LOCUS_02880 52820 52575 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_02880 53015 53164 gene locus_tag LOCUS_02890 53015 53164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 53369 54313 gene locus_tag LOCUS_02900 53369 54313 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_02900 54346 55266 gene locus_tag LOCUS_02910 54346 55266 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_02910 55834 56874 gene locus_tag LOCUS_02920 55834 56874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 57009 58067 gene locus_tag LOCUS_02930 57009 58067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_02930 58079 59005 gene locus_tag LOCUS_02940 58079 59005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_02940 59018 60559 gene locus_tag LOCUS_02950 59018 60559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_02950 60775 62016 gene locus_tag LOCUS_02960 60775 62016 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 protein_id gnl|my_center|LOCUS_02960 62227 63069 gene locus_tag LOCUS_02970 62227 63069 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_02970 63417 63599 gene locus_tag LOCUS_02980 63417 63599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 64301 63684 gene locus_tag LOCUS_02990 64301 63684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 65133 64324 gene locus_tag LOCUS_03000 65133 64324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 65250 66398 gene locus_tag LOCUS_03010 65250 66398 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_03010 66395 66769 gene locus_tag LOCUS_03020 66395 66769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 66936 67217 gene locus_tag LOCUS_03030 66936 67217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 68761 67466 gene locus_tag LOCUS_03040 68761 67466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 68898 69077 gene locus_tag LOCUS_03050 68898 69077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 69084 69857 gene locus_tag LOCUS_03060 69084 69857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 70082 70864 gene locus_tag LOCUS_03070 70082 70864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 72293 71163 gene locus_tag LOCUS_03080 72293 71163 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583033.1 protein_id gnl|my_center|LOCUS_03080 72434 73765 gene locus_tag LOCUS_03090 gene codB 72434 73765 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803756.1 protein_id gnl|my_center|LOCUS_03090 73796 74734 gene locus_tag LOCUS_03100 73796 74734 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534771.1 protein_id gnl|my_center|LOCUS_03100 74731 74961 gene locus_tag LOCUS_03110 74731 74961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 77159 75159 gene locus_tag LOCUS_03120 77159 75159 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_03120 77616 78986 gene locus_tag LOCUS_03130 77616 78986 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_03130 79177 79968 gene locus_tag LOCUS_03140 79177 79968 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_03140 80857 80063 gene locus_tag LOCUS_03150 80857 80063 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_03150 81244 82140 gene locus_tag LOCUS_03160 81244 82140 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393277.1 protein_id gnl|my_center|LOCUS_03160 82143 83174 gene locus_tag LOCUS_03170 gene dmpG 82143 83174 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_03170 83208 84866 gene locus_tag LOCUS_03180 gene ilvD 83208 84866 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584102.1 protein_id gnl|my_center|LOCUS_03180 84946 86316 gene locus_tag LOCUS_03190 84946 86316 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016237.1 protein_id gnl|my_center|LOCUS_03190 86431 87762 gene locus_tag LOCUS_03200 86431 87762 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 protein_id gnl|my_center|LOCUS_03200 87813 88616 gene locus_tag LOCUS_03210 87813 88616 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_03210 88613 89332 gene locus_tag LOCUS_03220 88613 89332 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_03220 92284 89732 gene locus_tag LOCUS_03230 gene xdh 92284 89732 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_03230 95400 92410 gene locus_tag LOCUS_03240 gene ygfK 95400 92410 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_03240 96771 95446 gene locus_tag LOCUS_03250 gene ssnA 96771 95446 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 protein_id gnl|my_center|LOCUS_03250 97002 98237 gene locus_tag LOCUS_03260 97002 98237 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_03260 98599 99867 gene locus_tag LOCUS_03270 98599 99867 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_03270 100063 101601 gene locus_tag LOCUS_03280 100063 101601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_03280 101594 102694 gene locus_tag LOCUS_03290 101594 102694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03290 102699 103694 gene locus_tag LOCUS_03300 102699 103694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_03300 103905 104996 gene locus_tag LOCUS_03310 gene serC 103905 104996 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_03310 105016 105930 gene locus_tag LOCUS_03320 105016 105930 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963344.1 protein_id gnl|my_center|LOCUS_03320 106334 108409 gene locus_tag LOCUS_03330 106334 108409 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_03330 108511 109182 gene locus_tag LOCUS_03340 108511 109182 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_03340 109266 110591 gene locus_tag LOCUS_03350 109266 110591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 110632 110707 gene locus_tag LOCUS_t00050 110632 110707 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 110814 111665 gene locus_tag LOCUS_03360 110814 111665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 112140 113057 gene locus_tag LOCUS_03370 112140 113057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_03370 113072 114133 gene locus_tag LOCUS_03380 113072 114133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_03380 114151 115188 gene locus_tag LOCUS_03390 114151 115188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_03390 115185 116171 gene locus_tag LOCUS_03400 115185 116171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_03400 116312 118120 gene locus_tag LOCUS_03410 116312 118120 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_03410 118311 119804 gene locus_tag LOCUS_03420 gene glpK 118311 119804 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_03420 119957 121018 gene locus_tag LOCUS_03430 119957 121018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 121191 122291 gene locus_tag LOCUS_03440 121191 122291 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_03440 122349 123032 gene locus_tag LOCUS_03450 122349 123032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 123034 123918 gene locus_tag LOCUS_03460 123034 123918 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392086.1 protein_id gnl|my_center|LOCUS_03460 123945 125780 gene locus_tag LOCUS_03470 123945 125780 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_03470 125761 126438 gene locus_tag LOCUS_03480 125761 126438 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_03480 126453 127964 gene locus_tag LOCUS_03490 126453 127964 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_03490 128087 128392 gene locus_tag LOCUS_03500 gene rplU 128087 128392 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_03500 128399 128728 gene locus_tag LOCUS_03510 128399 128728 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_03510 128732 129022 gene locus_tag LOCUS_03520 gene rpmA 128732 129022 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_03520 129084 130055 gene locus_tag LOCUS_03530 129084 130055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 130064 130384 gene locus_tag LOCUS_03540 130064 130384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 130544 130747 gene locus_tag LOCUS_03550 130544 130747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 130845 132281 gene locus_tag LOCUS_03560 130845 132281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 133491 132544 gene locus_tag LOCUS_03570 gene fba 133491 132544 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_03570 133610 134539 gene locus_tag LOCUS_03580 133610 134539 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_03580 134657 135667 gene locus_tag LOCUS_03590 gene gap 134657 135667 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_03590 135965 136570 gene locus_tag LOCUS_03600 135965 136570 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476292.1 protein_id gnl|my_center|LOCUS_03600 137307 136678 gene locus_tag LOCUS_03610 137307 136678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03610 137690 137220 gene locus_tag LOCUS_03620 137690 137220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 137879 139681 gene locus_tag LOCUS_03630 gene lepA 137879 139681 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_03630 139681 140838 gene locus_tag LOCUS_03640 gene hemW 139681 140838 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_03640 140959 142005 gene locus_tag LOCUS_03650 gene hrcA 140959 142005 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_03650 142008 142616 gene locus_tag LOCUS_03660 142008 142616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 142657 144513 gene locus_tag LOCUS_03670 gene dnaK 142657 144513 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_03670 144595 145719 gene locus_tag LOCUS_03680 gene dnaJ 144595 145719 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_03680 146309 145794 gene locus_tag LOCUS_03690 146309 145794 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704762.1 protein_id gnl|my_center|LOCUS_03690 146792 146313 gene locus_tag LOCUS_03700 146792 146313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 148075 146834 gene locus_tag LOCUS_03710 148075 146834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 148748 148095 gene locus_tag LOCUS_03720 148748 148095 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_03720 148916 149881 gene locus_tag LOCUS_03730 gene spoIIIAA 148916 149881 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_03730 149857 150372 gene locus_tag LOCUS_03740 149857 150372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 150388 150585 gene locus_tag LOCUS_03750 gene spoIIIAC 150388 150585 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393043.1 protein_id gnl|my_center|LOCUS_03750 150595 150993 gene locus_tag LOCUS_03760 gene spoIIIAD 150595 150993 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_03760 150990 152189 gene locus_tag LOCUS_03770 150990 152189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 152192 152371 gene locus_tag LOCUS_03780 152192 152371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 152374 152988 gene locus_tag LOCUS_03790 152374 152988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 153008 153544 gene locus_tag LOCUS_03800 153008 153544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 153648 154313 gene locus_tag LOCUS_03810 153648 154313 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_03810 154433 154972 gene locus_tag LOCUS_03820 154433 154972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 154975 155409 gene locus_tag LOCUS_03830 154975 155409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 155406 156530 gene locus_tag LOCUS_03840 155406 156530 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_03840 156571 157290 gene locus_tag LOCUS_03850 156571 157290 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 protein_id gnl|my_center|LOCUS_03850 157511 157792 gene locus_tag LOCUS_03860 157511 157792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 157814 158167 gene locus_tag LOCUS_03870 157814 158167 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_03870 158179 159375 gene locus_tag LOCUS_03880 158179 159375 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_03880 159402 160808 gene locus_tag LOCUS_03890 159402 160808 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_03890 160808 161368 gene locus_tag LOCUS_03900 160808 161368 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583479.1 protein_id gnl|my_center|LOCUS_03900 161520 161975 gene locus_tag LOCUS_03910 161520 161975 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_03910 162021 163118 gene locus_tag LOCUS_03920 gene nusA 162021 163118 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_03920 163121 163381 gene locus_tag LOCUS_03930 163121 163381 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_03930 163378 163707 gene locus_tag LOCUS_03940 163378 163707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 163710 166325 gene locus_tag LOCUS_03950 163710 166325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 166338 166724 gene locus_tag LOCUS_03960 gene rbfA 166338 166724 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_03960 166737 167705 gene locus_tag LOCUS_03970 166737 167705 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_03970 167705 168577 gene locus_tag LOCUS_03980 gene truB 167705 168577 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_03980 168587 169474 gene locus_tag LOCUS_03990 168587 169474 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_03990 169617 169871 gene locus_tag LOCUS_04000 gene rpsO 169617 169871 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_04000 169988 172087 gene locus_tag LOCUS_04010 gene pnp 169988 172087 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_04010 172192 172908 gene locus_tag LOCUS_04020 172192 172908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 172919 174181 gene locus_tag LOCUS_04030 172919 174181 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_04030 174218 174583 gene locus_tag LOCUS_04040 174218 174583 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_04040 174576 175793 gene locus_tag LOCUS_04050 174576 175793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 175790 176482 gene locus_tag LOCUS_04060 175790 176482 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_04060 176541 177062 gene locus_tag LOCUS_04070 176541 177062 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_04070 177139 177942 gene locus_tag LOCUS_04080 177139 177942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 177939 179825 gene locus_tag LOCUS_04090 177939 179825 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_04090 179886 180365 gene locus_tag LOCUS_04100 179886 180365 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_04100 180524 181093 gene locus_tag LOCUS_04110 180524 181093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 181107 181334 gene locus_tag LOCUS_04120 181107 181334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 181331 181747 gene locus_tag LOCUS_04130 gene nusB 181331 181747 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_04130 181761 182723 gene locus_tag LOCUS_04140 181761 182723 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_04140 182705 183919 gene locus_tag LOCUS_04150 gene xseA 182705 183919 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_04150 183923 184120 gene locus_tag LOCUS_04160 183923 184120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 184122 184970 gene locus_tag LOCUS_04170 184122 184970 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence03 1819 923 gene locus_tag LOCUS_04180 1819 923 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_04180 2417 1812 gene locus_tag LOCUS_04190 2417 1812 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_04190 3140 3793 gene locus_tag LOCUS_04200 3140 3793 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_04200 3790 4323 gene locus_tag LOCUS_04210 3790 4323 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_04210 5158 4373 gene locus_tag LOCUS_04220 5158 4373 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_04220 5542 6663 gene locus_tag LOCUS_04230 5542 6663 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_04230 6968 7807 gene locus_tag LOCUS_04240 6968 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7804 8718 gene locus_tag LOCUS_04250 7804 8718 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_04250 9052 9354 gene locus_tag LOCUS_04260 9052 9354 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_04260 9388 11916 gene locus_tag LOCUS_04270 9388 11916 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04270 11958 12788 gene locus_tag LOCUS_04280 11958 12788 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_04280 12841 12940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13384 13737 gene locus_tag LOCUS_04290 13384 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 13721 14251 gene locus_tag LOCUS_04300 gene eetB 13721 14251 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_04300 15224 14178 gene locus_tag LOCUS_04310 gene spoIID 15224 14178 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_04310 15342 16013 gene locus_tag LOCUS_04320 15342 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 16046 17245 gene locus_tag LOCUS_04330 16046 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 17252 18172 gene locus_tag LOCUS_04340 17252 18172 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_04340 18166 18996 gene locus_tag LOCUS_04350 gene rsmI 18166 18996 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887281.1 protein_id gnl|my_center|LOCUS_04350 19042 20055 gene locus_tag LOCUS_04360 19042 20055 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_04360 21918 20803 gene locus_tag LOCUS_04370 21918 20803 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_04370 23270 22041 gene locus_tag LOCUS_04380 23270 22041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081491.1 protein_id gnl|my_center|LOCUS_04380 23472 24863 gene locus_tag LOCUS_04390 23472 24863 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_04390 24860 26191 gene locus_tag LOCUS_04400 24860 26191 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_04400 26345 26494 gene locus_tag LOCUS_04410 gene rpmG 26345 26494 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_04410 26519 26791 gene locus_tag LOCUS_04420 26519 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 26796 27371 gene locus_tag LOCUS_04430 gene nusG 26796 27371 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_04430 27502 27927 gene locus_tag LOCUS_04440 gene rplK 27502 27927 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_04440 27940 28629 gene locus_tag LOCUS_04450 gene rplA 27940 28629 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_04450 28828 29355 gene locus_tag LOCUS_04460 gene rplJ 28828 29355 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_04460 32046 29386 gene locus_tag LOCUS_04470 32046 29386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 32328 32861 gene locus_tag LOCUS_04480 32328 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 32961 33887 gene locus_tag LOCUS_04490 32961 33887 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 protein_id gnl|my_center|LOCUS_04490 35183 33993 gene locus_tag LOCUS_04500 35183 33993 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_04500 35338 36279 gene locus_tag LOCUS_04510 35338 36279 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_04510 36285 37451 gene locus_tag LOCUS_04520 36285 37451 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 protein_id gnl|my_center|LOCUS_04520 38879 37461 gene locus_tag LOCUS_04530 38879 37461 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_04530 39507 39250 gene locus_tag LOCUS_04540 39507 39250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 40030 39572 gene locus_tag LOCUS_04550 40030 39572 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_04550 40223 40148 gene locus_tag LOCUS_t00060 40223 40148 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 41050 40307 gene locus_tag LOCUS_04560 41050 40307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_04560 41745 41047 gene locus_tag LOCUS_04570 41745 41047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_04570 43195 41789 gene locus_tag LOCUS_04580 43195 41789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 44759 43347 gene locus_tag LOCUS_04590 44759 43347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 46015 44846 gene locus_tag LOCUS_04600 46015 44846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 46748 46050 gene locus_tag LOCUS_04610 46748 46050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 47975 46815 gene locus_tag LOCUS_04620 gene ytvI 47975 46815 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_04620 48055 48552 gene locus_tag LOCUS_04630 48055 48552 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_04630 48549 49118 gene locus_tag LOCUS_04640 48549 49118 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_04640 49115 49663 gene locus_tag LOCUS_04650 49115 49663 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_04650 50572 49841 gene locus_tag LOCUS_04660 50572 49841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 51136 50615 gene locus_tag LOCUS_04670 51136 50615 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_04670 52054 51155 gene locus_tag LOCUS_04680 52054 51155 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_04680 52281 52745 gene locus_tag LOCUS_04690 52281 52745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 52939 54768 gene locus_tag LOCUS_04700 gene typA 52939 54768 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_04700 56498 55287 gene locus_tag LOCUS_04710 56498 55287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 57441 56500 gene locus_tag LOCUS_04720 57441 56500 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 protein_id gnl|my_center|LOCUS_04720 57724 59592 gene locus_tag LOCUS_04730 gene glgB 57724 59592 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_04730 59597 60820 gene locus_tag LOCUS_04740 59597 60820 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_04740 60817 61941 gene locus_tag LOCUS_04750 gene glgD 60817 61941 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_04750 61996 63675 gene locus_tag LOCUS_04760 gene glgA 61996 63675 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_04760 64193 63825 gene locus_tag LOCUS_04770 64193 63825 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_04770 64413 64628 gene locus_tag LOCUS_04780 64413 64628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 64661 64885 gene locus_tag LOCUS_04790 64661 64885 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_04790 64931 67432 gene locus_tag LOCUS_04800 64931 67432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 67489 67683 gene locus_tag LOCUS_04810 67489 67683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 68635 67760 gene locus_tag LOCUS_04820 68635 67760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 68949 69452 gene locus_tag LOCUS_04830 68949 69452 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620148.1 protein_id gnl|my_center|LOCUS_04830 70220 69621 gene locus_tag LOCUS_04840 70220 69621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 70800 70414 gene locus_tag LOCUS_04850 70800 70414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 71512 70874 gene locus_tag LOCUS_04860 71512 70874 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085042.1 protein_id gnl|my_center|LOCUS_04860 72400 71744 gene locus_tag LOCUS_04870 72400 71744 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_04870 73553 72480 gene locus_tag LOCUS_04880 73553 72480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 73888 73589 gene locus_tag LOCUS_04890 73888 73589 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_04890 74086 74955 gene locus_tag LOCUS_04900 74086 74955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 76331 75081 gene locus_tag LOCUS_04910 76331 75081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 77456 76344 gene locus_tag LOCUS_04920 77456 76344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 79356 77764 gene locus_tag LOCUS_04930 79356 77764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 80614 79319 gene locus_tag LOCUS_04940 gene murA 80614 79319 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_04940 81888 80716 gene locus_tag LOCUS_04950 gene spoVE 81888 80716 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_04950 83448 82096 gene locus_tag LOCUS_04960 gene murD 83448 82096 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_04960 84821 83811 gene locus_tag LOCUS_04970 gene mraY 84821 83811 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_04970 86270 84828 gene locus_tag LOCUS_04980 86270 84828 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_04980 88596 86338 gene locus_tag LOCUS_04990 88596 86338 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_04990 89234 88635 gene locus_tag LOCUS_05000 89234 88635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 90203 89268 gene locus_tag LOCUS_05010 gene rsmH 90203 89268 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_05010 90646 90200 gene locus_tag LOCUS_05020 gene mraZ 90646 90200 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 protein_id gnl|my_center|LOCUS_05020 90820 91098 gene locus_tag LOCUS_05030 90820 91098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 91082 93046 gene locus_tag LOCUS_05040 gene gyrB 91082 93046 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_05040 93064 95484 gene locus_tag LOCUS_05050 gene gyrA 93064 95484 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288365.1 protein_id gnl|my_center|LOCUS_05050 95946 96770 gene locus_tag LOCUS_05060 95946 96770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 96760 98502 gene locus_tag LOCUS_05070 96760 98502 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_05070 98695 99705 gene locus_tag LOCUS_05080 98695 99705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 99831 100964 gene locus_tag LOCUS_05090 99831 100964 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_05090 101033 101572 gene locus_tag LOCUS_05100 101033 101572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 101587 102234 gene locus_tag LOCUS_05110 101587 102234 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_05110 102658 102275 gene locus_tag LOCUS_05120 102658 102275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 103376 102648 gene locus_tag LOCUS_05130 103376 102648 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_05130 103545 103964 gene locus_tag LOCUS_05140 103545 103964 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_05140 103961 104719 gene locus_tag LOCUS_05150 gene thyX 103961 104719 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_05150 105545 104814 gene locus_tag LOCUS_05160 gene mtnP 105545 104814 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_05160 106932 105598 gene locus_tag LOCUS_05170 106932 105598 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594556.1 protein_id gnl|my_center|LOCUS_05170 107540 106986 gene locus_tag LOCUS_05180 107540 106986 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_05180 107721 107996 gene locus_tag LOCUS_05190 107721 107996 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_05190 107998 109356 gene locus_tag LOCUS_05200 107998 109356 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_05200 109656 110219 gene locus_tag LOCUS_05210 109656 110219 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775250.1 protein_id gnl|my_center|LOCUS_05210 110298 112772 gene locus_tag LOCUS_05220 110298 112772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 112827 115388 gene locus_tag LOCUS_05230 112827 115388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 115421 116272 gene locus_tag LOCUS_05240 115421 116272 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896272.1 protein_id gnl|my_center|LOCUS_05240 116303 117076 gene locus_tag LOCUS_05250 116303 117076 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_05250 117179 117688 gene locus_tag LOCUS_05260 117179 117688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 118604 117777 gene locus_tag LOCUS_05270 118604 117777 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_05270 120363 118732 gene locus_tag LOCUS_05280 120363 118732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 121281 120625 gene locus_tag LOCUS_05290 gene deoC 121281 120625 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_05290 122296 121748 gene locus_tag LOCUS_05300 122296 121748 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_05300 122429 124078 gene locus_tag LOCUS_05310 122429 124078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 124329 124724 gene locus_tag LOCUS_05320 124329 124724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 124769 124844 gene locus_tag LOCUS_t00070 124769 124844 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 124845 124921 gene locus_tag LOCUS_t00080 124845 124921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 125122 125535 gene locus_tag LOCUS_05330 125122 125535 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_05330 125677 126303 gene locus_tag LOCUS_05340 125677 126303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 126398 127045 gene locus_tag LOCUS_05350 126398 127045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 127042 127680 gene locus_tag LOCUS_05360 127042 127680 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433837.1 protein_id gnl|my_center|LOCUS_05360 127739 128359 gene locus_tag LOCUS_05370 127739 128359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_05370 128434 128718 gene locus_tag LOCUS_05380 128434 128718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 130699 128711 gene locus_tag LOCUS_05390 130699 128711 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_05390 131913 131197 gene locus_tag LOCUS_05400 131913 131197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 134661 132052 gene locus_tag LOCUS_05410 134661 132052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 134947 136281 gene locus_tag LOCUS_05420 134947 136281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_05420 136785 136477 gene locus_tag LOCUS_05430 136785 136477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_05430 136894 137376 gene locus_tag LOCUS_05440 136894 137376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 138796 137540 gene locus_tag LOCUS_05450 138796 137540 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_05450 139956 139540 gene locus_tag LOCUS_05460 139956 139540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 140853 140176 gene locus_tag LOCUS_05470 140853 140176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 141717 141307 gene locus_tag LOCUS_05480 141717 141307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 142113 141934 gene locus_tag LOCUS_05490 142113 141934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 142540 142289 gene locus_tag LOCUS_05500 142540 142289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence04 840 280 gene locus_tag LOCUS_05510 gene spoVT 840 280 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_05510 1128 2231 gene locus_tag LOCUS_05520 1128 2231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_05520 2241 3131 gene locus_tag LOCUS_05530 2241 3131 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_05530 3145 4020 gene locus_tag LOCUS_05540 3145 4020 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_05540 4017 5615 gene locus_tag LOCUS_05550 4017 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5752 6507 gene locus_tag LOCUS_05560 5752 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6865 7113 gene locus_tag LOCUS_05570 gene spoIIID 6865 7113 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966143.1 protein_id gnl|my_center|LOCUS_05570 7765 7115 gene locus_tag LOCUS_05580 7765 7115 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_05580 9983 7785 gene locus_tag LOCUS_05590 9983 7785 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_05590 10839 9991 gene locus_tag LOCUS_05600 10839 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 12281 10893 gene locus_tag LOCUS_05610 12281 10893 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_05610 12445 12669 gene locus_tag LOCUS_05620 12445 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 12756 13856 gene locus_tag LOCUS_05630 gene mnmA 12756 13856 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922791.1 protein_id gnl|my_center|LOCUS_05630 13919 14650 gene locus_tag LOCUS_05640 13919 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 14650 15414 gene locus_tag LOCUS_05650 14650 15414 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_05650 15426 16145 gene locus_tag LOCUS_05660 15426 16145 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_05660 16567 17577 gene locus_tag LOCUS_05670 gene trpS 16567 17577 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_05670 18839 17667 gene locus_tag LOCUS_05680 18839 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 20203 18947 gene locus_tag LOCUS_05690 20203 18947 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_05690 20956 20462 gene locus_tag LOCUS_05700 20956 20462 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_05700 21837 20956 gene locus_tag LOCUS_05710 gene xdhB 21837 20956 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_05710 24139 21857 gene locus_tag LOCUS_05720 gene xdhA 24139 21857 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_05720 25870 24167 gene locus_tag LOCUS_05730 gene ade 25870 24167 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439445.1 protein_id gnl|my_center|LOCUS_05730 26044 27414 gene locus_tag LOCUS_05740 gene hydA 26044 27414 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_05740 27411 28004 gene locus_tag LOCUS_05750 27411 28004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 28222 29484 gene locus_tag LOCUS_05760 28222 29484 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963605.1 protein_id gnl|my_center|LOCUS_05760 29511 30164 gene locus_tag LOCUS_05770 29511 30164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 30220 30296 gene locus_tag LOCUS_t00090 30220 30296 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30493 30566 gene locus_tag LOCUS_t00100 30493 30566 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 32460 31273 gene locus_tag LOCUS_05780 32460 31273 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_05780 32719 34155 gene locus_tag LOCUS_05790 32719 34155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 34286 34786 gene locus_tag LOCUS_05800 34286 34786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 34789 36648 gene locus_tag LOCUS_05810 34789 36648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 37588 36905 gene locus_tag LOCUS_05820 37588 36905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 39272 38043 gene locus_tag LOCUS_05830 39272 38043 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 protein_id gnl|my_center|LOCUS_05830 39574 40962 gene locus_tag LOCUS_05840 39574 40962 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_05840 41230 42639 gene locus_tag LOCUS_05850 41230 42639 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_05850 42726 44123 gene locus_tag LOCUS_05860 42726 44123 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_05860 44220 45035 gene locus_tag LOCUS_05870 44220 45035 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_05870 46731 45241 gene locus_tag LOCUS_05880 46731 45241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 47255 46728 gene locus_tag LOCUS_05890 47255 46728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 48153 47452 gene locus_tag LOCUS_05900 48153 47452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_05900 48988 48161 gene locus_tag LOCUS_05910 48988 48161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_05910 50061 48988 gene locus_tag LOCUS_05920 50061 48988 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_05920 50962 50075 gene locus_tag LOCUS_05930 50962 50075 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 protein_id gnl|my_center|LOCUS_05930 52255 51074 gene locus_tag LOCUS_05940 52255 51074 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_05940 53654 52668 gene locus_tag LOCUS_05950 53654 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 53554 53751 gene locus_tag LOCUS_05960 53554 53751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 53856 55073 gene locus_tag LOCUS_05970 gene arcA 53856 55073 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870198.1 protein_id gnl|my_center|LOCUS_05970 55079 56095 gene locus_tag LOCUS_05980 gene argF 55079 56095 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_05980 56239 57195 gene locus_tag LOCUS_05990 56239 57195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 57320 58636 gene locus_tag LOCUS_06000 57320 58636 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_06000 58673 59995 gene locus_tag LOCUS_06010 58673 59995 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_06010 60161 60343 gene locus_tag LOCUS_06020 60161 60343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 60402 61151 gene locus_tag LOCUS_06030 60402 61151 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_06030 61503 61228 gene locus_tag LOCUS_06040 61503 61228 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_06040 62428 61856 gene locus_tag LOCUS_06050 62428 61856 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_06050 62496 63506 gene locus_tag LOCUS_06060 gene mutY 62496 63506 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_06060 63519 64388 gene locus_tag LOCUS_06070 63519 64388 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263652.1 protein_id gnl|my_center|LOCUS_06070 64644 66755 gene locus_tag LOCUS_06080 64644 66755 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_06080 67148 69274 gene locus_tag LOCUS_06090 67148 69274 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_06090 69300 69974 gene locus_tag LOCUS_06100 gene udk 69300 69974 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293736.1 protein_id gnl|my_center|LOCUS_06100 71108 70134 gene locus_tag LOCUS_06110 gene pfkA 71108 70134 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_06110 71573 72250 gene locus_tag LOCUS_06120 71573 72250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 72279 73475 gene locus_tag LOCUS_06130 72279 73475 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_06130 73489 73854 gene locus_tag LOCUS_06140 73489 73854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 73862 74800 gene locus_tag LOCUS_06150 73862 74800 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704655.1 protein_id gnl|my_center|LOCUS_06150 74763 76325 gene locus_tag LOCUS_06160 gene fdrA 74763 76325 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_06160 76339 77763 gene locus_tag LOCUS_06170 76339 77763 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_06170 77925 78734 gene locus_tag LOCUS_06180 77925 78734 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_06180 78999 79541 gene locus_tag LOCUS_06190 78999 79541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 79605 80438 gene locus_tag LOCUS_06200 79605 80438 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_06200 80457 80942 gene locus_tag LOCUS_06210 80457 80942 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_06210 80942 83290 gene locus_tag LOCUS_06220 80942 83290 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_06220 83599 84924 gene locus_tag LOCUS_06230 83599 84924 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_06230 85221 86390 gene locus_tag LOCUS_06240 85221 86390 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_06240 86401 88161 gene locus_tag LOCUS_06250 86401 88161 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_06250 88158 88835 gene locus_tag LOCUS_06260 88158 88835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 89167 90195 gene locus_tag LOCUS_06270 89167 90195 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_06270 90258 91601 gene locus_tag LOCUS_06280 90258 91601 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_06280 91774 92694 gene locus_tag LOCUS_06290 91774 92694 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_06290 92694 93554 gene locus_tag LOCUS_06300 92694 93554 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_06300 93574 95058 gene locus_tag LOCUS_06310 gene malQ 93574 95058 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_06310 95191 96093 gene locus_tag LOCUS_06320 95191 96093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 96145 97077 gene locus_tag LOCUS_06330 gene cysK 96145 97077 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767706.1 protein_id gnl|my_center|LOCUS_06330 97435 98721 gene locus_tag LOCUS_06340 97435 98721 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_06340 98737 100350 gene locus_tag LOCUS_06350 98737 100350 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_06350 100347 101759 gene locus_tag LOCUS_06360 gene mazG 100347 101759 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099544.1 protein_id gnl|my_center|LOCUS_06360 101847 102119 gene locus_tag LOCUS_06370 101847 102119 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_06370 102306 102923 gene locus_tag LOCUS_06380 gene yedF 102306 102923 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_06380 102920 104065 gene locus_tag LOCUS_06390 102920 104065 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_06390 104062 104298 gene locus_tag LOCUS_06400 104062 104298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 104410 104787 gene locus_tag LOCUS_06410 104410 104787 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_06410 104787 105644 gene locus_tag LOCUS_06420 104787 105644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_06420 105641 106267 gene locus_tag LOCUS_06430 105641 106267 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_06430 106407 109553 gene locus_tag LOCUS_06440 106407 109553 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_06440 109580 109927 gene locus_tag LOCUS_06450 109580 109927 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_06450 109924 110676 gene locus_tag LOCUS_06460 109924 110676 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_06460 112375 110777 gene locus_tag LOCUS_06470 112375 110777 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_06470 114286 112457 gene locus_tag LOCUS_06480 gene glmS 114286 112457 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_06480 114522 114301 gene locus_tag LOCUS_06490 114522 114301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 114431 114440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115827 114583 gene locus_tag LOCUS_06500 gene trpB 115827 114583 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_06500 115889 116281 gene locus_tag LOCUS_06510 115889 116281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 116859 116290 gene locus_tag LOCUS_06520 116859 116290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 117961 117158 gene locus_tag LOCUS_06530 117961 117158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_06530 118718 117951 gene locus_tag LOCUS_06540 118718 117951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_06540 118915 119118 gene locus_tag LOCUS_06550 118915 119118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 119512 119111 gene locus_tag LOCUS_06560 119512 119111 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012344.1 protein_id gnl|my_center|LOCUS_06560 120117 119509 gene locus_tag LOCUS_06570 120117 119509 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073032.1 protein_id gnl|my_center|LOCUS_06570 121060 120119 gene locus_tag LOCUS_06580 121060 120119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_06580 122214 121057 gene locus_tag LOCUS_06590 122214 121057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_06590 123749 122211 gene locus_tag LOCUS_06600 123749 122211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_06600 125304 124033 gene locus_tag LOCUS_06610 125304 124033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 125547 125717 gene locus_tag LOCUS_06620 125547 125717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 125879 126142 gene locus_tag LOCUS_06630 125879 126142 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_06630 126268 126723 gene locus_tag LOCUS_06640 gene nrdR 126268 126723 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_06640 126727 127593 gene locus_tag LOCUS_06650 gene pgeF 126727 127593 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_06650 127658 128776 gene locus_tag LOCUS_06660 127658 128776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 128941 129642 gene locus_tag LOCUS_06670 128941 129642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_06670 129675 132206 gene locus_tag LOCUS_06680 129675 132206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence05 1021 931 gene locus_tag LOCUS_t00110 1021 931 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1901 1152 gene locus_tag LOCUS_06690 1901 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2705 3826 gene locus_tag LOCUS_06700 gene nagA 2705 3826 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_06700 3962 5185 gene locus_tag LOCUS_06710 3962 5185 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_06710 5161 6201 gene locus_tag LOCUS_06720 5161 6201 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_06720 6198 7331 gene locus_tag LOCUS_06730 6198 7331 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_06730 7337 8482 gene locus_tag LOCUS_06740 gene cap8G 7337 8482 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_06740 8479 9711 gene locus_tag LOCUS_06750 8479 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10450 9770 gene locus_tag LOCUS_06760 10450 9770 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_06760 10567 10941 gene locus_tag LOCUS_06770 10567 10941 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_06770 11377 12429 gene locus_tag LOCUS_06780 11377 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 12419 13129 gene locus_tag LOCUS_06790 12419 13129 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_06790 13440 13613 gene locus_tag LOCUS_06800 13440 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13634 13831 gene locus_tag LOCUS_06810 13634 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 13831 14049 gene locus_tag LOCUS_06820 13831 14049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 14128 15057 gene locus_tag LOCUS_06830 gene metF 14128 15057 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_06830 15103 15873 gene locus_tag LOCUS_06840 15103 15873 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_06840 15930 16868 gene locus_tag LOCUS_06850 gene acsD 15930 16868 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_06850 16884 19148 gene locus_tag LOCUS_06860 16884 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 19338 21461 gene locus_tag LOCUS_06870 gene acsB 19338 21461 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_06870 21549 23465 gene locus_tag LOCUS_06880 gene acsV 21549 23465 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_06880 23476 24111 gene locus_tag LOCUS_06890 23476 24111 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 protein_id gnl|my_center|LOCUS_06890 24464 25048 gene locus_tag LOCUS_06900 24464 25048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 25093 26367 gene locus_tag LOCUS_06910 25093 26367 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_06910 26531 28204 gene locus_tag LOCUS_06920 26531 28204 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_06920 28299 28919 gene locus_tag LOCUS_06930 28299 28919 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_06930 28937 29797 gene locus_tag LOCUS_06940 28937 29797 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_06940 29821 30642 gene locus_tag LOCUS_06950 29821 30642 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670448.1 protein_id gnl|my_center|LOCUS_06950 30632 31222 gene locus_tag LOCUS_06960 30632 31222 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_06960 31341 32153 gene locus_tag LOCUS_06970 31341 32153 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287979.1 protein_id gnl|my_center|LOCUS_06970 32432 33067 gene locus_tag LOCUS_06980 gene yqeC 32432 33067 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_06980 33093 33884 gene locus_tag LOCUS_06990 gene yqeB 33093 33884 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_06990 33888 34922 gene locus_tag LOCUS_07000 gene selD 33888 34922 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_07000 35178 36233 gene locus_tag LOCUS_07010 gene yedE 35178 36233 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_07010 36238 36447 gene locus_tag LOCUS_07020 36238 36447 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_07020 36892 37212 gene locus_tag LOCUS_07030 36892 37212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 37259 38068 gene locus_tag LOCUS_07040 37259 38068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 38065 39780 gene locus_tag LOCUS_07050 38065 39780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 39806 40684 gene locus_tag LOCUS_07060 39806 40684 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_07060 40657 42285 gene locus_tag LOCUS_07070 40657 42285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 42282 42968 gene locus_tag LOCUS_07080 42282 42968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 44584 43175 gene locus_tag LOCUS_07090 44584 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 45913 44699 gene locus_tag LOCUS_07100 45913 44699 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_07100 46257 45919 gene locus_tag LOCUS_07110 46257 45919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 46405 47019 gene locus_tag LOCUS_07120 46405 47019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 47734 47084 gene locus_tag LOCUS_07130 gene rpe 47734 47084 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_07130 48608 47727 gene locus_tag LOCUS_07140 gene rsgA 48608 47727 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460520.1 protein_id gnl|my_center|LOCUS_07140 50511 48613 gene locus_tag LOCUS_07150 gene pknB 50511 48613 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_07150 51242 50508 gene locus_tag LOCUS_07160 51242 50508 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830090.1 protein_id gnl|my_center|LOCUS_07160 52266 51226 gene locus_tag LOCUS_07170 gene rlmN 52266 51226 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_07170 53576 52257 gene locus_tag LOCUS_07180 gene rsmB 53576 52257 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_07180 54499 53573 gene locus_tag LOCUS_07190 gene fmt 54499 53573 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_07190 54990 54496 gene locus_tag LOCUS_07200 gene def 54990 54496 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_07200 55241 56269 gene locus_tag LOCUS_07210 55241 56269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 58418 56565 gene locus_tag LOCUS_07220 58418 56565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_07220 60241 58415 gene locus_tag LOCUS_07230 60241 58415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_07230 62521 60263 gene locus_tag LOCUS_07240 gene priA 62521 60263 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_07240 62871 62668 gene locus_tag LOCUS_07250 62871 62668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 63496 62873 gene locus_tag LOCUS_07260 gene gmk 63496 62873 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_07260 63793 63536 gene locus_tag LOCUS_07270 63793 63536 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_07270 64680 63805 gene locus_tag LOCUS_07280 64680 63805 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_07280 65695 64724 gene locus_tag LOCUS_07290 65695 64724 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_07290 67653 65692 gene locus_tag LOCUS_07300 gene ligA 67653 65692 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_07300 69905 67656 gene locus_tag LOCUS_07310 gene pcrA 69905 67656 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_07310 70065 70487 gene locus_tag LOCUS_07320 70065 70487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_07320 70514 71989 gene locus_tag LOCUS_07330 gene thrC 70514 71989 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_07330 71979 73157 gene locus_tag LOCUS_07340 71979 73157 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_07340 73186 74427 gene locus_tag LOCUS_07350 73186 74427 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_07350 74573 76645 gene locus_tag LOCUS_07360 gene fusA 74573 76645 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_07360 77131 78516 gene locus_tag LOCUS_07370 gene miaB 77131 78516 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_07370 78513 78896 gene locus_tag LOCUS_07380 78513 78896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 78932 81559 gene locus_tag LOCUS_07390 gene mutS 78932 81559 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_07390 81556 83505 gene locus_tag LOCUS_07400 gene mutL 81556 83505 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_07400 83505 84467 gene locus_tag LOCUS_07410 gene miaA 83505 84467 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_07410 84464 85705 gene locus_tag LOCUS_07420 84464 85705 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_07420 86377 85727 gene locus_tag LOCUS_07430 gene lexA 86377 85727 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_07430 87898 86843 gene locus_tag LOCUS_07440 87898 86843 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_07440 88102 88437 gene locus_tag LOCUS_07450 88102 88437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 88956 89324 gene locus_tag LOCUS_07460 88956 89324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 89570 89337 gene locus_tag LOCUS_07470 89570 89337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 90459 90004 gene locus_tag LOCUS_07480 gene rnhA 90459 90004 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_07480 91283 90489 gene locus_tag LOCUS_07490 gene proC 91283 90489 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_07490 91844 92563 gene locus_tag LOCUS_07500 91844 92563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 92539 92736 gene locus_tag LOCUS_07510 92539 92736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 93168 93040 gene locus_tag LOCUS_07520 93168 93040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 93495 93304 gene locus_tag LOCUS_07530 93495 93304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 93897 93824 gene locus_tag LOCUS_t00120 93897 93824 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 94865 93939 gene locus_tag LOCUS_07540 94865 93939 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_07540 96482 94941 gene locus_tag LOCUS_07550 gene rny 96482 94941 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_07550 100292 96645 gene locus_tag LOCUS_07560 100292 96645 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_07560 101778 100714 gene locus_tag LOCUS_07570 gene ispG 101778 100714 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_07570 102796 101786 gene locus_tag LOCUS_07580 gene rseP 102796 101786 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_07580 103981 102842 gene locus_tag LOCUS_07590 103981 102842 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_07590 104818 104003 gene locus_tag LOCUS_07600 104818 104003 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_07600 105552 104815 gene locus_tag LOCUS_07610 105552 104815 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_07610 105813 105613 gene locus_tag LOCUS_07620 105813 105613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 106367 105810 gene locus_tag LOCUS_07630 gene frr 106367 105810 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_07630 107126 106434 gene locus_tag LOCUS_07640 gene pyrH 107126 106434 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_07640 108071 107190 gene locus_tag LOCUS_07650 gene tsf 108071 107190 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_07650 108829 108092 gene locus_tag LOCUS_07660 gene rpsB 108829 108092 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_07660 109282 109001 gene locus_tag LOCUS_07670 109282 109001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 109731 109303 gene locus_tag LOCUS_07680 gene ruvX 109731 109303 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_07680 109991 109731 gene locus_tag LOCUS_07690 109991 109731 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_07690 110180 111178 gene locus_tag LOCUS_07700 110180 111178 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_07700 111615 111193 gene locus_tag LOCUS_07710 111615 111193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 112028 111717 gene locus_tag LOCUS_07720 gene yajC 112028 111717 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965579.1 protein_id gnl|my_center|LOCUS_07720 112381 112211 gene locus_tag LOCUS_07730 112381 112211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 112884 112480 gene locus_tag LOCUS_07740 gene nifU 112884 112480 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_07740 114056 112884 gene locus_tag LOCUS_07750 gene nifS 114056 112884 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_07750 114489 114037 gene locus_tag LOCUS_07760 114489 114037 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_07760 114975 114661 gene locus_tag LOCUS_07770 gene trxA 114975 114661 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_07770 115424 114975 gene locus_tag LOCUS_07780 115424 114975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 117211 115421 gene locus_tag LOCUS_07790 gene aspS 117211 115421 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_07790 118484 117213 gene locus_tag LOCUS_07800 gene hisS 118484 117213 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_07800 120222 118771 gene locus_tag LOCUS_07810 120222 118771 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_07810 120863 120219 gene locus_tag LOCUS_07820 120863 120219 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_07820 121309 120863 gene locus_tag LOCUS_07830 gene dtd 121309 120863 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_07830 123505 121328 gene locus_tag LOCUS_07840 123505 121328 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_07840 124128 123613 gene locus_tag LOCUS_07850 124128 123613 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_07850 126218 124149 gene locus_tag LOCUS_07860 126218 124149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 127564 126353 gene locus_tag LOCUS_07870 127564 126353 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_07870 128577 127579 gene locus_tag LOCUS_07880 gene pta 128577 127579 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_07880 128711 129913 gene locus_tag LOCUS_07890 128711 129913 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_07890 130699 129917 gene locus_tag LOCUS_07900 130699 129917 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662583.1 protein_id gnl|my_center|LOCUS_07900 131227 131865 gene locus_tag LOCUS_07910 131227 131865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence06 2535 646 gene locus_tag LOCUS_07920 2535 646 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_07920 2733 2936 gene locus_tag LOCUS_07930 2733 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2988 3842 gene locus_tag LOCUS_07940 gene cdaA 2988 3842 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_07940 3829 5115 gene locus_tag LOCUS_07950 3829 5115 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966359.1 protein_id gnl|my_center|LOCUS_07950 5214 6824 gene locus_tag LOCUS_07960 5214 6824 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_07960 7006 9189 gene locus_tag LOCUS_07970 7006 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 9211 11049 gene locus_tag LOCUS_07980 9211 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12010 11129 gene locus_tag LOCUS_07990 12010 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12084 12794 gene locus_tag LOCUS_08000 12084 12794 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964829.1 protein_id gnl|my_center|LOCUS_08000 13972 12851 gene locus_tag LOCUS_08010 13972 12851 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_08010 14547 14008 gene locus_tag LOCUS_08020 14547 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 14951 14688 gene locus_tag LOCUS_08030 14951 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 15004 15013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16220 15279 gene locus_tag LOCUS_08040 16220 15279 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_08040 16503 17753 gene locus_tag LOCUS_08050 16503 17753 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_08050 18059 18799 gene locus_tag LOCUS_08060 gene surE 18059 18799 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_08060 18948 20069 gene locus_tag LOCUS_08070 18948 20069 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_08070 20160 20954 gene locus_tag LOCUS_08080 gene phnC 20160 20954 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_08080 20959 21813 gene locus_tag LOCUS_08090 gene phnE 20959 21813 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_08090 21828 22691 gene locus_tag LOCUS_08100 gene phnE 21828 22691 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_08100 22770 24281 gene locus_tag LOCUS_08110 22770 24281 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069266.1 protein_id gnl|my_center|LOCUS_08110 24308 25282 gene locus_tag LOCUS_08120 24308 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 26710 25829 gene locus_tag LOCUS_08130 26710 25829 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_08130 26999 26742 gene locus_tag LOCUS_08140 26999 26742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_08140 27637 27035 gene locus_tag LOCUS_08150 27637 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_08150 28549 27668 gene locus_tag LOCUS_08160 28549 27668 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_08160 28697 29299 gene locus_tag LOCUS_08170 28697 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 32110 29504 gene locus_tag LOCUS_08180 gene adhE 32110 29504 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_08180 32221 32439 gene locus_tag LOCUS_08190 32221 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 32653 32561 gene locus_tag LOCUS_t00130 32653 32561 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32754 32666 gene locus_tag LOCUS_t00140 32754 32666 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32943 33548 gene locus_tag LOCUS_08200 32943 33548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 33596 34411 gene locus_tag LOCUS_08210 33596 34411 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_08210 34408 34902 gene locus_tag LOCUS_08220 34408 34902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 34956 35078 gene locus_tag LOCUS_08230 34956 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 35285 35698 gene locus_tag LOCUS_08240 35285 35698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 37043 35838 gene locus_tag LOCUS_08250 37043 35838 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 protein_id gnl|my_center|LOCUS_08250 38580 37045 gene locus_tag LOCUS_08260 38580 37045 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_08260 40125 38653 gene locus_tag LOCUS_08270 40125 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 40817 40122 gene locus_tag LOCUS_08280 40817 40122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 42075 40798 gene locus_tag LOCUS_08290 42075 40798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 42743 42597 gene locus_tag LOCUS_08300 42743 42597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 42928 43101 gene locus_tag LOCUS_08310 42928 43101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 43451 43107 gene locus_tag LOCUS_08320 43451 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 45196 43502 gene locus_tag LOCUS_08330 45196 43502 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_08330 45262 45486 gene locus_tag LOCUS_08340 45262 45486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 46519 45545 gene locus_tag LOCUS_08350 46519 45545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 47060 46506 gene locus_tag LOCUS_08360 47060 46506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 48832 48131 gene locus_tag LOCUS_08370 48832 48131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 49058 48789 gene locus_tag LOCUS_08380 49058 48789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 49884 49216 gene locus_tag LOCUS_08390 49884 49216 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_08390 50716 49892 gene locus_tag LOCUS_08400 50716 49892 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_08400 51650 50730 gene locus_tag LOCUS_08410 51650 50730 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949070.1 protein_id gnl|my_center|LOCUS_08410 52729 51662 gene locus_tag LOCUS_08420 52729 51662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_08420 54190 52841 gene locus_tag LOCUS_08430 54190 52841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_08430 55247 54342 gene locus_tag LOCUS_08440 55247 54342 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_08440 55382 55939 gene locus_tag LOCUS_08450 55382 55939 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_08450 56289 57599 gene locus_tag LOCUS_08460 56289 57599 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861962.1 protein_id gnl|my_center|LOCUS_08460 58737 57640 gene locus_tag LOCUS_08470 58737 57640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 58930 59937 gene locus_tag LOCUS_08480 58930 59937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 59934 60740 gene locus_tag LOCUS_08490 59934 60740 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980234.1 protein_id gnl|my_center|LOCUS_08490 60741 61715 gene locus_tag LOCUS_08500 gene rbsK 60741 61715 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_08500 62942 61839 gene locus_tag LOCUS_08510 62942 61839 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964251.1 protein_id gnl|my_center|LOCUS_08510 63990 63601 gene locus_tag LOCUS_08520 63990 63601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 64309 64233 gene locus_tag LOCUS_t00150 64309 64233 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66016 64442 gene locus_tag LOCUS_08530 gene radA 66016 64442 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_08530 65916 67607 gene locus_tag LOCUS_08540 65916 67607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 67634 67969 gene locus_tag LOCUS_08550 67634 67969 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_08550 68023 68622 gene locus_tag LOCUS_08560 gene recR 68023 68622 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_08560 68626 69477 gene locus_tag LOCUS_08570 68626 69477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 69474 69869 gene locus_tag LOCUS_08580 69474 69869 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165225.1 protein_id gnl|my_center|LOCUS_08580 70185 71261 gene locus_tag LOCUS_08590 70185 71261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 71286 71849 gene locus_tag LOCUS_08600 71286 71849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 71885 72985 gene locus_tag LOCUS_08610 71885 72985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 72982 73761 gene locus_tag LOCUS_08620 72982 73761 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_08620 73816 77160 gene locus_tag LOCUS_08630 73816 77160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 77223 77591 gene locus_tag LOCUS_08640 77223 77591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 77725 78222 gene locus_tag LOCUS_08650 gene ruvC 77725 78222 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_08650 78242 78826 gene locus_tag LOCUS_08660 gene ruvA 78242 78826 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_08660 78872 79891 gene locus_tag LOCUS_08670 gene ruvB 78872 79891 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_08670 79898 80683 gene locus_tag LOCUS_08680 79898 80683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 80676 82121 gene locus_tag LOCUS_08690 gene proS 80676 82121 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_08690 82228 82776 gene locus_tag LOCUS_08700 82228 82776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 82778 83494 gene locus_tag LOCUS_08710 82778 83494 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059917.1 protein_id gnl|my_center|LOCUS_08710 83564 84751 gene locus_tag LOCUS_08720 83564 84751 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_08720 84782 85528 gene locus_tag LOCUS_08730 gene tpiA 84782 85528 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_08730 85528 87072 gene locus_tag LOCUS_08740 gene gpmI 85528 87072 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_08740 87152 87391 gene locus_tag LOCUS_08750 87152 87391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 87557 88024 gene locus_tag LOCUS_08760 gene smpB 87557 88024 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_08760 88021 89268 gene locus_tag LOCUS_08770 gene lysA 88021 89268 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_08770 89326 89685 gene locus_tag LOCUS_tm00010 89326 89685 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 89853 90158 gene locus_tag LOCUS_08780 89853 90158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 90652 90870 gene locus_tag LOCUS_08790 90652 90870 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 protein_id gnl|my_center|LOCUS_08790 90851 91330 gene locus_tag LOCUS_08800 90851 91330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 91619 92905 gene locus_tag LOCUS_08810 91619 92905 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_08810 92994 93689 gene locus_tag LOCUS_08820 92994 93689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 93869 94099 gene locus_tag LOCUS_08830 93869 94099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 94140 95564 gene locus_tag LOCUS_08840 94140 95564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 96525 95920 gene locus_tag LOCUS_08850 96525 95920 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869350.1 protein_id gnl|my_center|LOCUS_08850 96625 97758 gene locus_tag LOCUS_08860 96625 97758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 97780 98877 gene locus_tag LOCUS_08870 97780 98877 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_08870 99056 99682 gene locus_tag LOCUS_08880 99056 99682 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435286.1 protein_id gnl|my_center|LOCUS_08880 99624 99902 gene locus_tag LOCUS_08890 99624 99902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 99927 100907 gene locus_tag LOCUS_08900 99927 100907 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_08900 101085 101534 gene locus_tag LOCUS_08910 101085 101534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 101599 102435 gene locus_tag LOCUS_08920 101599 102435 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_08920 103324 102614 gene locus_tag LOCUS_08930 103324 102614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 103579 103504 gene locus_tag LOCUS_t00160 103579 103504 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 135 60 gene locus_tag LOCUS_t00170 135 60 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 217 141 gene locus_tag LOCUS_t00180 217 141 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 319 243 gene locus_tag LOCUS_t00190 319 243 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 407 333 gene locus_tag LOCUS_t00200 407 333 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 489 413 gene locus_tag LOCUS_t00210 489 413 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3308 669 gene locus_tag LOCUS_08940 3308 669 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_08940 5602 3623 gene locus_tag LOCUS_08950 5602 3623 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994023.1 protein_id gnl|my_center|LOCUS_08950 6534 5602 gene locus_tag LOCUS_08960 6534 5602 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_08960 7102 6524 gene locus_tag LOCUS_08970 7102 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7752 7147 gene locus_tag LOCUS_08980 7752 7147 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_08980 8375 7749 gene locus_tag LOCUS_08990 gene coaE 8375 7749 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_08990 10950 8362 gene locus_tag LOCUS_09000 gene polA 10950 8362 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_09000 12269 10953 gene locus_tag LOCUS_09010 12269 10953 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_09010 13446 12307 gene locus_tag LOCUS_09020 13446 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 15368 13449 gene locus_tag LOCUS_09030 15368 13449 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_09030 15536 16963 gene locus_tag LOCUS_09040 15536 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 16965 17840 gene locus_tag LOCUS_09050 16965 17840 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_09050 19383 18187 gene locus_tag LOCUS_09060 19383 18187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 20446 19463 gene locus_tag LOCUS_09070 20446 19463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315533.1 protein_id gnl|my_center|LOCUS_09070 21519 20443 gene locus_tag LOCUS_09080 21519 20443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969743.1 protein_id gnl|my_center|LOCUS_09080 23051 21516 gene locus_tag LOCUS_09090 23051 21516 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973785.1 protein_id gnl|my_center|LOCUS_09090 24442 23312 gene locus_tag LOCUS_09100 24442 23312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 25659 24715 gene locus_tag LOCUS_09110 25659 24715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 26889 25768 gene locus_tag LOCUS_09120 26889 25768 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_09120 28128 26929 gene locus_tag LOCUS_09130 28128 26929 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_09130 29665 28241 gene locus_tag LOCUS_09140 29665 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 31116 29665 gene locus_tag LOCUS_09150 31116 29665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 31839 31135 gene locus_tag LOCUS_09160 31839 31135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 32804 31836 gene locus_tag LOCUS_09170 32804 31836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_09170 33907 32954 gene locus_tag LOCUS_09180 gene manA 33907 32954 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989899.1 protein_id gnl|my_center|LOCUS_09180 34815 33910 gene locus_tag LOCUS_09190 34815 33910 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_09190 37081 34808 gene locus_tag LOCUS_09200 37081 34808 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263031.1 protein_id gnl|my_center|LOCUS_09200 37832 37083 gene locus_tag LOCUS_09210 37832 37083 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930423.1 protein_id gnl|my_center|LOCUS_09210 38733 37975 gene locus_tag LOCUS_09220 38733 37975 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017152.1 protein_id gnl|my_center|LOCUS_09220 39749 38730 gene locus_tag LOCUS_09230 39749 38730 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_09230 40709 39759 gene locus_tag LOCUS_09240 40709 39759 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_09240 41652 40750 gene locus_tag LOCUS_09250 41652 40750 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970571.1 protein_id gnl|my_center|LOCUS_09250 42805 41696 gene locus_tag LOCUS_09260 42805 41696 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210025.1 protein_id gnl|my_center|LOCUS_09260 43610 42852 gene locus_tag LOCUS_09270 gene deoC 43610 42852 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_09270 43902 45047 gene locus_tag LOCUS_09280 43902 45047 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_09280 45059 45910 gene locus_tag LOCUS_09290 45059 45910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 45936 46856 gene locus_tag LOCUS_09300 45936 46856 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_09300 46881 47960 gene locus_tag LOCUS_09310 46881 47960 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_09310 47963 48682 gene locus_tag LOCUS_09320 47963 48682 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 protein_id gnl|my_center|LOCUS_09320 48872 49561 gene locus_tag LOCUS_09330 48872 49561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_09330 49558 51213 gene locus_tag LOCUS_09340 49558 51213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_09340 51357 53147 gene locus_tag LOCUS_09350 51357 53147 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_09350 54630 53275 gene locus_tag LOCUS_09360 54630 53275 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_09360 54811 55668 gene locus_tag LOCUS_09370 54811 55668 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_09370 55904 57256 gene locus_tag LOCUS_09380 55904 57256 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_09380 57490 58386 gene locus_tag LOCUS_09390 57490 58386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 59787 58576 gene locus_tag LOCUS_09400 59787 58576 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_09400 60792 59875 gene locus_tag LOCUS_09410 60792 59875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 61147 62364 gene locus_tag LOCUS_09420 61147 62364 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_09420 62955 62437 gene locus_tag LOCUS_09430 62955 62437 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_09430 63582 63019 gene locus_tag LOCUS_09440 63582 63019 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_09440 63907 65559 gene locus_tag LOCUS_09450 63907 65559 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_09450 66819 65932 gene locus_tag LOCUS_09460 66819 65932 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_09460 66946 67929 gene locus_tag LOCUS_09470 66946 67929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 68311 69285 gene locus_tag LOCUS_09480 68311 69285 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_09480 69872 69282 gene locus_tag LOCUS_09490 69872 69282 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_09490 70035 70484 gene locus_tag LOCUS_09500 70035 70484 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_09500 70573 71376 gene locus_tag LOCUS_09510 70573 71376 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_09510 71500 73383 gene locus_tag LOCUS_09520 gene htpG 71500 73383 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_09520 73909 73457 gene locus_tag LOCUS_09530 73909 73457 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_09530 74008 74084 gene locus_tag LOCUS_t00220 74008 74084 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 76483 74753 gene locus_tag LOCUS_09540 76483 74753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 77335 76487 gene locus_tag LOCUS_09550 77335 76487 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_09550 78212 77325 gene locus_tag LOCUS_09560 78212 77325 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226871.1 protein_id gnl|my_center|LOCUS_09560 79627 78299 gene locus_tag LOCUS_09570 79627 78299 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776454.1 protein_id gnl|my_center|LOCUS_09570 79792 81591 gene locus_tag LOCUS_09580 79792 81591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 81593 83083 gene locus_tag LOCUS_09590 81593 83083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 83087 84742 gene locus_tag LOCUS_09600 83087 84742 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 protein_id gnl|my_center|LOCUS_09600 86112 86738 gene locus_tag LOCUS_09610 86112 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 86732 87184 gene locus_tag LOCUS_09620 86732 87184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 87289 88002 gene locus_tag LOCUS_09630 87289 88002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_09630 87996 89594 gene locus_tag LOCUS_09640 87996 89594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_09640 89780 90298 gene locus_tag LOCUS_09650 89780 90298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 90474 90932 gene locus_tag LOCUS_09660 90474 90932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 91599 90940 gene locus_tag LOCUS_09670 91599 90940 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_09670 92029 91616 gene locus_tag LOCUS_09680 92029 91616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 92349 92119 gene locus_tag LOCUS_09690 92349 92119 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_09690 92696 92415 gene locus_tag LOCUS_09700 92696 92415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 94862 92709 gene locus_tag LOCUS_09710 94862 92709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 95208 96353 gene locus_tag LOCUS_09720 95208 96353 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_09720 96364 97545 gene locus_tag LOCUS_09730 gene thiI 96364 97545 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_09730 <100067 98680 gene locus_tag LOCUS_09740 <100067 98680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein >Feature sequence08 1007 522 gene locus_tag LOCUS_09750 1007 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1280 1642 gene locus_tag LOCUS_09760 1280 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2125 1694 gene locus_tag LOCUS_09770 2125 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3738 2122 gene locus_tag LOCUS_09780 3738 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4039 3698 gene locus_tag LOCUS_09790 4039 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4860 4378 gene locus_tag LOCUS_09800 4860 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 6386 5148 gene locus_tag LOCUS_09810 6386 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7498 6959 gene locus_tag LOCUS_09820 7498 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8293 7517 gene locus_tag LOCUS_09830 8293 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09830 9746 8805 gene locus_tag LOCUS_09840 9746 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 11242 9938 gene locus_tag LOCUS_09850 gene clpX 11242 9938 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_09850 11872 11288 gene locus_tag LOCUS_09860 gene clpP 11872 11288 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_09860 13213 11909 gene locus_tag LOCUS_09870 gene tig 13213 11909 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_09870 13600 15507 gene locus_tag LOCUS_09880 gene thrS 13600 15507 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_09880 15854 17185 gene locus_tag LOCUS_09890 gene gdhA 15854 17185 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_09890 19032 17914 gene locus_tag LOCUS_09900 19032 17914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_09900 19170 21920 gene locus_tag LOCUS_09910 gene secA 19170 21920 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_09910 21934 23034 gene locus_tag LOCUS_09920 gene prfB 21934 23034 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 protein_id gnl|my_center|LOCUS_09920 23067 23897 gene locus_tag LOCUS_09930 23067 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 24098 24577 gene locus_tag LOCUS_09940 24098 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 24589 24816 gene locus_tag LOCUS_09950 24589 24816 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_09950 24797 26053 gene locus_tag LOCUS_09960 24797 26053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 26609 26533 gene locus_tag LOCUS_t00230 26609 26533 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26744 28060 gene locus_tag LOCUS_09970 gene nagZ 26744 28060 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_09970 28147 29568 gene locus_tag LOCUS_09980 28147 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 29712 29811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30764 29946 gene locus_tag LOCUS_09990 30764 29946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 31543 30872 gene locus_tag LOCUS_10000 31543 30872 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_10000 31741 32241 gene locus_tag LOCUS_10010 31741 32241 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_10010 32234 34306 gene locus_tag LOCUS_10020 32234 34306 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_10020 34688 34278 gene locus_tag LOCUS_10030 34688 34278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 34891 34697 gene locus_tag LOCUS_10040 34891 34697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 35081 36115 gene locus_tag LOCUS_10050 35081 36115 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_10050 36109 36750 gene locus_tag LOCUS_10060 36109 36750 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_10060 36797 38164 gene locus_tag LOCUS_10070 gene brnQ 36797 38164 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_10070 38175 38771 gene locus_tag LOCUS_10080 38175 38771 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_10080 40652 38889 gene locus_tag LOCUS_10090 40652 38889 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_10090 42461 40665 gene locus_tag LOCUS_10100 gene nuoF 42461 40665 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_10100 42846 42475 gene locus_tag LOCUS_10110 42846 42475 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_10110 43466 42921 gene locus_tag LOCUS_10120 43466 42921 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_10120 44332 43595 gene locus_tag LOCUS_10130 44332 43595 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_10130 44655 44329 gene locus_tag LOCUS_10140 44655 44329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 45947 44652 gene locus_tag LOCUS_10150 45947 44652 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_10150 46389 45964 gene locus_tag LOCUS_10160 46389 45964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 46739 46386 gene locus_tag LOCUS_10170 46739 46386 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_10170 47300 46806 gene locus_tag LOCUS_10180 47300 46806 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_10180 47611 48534 gene locus_tag LOCUS_10190 47611 48534 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_10190 48548 49213 gene locus_tag LOCUS_10200 48548 49213 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_10200 49392 50258 gene locus_tag LOCUS_10210 49392 50258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 50527 51993 gene locus_tag LOCUS_10220 50527 51993 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_10220 52678 52193 gene locus_tag LOCUS_10230 52678 52193 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 protein_id gnl|my_center|LOCUS_10230 52854 52779 gene locus_tag LOCUS_t00240 52854 52779 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 53782 52961 gene locus_tag LOCUS_10240 gene dapF 53782 52961 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_10240 54154 53807 gene locus_tag LOCUS_10250 54154 53807 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_10250 54244 54891 gene locus_tag LOCUS_10260 54244 54891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 54948 55604 gene locus_tag LOCUS_10270 54948 55604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_10270 55686 56402 gene locus_tag LOCUS_10280 55686 56402 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_10280 56561 56827 gene locus_tag LOCUS_10290 56561 56827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 56824 58827 gene locus_tag LOCUS_10300 gene feoB 56824 58827 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_10300 60044 59175 gene locus_tag LOCUS_10310 60044 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 60461 60282 gene locus_tag LOCUS_10320 60461 60282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 61654 60467 gene locus_tag LOCUS_10330 61654 60467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 62418 61690 gene locus_tag LOCUS_10340 62418 61690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 63170 62694 gene locus_tag LOCUS_10350 63170 62694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 63913 63254 gene locus_tag LOCUS_10360 63913 63254 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_10360 64946 63915 gene locus_tag LOCUS_10370 64946 63915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 65686 64976 gene locus_tag LOCUS_10380 65686 64976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 67505 65688 gene locus_tag LOCUS_10390 67505 65688 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860923.1 protein_id gnl|my_center|LOCUS_10390 67657 68688 gene locus_tag LOCUS_10400 67657 68688 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_10400 68685 70037 gene locus_tag LOCUS_10410 68685 70037 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_10410 70152 71357 gene locus_tag LOCUS_10420 70152 71357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 71360 71617 gene locus_tag LOCUS_10430 71360 71617 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_10430 71914 72990 gene locus_tag LOCUS_10440 71914 72990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 73615 73235 gene locus_tag LOCUS_10450 73615 73235 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 protein_id gnl|my_center|LOCUS_10450 74262 73612 gene locus_tag LOCUS_10460 74262 73612 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_10460 75112 74243 gene locus_tag LOCUS_10470 75112 74243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_10470 75251 75940 gene locus_tag LOCUS_10480 75251 75940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 76882 76070 gene locus_tag LOCUS_10490 76882 76070 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_10490 77582 76902 gene locus_tag LOCUS_10500 77582 76902 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_10500 80819 77700 gene locus_tag LOCUS_10510 gene ileS 80819 77700 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_10510 82554 81217 gene locus_tag LOCUS_10520 82554 81217 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_10520 84713 82869 gene locus_tag LOCUS_10530 84713 82869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 85716 85177 gene locus_tag LOCUS_10540 85716 85177 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_10540 86148 85774 gene locus_tag LOCUS_10550 86148 85774 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_10550 86494 87054 gene locus_tag LOCUS_10560 86494 87054 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_10560 87397 87582 gene locus_tag LOCUS_10570 87397 87582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 87682 88083 gene locus_tag LOCUS_10580 87682 88083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 88169 88864 gene locus_tag LOCUS_10590 88169 88864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence09 3 239 gene locus_tag LOCUS_10600 3 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 309 1535 gene locus_tag LOCUS_10610 309 1535 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_10610 1732 2637 gene locus_tag LOCUS_10620 1732 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3195 2890 gene locus_tag LOCUS_10630 3195 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3696 3505 gene locus_tag LOCUS_10640 3696 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3795 7883 gene locus_tag LOCUS_10650 gene cas9 3795 7883 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_10650 7880 8749 gene locus_tag LOCUS_10660 gene cas1 7880 8749 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_10660 8746 9066 gene locus_tag LOCUS_10670 gene cas2 8746 9066 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 protein_id gnl|my_center|LOCUS_10670 9063 9728 gene locus_tag LOCUS_10680 9063 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 9837 10333 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagagctgtgtaatttcagagggtacttaaac 11060 18631 gene locus_tag LOCUS_10690 11060 18631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 18628 19929 gene locus_tag LOCUS_10700 18628 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 19926 21620 gene locus_tag LOCUS_10710 19926 21620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 21636 25175 gene locus_tag LOCUS_10720 21636 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 25277 26395 gene locus_tag LOCUS_10730 25277 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 26416 27300 gene locus_tag LOCUS_10740 26416 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 27348 29258 gene locus_tag LOCUS_10750 27348 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 29264 30199 gene locus_tag LOCUS_10760 29264 30199 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_10760 30206 31345 gene locus_tag LOCUS_10770 30206 31345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 31367 33679 gene locus_tag LOCUS_10780 31367 33679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 34607 33747 gene locus_tag LOCUS_10790 34607 33747 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 protein_id gnl|my_center|LOCUS_10790 36237 35020 gene locus_tag LOCUS_10800 36237 35020 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_10800 37443 36517 gene locus_tag LOCUS_10810 37443 36517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 39439 37607 gene locus_tag LOCUS_10820 39439 37607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 41442 39520 gene locus_tag LOCUS_10830 41442 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 41624 42706 gene locus_tag LOCUS_10840 41624 42706 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_10840 42693 43718 gene locus_tag LOCUS_10850 42693 43718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 43731 43973 gene locus_tag LOCUS_10860 43731 43973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 44940 44269 gene locus_tag LOCUS_10870 44940 44269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 45992 45108 gene locus_tag LOCUS_10880 45992 45108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 46172 46483 gene locus_tag LOCUS_10890 46172 46483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 47229 46603 gene locus_tag LOCUS_10900 47229 46603 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 protein_id gnl|my_center|LOCUS_10900 48190 47324 gene locus_tag LOCUS_10910 48190 47324 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_10910 49066 48218 gene locus_tag LOCUS_10920 49066 48218 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272204.1 protein_id gnl|my_center|LOCUS_10920 51950 49125 gene locus_tag LOCUS_10930 gene uvrA 51950 49125 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_10930 52288 53400 gene locus_tag LOCUS_10940 52288 53400 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_10940 55367 53487 gene locus_tag LOCUS_10950 55367 53487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_10950 57095 55368 gene locus_tag LOCUS_10960 57095 55368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_10960 57566 57096 gene locus_tag LOCUS_10970 57566 57096 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 protein_id gnl|my_center|LOCUS_10970 57699 59471 gene locus_tag LOCUS_10980 gene hflX 57699 59471 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_10980 59650 60138 gene locus_tag LOCUS_10990 59650 60138 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_10990 61916 60141 gene locus_tag LOCUS_11000 61916 60141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 61997 62917 gene locus_tag LOCUS_11010 61997 62917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 64494 63061 gene locus_tag LOCUS_11020 64494 63061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 64651 65313 gene locus_tag LOCUS_11030 64651 65313 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_11030 67068 65863 gene locus_tag LOCUS_11040 67068 65863 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_11040 69742 67505 gene locus_tag LOCUS_11050 69742 67505 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 protein_id gnl|my_center|LOCUS_11050 70328 69771 gene locus_tag LOCUS_11060 70328 69771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 71358 70345 gene locus_tag LOCUS_11070 71358 70345 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_11070 71587 72453 gene locus_tag LOCUS_11080 71587 72453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 72465 73112 gene locus_tag LOCUS_11090 72465 73112 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_11090 74012 74203 gene locus_tag LOCUS_11100 74012 74203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 75027 74548 gene locus_tag LOCUS_11110 75027 74548 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868950.1 protein_id gnl|my_center|LOCUS_11110 75893 75024 gene locus_tag LOCUS_11120 gene xdhB 75893 75024 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459192.1 protein_id gnl|my_center|LOCUS_11120 78200 75897 gene locus_tag LOCUS_11130 78200 75897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11130 79638 78523 gene locus_tag LOCUS_11140 79638 78523 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_11140 80709 79684 gene locus_tag LOCUS_11150 80709 79684 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_11150 81051 82361 gene locus_tag LOCUS_11160 gene codB 81051 82361 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261296.1 protein_id gnl|my_center|LOCUS_11160 84229 82991 gene locus_tag LOCUS_11170 84229 82991 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_11170 84609 84534 gene locus_tag LOCUS_t00250 84609 84534 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 85999 84710 gene locus_tag LOCUS_11180 85999 84710 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964316.1 protein_id gnl|my_center|LOCUS_11180 87371 86037 gene locus_tag LOCUS_11190 87371 86037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 87550 88581 gene locus_tag LOCUS_11200 87550 88581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 88643 88718 gene locus_tag LOCUS_t00260 88643 88718 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 355 849 gene locus_tag LOCUS_11210 355 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2108 1242 gene locus_tag LOCUS_11220 2108 1242 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_11220 3860 2637 gene locus_tag LOCUS_11230 3860 2637 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_11230 6105 3865 gene locus_tag LOCUS_11240 6105 3865 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_11240 6341 7726 gene locus_tag LOCUS_11250 6341 7726 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_11250 10074 7903 gene locus_tag LOCUS_11260 10074 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 10466 10041 gene locus_tag LOCUS_11270 10466 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 11231 10743 gene locus_tag LOCUS_11280 11231 10743 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_11280 12671 11418 gene locus_tag LOCUS_11290 12671 11418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_11290 14506 12686 gene locus_tag LOCUS_11300 14506 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 15207 14503 gene locus_tag LOCUS_11310 15207 14503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_11310 16584 15223 gene locus_tag LOCUS_11320 16584 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 16961 19591 gene locus_tag LOCUS_11330 16961 19591 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_11330 19723 20124 gene locus_tag LOCUS_11340 19723 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 20361 20654 gene locus_tag LOCUS_11350 20361 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 20645 21727 gene locus_tag LOCUS_11360 20645 21727 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 22568 22248 gene locus_tag LOCUS_11370 22568 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 24354 22570 gene locus_tag LOCUS_11380 gene pepF 24354 22570 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_11380 24632 24393 gene locus_tag LOCUS_11390 24632 24393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 25903 24629 gene locus_tag LOCUS_11400 25903 24629 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_11400 26492 26148 gene locus_tag LOCUS_11410 26492 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 26776 27213 gene locus_tag LOCUS_11420 26776 27213 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_11420 27481 27867 gene locus_tag LOCUS_11430 27481 27867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 28249 27989 gene locus_tag LOCUS_11440 28249 27989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 29149 28274 gene locus_tag LOCUS_11450 29149 28274 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_11450 29886 29146 gene locus_tag LOCUS_11460 29886 29146 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_11460 30358 31365 gene locus_tag LOCUS_11470 30358 31365 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_11470 31369 32031 gene locus_tag LOCUS_11480 31369 32031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_11480 32084 32884 gene locus_tag LOCUS_11490 32084 32884 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_11490 33313 33044 gene locus_tag LOCUS_11500 33313 33044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 34367 33270 gene locus_tag LOCUS_11510 34367 33270 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963504.1 protein_id gnl|my_center|LOCUS_11510 35550 34369 gene locus_tag LOCUS_11520 35550 34369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_11520 37642 35564 gene locus_tag LOCUS_11530 37642 35564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 38649 37660 gene locus_tag LOCUS_11540 38649 37660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_11540 41220 38899 gene locus_tag LOCUS_11550 41220 38899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 41866 41303 gene locus_tag LOCUS_11560 41866 41303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 43296 42280 gene locus_tag LOCUS_11570 gene galE 43296 42280 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_11570 43829 43326 gene locus_tag LOCUS_11580 43829 43326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 45281 43893 gene locus_tag LOCUS_11590 gene cysS 45281 43893 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_11590 46046 45309 gene locus_tag LOCUS_11600 gene cysE 46046 45309 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_11600 46497 47009 gene locus_tag LOCUS_11610 46497 47009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 47025 47252 gene locus_tag LOCUS_11620 47025 47252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 47294 48289 gene locus_tag LOCUS_11630 gene floA 47294 48289 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_11630 48296 48895 gene locus_tag LOCUS_11640 48296 48895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 48918 50321 gene locus_tag LOCUS_11650 48918 50321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 50474 51286 gene locus_tag LOCUS_11660 50474 51286 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_11660 51314 52183 gene locus_tag LOCUS_11670 gene pstC 51314 52183 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_11670 52190 53053 gene locus_tag LOCUS_11680 gene pstA 52190 53053 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_11680 53050 53805 gene locus_tag LOCUS_11690 gene pstB 53050 53805 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_11690 53807 54445 gene locus_tag LOCUS_11700 gene phoU 53807 54445 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_11700 55927 54743 gene locus_tag LOCUS_11710 55927 54743 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669899.1 protein_id gnl|my_center|LOCUS_11710 56397 55942 gene locus_tag LOCUS_11720 56397 55942 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_11720 57435 56452 gene locus_tag LOCUS_11730 57435 56452 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_11730 58430 57435 gene locus_tag LOCUS_11740 58430 57435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_11740 59345 58488 gene locus_tag LOCUS_11750 59345 58488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_11750 60303 59356 gene locus_tag LOCUS_11760 60303 59356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_11760 62047 60422 gene locus_tag LOCUS_11770 62047 60422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_11770 62842 62066 gene locus_tag LOCUS_11780 62842 62066 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_11780 63803 62844 gene locus_tag LOCUS_11790 63803 62844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 64863 63835 gene locus_tag LOCUS_11800 64863 63835 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_11800 65223 66470 gene locus_tag LOCUS_11810 gene thrC 65223 66470 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_11810 67437 66640 gene locus_tag LOCUS_11820 gene xynR 67437 66640 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095377.1 protein_id gnl|my_center|LOCUS_11820 67733 68908 gene locus_tag LOCUS_11830 67733 68908 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931392.1 protein_id gnl|my_center|LOCUS_11830 68927 69316 gene locus_tag LOCUS_11840 gene madL 68927 69316 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389084.1 protein_id gnl|my_center|LOCUS_11840 69309 70082 gene locus_tag LOCUS_11850 gene madM 69309 70082 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_11850 70105 70863 gene locus_tag LOCUS_11860 70105 70863 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_11860 71822 70884 gene locus_tag LOCUS_11870 71822 70884 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_11870 72087 72533 gene locus_tag LOCUS_11880 72087 72533 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446103.1 protein_id gnl|my_center|LOCUS_11880 72588 73754 gene locus_tag LOCUS_11890 72588 73754 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390286.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence11 694 14 gene locus_tag LOCUS_11900 694 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 899 741 gene locus_tag LOCUS_11910 899 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2416 1187 gene locus_tag LOCUS_11920 2416 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2950 2474 gene locus_tag LOCUS_11930 2950 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 3300 2947 gene locus_tag LOCUS_11940 3300 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 3650 5011 gene locus_tag LOCUS_11950 gene trkA 3650 5011 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_11950 5026 6486 gene locus_tag LOCUS_11960 5026 6486 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_11960 7350 6616 gene locus_tag LOCUS_11970 7350 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7547 9292 gene locus_tag LOCUS_11980 7547 9292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_11980 9292 11037 gene locus_tag LOCUS_11990 9292 11037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_11990 11457 12662 gene locus_tag LOCUS_12000 gene ugpC 11457 12662 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_12000 12877 13449 gene locus_tag LOCUS_12010 12877 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 13421 15013 gene locus_tag LOCUS_12020 13421 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15228 16046 gene locus_tag LOCUS_12030 15228 16046 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 protein_id gnl|my_center|LOCUS_12030 16163 16321 gene locus_tag LOCUS_12040 16163 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 16321 16893 gene locus_tag LOCUS_12050 16321 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 16878 17564 gene locus_tag LOCUS_12060 16878 17564 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_12060 17561 18553 gene locus_tag LOCUS_12070 17561 18553 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_12070 18727 19488 gene locus_tag LOCUS_12080 18727 19488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_12080 19481 21193 gene locus_tag LOCUS_12090 19481 21193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 21208 21762 gene locus_tag LOCUS_12100 21208 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 23194 22025 gene locus_tag LOCUS_12110 23194 22025 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_12110 23688 23191 gene locus_tag LOCUS_12120 gene crtO 23688 23191 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_12120 23990 24562 gene locus_tag LOCUS_12130 gene dhaS 23990 24562 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 protein_id gnl|my_center|LOCUS_12130 25432 24644 gene locus_tag LOCUS_12140 25432 24644 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_12140 26080 25436 gene locus_tag LOCUS_12150 26080 25436 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_12150 26965 26156 gene locus_tag LOCUS_12160 26965 26156 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_12160 27173 28240 gene locus_tag LOCUS_12170 27173 28240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 28718 28329 gene locus_tag LOCUS_12180 28718 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 29427 28786 gene locus_tag LOCUS_12190 29427 28786 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_12190 29548 29955 gene locus_tag LOCUS_12200 29548 29955 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581517.1 protein_id gnl|my_center|LOCUS_12200 29952 30830 gene locus_tag LOCUS_12210 29952 30830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 30922 31854 gene locus_tag LOCUS_12220 30922 31854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 31946 32485 gene locus_tag LOCUS_12230 31946 32485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459532.1 protein_id gnl|my_center|LOCUS_12230 32554 33243 gene locus_tag LOCUS_12240 32554 33243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_12240 33240 34643 gene locus_tag LOCUS_12250 33240 34643 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986771.1 protein_id gnl|my_center|LOCUS_12250 35405 34857 gene locus_tag LOCUS_12260 35405 34857 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_12260 36380 35418 gene locus_tag LOCUS_12270 36380 35418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 36891 36403 gene locus_tag LOCUS_12280 36891 36403 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_12280 38245 36896 gene locus_tag LOCUS_12290 38245 36896 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_12290 38410 39240 gene locus_tag LOCUS_12300 38410 39240 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_12300 39216 40064 gene locus_tag LOCUS_12310 39216 40064 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_12310 40069 40875 gene locus_tag LOCUS_12320 40069 40875 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_12320 40875 41645 gene locus_tag LOCUS_12330 gene truA 40875 41645 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_12330 41642 42121 gene locus_tag LOCUS_12340 gene tadA 41642 42121 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_12340 42415 42503 gene locus_tag LOCUS_t00270 42415 42503 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43807 42593 gene locus_tag LOCUS_12350 43807 42593 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_12350 44199 43933 gene locus_tag LOCUS_12360 44199 43933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 44781 44413 gene locus_tag LOCUS_12370 44781 44413 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567661.1 protein_id gnl|my_center|LOCUS_12370 45752 45252 gene locus_tag LOCUS_12380 45752 45252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 47423 46803 gene locus_tag LOCUS_12390 gene lexA 47423 46803 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_12390 47830 48678 gene locus_tag LOCUS_12400 47830 48678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 49846 49340 gene locus_tag LOCUS_12410 49846 49340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 50955 49924 gene locus_tag LOCUS_12420 50955 49924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 51711 51073 gene locus_tag LOCUS_12430 51711 51073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 58571 52047 gene locus_tag LOCUS_12440 58571 52047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 59008 59544 gene locus_tag LOCUS_12450 59008 59544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 59439 59708 gene locus_tag LOCUS_12460 59439 59708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 >Feature sequence12 171 87 gene locus_tag LOCUS_t00280 171 87 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 266 191 gene locus_tag LOCUS_t00290 266 191 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 347 272 gene locus_tag LOCUS_t00300 347 272 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 450 374 gene locus_tag LOCUS_t00310 450 374 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 618 542 gene locus_tag LOCUS_t00320 618 542 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1207 704 gene locus_tag LOCUS_12470 1207 704 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_12470 1734 1246 gene locus_tag LOCUS_12480 gene rimI 1734 1246 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_12480 2365 1739 gene locus_tag LOCUS_12490 2365 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2814 2362 gene locus_tag LOCUS_12500 gene tsaE 2814 2362 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_12500 3935 2811 gene locus_tag LOCUS_12510 gene tgt 3935 2811 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_12510 4982 3957 gene locus_tag LOCUS_12520 gene queA 4982 3957 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_12520 5144 5971 gene locus_tag LOCUS_12530 5144 5971 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_12530 7185 6091 gene locus_tag LOCUS_12540 gene rpoD 7185 6091 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_12540 8980 7205 gene locus_tag LOCUS_12550 gene dnaG 8980 7205 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_12550 10045 9047 gene locus_tag LOCUS_12560 10045 9047 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_12560 10702 10262 gene locus_tag LOCUS_12570 10702 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_12570 11308 10751 gene locus_tag LOCUS_12580 gene efp 11308 10751 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_12580 12411 11344 gene locus_tag LOCUS_12590 12411 11344 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_12590 13916 12468 gene locus_tag LOCUS_12600 13916 12468 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_12600 14658 13978 gene locus_tag LOCUS_12610 gene sigK 14658 13978 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_12610 15929 14778 gene locus_tag LOCUS_12620 gene mltG 15929 14778 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_12620 16302 15961 gene locus_tag LOCUS_12630 16302 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 17967 16318 gene locus_tag LOCUS_12640 17967 16318 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_12640 18921 17980 gene locus_tag LOCUS_12650 18921 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 20278 18893 gene locus_tag LOCUS_12660 gene hslU 20278 18893 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_12660 20815 20282 gene locus_tag LOCUS_12670 gene hslV 20815 20282 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_12670 22177 20885 gene locus_tag LOCUS_12680 gene trmFO 22177 20885 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_12680 24272 22170 gene locus_tag LOCUS_12690 gene topA 24272 22170 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_12690 25451 24294 gene locus_tag LOCUS_12700 gene dprA 25451 24294 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12700 26982 25459 gene locus_tag LOCUS_12710 26982 25459 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_12710 27462 26989 gene locus_tag LOCUS_12720 27462 26989 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964330.1 protein_id gnl|my_center|LOCUS_12720 31288 27452 gene locus_tag LOCUS_12730 31288 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 31699 31349 gene locus_tag LOCUS_12740 31699 31349 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094547338.1 protein_id gnl|my_center|LOCUS_12740 32322 31696 gene locus_tag LOCUS_12750 32322 31696 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_12750 33208 32306 gene locus_tag LOCUS_12760 gene ylqF 33208 32306 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_12760 33636 33277 gene locus_tag LOCUS_12770 gene rplS 33636 33277 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_12770 34483 33797 gene locus_tag LOCUS_12780 gene trmD 34483 33797 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_12780 34991 34473 gene locus_tag LOCUS_12790 gene rimM 34991 34473 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_12790 35215 34988 gene locus_tag LOCUS_12800 35215 34988 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_12800 35466 35224 gene locus_tag LOCUS_12810 gene rpsP 35466 35224 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_12810 36874 35540 gene locus_tag LOCUS_12820 gene ffh 36874 35540 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_12820 37220 36864 gene locus_tag LOCUS_12830 37220 36864 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_12830 38312 37407 gene locus_tag LOCUS_12840 gene ftsY 38312 37407 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723863.1 protein_id gnl|my_center|LOCUS_12840 41876 38313 gene locus_tag LOCUS_12850 gene smc 41876 38313 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_12850 42602 41883 gene locus_tag LOCUS_12860 gene rnc 42602 41883 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_12860 42894 42670 gene locus_tag LOCUS_12870 gene acpP 42894 42670 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_12870 43978 42968 gene locus_tag LOCUS_12880 gene plsX 43978 42968 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_12880 44315 44115 gene locus_tag LOCUS_12890 gene rpmF 44315 44115 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_12890 44840 44334 gene locus_tag LOCUS_12900 44840 44334 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_12900 47270 44976 gene locus_tag LOCUS_12910 47270 44976 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_12910 47982 47362 gene locus_tag LOCUS_12920 47982 47362 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_12920 48805 47969 gene locus_tag LOCUS_12930 48805 47969 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_12930 49131 48976 gene locus_tag LOCUS_12940 49131 48976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 50334 49141 gene locus_tag LOCUS_12950 50334 49141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 51422 50316 gene locus_tag LOCUS_12960 51422 50316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 53026 51419 gene locus_tag LOCUS_12970 53026 51419 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_12970 <53938 53032 gene locus_tag LOCUS_12980 <53938 53032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933511.1:AAA family ATPase >Feature sequence13 1423 143 gene locus_tag LOCUS_12990 gene rmuC 1423 143 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_12990 2100 1429 gene locus_tag LOCUS_13000 2100 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2279 2971 gene locus_tag LOCUS_13010 2279 2971 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_13010 2984 3982 gene locus_tag LOCUS_13020 2984 3982 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_13020 4064 4561 gene locus_tag LOCUS_13030 4064 4561 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 protein_id gnl|my_center|LOCUS_13030 4558 4968 gene locus_tag LOCUS_13040 4558 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 5138 6466 gene locus_tag LOCUS_13050 5138 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6505 7080 gene locus_tag LOCUS_13060 6505 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7181 8125 gene locus_tag LOCUS_13070 7181 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 8207 8812 gene locus_tag LOCUS_13080 8207 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8812 9846 gene locus_tag LOCUS_13090 gene rsgA 8812 9846 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861937.1 protein_id gnl|my_center|LOCUS_13090 9857 10573 gene locus_tag LOCUS_13100 9857 10573 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_13100 10768 13140 gene locus_tag LOCUS_13110 10768 13140 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_13110 13698 13255 gene locus_tag LOCUS_13120 13698 13255 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_13120 14238 13768 gene locus_tag LOCUS_13130 14238 13768 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_13130 14834 14235 gene locus_tag LOCUS_13140 14834 14235 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 protein_id gnl|my_center|LOCUS_13140 16540 14825 gene locus_tag LOCUS_13150 16540 14825 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_13150 16857 16546 gene locus_tag LOCUS_13160 16857 16546 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_13160 17351 17088 gene locus_tag LOCUS_13170 gene rpsT 17351 17088 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 protein_id gnl|my_center|LOCUS_13170 19676 17454 gene locus_tag LOCUS_13180 19676 17454 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836341.1 protein_id gnl|my_center|LOCUS_13180 19898 20182 gene locus_tag LOCUS_13190 gene groES 19898 20182 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_13190 20218 21843 gene locus_tag LOCUS_13200 gene groL 20218 21843 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_13200 21932 22837 gene locus_tag LOCUS_13210 21932 22837 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_13210 23156 22926 gene locus_tag LOCUS_13220 23156 22926 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 protein_id gnl|my_center|LOCUS_13220 23593 23153 gene locus_tag LOCUS_13230 23593 23153 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_13230 24876 23596 gene locus_tag LOCUS_13240 24876 23596 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_13240 25180 26430 gene locus_tag LOCUS_13250 25180 26430 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_13250 26427 27752 gene locus_tag LOCUS_13260 gene der 26427 27752 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_13260 27758 28369 gene locus_tag LOCUS_13270 gene plsY 27758 28369 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476008.1 protein_id gnl|my_center|LOCUS_13270 28385 29986 gene locus_tag LOCUS_13280 gene spoIVA 28385 29986 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_13280 30059 30961 gene locus_tag LOCUS_13290 gene gpr 30059 30961 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392443.1 protein_id gnl|my_center|LOCUS_13290 30989 32035 gene locus_tag LOCUS_13300 30989 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 33355 32141 gene locus_tag LOCUS_13310 33355 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 34242 33367 gene locus_tag LOCUS_13320 gene dapA 34242 33367 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_13320 35254 34247 gene locus_tag LOCUS_13330 35254 34247 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 protein_id gnl|my_center|LOCUS_13330 35478 36248 gene locus_tag LOCUS_13340 35478 36248 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_13340 36245 37159 gene locus_tag LOCUS_13350 gene hslO 36245 37159 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_13350 37140 38852 gene locus_tag LOCUS_13360 37140 38852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 38849 39964 gene locus_tag LOCUS_13370 38849 39964 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_13370 39961 41178 gene locus_tag LOCUS_13380 39961 41178 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_13380 41247 41329 gene locus_tag LOCUS_t00330 41247 41329 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41499 41747 gene locus_tag LOCUS_13390 41499 41747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 42033 41839 gene locus_tag LOCUS_13400 42033 41839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence14 1453 140 gene locus_tag LOCUS_13410 gene mnmE 1453 140 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_13410 2344 1511 gene locus_tag LOCUS_13420 2344 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3354 2341 gene locus_tag LOCUS_13430 3354 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3618 3400 gene locus_tag LOCUS_13440 gene yidD 3618 3400 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667653.1 protein_id gnl|my_center|LOCUS_13440 3962 3606 gene locus_tag LOCUS_13450 gene rnpA 3962 3606 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726628.1 protein_id gnl|my_center|LOCUS_13450 5412 4351 gene locus_tag LOCUS_13460 5412 4351 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_13460 5934 5464 gene locus_tag LOCUS_13470 5934 5464 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_13470 7224 6205 gene locus_tag LOCUS_13480 7224 6205 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_13480 7981 7340 gene locus_tag LOCUS_13490 gene yunB 7981 7340 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_13490 8891 8010 gene locus_tag LOCUS_13500 8891 8010 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_13500 10991 8922 gene locus_tag LOCUS_13510 gene ftsH 10991 8922 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_13510 11624 11061 gene locus_tag LOCUS_13520 gene hpt 11624 11061 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_13520 12828 11590 gene locus_tag LOCUS_13530 gene tilS 12828 11590 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_13530 13143 13937 gene locus_tag LOCUS_13540 gene radC 13143 13937 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_13540 14029 14244 gene locus_tag LOCUS_13550 14029 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 14616 14269 gene locus_tag LOCUS_13560 14616 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 14785 14709 gene locus_tag LOCUS_t00340 14785 14709 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15052 15378 gene locus_tag LOCUS_13570 gene darA 15052 15378 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_13570 15397 16758 gene locus_tag LOCUS_13580 15397 16758 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_13580 16796 17752 gene locus_tag LOCUS_13590 16796 17752 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_13590 18460 18035 gene locus_tag LOCUS_13600 18460 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 18732 18430 gene locus_tag LOCUS_13610 18732 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 20699 18777 gene locus_tag LOCUS_13620 20699 18777 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_13620 21083 21790 gene locus_tag LOCUS_13630 21083 21790 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_13630 22634 21888 gene locus_tag LOCUS_13640 22634 21888 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_13640 23173 22808 gene locus_tag LOCUS_13650 gene spoVAE 23173 22808 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_13650 24204 23176 gene locus_tag LOCUS_13660 gene spoVAD 24204 23176 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_13660 24338 24201 gene locus_tag LOCUS_13670 24338 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 26135 24513 gene locus_tag LOCUS_13680 26135 24513 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_13680 27747 26128 gene locus_tag LOCUS_13690 27747 26128 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_13690 29488 27827 gene locus_tag LOCUS_13700 29488 27827 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_13700 29887 29627 gene locus_tag LOCUS_13710 29887 29627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 31035 31379 gene locus_tag LOCUS_13720 31035 31379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 31697 31503 gene locus_tag LOCUS_13730 31697 31503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 32602 33639 gene locus_tag LOCUS_13740 32602 33639 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 protein_id gnl|my_center|LOCUS_13740 33704 34750 gene locus_tag LOCUS_13750 33704 34750 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_13750 34895 36610 gene locus_tag LOCUS_13760 34895 36610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 36607 37725 gene locus_tag LOCUS_13770 36607 37725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_13770 38466 38542 gene locus_tag LOCUS_t00350 38466 38542 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39921 38749 gene locus_tag LOCUS_13780 39921 38749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence15 839 111 gene locus_tag LOCUS_13790 839 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1798 851 gene locus_tag LOCUS_13800 1798 851 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_13800 2002 4836 gene locus_tag LOCUS_13810 2002 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4833 6122 gene locus_tag LOCUS_13820 gene rimO 4833 6122 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_13820 6119 6658 gene locus_tag LOCUS_13830 gene pgsA 6119 6658 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_13830 6655 7911 gene locus_tag LOCUS_13840 6655 7911 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_13840 7955 9028 gene locus_tag LOCUS_13850 gene recA 7955 9028 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_13850 9628 9143 gene locus_tag LOCUS_13860 9628 9143 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 protein_id gnl|my_center|LOCUS_13860 10673 9645 gene locus_tag LOCUS_13870 10673 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11701 11021 gene locus_tag LOCUS_13880 11701 11021 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_13880 12039 11743 gene locus_tag LOCUS_13890 12039 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12794 12192 gene locus_tag LOCUS_13900 gene yihA 12794 12192 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_13900 15153 12775 gene locus_tag LOCUS_13910 gene lon 15153 12775 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_13910 16836 15193 gene locus_tag LOCUS_13920 gene lonB 16836 15193 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 protein_id gnl|my_center|LOCUS_13920 17803 16988 gene locus_tag LOCUS_13930 gene murI 17803 16988 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_13930 20007 18160 gene locus_tag LOCUS_13940 gene ftsH 20007 18160 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_13940 21774 20272 gene locus_tag LOCUS_13950 21774 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 22524 22018 gene locus_tag LOCUS_13960 gene rplQ 22524 22018 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331497.1 protein_id gnl|my_center|LOCUS_13960 23479 22538 gene locus_tag LOCUS_13970 23479 22538 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_13970 24156 23530 gene locus_tag LOCUS_13980 gene rpsD 24156 23530 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_13980 24579 24172 gene locus_tag LOCUS_13990 gene rpsK 24579 24172 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_13990 24962 24594 gene locus_tag LOCUS_14000 gene rpsM 24962 24594 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_14000 25425 25204 gene locus_tag LOCUS_14010 gene infA 25425 25204 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_14010 25720 25436 gene locus_tag LOCUS_14020 25720 25436 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 protein_id gnl|my_center|LOCUS_14020 26481 25717 gene locus_tag LOCUS_14030 gene map 26481 25717 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_14030 27095 26478 gene locus_tag LOCUS_14040 27095 26478 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_14040 28390 27110 gene locus_tag LOCUS_14050 gene secY 28390 27110 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_14050 28833 28390 gene locus_tag LOCUS_14060 gene rplO 28833 28390 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_14060 29034 28852 gene locus_tag LOCUS_14070 gene rpmD 29034 28852 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_14070 29554 29048 gene locus_tag LOCUS_14080 gene rpsE 29554 29048 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_14080 29935 29567 gene locus_tag LOCUS_14090 gene rplR 29935 29567 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705309.1 protein_id gnl|my_center|LOCUS_14090 30496 29957 gene locus_tag LOCUS_14100 gene rplF 30496 29957 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_14100 30932 30540 gene locus_tag LOCUS_14110 gene rpsH 30932 30540 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_14110 31132 30947 gene locus_tag LOCUS_14120 31132 30947 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_14120 31740 31147 gene locus_tag LOCUS_14130 gene rplE 31740 31147 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_14130 32108 31761 gene locus_tag LOCUS_14140 gene rplX 32108 31761 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258242.1 protein_id gnl|my_center|LOCUS_14140 32490 32122 gene locus_tag LOCUS_14150 gene rplN 32490 32122 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_14150 32766 32509 gene locus_tag LOCUS_14160 gene rpsQ 32766 32509 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_14160 32990 32787 gene locus_tag LOCUS_14170 gene rpmC 32990 32787 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720942.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence16 <1 1723 gene locus_tag LOCUS_14180 <1 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903185.1:C40 family peptidase 670 679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1938 3122 gene locus_tag LOCUS_14190 1938 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3143 3607 gene locus_tag LOCUS_14200 3143 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5017 3890 gene locus_tag LOCUS_14210 gene zinU 5017 3890 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_14210 5573 5190 gene locus_tag LOCUS_14220 5573 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5928 5608 gene locus_tag LOCUS_14230 5928 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 7415 6498 gene locus_tag LOCUS_14240 7415 6498 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_14240 7734 7585 gene locus_tag LOCUS_14250 7734 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 9296 7941 gene locus_tag LOCUS_14260 gene rlmD 9296 7941 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_14260 12745 9293 gene locus_tag LOCUS_14270 12745 9293 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_14270 13684 12755 gene locus_tag LOCUS_14280 gene whiA 13684 12755 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_14280 14624 13734 gene locus_tag LOCUS_14290 gene rapZ 14624 13734 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_14290 15542 14631 gene locus_tag LOCUS_14300 gene murB 15542 14631 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_14300 16635 15547 gene locus_tag LOCUS_14310 16635 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 16778 17083 gene locus_tag LOCUS_14320 gene spoIIAA 16778 17083 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_14320 17102 17536 gene locus_tag LOCUS_14330 gene spoIIAB 17102 17536 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_14330 17533 18336 gene locus_tag LOCUS_14340 gene sigF 17533 18336 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_14340 18350 19630 gene locus_tag LOCUS_14350 18350 19630 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_14350 20613 19723 gene locus_tag LOCUS_14360 20613 19723 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_14360 20879 21961 gene locus_tag LOCUS_14370 gene nahK 20879 21961 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence17 <1 1479 gene locus_tag LOCUS_14380 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033045549.1:1-deoxy-D-xylulose-5-phosphate synthase 1476 2288 gene locus_tag LOCUS_14390 1476 2288 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_14390 2507 3295 gene locus_tag LOCUS_14400 2507 3295 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_14400 3354 3803 gene locus_tag LOCUS_14410 3354 3803 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_14410 3819 5519 gene locus_tag LOCUS_14420 gene recN 3819 5519 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_14420 5670 6896 gene locus_tag LOCUS_14430 gene spoIVB 5670 6896 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_14430 6928 7704 gene locus_tag LOCUS_14440 gene spo0A 6928 7704 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_14440 7745 8317 gene locus_tag LOCUS_14450 7745 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8366 9541 gene locus_tag LOCUS_14460 8366 9541 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_14460 9545 10369 gene locus_tag LOCUS_14470 9545 10369 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_14470 10893 10462 gene locus_tag LOCUS_14480 10893 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 11292 10897 gene locus_tag LOCUS_14490 11292 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11469 11771 gene locus_tag LOCUS_14500 11469 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11768 12931 gene locus_tag LOCUS_14510 11768 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 12912 13892 gene locus_tag LOCUS_14520 12912 13892 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_14520 13873 16059 gene locus_tag LOCUS_14530 gene pgpH 13873 16059 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721972.1 protein_id gnl|my_center|LOCUS_14530 16065 16505 gene locus_tag LOCUS_14540 gene ybeY 16065 16505 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_14540 16502 16918 gene locus_tag LOCUS_14550 16502 16918 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383839.1 protein_id gnl|my_center|LOCUS_14550 16915 17805 gene locus_tag LOCUS_14560 gene era 16915 17805 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_14560 17893 18012 gene locus_tag LOCUS_14570 17893 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 18018 18761 gene locus_tag LOCUS_14580 18018 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 18936 21566 gene locus_tag LOCUS_14590 gene ppdK 18936 21566 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence18 699 139 gene locus_tag LOCUS_14600 gene lepB 699 139 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 protein_id gnl|my_center|LOCUS_14600 1310 696 gene locus_tag LOCUS_14610 1310 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1513 1310 gene locus_tag LOCUS_14620 1513 1310 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355974.1 protein_id gnl|my_center|LOCUS_14620 2502 1510 gene locus_tag LOCUS_14630 2502 1510 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_14630 2725 4035 gene locus_tag LOCUS_14640 gene dnaA 2725 4035 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_14640 4680 5780 gene locus_tag LOCUS_14650 gene dnaN 4680 5780 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_14650 5803 6462 gene locus_tag LOCUS_14660 5803 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 7061 7447 gene locus_tag LOCUS_14670 7061 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7444 9798 gene locus_tag LOCUS_14680 7444 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10319 11185 gene locus_tag LOCUS_14690 10319 11185 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_14690 11185 12582 gene locus_tag LOCUS_14700 gene gltA 11185 12582 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence19 636 82 gene locus_tag LOCUS_14710 636 82 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_14710 1014 4694 gene locus_tag LOCUS_14720 gene rpoB 1014 4694 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_14720 4735 8262 gene locus_tag LOCUS_14730 gene rpoC 4735 8262 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_14730 8365 9096 gene locus_tag LOCUS_14740 8365 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 9093 9446 gene locus_tag LOCUS_14750 9093 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 9485 9859 gene locus_tag LOCUS_14760 gene rpsL 9485 9859 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357676.1 protein_id gnl|my_center|LOCUS_14760 9872 10342 gene locus_tag LOCUS_14770 gene rpsG 9872 10342 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 protein_id gnl|my_center|LOCUS_14770 10354 12435 gene locus_tag LOCUS_14780 gene fusA 10354 12435 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence20 913 245 gene locus_tag LOCUS_14790 gene rpsC 913 245 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_14790 1316 927 gene locus_tag LOCUS_14800 gene rplV 1316 927 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_14800 1611 1330 gene locus_tag LOCUS_14810 gene rpsS 1611 1330 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_14810 2461 1628 gene locus_tag LOCUS_14820 gene rplB 2461 1628 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_14820 2768 2472 gene locus_tag LOCUS_14830 gene rplW 2768 2472 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_14830 3388 2768 gene locus_tag LOCUS_14840 gene rplD 3388 2768 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_14840 4032 3406 gene locus_tag LOCUS_14850 gene rplC 4032 3406 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_14850 4357 4052 gene locus_tag LOCUS_14860 gene rpsJ 4357 4052 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290443.1 protein_id gnl|my_center|LOCUS_14860 6670 4934 gene locus_tag LOCUS_14870 6670 4934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_14870 8277 6748 gene locus_tag LOCUS_14880 8277 6748 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_14880 8594 9160 gene locus_tag LOCUS_14890 8594 9160 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390032.1 protein_id gnl|my_center|LOCUS_14890