>Feature sequence01 434 15 gene locus_tag LOCUS_00010 434 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1294 479 gene locus_tag LOCUS_00020 1294 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2089 1664 gene locus_tag LOCUS_00030 2089 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2512 2093 gene locus_tag LOCUS_00040 2512 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3167 2532 gene locus_tag LOCUS_00050 3167 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4684 3296 gene locus_tag LOCUS_00060 4684 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5209 4802 gene locus_tag LOCUS_00070 5209 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6142 5510 gene locus_tag LOCUS_00080 6142 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6926 6201 gene locus_tag LOCUS_00090 6926 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8127 7081 gene locus_tag LOCUS_00100 8127 7081 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_00100 8378 8118 gene locus_tag LOCUS_00110 8378 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8697 8368 gene locus_tag LOCUS_00120 8697 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9143 8694 gene locus_tag LOCUS_00130 9143 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10308 9145 gene locus_tag LOCUS_00140 10308 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10825 10367 gene locus_tag LOCUS_00150 10825 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11652 10822 gene locus_tag LOCUS_00160 11652 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13262 11649 gene locus_tag LOCUS_00170 13262 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14697 13273 gene locus_tag LOCUS_00180 14697 13273 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_00180 15142 14687 gene locus_tag LOCUS_00190 15142 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15572 15147 gene locus_tag LOCUS_00200 15572 15147 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_00200 16225 15653 gene locus_tag LOCUS_00210 16225 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22582 16253 gene locus_tag LOCUS_00220 22582 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22964 22566 gene locus_tag LOCUS_00230 22964 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23331 23065 gene locus_tag LOCUS_00240 23331 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29792 23328 gene locus_tag LOCUS_00250 29792 23328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30303 29905 gene locus_tag LOCUS_00260 30303 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32208 30526 gene locus_tag LOCUS_00270 32208 30526 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769667.1 protein_id gnl|my_center|LOCUS_00270 32966 32415 gene locus_tag LOCUS_00280 32966 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33813 33376 gene locus_tag LOCUS_00290 33813 33376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34609 33998 gene locus_tag LOCUS_00300 34609 33998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35545 34955 gene locus_tag LOCUS_00310 35545 34955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35913 35695 gene locus_tag LOCUS_00320 35913 35695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38396 36534 gene locus_tag LOCUS_00330 38396 36534 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_00330 39640 38396 gene locus_tag LOCUS_00340 39640 38396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41148 39637 gene locus_tag LOCUS_00350 41148 39637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42026 41154 gene locus_tag LOCUS_00360 42026 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42821 42042 gene locus_tag LOCUS_00370 42821 42042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43210 43737 gene locus_tag LOCUS_00380 43210 43737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44410 43907 gene locus_tag LOCUS_00390 44410 43907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47287 44714 gene locus_tag LOCUS_00400 47287 44714 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_00400 49593 47437 gene locus_tag LOCUS_00410 49593 47437 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_00410 49956 49753 gene locus_tag LOCUS_00420 49956 49753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 50173 50598 gene locus_tag LOCUS_00430 50173 50598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51216 50581 gene locus_tag LOCUS_00440 51216 50581 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_00440 51471 53582 gene locus_tag LOCUS_00450 51471 53582 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_00450 53612 54655 gene locus_tag LOCUS_00460 53612 54655 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_00460 56160 54883 gene locus_tag LOCUS_00470 56160 54883 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_00470 59059 56324 gene locus_tag LOCUS_00480 59059 56324 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_00480 60400 59072 gene locus_tag LOCUS_00490 60400 59072 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_00490 60550 61731 gene locus_tag LOCUS_00500 60550 61731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61984 64629 gene locus_tag LOCUS_00510 gene mutS 61984 64629 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_00510 66050 64626 gene locus_tag LOCUS_00520 gene nhaA 66050 64626 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_00520 67371 66121 gene locus_tag LOCUS_00530 67371 66121 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_00530 67933 68679 gene locus_tag LOCUS_00540 gene fabG 67933 68679 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_00540 69062 68676 gene locus_tag LOCUS_00550 69062 68676 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_00550 69956 69192 gene locus_tag LOCUS_00560 gene agaR 69956 69192 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_00560 70506 73493 gene locus_tag LOCUS_00570 70506 73493 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_00570 73504 75516 gene locus_tag LOCUS_00580 73504 75516 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_00580 75579 78713 gene locus_tag LOCUS_00590 75579 78713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 78716 80545 gene locus_tag LOCUS_00600 78716 80545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 80555 81409 gene locus_tag LOCUS_00610 gene murQ 80555 81409 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_00610 81413 82780 gene locus_tag LOCUS_00620 81413 82780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 82800 85067 gene locus_tag LOCUS_00630 82800 85067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 85129 86202 gene locus_tag LOCUS_00640 85129 86202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 86223 87416 gene locus_tag LOCUS_00650 gene gluP 86223 87416 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785331.1 protein_id gnl|my_center|LOCUS_00650 87436 88290 gene locus_tag LOCUS_00660 87436 88290 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_00660 89566 88814 gene locus_tag LOCUS_00670 89566 88814 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_00670 92106 89764 gene locus_tag LOCUS_00680 92106 89764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_00680 93296 92883 gene locus_tag LOCUS_00690 93296 92883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 94820 93378 gene locus_tag LOCUS_00700 94820 93378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 94961 96358 gene locus_tag LOCUS_00710 94961 96358 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764196.1 protein_id gnl|my_center|LOCUS_00710 97287 96748 gene locus_tag LOCUS_00720 97287 96748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 98745 97624 gene locus_tag LOCUS_00730 98745 97624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 100561 99755 gene locus_tag LOCUS_00740 100561 99755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 101392 100664 gene locus_tag LOCUS_00750 101392 100664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 102837 101410 gene locus_tag LOCUS_00760 102837 101410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 103329 102922 gene locus_tag LOCUS_00770 103329 102922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 105066 103585 gene locus_tag LOCUS_00780 105066 103585 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108027.1 protein_id gnl|my_center|LOCUS_00780 106356 105760 gene locus_tag LOCUS_00790 106356 105760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 107164 106604 gene locus_tag LOCUS_00800 107164 106604 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_00800 107288 108211 gene locus_tag LOCUS_00810 107288 108211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 108326 111850 gene locus_tag LOCUS_00820 108326 111850 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_00820 111863 113722 gene locus_tag LOCUS_00830 111863 113722 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_00830 113745 115892 gene locus_tag LOCUS_00840 113745 115892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 115899 118352 gene locus_tag LOCUS_00850 115899 118352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 118363 122529 gene locus_tag LOCUS_00860 118363 122529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 122728 123681 gene locus_tag LOCUS_00870 122728 123681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 125574 124036 gene locus_tag LOCUS_00880 125574 124036 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_00880 127199 126156 gene locus_tag LOCUS_00890 127199 126156 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_00890 127653 128282 gene locus_tag LOCUS_00900 127653 128282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 128298 128519 gene locus_tag LOCUS_00910 128298 128519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 129801 128530 gene locus_tag LOCUS_00920 129801 128530 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_00920 130059 130715 gene locus_tag LOCUS_00930 130059 130715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 132801 131149 gene locus_tag LOCUS_00940 132801 131149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 133337 132903 gene locus_tag LOCUS_00950 133337 132903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 134553 133339 gene locus_tag LOCUS_00960 134553 133339 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331495.1 protein_id gnl|my_center|LOCUS_00960 135692 134556 gene locus_tag LOCUS_00970 135692 134556 CDS product SAVED domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082906.1 protein_id gnl|my_center|LOCUS_00970 137454 135838 gene locus_tag LOCUS_00980 137454 135838 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_00980 137698 137486 gene locus_tag LOCUS_00990 137698 137486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 138726 137656 gene locus_tag LOCUS_01000 138726 137656 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_01000 139938 138739 gene locus_tag LOCUS_01010 139938 138739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 142913 139959 gene locus_tag LOCUS_01020 142913 139959 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_01020 143999 142962 gene locus_tag LOCUS_01030 143999 142962 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_01030 144199 144738 gene locus_tag LOCUS_01040 144199 144738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 144854 145285 gene locus_tag LOCUS_01050 144854 145285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 145224 145883 gene locus_tag LOCUS_01060 145224 145883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 145852 146097 gene locus_tag LOCUS_01070 145852 146097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 146727 146140 gene locus_tag LOCUS_01080 146727 146140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 147238 146732 gene locus_tag LOCUS_01090 147238 146732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 148042 147437 gene locus_tag LOCUS_01100 148042 147437 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_01100 149408 148044 gene locus_tag LOCUS_01110 149408 148044 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_01110 150048 149557 gene locus_tag LOCUS_01120 gene folK 150048 149557 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_01120 150719 150279 gene locus_tag LOCUS_01130 150719 150279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 151374 150955 gene locus_tag LOCUS_01140 151374 150955 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_01140 152647 151448 gene locus_tag LOCUS_01150 152647 151448 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_01150 152804 153391 gene locus_tag LOCUS_01160 gene ruvA 152804 153391 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_01160 155545 153632 gene locus_tag LOCUS_01170 gene mnmG 155545 153632 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_01170 156045 155626 gene locus_tag LOCUS_01180 gene ybeY 156045 155626 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_01180 156184 156873 gene locus_tag LOCUS_01190 156184 156873 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_01190 156978 158159 gene locus_tag LOCUS_01200 gene hflX 156978 158159 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_01200 159240 158461 gene locus_tag LOCUS_01210 159240 158461 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_01210 161195 159249 gene locus_tag LOCUS_01220 161195 159249 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_01220 162342 161251 gene locus_tag LOCUS_01230 162342 161251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 163357 162326 gene locus_tag LOCUS_01240 gene ruvB 163357 162326 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_01240 163682 166876 gene locus_tag LOCUS_01250 gene mfd 163682 166876 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_01250 166888 167640 gene locus_tag LOCUS_01260 166888 167640 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_01260 167621 168946 gene locus_tag LOCUS_01270 167621 168946 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_01270 168971 170275 gene locus_tag LOCUS_01280 168971 170275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 170283 170912 gene locus_tag LOCUS_01290 170283 170912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 170987 173071 gene locus_tag LOCUS_01300 170987 173071 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_01300 173364 176522 gene locus_tag LOCUS_01310 173364 176522 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_01310 176530 178461 gene locus_tag LOCUS_01320 176530 178461 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070102931.1 protein_id gnl|my_center|LOCUS_01320 178501 181584 gene locus_tag LOCUS_01330 178501 181584 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_01330 181597 183327 gene locus_tag LOCUS_01340 181597 183327 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_01340 183366 184958 gene locus_tag LOCUS_01350 183366 184958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 184990 186918 gene locus_tag LOCUS_01360 184990 186918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 186924 189653 gene locus_tag LOCUS_01370 186924 189653 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_01370 189730 191511 gene locus_tag LOCUS_01380 189730 191511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 191553 193154 gene locus_tag LOCUS_01390 191553 193154 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303098.1 protein_id gnl|my_center|LOCUS_01390 194571 193468 gene locus_tag LOCUS_01400 gene ychF 194571 193468 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_01400 194996 195901 gene locus_tag LOCUS_01410 194996 195901 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_01410 196004 197155 gene locus_tag LOCUS_01420 gene galK 196004 197155 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_01420 199873 197237 gene locus_tag LOCUS_01430 199873 197237 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_01430 203748 199870 gene locus_tag LOCUS_01440 203748 199870 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_01440 204030 207236 gene locus_tag LOCUS_01450 204030 207236 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_01450 207243 209114 gene locus_tag LOCUS_01460 207243 209114 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_01460 209134 209817 gene locus_tag LOCUS_01470 209134 209817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 209833 210837 gene locus_tag LOCUS_01480 209833 210837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 210886 212598 gene locus_tag LOCUS_01490 210886 212598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 212637 214073 gene locus_tag LOCUS_01500 212637 214073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 214087 215304 gene locus_tag LOCUS_01510 214087 215304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 215310 217565 gene locus_tag LOCUS_01520 215310 217565 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_01520 218319 217669 gene locus_tag LOCUS_01530 218319 217669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 218758 218483 gene locus_tag LOCUS_01540 218758 218483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 220110 218758 gene locus_tag LOCUS_01550 220110 218758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 223775 220422 gene locus_tag LOCUS_01560 223775 220422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 223973 224173 gene locus_tag LOCUS_01570 223973 224173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 224154 224666 gene locus_tag LOCUS_01580 224154 224666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 224916 226649 gene locus_tag LOCUS_01590 224916 226649 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_01590 226653 227621 gene locus_tag LOCUS_01600 226653 227621 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_01600 227630 228682 gene locus_tag LOCUS_01610 227630 228682 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_01610 228848 229642 gene locus_tag LOCUS_01620 228848 229642 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_01620 230165 231274 gene locus_tag LOCUS_01630 230165 231274 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_01630 232809 231715 gene locus_tag LOCUS_01640 232809 231715 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_01640 235413 233023 gene locus_tag LOCUS_01650 235413 233023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_01650 236224 236811 gene locus_tag LOCUS_01660 236224 236811 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_01660 236945 238306 gene locus_tag LOCUS_01670 236945 238306 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_01670 239165 238311 gene locus_tag LOCUS_01680 239165 238311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 239268 240317 gene locus_tag LOCUS_01690 239268 240317 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_01690 241108 240431 gene locus_tag LOCUS_01700 241108 240431 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_01700 241921 241175 gene locus_tag LOCUS_01710 241921 241175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 242476 241925 gene locus_tag LOCUS_01720 242476 241925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 245892 242473 gene locus_tag LOCUS_01730 245892 242473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 248998 245852 gene locus_tag LOCUS_01740 248998 245852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 249995 249045 gene locus_tag LOCUS_01750 249995 249045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 250933 250058 gene locus_tag LOCUS_01760 250933 250058 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_01760 253006 251003 gene locus_tag LOCUS_01770 253006 251003 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_01770 254371 257556 gene locus_tag LOCUS_01780 254371 257556 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203145.1 protein_id gnl|my_center|LOCUS_01780 257565 259466 gene locus_tag LOCUS_01790 257565 259466 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788911.1 protein_id gnl|my_center|LOCUS_01790 259494 260339 gene locus_tag LOCUS_01800 259494 260339 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788909.1 protein_id gnl|my_center|LOCUS_01800 260336 262624 gene locus_tag LOCUS_01810 260336 262624 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798674.1 protein_id gnl|my_center|LOCUS_01810 262687 265881 gene locus_tag LOCUS_01820 262687 265881 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_01820 265994 267382 gene locus_tag LOCUS_01830 265994 267382 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_01830 267404 268156 gene locus_tag LOCUS_01840 267404 268156 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_01840 269530 268430 gene locus_tag LOCUS_01850 269530 268430 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_01850 270072 269671 gene locus_tag LOCUS_01860 270072 269671 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020901.1 protein_id gnl|my_center|LOCUS_01860 272615 270090 gene locus_tag LOCUS_01870 272615 270090 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_01870 273458 272625 gene locus_tag LOCUS_01880 gene cdaA 273458 272625 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_01880 273648 274274 gene locus_tag LOCUS_01890 gene rplC 273648 274274 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_01890 274277 274906 gene locus_tag LOCUS_01900 gene rplD 274277 274906 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_01900 274919 275209 gene locus_tag LOCUS_01910 gene rplW 274919 275209 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_01910 275224 276051 gene locus_tag LOCUS_01920 gene rplB 275224 276051 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_01920 276077 276346 gene locus_tag LOCUS_01930 gene rpsS 276077 276346 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_01930 276366 276791 gene locus_tag LOCUS_01940 gene rplV 276366 276791 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_01940 276793 277575 gene locus_tag LOCUS_01950 gene rpsC 276793 277575 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_01950 277657 278544 gene locus_tag LOCUS_01960 277657 278544 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 protein_id gnl|my_center|LOCUS_01960 278531 278728 gene locus_tag LOCUS_01970 278531 278728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 278701 280008 gene locus_tag LOCUS_01980 278701 280008 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_01980 280010 282781 gene locus_tag LOCUS_01990 280010 282781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 282898 282713 gene locus_tag LOCUS_02000 282898 282713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 >Feature sequence02 989 684 gene locus_tag LOCUS_02010 gene cas2 989 684 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_02010 1936 1022 gene locus_tag LOCUS_02020 gene cas1 1936 1022 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_02020 5693 1929 gene locus_tag LOCUS_02030 gene cas9 5693 1929 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_02030 6821 7951 gene locus_tag LOCUS_02040 gene prfB 6821 7951 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_02040 7977 9593 gene locus_tag LOCUS_02050 7977 9593 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_02050 9676 11370 gene locus_tag LOCUS_02060 9676 11370 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_02060 11590 12162 gene locus_tag LOCUS_02070 11590 12162 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763535.1 protein_id gnl|my_center|LOCUS_02070 12166 13176 gene locus_tag LOCUS_02080 12166 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 13267 16569 gene locus_tag LOCUS_02090 13267 16569 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_02090 16716 18374 gene locus_tag LOCUS_02100 16716 18374 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_02100 18467 20938 gene locus_tag LOCUS_02110 18467 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_02110 21050 22924 gene locus_tag LOCUS_02120 21050 22924 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_02120 24531 22996 gene locus_tag LOCUS_02130 24531 22996 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_02130 26754 24535 gene locus_tag LOCUS_02140 26754 24535 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_02140 26897 26996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27467 28132 gene locus_tag LOCUS_02150 27467 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 28122 28451 gene locus_tag LOCUS_02160 28122 28451 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_02160 28488 29543 gene locus_tag LOCUS_02170 28488 29543 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_02170 32381 29940 gene locus_tag LOCUS_02180 gene pnp 32381 29940 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_02180 32807 32532 gene locus_tag LOCUS_02190 gene rpsO 32807 32532 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_02190 35275 32924 gene locus_tag LOCUS_02200 35275 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 35635 35291 gene locus_tag LOCUS_02210 35635 35291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 36135 35794 gene locus_tag LOCUS_02220 36135 35794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 36875 36318 gene locus_tag LOCUS_02230 36875 36318 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_02230 37827 36859 gene locus_tag LOCUS_02240 37827 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 38765 37827 gene locus_tag LOCUS_02250 38765 37827 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_02250 38860 39210 gene locus_tag LOCUS_02260 38860 39210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 39223 40584 gene locus_tag LOCUS_02270 gene purB 39223 40584 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_02270 41865 40633 gene locus_tag LOCUS_02280 41865 40633 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_02280 42548 41862 gene locus_tag LOCUS_02290 42548 41862 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_02290 42653 43483 gene locus_tag LOCUS_02300 gene folP 42653 43483 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_02300 44774 45016 gene locus_tag LOCUS_02310 44774 45016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 45006 48143 gene locus_tag LOCUS_02320 45006 48143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767440.1 protein_id gnl|my_center|LOCUS_02320 48148 52206 gene locus_tag LOCUS_02330 48148 52206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 52208 52657 gene locus_tag LOCUS_02340 52208 52657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 52925 54412 gene locus_tag LOCUS_02350 52925 54412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 54417 54899 gene locus_tag LOCUS_02360 54417 54899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 55067 55708 gene locus_tag LOCUS_02370 55067 55708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 58807 55844 gene locus_tag LOCUS_02380 gene infB 58807 55844 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_02380 60116 58851 gene locus_tag LOCUS_02390 gene nusA 60116 58851 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_02390 60606 60136 gene locus_tag LOCUS_02400 gene rimP 60606 60136 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_02400 60728 61750 gene locus_tag LOCUS_02410 gene lpxD 60728 61750 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_02410 61853 62767 gene locus_tag LOCUS_02420 61853 62767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 62783 63595 gene locus_tag LOCUS_02430 gene lpxA 62783 63595 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_02430 63615 64292 gene locus_tag LOCUS_02440 63615 64292 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_02440 66019 64289 gene locus_tag LOCUS_02450 66019 64289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 67468 66038 gene locus_tag LOCUS_02460 67468 66038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 67620 69098 gene locus_tag LOCUS_02470 gene proS 67620 69098 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_02470 69119 70222 gene locus_tag LOCUS_02480 69119 70222 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_02480 70234 71577 gene locus_tag LOCUS_02490 gene tilS 70234 71577 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_02490 73390 71570 gene locus_tag LOCUS_02500 gene sppA 73390 71570 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_02500 73538 75736 gene locus_tag LOCUS_02510 73538 75736 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_02510 75802 76131 gene locus_tag LOCUS_02520 75802 76131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 76137 77549 gene locus_tag LOCUS_02530 gene hisS 76137 77549 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_02530 77837 77910 gene locus_tag LOCUS_t00010 77837 77910 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77996 80719 gene locus_tag LOCUS_02540 77996 80719 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_02540 80737 81777 gene locus_tag LOCUS_02550 gene manA 80737 81777 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173201.1 protein_id gnl|my_center|LOCUS_02550 81781 82233 gene locus_tag LOCUS_02560 81781 82233 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_02560 82780 82995 gene locus_tag LOCUS_02570 82780 82995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 83531 83968 gene locus_tag LOCUS_02580 83531 83968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 84077 84286 gene locus_tag LOCUS_02590 84077 84286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 84347 85255 gene locus_tag LOCUS_02600 84347 85255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 85416 85297 gene locus_tag LOCUS_02610 85416 85297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 86329 86781 gene locus_tag LOCUS_02620 86329 86781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 86814 89009 gene locus_tag LOCUS_02630 86814 89009 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_02630 89014 90324 gene locus_tag LOCUS_02640 89014 90324 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759964.1 protein_id gnl|my_center|LOCUS_02640 90359 90739 gene locus_tag LOCUS_02650 90359 90739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 90839 92515 gene locus_tag LOCUS_02660 90839 92515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761175.1 protein_id gnl|my_center|LOCUS_02660 92841 93011 gene locus_tag LOCUS_02670 92841 93011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 93109 93873 gene locus_tag LOCUS_02680 93109 93873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 93927 96512 gene locus_tag LOCUS_02690 93927 96512 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_02690 96843 97010 gene locus_tag LOCUS_02700 96843 97010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 97267 97968 gene locus_tag LOCUS_02710 97267 97968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 98045 99454 gene locus_tag LOCUS_02720 98045 99454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 99561 102149 gene locus_tag LOCUS_02730 99561 102149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 102847 102293 gene locus_tag LOCUS_02740 102847 102293 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_02740 105973 103187 gene locus_tag LOCUS_02750 105973 103187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 106672 109443 gene locus_tag LOCUS_02760 106672 109443 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583217.1 protein_id gnl|my_center|LOCUS_02760 109457 110896 gene locus_tag LOCUS_02770 109457 110896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 111020 112420 gene locus_tag LOCUS_02780 111020 112420 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108267.1 protein_id gnl|my_center|LOCUS_02780 112458 115643 gene locus_tag LOCUS_02790 112458 115643 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_02790 115656 117491 gene locus_tag LOCUS_02800 115656 117491 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_02800 117562 119724 gene locus_tag LOCUS_02810 117562 119724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 119877 120899 gene locus_tag LOCUS_02820 119877 120899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 121043 123892 gene locus_tag LOCUS_02830 121043 123892 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_02830 123933 127067 gene locus_tag LOCUS_02840 123933 127067 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_02840 127108 127767 gene locus_tag LOCUS_02850 127108 127767 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761105.1 protein_id gnl|my_center|LOCUS_02850 127767 130157 gene locus_tag LOCUS_02860 127767 130157 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_02860 130171 130851 gene locus_tag LOCUS_02870 130171 130851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 131848 130868 gene locus_tag LOCUS_02880 131848 130868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 132035 133036 gene locus_tag LOCUS_02890 132035 133036 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02890 133050 133457 gene locus_tag LOCUS_02900 133050 133457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 134333 133428 gene locus_tag LOCUS_02910 gene truB 134333 133428 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_02910 134771 134337 gene locus_tag LOCUS_02920 gene rpiB 134771 134337 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_02920 135478 134786 gene locus_tag LOCUS_02930 gene tsaB 135478 134786 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_02930 135972 135478 gene locus_tag LOCUS_02940 135972 135478 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_02940 136077 139514 gene locus_tag LOCUS_02950 gene ileS 136077 139514 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_02950 139541 139972 gene locus_tag LOCUS_02960 139541 139972 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_02960 139972 140610 gene locus_tag LOCUS_02970 139972 140610 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_02970 140794 140879 gene locus_tag LOCUS_t00020 140794 140879 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 142399 141425 gene locus_tag LOCUS_02980 142399 141425 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_02980 143115 142396 gene locus_tag LOCUS_02990 143115 142396 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_02990 143437 143841 gene locus_tag LOCUS_03000 143437 143841 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_03000 143890 144885 gene locus_tag LOCUS_03010 143890 144885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 145077 146792 gene locus_tag LOCUS_03020 145077 146792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 146801 147538 gene locus_tag LOCUS_03030 146801 147538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 147543 148784 gene locus_tag LOCUS_03040 147543 148784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 148790 150622 gene locus_tag LOCUS_03050 148790 150622 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203376.1 protein_id gnl|my_center|LOCUS_03050 150622 151365 gene locus_tag LOCUS_03060 150622 151365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_03060 151385 152113 gene locus_tag LOCUS_03070 151385 152113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 152117 153724 gene locus_tag LOCUS_03080 152117 153724 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_03080 154898 153933 gene locus_tag LOCUS_03090 154898 153933 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_03090 155473 154901 gene locus_tag LOCUS_03100 155473 154901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 155610 157568 gene locus_tag LOCUS_03110 gene thrS 155610 157568 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_03110 157623 158255 gene locus_tag LOCUS_03120 gene infC 157623 158255 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_03120 158302 158496 gene locus_tag LOCUS_03130 gene rpmI 158302 158496 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_03130 158574 158918 gene locus_tag LOCUS_03140 gene rplT 158574 158918 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_03140 158929 160275 gene locus_tag LOCUS_03150 158929 160275 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_03150 160391 160597 gene locus_tag LOCUS_03160 160391 160597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 160611 160799 gene locus_tag LOCUS_03170 gene rpmG 160611 160799 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_03170 160817 160978 gene locus_tag LOCUS_03180 160817 160978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 160990 161202 gene locus_tag LOCUS_03190 160990 161202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 161178 162110 gene locus_tag LOCUS_03200 gene ftsY 161178 162110 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_03200 162123 164564 gene locus_tag LOCUS_03210 gene pheT 162123 164564 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_03210 164569 165282 gene locus_tag LOCUS_03220 164569 165282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 165275 166459 gene locus_tag LOCUS_03230 165275 166459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 166462 167217 gene locus_tag LOCUS_03240 166462 167217 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_03240 167260 168153 gene locus_tag LOCUS_03250 gene deoC 167260 168153 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_03250 169501 168155 gene locus_tag LOCUS_03260 169501 168155 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_03260 169647 171221 gene locus_tag LOCUS_03270 169647 171221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 171726 175058 gene locus_tag LOCUS_03280 171726 175058 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_03280 175076 176659 gene locus_tag LOCUS_03290 175076 176659 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_03290 176680 177576 gene locus_tag LOCUS_03300 176680 177576 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762845.1 protein_id gnl|my_center|LOCUS_03300 177591 178895 gene locus_tag LOCUS_03310 177591 178895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 178911 180836 gene locus_tag LOCUS_03320 178911 180836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 180837 181100 gene locus_tag LOCUS_03330 180837 181100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 181121 184363 gene locus_tag LOCUS_03340 181121 184363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 184615 186717 gene locus_tag LOCUS_03350 184615 186717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 186731 187627 gene locus_tag LOCUS_03360 186731 187627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 187858 187941 gene locus_tag LOCUS_t00030 187858 187941 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 188171 189097 gene locus_tag LOCUS_03370 188171 189097 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_03370 189346 189822 gene locus_tag LOCUS_03380 189346 189822 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_03380 189843 190460 gene locus_tag LOCUS_03390 189843 190460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_03390 190460 191686 gene locus_tag LOCUS_03400 190460 191686 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_03400 191709 192689 gene locus_tag LOCUS_03410 gene argC 191709 192689 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_03410 192705 193826 gene locus_tag LOCUS_03420 192705 193826 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_03420 193823 194773 gene locus_tag LOCUS_03430 193823 194773 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_03430 194893 195681 gene locus_tag LOCUS_03440 gene argB 194893 195681 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_03440 196035 196727 gene locus_tag LOCUS_03450 196035 196727 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_03450 198877 196736 gene locus_tag LOCUS_03460 198877 196736 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_03460 198927 199964 gene locus_tag LOCUS_03470 198927 199964 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_03470 201047 200139 gene locus_tag LOCUS_03480 201047 200139 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_03480 201805 202917 gene locus_tag LOCUS_03490 201805 202917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 203813 205489 gene locus_tag LOCUS_03500 203813 205489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761175.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence03 1454 426 gene locus_tag LOCUS_03510 gene mltG 1454 426 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_03510 2575 1454 gene locus_tag LOCUS_03520 2575 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3651 2710 gene locus_tag LOCUS_03530 3651 2710 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_03530 5511 3655 gene locus_tag LOCUS_03540 gene rpsA 5511 3655 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_03540 6594 5647 gene locus_tag LOCUS_03550 gene corA 6594 5647 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_03550 7484 6921 gene locus_tag LOCUS_03560 7484 6921 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764711.1 protein_id gnl|my_center|LOCUS_03560 8162 7521 gene locus_tag LOCUS_03570 gene recR 8162 7521 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_03570 8987 8163 gene locus_tag LOCUS_03580 gene murQ 8987 8163 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_03580 9897 9025 gene locus_tag LOCUS_03590 9897 9025 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_03590 11112 10000 gene locus_tag LOCUS_03600 11112 10000 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_03600 11718 11125 gene locus_tag LOCUS_03610 11718 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11823 13631 gene locus_tag LOCUS_03620 11823 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 13645 15057 gene locus_tag LOCUS_03630 13645 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 16289 15141 gene locus_tag LOCUS_03640 16289 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_03640 17346 16330 gene locus_tag LOCUS_03650 17346 16330 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_03650 18639 17638 gene locus_tag LOCUS_03660 18639 17638 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_03660 18770 19072 gene locus_tag LOCUS_03670 18770 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 21101 19497 gene locus_tag LOCUS_03680 21101 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 21646 21176 gene locus_tag LOCUS_03690 gene coaD 21646 21176 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_03690 22391 21684 gene locus_tag LOCUS_03700 gene ung 22391 21684 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528805.1 protein_id gnl|my_center|LOCUS_03700 24893 22449 gene locus_tag LOCUS_03710 gene lon 24893 22449 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_03710 25073 25354 gene locus_tag LOCUS_03720 25073 25354 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_03720 25603 27174 gene locus_tag LOCUS_03730 25603 27174 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_03730 28932 27229 gene locus_tag LOCUS_03740 gene lnt 28932 27229 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_03740 31516 28955 gene locus_tag LOCUS_03750 31516 28955 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_03750 31917 31513 gene locus_tag LOCUS_03760 31917 31513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 32045 32518 gene locus_tag LOCUS_03770 gene rlmH 32045 32518 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_03770 32515 36075 gene locus_tag LOCUS_03780 32515 36075 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_03780 36677 36090 gene locus_tag LOCUS_03790 gene eamB 36677 36090 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 protein_id gnl|my_center|LOCUS_03790 36842 36770 gene locus_tag LOCUS_t00040 36842 36770 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37046 36864 gene locus_tag LOCUS_03800 gene rpmF 37046 36864 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_03800 37609 37070 gene locus_tag LOCUS_03810 37609 37070 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_03810 39499 37688 gene locus_tag LOCUS_03820 gene typA 39499 37688 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_03820 41086 39629 gene locus_tag LOCUS_03830 41086 39629 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_03830 41310 41119 gene locus_tag LOCUS_03840 41310 41119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 41932 41222 gene locus_tag LOCUS_03850 41932 41222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 42188 43528 gene locus_tag LOCUS_03860 gene argH 42188 43528 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_03860 44957 43581 gene locus_tag LOCUS_03870 44957 43581 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_03870 45523 44954 gene locus_tag LOCUS_03880 45523 44954 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_03880 46231 45542 gene locus_tag LOCUS_03890 46231 45542 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_03890 46354 47799 gene locus_tag LOCUS_03900 46354 47799 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_03900 47803 48768 gene locus_tag LOCUS_03910 47803 48768 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_03910 49144 48707 gene locus_tag LOCUS_03920 gene mscL 49144 48707 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_03920 49899 49153 gene locus_tag LOCUS_03930 49899 49153 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_03930 51315 49900 gene locus_tag LOCUS_03940 51315 49900 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_03940 52133 51330 gene locus_tag LOCUS_03950 52133 51330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 52186 52524 gene locus_tag LOCUS_03960 52186 52524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 52735 53022 gene locus_tag LOCUS_03970 52735 53022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 54320 53028 gene locus_tag LOCUS_03980 54320 53028 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_03980 55654 54329 gene locus_tag LOCUS_03990 55654 54329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_03990 57892 55670 gene locus_tag LOCUS_04000 57892 55670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 58482 57892 gene locus_tag LOCUS_04010 58482 57892 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_04010 60172 58487 gene locus_tag LOCUS_04020 60172 58487 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_04020 60964 60179 gene locus_tag LOCUS_04030 60964 60179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 61772 60969 gene locus_tag LOCUS_04040 61772 60969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 61898 61974 gene locus_tag LOCUS_t00050 61898 61974 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 62676 63218 gene locus_tag LOCUS_04050 62676 63218 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948788.1 protein_id gnl|my_center|LOCUS_04050 65307 63223 gene locus_tag LOCUS_04060 65307 63223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 65626 65700 gene locus_tag LOCUS_t00060 65626 65700 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67515 66454 gene locus_tag LOCUS_04070 67515 66454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 68879 67521 gene locus_tag LOCUS_04080 68879 67521 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_04080 69445 68891 gene locus_tag LOCUS_04090 gene def 69445 68891 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_04090 69877 69458 gene locus_tag LOCUS_04100 gene ruvX 69877 69458 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_04100 69923 70771 gene locus_tag LOCUS_04110 69923 70771 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_04110 70771 71943 gene locus_tag LOCUS_04120 70771 71943 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_04120 71943 73283 gene locus_tag LOCUS_04130 gene rseP 71943 73283 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_04130 73503 74510 gene locus_tag LOCUS_04140 73503 74510 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_04140 74604 74676 gene locus_tag LOCUS_t00070 74604 74676 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 74698 74952 gene locus_tag LOCUS_04150 gene rpsT 74698 74952 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_04150 75007 75080 gene locus_tag LOCUS_t00080 75007 75080 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 75743 75273 gene locus_tag LOCUS_04160 75743 75273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 77992 75761 gene locus_tag LOCUS_04170 gene nrdD 77992 75761 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_04170 79523 78183 gene locus_tag LOCUS_04180 79523 78183 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_04180 80353 79553 gene locus_tag LOCUS_04190 80353 79553 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_04190 80468 81034 gene locus_tag LOCUS_04200 80468 81034 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965573.1 protein_id gnl|my_center|LOCUS_04200 81236 81745 gene locus_tag LOCUS_04210 81236 81745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 84057 81742 gene locus_tag LOCUS_04220 84057 81742 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_04220 86112 84529 gene locus_tag LOCUS_04230 gene guaA 86112 84529 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_04230 86429 86193 gene locus_tag LOCUS_04240 86429 86193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 87895 86426 gene locus_tag LOCUS_04250 87895 86426 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303185.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 89109 87895 gene locus_tag LOCUS_04260 89109 87895 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_04260 90980 89109 gene locus_tag LOCUS_04270 90980 89109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 92380 90989 gene locus_tag LOCUS_04280 92380 90989 CDS product alpha amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107271.1 protein_id gnl|my_center|LOCUS_04280 94082 92385 gene locus_tag LOCUS_04290 94082 92385 CDS product DUF5018 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107272.1 protein_id gnl|my_center|LOCUS_04290 95761 94094 gene locus_tag LOCUS_04300 95761 94094 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766059.1 protein_id gnl|my_center|LOCUS_04300 98970 95776 gene locus_tag LOCUS_04310 98970 95776 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766060.1 protein_id gnl|my_center|LOCUS_04310 99196 100299 gene locus_tag LOCUS_04320 99196 100299 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766063.1 protein_id gnl|my_center|LOCUS_04320 100321 101697 gene locus_tag LOCUS_04330 100321 101697 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_04330 101703 102905 gene locus_tag LOCUS_04340 101703 102905 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_04340 103266 102937 gene locus_tag LOCUS_04350 103266 102937 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_04350 103595 103266 gene locus_tag LOCUS_04360 103595 103266 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555815.1 protein_id gnl|my_center|LOCUS_04360 103922 105388 gene locus_tag LOCUS_04370 103922 105388 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_04370 105595 105694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106824 105856 gene locus_tag LOCUS_04380 106824 105856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 107005 106817 gene locus_tag LOCUS_04390 107005 106817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 107064 107258 gene locus_tag LOCUS_04400 107064 107258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 108182 107307 gene locus_tag LOCUS_04410 108182 107307 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_04410 109107 108319 gene locus_tag LOCUS_04420 109107 108319 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815888.1 protein_id gnl|my_center|LOCUS_04420 110050 109118 gene locus_tag LOCUS_04430 110050 109118 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_04430 113179 110057 gene locus_tag LOCUS_04440 113179 110057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 114200 113172 gene locus_tag LOCUS_04450 114200 113172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 116022 114232 gene locus_tag LOCUS_04460 116022 114232 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_04460 118852 116045 gene locus_tag LOCUS_04470 118852 116045 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_04470 120758 118869 gene locus_tag LOCUS_04480 120758 118869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 123937 120758 gene locus_tag LOCUS_04490 123937 120758 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_04490 125418 123982 gene locus_tag LOCUS_04500 125418 123982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 126584 125607 gene locus_tag LOCUS_04510 126584 125607 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_04510 126807 128066 gene locus_tag LOCUS_04520 126807 128066 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_04520 128085 129527 gene locus_tag LOCUS_04530 128085 129527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 129581 131428 gene locus_tag LOCUS_04540 129581 131428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 131421 132332 gene locus_tag LOCUS_04550 131421 132332 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767097.1 protein_id gnl|my_center|LOCUS_04550 133256 132381 gene locus_tag LOCUS_04560 133256 132381 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_04560 133649 135172 gene locus_tag LOCUS_04570 133649 135172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 135197 137287 gene locus_tag LOCUS_04580 135197 137287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 137289 140414 gene locus_tag LOCUS_04590 137289 140414 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_04590 140483 142051 gene locus_tag LOCUS_04600 140483 142051 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_04600 142038 142955 gene locus_tag LOCUS_04610 142038 142955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 143174 142959 gene locus_tag LOCUS_04620 143174 142959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 143330 143857 gene locus_tag LOCUS_04630 143330 143857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 145260 144082 gene locus_tag LOCUS_04640 145260 144082 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_04640 145408 146949 gene locus_tag LOCUS_04650 145408 146949 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_04650 147803 146922 gene locus_tag LOCUS_04660 147803 146922 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_04660 149874 147916 gene locus_tag LOCUS_04670 149874 147916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 151009 149888 gene locus_tag LOCUS_04680 151009 149888 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_04680 152471 151011 gene locus_tag LOCUS_04690 152471 151011 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_04690 154092 152479 gene locus_tag LOCUS_04700 154092 152479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 154655 154110 gene locus_tag LOCUS_04710 154655 154110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 156341 154668 gene locus_tag LOCUS_04720 156341 154668 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_04720 159194 156351 gene locus_tag LOCUS_04730 159194 156351 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_04730 161048 159228 gene locus_tag LOCUS_04740 161048 159228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 164352 161068 gene locus_tag LOCUS_04750 164352 161068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_04750 165856 164375 gene locus_tag LOCUS_04760 165856 164375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 166957 165863 gene locus_tag LOCUS_04770 166957 165863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 168225 166954 gene locus_tag LOCUS_04780 168225 166954 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_04780 168441 170117 gene locus_tag LOCUS_04790 168441 170117 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_04790 170129 171337 gene locus_tag LOCUS_04800 170129 171337 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_04800 171408 171743 gene locus_tag LOCUS_04810 171408 171743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 172134 171733 gene locus_tag LOCUS_04820 172134 171733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 174306 172171 gene locus_tag LOCUS_04830 174306 172171 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963110.1 protein_id gnl|my_center|LOCUS_04830 174401 176515 gene locus_tag LOCUS_04840 174401 176515 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_04840 176713 177204 gene locus_tag LOCUS_04850 176713 177204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 178768 178583 gene locus_tag LOCUS_04860 178768 178583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 178730 180016 gene locus_tag LOCUS_04870 178730 180016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 180184 180369 gene locus_tag LOCUS_04880 180184 180369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 180366 180839 gene locus_tag LOCUS_04890 180366 180839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 181287 181757 gene locus_tag LOCUS_04900 181287 181757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence04 167 355 gene locus_tag LOCUS_04910 167 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 706 897 gene locus_tag LOCUS_04920 706 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 2048 996 gene locus_tag LOCUS_04930 2048 996 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_04930 3721 2051 gene locus_tag LOCUS_04940 3721 2051 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695757.1 protein_id gnl|my_center|LOCUS_04940 6979 3728 gene locus_tag LOCUS_04950 6979 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8264 6972 gene locus_tag LOCUS_04960 8264 6972 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767184.1 protein_id gnl|my_center|LOCUS_04960 10131 8293 gene locus_tag LOCUS_04970 10131 8293 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_04970 13422 10150 gene locus_tag LOCUS_04980 13422 10150 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_04980 15150 13432 gene locus_tag LOCUS_04990 15150 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 17142 15388 gene locus_tag LOCUS_05000 17142 15388 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_05000 18719 17550 gene locus_tag LOCUS_05010 18719 17550 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_05010 19014 19553 gene locus_tag LOCUS_05020 19014 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 19903 20181 gene locus_tag LOCUS_05030 gene citD 19903 20181 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542888.1 protein_id gnl|my_center|LOCUS_05030 20278 21147 gene locus_tag LOCUS_05040 gene citE 20278 21147 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_05040 21140 22675 gene locus_tag LOCUS_05050 gene citF 21140 22675 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192238.1 protein_id gnl|my_center|LOCUS_05050 22687 23190 gene locus_tag LOCUS_05060 gene citX 22687 23190 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018088.1 protein_id gnl|my_center|LOCUS_05060 23180 24919 gene locus_tag LOCUS_05070 23180 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 24938 27184 gene locus_tag LOCUS_05080 24938 27184 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_05080 27464 28657 gene locus_tag LOCUS_05090 27464 28657 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_05090 28924 29148 gene locus_tag LOCUS_05100 28924 29148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 30328 31218 gene locus_tag LOCUS_05110 30328 31218 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962714.1 protein_id gnl|my_center|LOCUS_05110 31245 31550 gene locus_tag LOCUS_05120 31245 31550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 31608 32396 gene locus_tag LOCUS_05130 31608 32396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 32396 32773 gene locus_tag LOCUS_05140 32396 32773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 33385 32927 gene locus_tag LOCUS_05150 33385 32927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 35036 33897 gene locus_tag LOCUS_05160 35036 33897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 35901 35167 gene locus_tag LOCUS_05170 35901 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 36694 35948 gene locus_tag LOCUS_05180 gene sufC 36694 35948 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_05180 37480 36821 gene locus_tag LOCUS_05190 gene pnuC 37480 36821 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_05190 39040 37592 gene locus_tag LOCUS_05200 gene sufB 39040 37592 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_05200 39185 40171 gene locus_tag LOCUS_05210 gene aroC 39185 40171 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_05210 40519 41475 gene locus_tag LOCUS_05220 40519 41475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 43743 41497 gene locus_tag LOCUS_05230 43743 41497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 44883 43840 gene locus_tag LOCUS_05240 gene aroB 44883 43840 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147236.1 protein_id gnl|my_center|LOCUS_05240 45343 44921 gene locus_tag LOCUS_05250 45343 44921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 45542 45763 gene locus_tag LOCUS_05260 45542 45763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 45796 46548 gene locus_tag LOCUS_05270 45796 46548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 46672 47301 gene locus_tag LOCUS_05280 46672 47301 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_05280 49873 47630 gene locus_tag LOCUS_05290 49873 47630 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_05290 50004 51281 gene locus_tag LOCUS_05300 50004 51281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 51509 52546 gene locus_tag LOCUS_05310 51509 52546 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_05310 52557 53879 gene locus_tag LOCUS_05320 52557 53879 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_05320 53897 54442 gene locus_tag LOCUS_05330 53897 54442 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_05330 55420 54509 gene locus_tag LOCUS_05340 55420 54509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 56763 55423 gene locus_tag LOCUS_05350 56763 55423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 58595 56775 gene locus_tag LOCUS_05360 58595 56775 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_05360 62137 58610 gene locus_tag LOCUS_05370 62137 58610 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_05370 63141 62206 gene locus_tag LOCUS_05380 63141 62206 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202064.1 protein_id gnl|my_center|LOCUS_05380 63316 63390 gene locus_tag LOCUS_t00090 63316 63390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64403 63444 gene locus_tag LOCUS_05390 64403 63444 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_05390 64943 64410 gene locus_tag LOCUS_05400 64943 64410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 65942 64947 gene locus_tag LOCUS_05410 65942 64947 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_05410 66013 67080 gene locus_tag LOCUS_05420 66013 67080 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_05420 67093 68649 gene locus_tag LOCUS_05430 67093 68649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 68654 71503 gene locus_tag LOCUS_05440 68654 71503 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_05440 71514 73016 gene locus_tag LOCUS_05450 71514 73016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 73031 73582 gene locus_tag LOCUS_05460 73031 73582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 74666 73917 gene locus_tag LOCUS_05470 74666 73917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 77199 74932 gene locus_tag LOCUS_05480 gene bglX 77199 74932 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_05480 79742 77361 gene locus_tag LOCUS_05490 79742 77361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 79866 80945 gene locus_tag LOCUS_05500 79866 80945 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_05500 81040 83028 gene locus_tag LOCUS_05510 81040 83028 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_05510 83028 84500 gene locus_tag LOCUS_05520 83028 84500 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_05520 86419 84569 gene locus_tag LOCUS_05530 86419 84569 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_05530 89584 86432 gene locus_tag LOCUS_05540 89584 86432 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_05540 89791 90000 gene locus_tag LOCUS_05550 89791 90000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 90145 93729 gene locus_tag LOCUS_05560 90145 93729 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_05560 93748 95433 gene locus_tag LOCUS_05570 93748 95433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 95514 97103 gene locus_tag LOCUS_05580 95514 97103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 98148 97186 gene locus_tag LOCUS_05590 98148 97186 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_05590 101111 98709 gene locus_tag LOCUS_05600 101111 98709 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_05600 101228 104356 gene locus_tag LOCUS_05610 101228 104356 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767205.1 protein_id gnl|my_center|LOCUS_05610 104366 106336 gene locus_tag LOCUS_05620 104366 106336 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_05620 106354 107655 gene locus_tag LOCUS_05630 106354 107655 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767203.1 protein_id gnl|my_center|LOCUS_05630 107674 108867 gene locus_tag LOCUS_05640 107674 108867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 108879 112547 gene locus_tag LOCUS_05650 108879 112547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 112590 113825 gene locus_tag LOCUS_05660 112590 113825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 113862 116570 gene locus_tag LOCUS_05670 113862 116570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 116588 118333 gene locus_tag LOCUS_05680 116588 118333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 118636 118947 gene locus_tag LOCUS_05690 118636 118947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 119095 120498 gene locus_tag LOCUS_05700 119095 120498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_05700 120866 123175 gene locus_tag LOCUS_05710 120866 123175 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474357.1 protein_id gnl|my_center|LOCUS_05710 123352 124299 gene locus_tag LOCUS_05720 123352 124299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 125343 126095 gene locus_tag LOCUS_05730 125343 126095 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_05730 126269 127399 gene locus_tag LOCUS_05740 126269 127399 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_05740 127621 129837 gene locus_tag LOCUS_05750 127621 129837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 129940 131127 gene locus_tag LOCUS_05760 129940 131127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 131175 132260 gene locus_tag LOCUS_05770 131175 132260 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_05770 132385 135285 gene locus_tag LOCUS_05780 132385 135285 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_05780 135298 136329 gene locus_tag LOCUS_05790 135298 136329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 136464 138041 gene locus_tag LOCUS_05800 136464 138041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_05800 138161 140173 gene locus_tag LOCUS_05810 138161 140173 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_05810 140887 142035 gene locus_tag LOCUS_05820 140887 142035 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_05820 142057 145344 gene locus_tag LOCUS_05830 142057 145344 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_05830 145367 148045 gene locus_tag LOCUS_05840 145367 148045 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_05840 148196 149869 gene locus_tag LOCUS_05850 148196 149869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 150186 150500 gene locus_tag LOCUS_05860 150186 150500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 151079 151891 gene locus_tag LOCUS_05870 151079 151891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 151986 153053 gene locus_tag LOCUS_05880 151986 153053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 153633 153818 gene locus_tag LOCUS_05890 153633 153818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 154050 155111 gene locus_tag LOCUS_05900 154050 155111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 155291 155560 gene locus_tag LOCUS_05910 155291 155560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 155557 156636 gene locus_tag LOCUS_05920 155557 156636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 156749 157702 gene locus_tag LOCUS_05930 156749 157702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 157845 158465 gene locus_tag LOCUS_05940 157845 158465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 158462 159529 gene locus_tag LOCUS_05950 158462 159529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 159678 160718 gene locus_tag LOCUS_05960 159678 160718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 161185 161577 gene locus_tag LOCUS_05970 161185 161577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 161697 162170 gene locus_tag LOCUS_05980 161697 162170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 162490 164223 gene locus_tag LOCUS_05990 162490 164223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761175.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence05 132 2201 gene locus_tag LOCUS_06000 132 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2330 3340 gene locus_tag LOCUS_06010 2330 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3327 3551 gene locus_tag LOCUS_06020 3327 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3529 3723 gene locus_tag LOCUS_06030 3529 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4675 3923 gene locus_tag LOCUS_06040 4675 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6623 4998 gene locus_tag LOCUS_06050 6623 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8276 6663 gene locus_tag LOCUS_06060 8276 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9441 8281 gene locus_tag LOCUS_06070 9441 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10720 9599 gene locus_tag LOCUS_06080 10720 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11730 10744 gene locus_tag LOCUS_06090 11730 10744 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_06090 12828 11755 gene locus_tag LOCUS_06100 12828 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13155 15620 gene locus_tag LOCUS_06110 gene rnr 13155 15620 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_06110 16877 16803 gene locus_tag LOCUS_t00100 16877 16803 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17261 16956 gene locus_tag LOCUS_06120 gene rpsJ 17261 16956 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_06120 19411 17291 gene locus_tag LOCUS_06130 gene fusA 19411 17291 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_06130 19900 19424 gene locus_tag LOCUS_06140 gene rpsG 19900 19424 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_06140 20292 19942 gene locus_tag LOCUS_06150 gene rpsL 20292 19942 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_06150 21605 20481 gene locus_tag LOCUS_06160 21605 20481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107327.1 protein_id gnl|my_center|LOCUS_06160 22716 21607 gene locus_tag LOCUS_06170 22716 21607 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_06170 23486 22713 gene locus_tag LOCUS_06180 23486 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 24453 23509 gene locus_tag LOCUS_06190 24453 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 25355 24456 gene locus_tag LOCUS_06200 25355 24456 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_06200 26632 25370 gene locus_tag LOCUS_06210 26632 25370 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_06210 27262 26648 gene locus_tag LOCUS_06220 27262 26648 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187702.1 protein_id gnl|my_center|LOCUS_06220 27458 29887 gene locus_tag LOCUS_06230 gene galB 27458 29887 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039185.1 protein_id gnl|my_center|LOCUS_06230 29914 32313 gene locus_tag LOCUS_06240 29914 32313 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_06240 33833 32649 gene locus_tag LOCUS_06250 33833 32649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 34368 34934 gene locus_tag LOCUS_06260 34368 34934 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_06260 37101 34945 gene locus_tag LOCUS_06270 37101 34945 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108899.1 protein_id gnl|my_center|LOCUS_06270 38210 37101 gene locus_tag LOCUS_06280 38210 37101 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_06280 39304 38216 gene locus_tag LOCUS_06290 39304 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 41766 39337 gene locus_tag LOCUS_06300 41766 39337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 43637 41778 gene locus_tag LOCUS_06310 43637 41778 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813804.1 protein_id gnl|my_center|LOCUS_06310 46930 43649 gene locus_tag LOCUS_06320 46930 43649 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201911.1 protein_id gnl|my_center|LOCUS_06320 47968 47000 gene locus_tag LOCUS_06330 47968 47000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 49740 48175 gene locus_tag LOCUS_06340 49740 48175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 50788 49781 gene locus_tag LOCUS_06350 gene thiL 50788 49781 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_06350 50933 51778 gene locus_tag LOCUS_06360 50933 51778 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_06360 51815 53077 gene locus_tag LOCUS_06370 51815 53077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 53080 54732 gene locus_tag LOCUS_06380 53080 54732 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_06380 55088 58333 gene locus_tag LOCUS_06390 55088 58333 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_06390 58347 59849 gene locus_tag LOCUS_06400 58347 59849 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_06400 59856 61778 gene locus_tag LOCUS_06410 59856 61778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 61803 62924 gene locus_tag LOCUS_06420 61803 62924 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_06420 62929 64524 gene locus_tag LOCUS_06430 62929 64524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 64525 66732 gene locus_tag LOCUS_06440 64525 66732 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_06440 68058 66919 gene locus_tag LOCUS_06450 68058 66919 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483126.1 protein_id gnl|my_center|LOCUS_06450 69996 68833 gene locus_tag LOCUS_06460 gene hemW 69996 68833 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_06460 70914 70000 gene locus_tag LOCUS_06470 70914 70000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 70997 71467 gene locus_tag LOCUS_06480 70997 71467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 71553 71765 gene locus_tag LOCUS_06490 71553 71765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 72422 71814 gene locus_tag LOCUS_06500 72422 71814 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_06500 74877 72406 gene locus_tag LOCUS_06510 74877 72406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 75055 75990 gene locus_tag LOCUS_06520 75055 75990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 75994 78135 gene locus_tag LOCUS_06530 75994 78135 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104461.1 protein_id gnl|my_center|LOCUS_06530 78308 78775 gene locus_tag LOCUS_06540 78308 78775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 79358 78762 gene locus_tag LOCUS_06550 79358 78762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 81124 79505 gene locus_tag LOCUS_06560 gene araB 81124 79505 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951845.1 protein_id gnl|my_center|LOCUS_06560 81589 81140 gene locus_tag LOCUS_06570 81589 81140 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_06570 83189 81687 gene locus_tag LOCUS_06580 83189 81687 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202534.1 protein_id gnl|my_center|LOCUS_06580 86506 83210 gene locus_tag LOCUS_06590 86506 83210 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822182.1 protein_id gnl|my_center|LOCUS_06590 88333 86555 gene locus_tag LOCUS_06600 gene fucI 88333 86555 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_06600 89808 88336 gene locus_tag LOCUS_06610 89808 88336 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_06610 90744 89827 gene locus_tag LOCUS_06620 90744 89827 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_06620 92558 90762 gene locus_tag LOCUS_06630 92558 90762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 93797 92763 gene locus_tag LOCUS_06640 93797 92763 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765892.1 protein_id gnl|my_center|LOCUS_06640 94246 93884 gene locus_tag LOCUS_06650 94246 93884 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786310.1 protein_id gnl|my_center|LOCUS_06650 94558 94259 gene locus_tag LOCUS_06660 94558 94259 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_06660 95878 94661 gene locus_tag LOCUS_06670 95878 94661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 96893 95991 gene locus_tag LOCUS_06680 gene prmC 96893 95991 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_06680 97941 96925 gene locus_tag LOCUS_06690 97941 96925 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_06690 100327 97976 gene locus_tag LOCUS_06700 100327 97976 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_06700 100434 102749 gene locus_tag LOCUS_06710 gene topA 100434 102749 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_06710 102804 103316 gene locus_tag LOCUS_06720 102804 103316 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_06720 104016 103288 gene locus_tag LOCUS_06730 104016 103288 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_06730 104105 105127 gene locus_tag LOCUS_06740 104105 105127 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_06740 105127 105960 gene locus_tag LOCUS_06750 gene mreC 105127 105960 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_06750 105957 106466 gene locus_tag LOCUS_06760 105957 106466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 106450 108297 gene locus_tag LOCUS_06770 gene mrdA 106450 108297 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_06770 108305 109750 gene locus_tag LOCUS_06780 gene rodA 108305 109750 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_06780 109838 109923 gene locus_tag LOCUS_t00110 109838 109923 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 110156 109992 gene locus_tag LOCUS_06790 110156 109992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 110676 110254 gene locus_tag LOCUS_06800 110676 110254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 111238 110681 gene locus_tag LOCUS_06810 111238 110681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 112575 111319 gene locus_tag LOCUS_06820 112575 111319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 112876 113454 gene locus_tag LOCUS_06830 112876 113454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802421.1 protein_id gnl|my_center|LOCUS_06830 113456 114340 gene locus_tag LOCUS_06840 113456 114340 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203382.1 protein_id gnl|my_center|LOCUS_06840 114961 114548 gene locus_tag LOCUS_06850 114961 114548 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_06850 116439 115045 gene locus_tag LOCUS_06860 gene aspA 116439 115045 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_06860 119721 116656 gene locus_tag LOCUS_06870 gene secDF 119721 116656 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_06870 119858 121711 gene locus_tag LOCUS_06880 119858 121711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 121730 123082 gene locus_tag LOCUS_06890 121730 123082 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_06890 123092 124327 gene locus_tag LOCUS_06900 123092 124327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_06900 127040 124662 gene locus_tag LOCUS_06910 127040 124662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_06910 129786 127354 gene locus_tag LOCUS_06920 129786 127354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_06920 130832 130152 gene locus_tag LOCUS_06930 130832 130152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_06930 132134 130878 gene locus_tag LOCUS_06940 132134 130878 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_06940 133563 132208 gene locus_tag LOCUS_06950 133563 132208 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_06950 134359 133757 gene locus_tag LOCUS_06960 134359 133757 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_06960 135245 134949 gene locus_tag LOCUS_06970 135245 134949 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_06970 135869 135249 gene locus_tag LOCUS_06980 135869 135249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 136150 135944 gene locus_tag LOCUS_06990 136150 135944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 136543 136166 gene locus_tag LOCUS_07000 136543 136166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 136851 136555 gene locus_tag LOCUS_07010 136851 136555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 137089 136880 gene locus_tag LOCUS_07020 137089 136880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 139314 137431 gene locus_tag LOCUS_07030 139314 137431 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_07030 140879 139416 gene locus_tag LOCUS_07040 140879 139416 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_07040 142619 140883 gene locus_tag LOCUS_07050 142619 140883 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_07050 143768 142629 gene locus_tag LOCUS_07060 143768 142629 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_07060 146833 143786 gene locus_tag LOCUS_07070 146833 143786 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_07070 147928 146843 gene locus_tag LOCUS_07080 147928 146843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 149590 148034 gene locus_tag LOCUS_07090 149590 148034 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_07090 152764 149612 gene locus_tag LOCUS_07100 152764 149612 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_07100 152866 153642 gene locus_tag LOCUS_07110 152866 153642 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_07110 154278 156587 gene locus_tag LOCUS_07120 154278 156587 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_07120 157193 156891 gene locus_tag LOCUS_07130 157193 156891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 157371 157700 gene locus_tag LOCUS_07140 157371 157700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 157825 158184 gene locus_tag LOCUS_07150 157825 158184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 158181 158363 gene locus_tag LOCUS_07160 158181 158363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 158329 158811 gene locus_tag LOCUS_07170 158329 158811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 158910 159203 gene locus_tag LOCUS_07180 158910 159203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 159203 159619 gene locus_tag LOCUS_07190 159203 159619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 160160 159801 gene locus_tag LOCUS_07200 160160 159801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 161002 160178 gene locus_tag LOCUS_07210 161002 160178 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence06 2733 463 gene locus_tag LOCUS_07220 2733 463 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_07220 5979 2923 gene locus_tag LOCUS_07230 5979 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7977 5995 gene locus_tag LOCUS_07240 7977 5995 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108937.1 protein_id gnl|my_center|LOCUS_07240 9841 8075 gene locus_tag LOCUS_07250 9841 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11452 9848 gene locus_tag LOCUS_07260 11452 9848 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_07260 14501 11466 gene locus_tag LOCUS_07270 14501 11466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_07270 15856 14522 gene locus_tag LOCUS_07280 15856 14522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_07280 16056 17426 gene locus_tag LOCUS_07290 16056 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 17518 18264 gene locus_tag LOCUS_07300 17518 18264 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_07300 18539 18638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19651 21135 gene locus_tag LOCUS_07310 19651 21135 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_07310 21164 22306 gene locus_tag LOCUS_07320 21164 22306 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_07320 22436 25900 gene locus_tag LOCUS_07330 22436 25900 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_07330 25953 27800 gene locus_tag LOCUS_07340 25953 27800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 28491 27901 gene locus_tag LOCUS_07350 28491 27901 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_07350 28593 29921 gene locus_tag LOCUS_07360 28593 29921 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_07360 30199 31104 gene locus_tag LOCUS_07370 30199 31104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 34424 31263 gene locus_tag LOCUS_07380 34424 31263 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_07380 36319 34475 gene locus_tag LOCUS_07390 36319 34475 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201995.1 protein_id gnl|my_center|LOCUS_07390 36694 36765 gene locus_tag LOCUS_t00120 36694 36765 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 37453 37878 gene locus_tag LOCUS_07400 37453 37878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 39374 38064 gene locus_tag LOCUS_07410 39374 38064 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_07410 40014 39346 gene locus_tag LOCUS_07420 40014 39346 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_07420 40621 39992 gene locus_tag LOCUS_07430 40621 39992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 40719 40949 gene locus_tag LOCUS_07440 40719 40949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 41154 42326 gene locus_tag LOCUS_07450 41154 42326 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_07450 42361 43548 gene locus_tag LOCUS_07460 42361 43548 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_07460 44248 43604 gene locus_tag LOCUS_07470 44248 43604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 44980 44252 gene locus_tag LOCUS_07480 gene pssA 44980 44252 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_07480 46165 44981 gene locus_tag LOCUS_07490 46165 44981 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_07490 46716 46177 gene locus_tag LOCUS_07500 46716 46177 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_07500 47345 47782 gene locus_tag LOCUS_07510 47345 47782 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840640.1 protein_id gnl|my_center|LOCUS_07510 47856 49349 gene locus_tag LOCUS_07520 47856 49349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 49680 52487 gene locus_tag LOCUS_07530 49680 52487 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_07530 54129 52456 gene locus_tag LOCUS_07540 54129 52456 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763411.1 protein_id gnl|my_center|LOCUS_07540 54222 55094 gene locus_tag LOCUS_07550 54222 55094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 55728 55150 gene locus_tag LOCUS_07560 55728 55150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 57667 55955 gene locus_tag LOCUS_07570 57667 55955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 59419 57707 gene locus_tag LOCUS_07580 59419 57707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 61790 59439 gene locus_tag LOCUS_07590 61790 59439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 63120 62014 gene locus_tag LOCUS_07600 63120 62014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 64310 63150 gene locus_tag LOCUS_07610 gene lpxB 64310 63150 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_07610 65173 64316 gene locus_tag LOCUS_07620 gene surE 65173 64316 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_07620 65307 66305 gene locus_tag LOCUS_07630 gene gap 65307 66305 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_07630 66569 67249 gene locus_tag LOCUS_07640 66569 67249 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_07640 67590 67901 gene locus_tag LOCUS_07650 67590 67901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 67885 68793 gene locus_tag LOCUS_07660 67885 68793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 69012 69239 gene locus_tag LOCUS_07670 69012 69239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 70036 69371 gene locus_tag LOCUS_07680 70036 69371 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_07680 72074 70203 gene locus_tag LOCUS_07690 gene yidC 72074 70203 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_07690 74033 72081 gene locus_tag LOCUS_07700 74033 72081 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_07700 74130 74825 gene locus_tag LOCUS_07710 gene trmD 74130 74825 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_07710 76738 75611 gene locus_tag LOCUS_07720 76738 75611 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_07720 77143 78507 gene locus_tag LOCUS_07730 77143 78507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 78537 79358 gene locus_tag LOCUS_07740 78537 79358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 79422 79844 gene locus_tag LOCUS_07750 79422 79844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 79857 80183 gene locus_tag LOCUS_07760 79857 80183 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_07760 80198 81472 gene locus_tag LOCUS_07770 80198 81472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 82436 81555 gene locus_tag LOCUS_07780 82436 81555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 83904 82459 gene locus_tag LOCUS_07790 83904 82459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 84571 83936 gene locus_tag LOCUS_07800 84571 83936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 84757 85347 gene locus_tag LOCUS_07810 84757 85347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 85402 85956 gene locus_tag LOCUS_07820 85402 85956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 85961 87754 gene locus_tag LOCUS_07830 85961 87754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 87758 88690 gene locus_tag LOCUS_07840 87758 88690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 89304 88942 gene locus_tag LOCUS_07850 89304 88942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 89298 89582 gene locus_tag LOCUS_07860 89298 89582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 90742 89579 gene locus_tag LOCUS_07870 90742 89579 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109296.1 protein_id gnl|my_center|LOCUS_07870 90854 90781 gene locus_tag LOCUS_t00130 90854 90781 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 91094 92677 gene locus_tag LOCUS_07880 91094 92677 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_07880 94279 92747 gene locus_tag LOCUS_07890 gene gcvPB 94279 92747 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861288.1 protein_id gnl|my_center|LOCUS_07890 95610 94285 gene locus_tag LOCUS_07900 gene gcvPA 95610 94285 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948419.1 protein_id gnl|my_center|LOCUS_07900 95992 95612 gene locus_tag LOCUS_07910 gene gcvH 95992 95612 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_07910 97149 96043 gene locus_tag LOCUS_07920 gene gcvT 97149 96043 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_07920 98641 97190 gene locus_tag LOCUS_07930 98641 97190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 99403 98708 gene locus_tag LOCUS_07940 99403 98708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 99894 99421 gene locus_tag LOCUS_07950 99894 99421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 100939 100007 gene locus_tag LOCUS_07960 100939 100007 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_07960 101270 102373 gene locus_tag LOCUS_07970 101270 102373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 104098 102515 gene locus_tag LOCUS_07980 104098 102515 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_07980 106248 104251 gene locus_tag LOCUS_07990 gene htpG 106248 104251 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_07990 106965 106360 gene locus_tag LOCUS_08000 106965 106360 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_08000 107932 108561 gene locus_tag LOCUS_08010 107932 108561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 109273 108533 gene locus_tag LOCUS_08020 109273 108533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 110376 109270 gene locus_tag LOCUS_08030 110376 109270 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379013.1 protein_id gnl|my_center|LOCUS_08030 111945 110593 gene locus_tag LOCUS_08040 111945 110593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202532.1 protein_id gnl|my_center|LOCUS_08040 112101 112469 gene locus_tag LOCUS_08050 112101 112469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 113020 112619 gene locus_tag LOCUS_08060 113020 112619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 113626 113042 gene locus_tag LOCUS_08070 113626 113042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 115310 113631 gene locus_tag LOCUS_08080 115310 113631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_08080 115755 115955 gene locus_tag LOCUS_08090 115755 115955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 117653 116010 gene locus_tag LOCUS_08100 117653 116010 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_08100 117763 118605 gene locus_tag LOCUS_08110 117763 118605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 120056 118686 gene locus_tag LOCUS_08120 120056 118686 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_08120 121807 120056 gene locus_tag LOCUS_08130 121807 120056 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_08130 124455 121867 gene locus_tag LOCUS_08140 124455 121867 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108733.1 protein_id gnl|my_center|LOCUS_08140 125985 124483 gene locus_tag LOCUS_08150 125985 124483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 126855 126001 gene locus_tag LOCUS_08160 126855 126001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 128374 126944 gene locus_tag LOCUS_08170 128374 126944 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_08170 131484 128392 gene locus_tag LOCUS_08180 131484 128392 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_08180 132539 131655 gene locus_tag LOCUS_08190 132539 131655 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_08190 133377 132622 gene locus_tag LOCUS_08200 133377 132622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 134741 133626 gene locus_tag LOCUS_08210 134741 133626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 137998 134927 gene locus_tag LOCUS_08220 137998 134927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 138280 140436 gene locus_tag LOCUS_08230 138280 140436 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_08230 142647 140470 gene locus_tag LOCUS_08240 gene uvrB 142647 140470 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_08240 142714 143742 gene locus_tag LOCUS_08250 142714 143742 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_08250 145212 143746 gene locus_tag LOCUS_08260 145212 143746 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_08260 145998 145345 gene locus_tag LOCUS_08270 145998 145345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 146249 147346 gene locus_tag LOCUS_08280 146249 147346 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785425.1 protein_id gnl|my_center|LOCUS_08280 147952 147410 gene locus_tag LOCUS_08290 147952 147410 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_08290 148462 149133 gene locus_tag LOCUS_08300 148462 149133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 149569 150837 gene locus_tag LOCUS_08310 149569 150837 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_08310 150856 151281 gene locus_tag LOCUS_08320 150856 151281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 152431 151601 gene locus_tag LOCUS_08330 152431 151601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 153158 152454 gene locus_tag LOCUS_08340 153158 152454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 154207 153188 gene locus_tag LOCUS_08350 154207 153188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 154978 154220 gene locus_tag LOCUS_08360 154978 154220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence07 315 1526 gene locus_tag LOCUS_08370 315 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1542 2321 gene locus_tag LOCUS_08380 1542 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3410 2313 gene locus_tag LOCUS_08390 3410 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4490 3411 gene locus_tag LOCUS_08400 4490 3411 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121735.1 protein_id gnl|my_center|LOCUS_08400 7310 4503 gene locus_tag LOCUS_08410 7310 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 8724 7396 gene locus_tag LOCUS_08420 8724 7396 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_08420 9822 8743 gene locus_tag LOCUS_08430 9822 8743 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_08430 10010 10702 gene locus_tag LOCUS_08440 10010 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11040 10711 gene locus_tag LOCUS_08450 11040 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 11063 13144 gene locus_tag LOCUS_08460 11063 13144 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_08460 13165 13617 gene locus_tag LOCUS_08470 13165 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13956 15335 gene locus_tag LOCUS_08480 13956 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 16304 15336 gene locus_tag LOCUS_08490 16304 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 17464 16304 gene locus_tag LOCUS_08500 17464 16304 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_08500 17655 20009 gene locus_tag LOCUS_08510 17655 20009 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_08510 20219 20010 gene locus_tag LOCUS_08520 20219 20010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 20308 22833 gene locus_tag LOCUS_08530 gene gyrA 20308 22833 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_08530 22865 24184 gene locus_tag LOCUS_08540 22865 24184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 25348 24341 gene locus_tag LOCUS_08550 25348 24341 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_08550 26352 25351 gene locus_tag LOCUS_08560 26352 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 26645 26720 gene locus_tag LOCUS_t00140 26645 26720 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 27111 26932 gene locus_tag LOCUS_08570 27111 26932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 28612 27083 gene locus_tag LOCUS_08580 28612 27083 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_08580 30453 28639 gene locus_tag LOCUS_08590 30453 28639 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109123.1 protein_id gnl|my_center|LOCUS_08590 30742 33939 gene locus_tag LOCUS_08600 30742 33939 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 protein_id gnl|my_center|LOCUS_08600 33952 36057 gene locus_tag LOCUS_08610 33952 36057 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784466.1 protein_id gnl|my_center|LOCUS_08610 37592 36129 gene locus_tag LOCUS_08620 37592 36129 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_08620 38080 37631 gene locus_tag LOCUS_08630 38080 37631 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_08630 38270 39193 gene locus_tag LOCUS_08640 gene trxB 38270 39193 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_08640 39256 40143 gene locus_tag LOCUS_08650 39256 40143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 40181 40552 gene locus_tag LOCUS_08660 40181 40552 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_08660 40564 42240 gene locus_tag LOCUS_08670 gene recN 40564 42240 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_08670 43948 42233 gene locus_tag LOCUS_08680 43948 42233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 45078 43945 gene locus_tag LOCUS_08690 45078 43945 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_08690 45744 45082 gene locus_tag LOCUS_08700 45744 45082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 46503 45784 gene locus_tag LOCUS_08710 46503 45784 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_08710 46649 47440 gene locus_tag LOCUS_08720 46649 47440 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_08720 47452 48177 gene locus_tag LOCUS_08730 47452 48177 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969256.1 protein_id gnl|my_center|LOCUS_08730 48189 50816 gene locus_tag LOCUS_08740 48189 50816 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_08740 50876 51439 gene locus_tag LOCUS_08750 50876 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 51671 53503 gene locus_tag LOCUS_08760 51671 53503 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_08760 53516 54535 gene locus_tag LOCUS_08770 53516 54535 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_08770 54591 55916 gene locus_tag LOCUS_08780 gene gdhA 54591 55916 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_08780 56038 57636 gene locus_tag LOCUS_08790 56038 57636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 57663 59114 gene locus_tag LOCUS_08800 57663 59114 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_08800 59200 60474 gene locus_tag LOCUS_08810 59200 60474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 60531 61841 gene locus_tag LOCUS_08820 60531 61841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_08820 62071 62922 gene locus_tag LOCUS_08830 gene hisG 62071 62922 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_08830 62949 64277 gene locus_tag LOCUS_08840 gene hisD 62949 64277 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_08840 64284 65948 gene locus_tag LOCUS_08850 64284 65948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 65945 66544 gene locus_tag LOCUS_08860 gene hisH 65945 66544 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_08860 66531 67244 gene locus_tag LOCUS_08870 gene hisA 66531 67244 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_08870 67246 68049 gene locus_tag LOCUS_08880 gene hisF 67246 68049 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_08880 68064 68666 gene locus_tag LOCUS_08890 gene hisIE 68064 68666 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_08890 68739 70238 gene locus_tag LOCUS_08900 68739 70238 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789851.1 protein_id gnl|my_center|LOCUS_08900 70235 71596 gene locus_tag LOCUS_08910 gene leuC 70235 71596 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_08910 71593 72201 gene locus_tag LOCUS_08920 gene leuD 71593 72201 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_08920 72170 73243 gene locus_tag LOCUS_08930 gene leuB 72170 73243 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_08930 73253 74290 gene locus_tag LOCUS_08940 73253 74290 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775067.1 protein_id gnl|my_center|LOCUS_08940 74642 74430 gene locus_tag LOCUS_08950 74642 74430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 74667 75416 gene locus_tag LOCUS_08960 74667 75416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 76561 77412 gene locus_tag LOCUS_08970 76561 77412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 77424 78878 gene locus_tag LOCUS_08980 77424 78878 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_08980 78884 80383 gene locus_tag LOCUS_08990 78884 80383 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_08990 80518 80949 gene locus_tag LOCUS_09000 80518 80949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 80994 83384 gene locus_tag LOCUS_09010 80994 83384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 83386 83961 gene locus_tag LOCUS_09020 83386 83961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 84144 84749 gene locus_tag LOCUS_09030 84144 84749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 84775 85134 gene locus_tag LOCUS_09040 84775 85134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 85909 87138 gene locus_tag LOCUS_09050 85909 87138 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707197.1 protein_id gnl|my_center|LOCUS_09050 87171 88214 gene locus_tag LOCUS_09060 87171 88214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 88318 89376 gene locus_tag LOCUS_09070 88318 89376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 90014 90895 gene locus_tag LOCUS_09080 90014 90895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 91232 92401 gene locus_tag LOCUS_09090 91232 92401 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_09090 92475 94586 gene locus_tag LOCUS_09100 92475 94586 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_09100 94645 95868 gene locus_tag LOCUS_09110 94645 95868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 97343 95880 gene locus_tag LOCUS_09120 97343 95880 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 protein_id gnl|my_center|LOCUS_09120 97457 99121 gene locus_tag LOCUS_09130 97457 99121 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_09130 99268 100053 gene locus_tag LOCUS_09140 99268 100053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 100351 100277 gene locus_tag LOCUS_t00150 100351 100277 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 100412 101902 gene locus_tag LOCUS_09150 100412 101902 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_09150 103514 101904 gene locus_tag LOCUS_09160 103514 101904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 103762 104244 gene locus_tag LOCUS_09170 gene cdd 103762 104244 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_09170 104415 104735 gene locus_tag LOCUS_09180 104415 104735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 105688 107958 gene locus_tag LOCUS_09190 105688 107958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073145322.1 protein_id gnl|my_center|LOCUS_09190 108031 110595 gene locus_tag LOCUS_09200 108031 110595 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_09200 110750 112093 gene locus_tag LOCUS_09210 110750 112093 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_09210 112106 113248 gene locus_tag LOCUS_09220 112106 113248 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_09220 113261 114127 gene locus_tag LOCUS_09230 113261 114127 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_09230 114144 114764 gene locus_tag LOCUS_09240 114144 114764 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_09240 114786 115382 gene locus_tag LOCUS_09250 gene nqrE 114786 115382 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_09250 115399 116667 gene locus_tag LOCUS_09260 gene nqrF 115399 116667 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_09260 116732 117250 gene locus_tag LOCUS_09270 116732 117250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 117583 118686 gene locus_tag LOCUS_09280 117583 118686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 118711 119922 gene locus_tag LOCUS_09290 118711 119922 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659719.1 protein_id gnl|my_center|LOCUS_09290 119936 123346 gene locus_tag LOCUS_09300 119936 123346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 125489 123438 gene locus_tag LOCUS_09310 125489 123438 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_09310 125890 125489 gene locus_tag LOCUS_09320 125890 125489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 127039 125897 gene locus_tag LOCUS_09330 127039 125897 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_09330 127271 127199 gene locus_tag LOCUS_t00160 127271 127199 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 127728 127477 gene locus_tag LOCUS_09340 127728 127477 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_09340 128234 127911 gene locus_tag LOCUS_09350 128234 127911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence08 465 698 gene locus_tag LOCUS_09360 465 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 892 1821 gene locus_tag LOCUS_09370 892 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2792 4033 gene locus_tag LOCUS_09380 2792 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4044 4922 gene locus_tag LOCUS_09390 4044 4922 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_09390 4930 5622 gene locus_tag LOCUS_09400 gene cas5c 4930 5622 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_09400 5619 7364 gene locus_tag LOCUS_09410 gene cas8c 5619 7364 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_09410 7378 8238 gene locus_tag LOCUS_09420 gene cas7c 7378 8238 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_09420 8248 8919 gene locus_tag LOCUS_09430 gene cas4 8248 8919 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_09430 8903 9925 gene locus_tag LOCUS_09440 gene cas1c 8903 9925 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_09440 9935 10225 gene locus_tag LOCUS_09450 gene cas2 9935 10225 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_09450 10397 10952 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccccacgtgggtgcgtggattgaaat 11278 11114 gene locus_tag LOCUS_09460 11278 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 12548 11634 gene locus_tag LOCUS_09470 12548 11634 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_09470 12729 14249 gene locus_tag LOCUS_09480 12729 14249 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_09480 14282 15268 gene locus_tag LOCUS_09490 14282 15268 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_09490 15280 16449 gene locus_tag LOCUS_09500 15280 16449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_09500 16455 17732 gene locus_tag LOCUS_09510 16455 17732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_09510 19172 17865 gene locus_tag LOCUS_09520 19172 17865 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_09520 21194 19242 gene locus_tag LOCUS_09530 21194 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 22349 21237 gene locus_tag LOCUS_09540 22349 21237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 22505 23788 gene locus_tag LOCUS_09550 22505 23788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_09550 23844 24803 gene locus_tag LOCUS_09560 23844 24803 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_09560 28005 25165 gene locus_tag LOCUS_09570 gene uvrA 28005 25165 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_09570 28078 28803 gene locus_tag LOCUS_09580 28078 28803 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_09580 28803 29426 gene locus_tag LOCUS_09590 28803 29426 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09590 30665 29508 gene locus_tag LOCUS_09600 30665 29508 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_09600 32613 30709 gene locus_tag LOCUS_09610 32613 30709 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_09610 33474 32839 gene locus_tag LOCUS_09620 33474 32839 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09620 34978 34028 gene locus_tag LOCUS_09630 34978 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 37650 36409 gene locus_tag LOCUS_09640 37650 36409 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_09640 38700 37780 gene locus_tag LOCUS_09650 38700 37780 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_09650 39780 38707 gene locus_tag LOCUS_09660 gene serC 39780 38707 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_09660 40800 39895 gene locus_tag LOCUS_09670 gene pyrB 40800 39895 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_09670 41433 40813 gene locus_tag LOCUS_09680 41433 40813 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_09680 41525 42109 gene locus_tag LOCUS_09690 41525 42109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 42133 42996 gene locus_tag LOCUS_09700 gene miaA 42133 42996 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_09700 43054 43153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43772 43332 gene locus_tag LOCUS_09710 43772 43332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 44668 43856 gene locus_tag LOCUS_09720 gene fkpA 44668 43856 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_09720 44836 47040 gene locus_tag LOCUS_09730 gene recQ 44836 47040 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_09730 47894 47037 gene locus_tag LOCUS_09740 47894 47037 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_09740 47949 48590 gene locus_tag LOCUS_09750 47949 48590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 48592 50730 gene locus_tag LOCUS_09760 gene dnaG 48592 50730 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109025.1 protein_id gnl|my_center|LOCUS_09760 50736 52919 gene locus_tag LOCUS_09770 gene metG 50736 52919 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_09770 52937 54070 gene locus_tag LOCUS_09780 52937 54070 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_09780 54517 54993 gene locus_tag LOCUS_09790 54517 54993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 55495 55133 gene locus_tag LOCUS_09800 55495 55133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 56904 55543 gene locus_tag LOCUS_09810 56904 55543 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681485.1 protein_id gnl|my_center|LOCUS_09810 57726 57088 gene locus_tag LOCUS_09820 57726 57088 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_09820 58978 57749 gene locus_tag LOCUS_09830 58978 57749 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_09830 59832 58978 gene locus_tag LOCUS_09840 59832 58978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 60021 61970 gene locus_tag LOCUS_09850 60021 61970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 61997 62815 gene locus_tag LOCUS_09860 gene lptB 61997 62815 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_09860 64599 63199 gene locus_tag LOCUS_09870 64599 63199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 protein_id gnl|my_center|LOCUS_09870 64782 66248 gene locus_tag LOCUS_09880 gene glpT 64782 66248 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768419.1 protein_id gnl|my_center|LOCUS_09880 68204 66336 gene locus_tag LOCUS_09890 68204 66336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 68382 69533 gene locus_tag LOCUS_09900 68382 69533 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861528.1 protein_id gnl|my_center|LOCUS_09900 69545 70732 gene locus_tag LOCUS_09910 69545 70732 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_09910 70772 71842 gene locus_tag LOCUS_09920 70772 71842 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_09920 72497 71931 gene locus_tag LOCUS_09930 gene efp 72497 71931 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_09930 73464 72562 gene locus_tag LOCUS_09940 73464 72562 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108114.1 protein_id gnl|my_center|LOCUS_09940 74157 73471 gene locus_tag LOCUS_09950 gene cmk 74157 73471 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_09950 74345 75502 gene locus_tag LOCUS_09960 74345 75502 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_09960 77060 75486 gene locus_tag LOCUS_09970 77060 75486 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_09970 77466 77062 gene locus_tag LOCUS_09980 77466 77062 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_09980 79136 77466 gene locus_tag LOCUS_09990 79136 77466 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_09990 81319 79148 gene locus_tag LOCUS_10000 81319 79148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 82048 81347 gene locus_tag LOCUS_10010 82048 81347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 82720 82094 gene locus_tag LOCUS_10020 gene udk 82720 82094 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_10020 84130 82733 gene locus_tag LOCUS_10030 gene asnS 84130 82733 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_10030 84700 84236 gene locus_tag LOCUS_10040 84700 84236 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_10040 85293 84718 gene locus_tag LOCUS_10050 85293 84718 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_10050 85718 85308 gene locus_tag LOCUS_10060 85718 85308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761056.1 protein_id gnl|my_center|LOCUS_10060 86560 85751 gene locus_tag LOCUS_10070 86560 85751 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_10070 87724 86690 gene locus_tag LOCUS_10080 87724 86690 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_10080 88521 87739 gene locus_tag LOCUS_10090 88521 87739 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_10090 88740 89933 gene locus_tag LOCUS_10100 88740 89933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 91056 90007 gene locus_tag LOCUS_10110 gene queA 91056 90007 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_10110 91718 91134 gene locus_tag LOCUS_10120 91718 91134 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_10120 91820 92458 gene locus_tag LOCUS_10130 gene pyrE 91820 92458 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_10130 92474 92947 gene locus_tag LOCUS_10140 92474 92947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 92948 94285 gene locus_tag LOCUS_10150 92948 94285 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_10150 94296 95219 gene locus_tag LOCUS_10160 94296 95219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 96377 95376 gene locus_tag LOCUS_10170 96377 95376 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_10170 96737 97864 gene locus_tag LOCUS_10180 96737 97864 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_10180 99762 98131 gene locus_tag LOCUS_10190 99762 98131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 101024 99780 gene locus_tag LOCUS_10200 101024 99780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 102378 101062 gene locus_tag LOCUS_10210 102378 101062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 103259 102390 gene locus_tag LOCUS_10220 103259 102390 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_10220 104796 103273 gene locus_tag LOCUS_10230 104796 103273 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_10230 108150 104845 gene locus_tag LOCUS_10240 108150 104845 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165360391.1 protein_id gnl|my_center|LOCUS_10240 108632 109219 gene locus_tag LOCUS_10250 108632 109219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 109259 110539 gene locus_tag LOCUS_10260 109259 110539 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_10260 111152 110640 gene locus_tag LOCUS_10270 111152 110640 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791444.1 protein_id gnl|my_center|LOCUS_10270 111357 111851 gene locus_tag LOCUS_10280 111357 111851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 111859 112242 gene locus_tag LOCUS_10290 111859 112242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 112249 112689 gene locus_tag LOCUS_10300 112249 112689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 113278 112703 gene locus_tag LOCUS_10310 113278 112703 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_10310 113495 113292 gene locus_tag LOCUS_10320 113495 113292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 113774 114595 gene locus_tag LOCUS_10330 113774 114595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 114619 117174 gene locus_tag LOCUS_10340 114619 117174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 117246 117956 gene locus_tag LOCUS_10350 117246 117956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 118031 118528 gene locus_tag LOCUS_10360 118031 118528 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_10360 118525 118920 gene locus_tag LOCUS_10370 118525 118920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 119067 119588 gene locus_tag LOCUS_10380 119067 119588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 119633 120904 gene locus_tag LOCUS_10390 119633 120904 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683308.1 protein_id gnl|my_center|LOCUS_10390 121610 121709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 122093 123196 gene locus_tag LOCUS_10400 122093 123196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811534.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence09 1511 2680 gene locus_tag LOCUS_10410 gene uxuA 1511 2680 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_10410 2708 3529 gene locus_tag LOCUS_10420 2708 3529 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_10420 4619 3858 gene locus_tag LOCUS_10430 4619 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 5467 4619 gene locus_tag LOCUS_10440 5467 4619 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530507.1 protein_id gnl|my_center|LOCUS_10440 6045 5470 gene locus_tag LOCUS_10450 6045 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6751 7503 gene locus_tag LOCUS_10460 6751 7503 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_10460 7507 7917 gene locus_tag LOCUS_10470 7507 7917 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_10470 7914 8687 gene locus_tag LOCUS_10480 7914 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 8859 10346 gene locus_tag LOCUS_10490 8859 10346 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760797.1 protein_id gnl|my_center|LOCUS_10490 10339 11241 gene locus_tag LOCUS_10500 gene era 10339 11241 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_10500 11285 14065 gene locus_tag LOCUS_10510 11285 14065 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_10510 14160 14705 gene locus_tag LOCUS_10520 14160 14705 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632876.1 protein_id gnl|my_center|LOCUS_10520 17064 15322 gene locus_tag LOCUS_10530 gene recJ 17064 15322 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_10530 17231 18778 gene locus_tag LOCUS_10540 gene lysS 17231 18778 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_10540 18919 19728 gene locus_tag LOCUS_10550 18919 19728 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_10550 19961 20356 gene locus_tag LOCUS_10560 19961 20356 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_10560 21578 20652 gene locus_tag LOCUS_10570 21578 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 22095 22853 gene locus_tag LOCUS_10580 22095 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 23137 23868 gene locus_tag LOCUS_10590 23137 23868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 23903 25168 gene locus_tag LOCUS_10600 23903 25168 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_10600 26461 25427 gene locus_tag LOCUS_10610 26461 25427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 27012 26473 gene locus_tag LOCUS_10620 27012 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 27425 27009 gene locus_tag LOCUS_10630 27425 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 27882 27418 gene locus_tag LOCUS_10640 27882 27418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 28922 28194 gene locus_tag LOCUS_10650 gene fabG 28922 28194 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_10650 30499 29033 gene locus_tag LOCUS_10660 30499 29033 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_10660 30924 30505 gene locus_tag LOCUS_10670 30924 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 32143 30926 gene locus_tag LOCUS_10680 32143 30926 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_10680 33468 32323 gene locus_tag LOCUS_10690 33468 32323 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_10690 34763 33465 gene locus_tag LOCUS_10700 34763 33465 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_10700 35737 34931 gene locus_tag LOCUS_10710 35737 34931 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_10710 39201 35749 gene locus_tag LOCUS_10720 39201 35749 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_10720 40350 39235 gene locus_tag LOCUS_10730 40350 39235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 40796 40347 gene locus_tag LOCUS_10740 40796 40347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 41451 40813 gene locus_tag LOCUS_10750 41451 40813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 41807 41454 gene locus_tag LOCUS_10760 41807 41454 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 protein_id gnl|my_center|LOCUS_10760 42691 41792 gene locus_tag LOCUS_10770 42691 41792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 43862 42681 gene locus_tag LOCUS_10780 43862 42681 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_10780 44120 43863 gene locus_tag LOCUS_10790 44120 43863 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_10790 44673 44125 gene locus_tag LOCUS_10800 44673 44125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_10800 46331 44670 gene locus_tag LOCUS_10810 46331 44670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 47217 46324 gene locus_tag LOCUS_10820 47217 46324 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_10820 47533 47291 gene locus_tag LOCUS_10830 47533 47291 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_10830 48643 47546 gene locus_tag LOCUS_10840 48643 47546 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082083.1 protein_id gnl|my_center|LOCUS_10840 50179 48644 gene locus_tag LOCUS_10850 50179 48644 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_10850 50782 50300 gene locus_tag LOCUS_10860 50782 50300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 51426 50827 gene locus_tag LOCUS_10870 gene rsxA 51426 50827 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_10870 52020 51430 gene locus_tag LOCUS_10880 52020 51430 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_10880 52587 52024 gene locus_tag LOCUS_10890 52587 52024 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_10890 53511 52591 gene locus_tag LOCUS_10900 53511 52591 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_10900 54976 53579 gene locus_tag LOCUS_10910 gene rsxC 54976 53579 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_10910 55901 54969 gene locus_tag LOCUS_10920 55901 54969 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_10920 56345 55929 gene locus_tag LOCUS_10930 56345 55929 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_10930 57204 56347 gene locus_tag LOCUS_10940 57204 56347 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_10940 58697 57204 gene locus_tag LOCUS_10950 gene dnaB 58697 57204 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_10950 59533 58721 gene locus_tag LOCUS_10960 59533 58721 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_10960 60331 59546 gene locus_tag LOCUS_10970 60331 59546 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_10970 60651 60328 gene locus_tag LOCUS_10980 60651 60328 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_10980 61610 60660 gene locus_tag LOCUS_10990 61610 60660 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_10990 62636 61626 gene locus_tag LOCUS_11000 62636 61626 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_11000 62766 65384 gene locus_tag LOCUS_11010 gene alaS 62766 65384 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_11010 65430 67862 gene locus_tag LOCUS_11020 65430 67862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 67862 68533 gene locus_tag LOCUS_11030 67862 68533 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_11030 68588 70306 gene locus_tag LOCUS_11040 68588 70306 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_11040 70369 71766 gene locus_tag LOCUS_11050 70369 71766 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_11050 72089 72177 gene locus_tag LOCUS_t00170 72089 72177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 72939 72373 gene locus_tag LOCUS_11060 72939 72373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 74064 73228 gene locus_tag LOCUS_11070 74064 73228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 74661 74077 gene locus_tag LOCUS_11080 74661 74077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 75601 74735 gene locus_tag LOCUS_11090 75601 74735 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_11090 78255 75646 gene locus_tag LOCUS_11100 78255 75646 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_11100 78710 78426 gene locus_tag LOCUS_11110 78710 78426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 80368 78821 gene locus_tag LOCUS_11120 80368 78821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_11120 81032 80499 gene locus_tag LOCUS_11130 81032 80499 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_11130 82811 81483 gene locus_tag LOCUS_11140 82811 81483 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_11140 83995 82919 gene locus_tag LOCUS_11150 83995 82919 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_11150 85630 84008 gene locus_tag LOCUS_11160 gene atpA 85630 84008 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_11160 86252 85632 gene locus_tag LOCUS_11170 86252 85632 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768717.1 protein_id gnl|my_center|LOCUS_11170 86766 86257 gene locus_tag LOCUS_11180 gene atpF 86766 86257 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_11180 86997 86770 gene locus_tag LOCUS_11190 86997 86770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 88106 87054 gene locus_tag LOCUS_11200 gene atpB 88106 87054 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_11200 88363 88106 gene locus_tag LOCUS_11210 gene atpC 88363 88106 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_11210 89914 88391 gene locus_tag LOCUS_11220 gene atpD 89914 88391 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_11220 91388 90081 gene locus_tag LOCUS_11230 gene eno 91388 90081 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_11230 92552 91485 gene locus_tag LOCUS_11240 92552 91485 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109277.1 protein_id gnl|my_center|LOCUS_11240 93827 92682 gene locus_tag LOCUS_11250 93827 92682 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_11250 94841 94236 gene locus_tag LOCUS_11260 94841 94236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 98122 94937 gene locus_tag LOCUS_11270 98122 94937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 99868 98144 gene locus_tag LOCUS_11280 99868 98144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 103309 100091 gene locus_tag LOCUS_11290 103309 100091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 104564 103737 gene locus_tag LOCUS_11300 104564 103737 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_11300 105049 104561 gene locus_tag LOCUS_11310 105049 104561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 105564 105968 gene locus_tag LOCUS_11320 105564 105968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 106226 105915 gene locus_tag LOCUS_11330 106226 105915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 106735 106262 gene locus_tag LOCUS_11340 106735 106262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 110277 106804 gene locus_tag LOCUS_11350 110277 106804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 110670 111137 gene locus_tag LOCUS_11360 110670 111137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 113796 111181 gene locus_tag LOCUS_11370 113796 111181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 114615 113917 gene locus_tag LOCUS_11380 114615 113917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 118445 114714 gene locus_tag LOCUS_11390 118445 114714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 118916 120043 gene locus_tag LOCUS_11400 118916 120043 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_11400 120046 120714 gene locus_tag LOCUS_11410 120046 120714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 122081 121128 gene locus_tag LOCUS_11420 122081 121128 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence10 556 741 gene locus_tag LOCUS_11430 556 741 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793631.1 protein_id gnl|my_center|LOCUS_11430 776 1180 gene locus_tag LOCUS_11440 776 1180 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_11440 1359 1538 gene locus_tag LOCUS_11450 1359 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1571 1975 gene locus_tag LOCUS_11460 1571 1975 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_11460 3579 2086 gene locus_tag LOCUS_11470 3579 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3730 4527 gene locus_tag LOCUS_11480 gene murI 3730 4527 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_11480 4555 6093 gene locus_tag LOCUS_11490 4555 6093 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 protein_id gnl|my_center|LOCUS_11490 6175 6363 gene locus_tag LOCUS_11500 6175 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7036 6548 gene locus_tag LOCUS_11510 7036 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 8669 7389 gene locus_tag LOCUS_11520 8669 7389 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853188.1 protein_id gnl|my_center|LOCUS_11520 11164 8681 gene locus_tag LOCUS_11530 11164 8681 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_11530 12621 11242 gene locus_tag LOCUS_11540 gene lpdA 12621 11242 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_11540 14041 12635 gene locus_tag LOCUS_11550 gene sucB 14041 12635 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_11550 14213 15058 gene locus_tag LOCUS_11560 14213 15058 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_11560 15071 16021 gene locus_tag LOCUS_11570 15071 16021 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_11570 16193 16900 gene locus_tag LOCUS_11580 gene radC 16193 16900 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_11580 16948 17601 gene locus_tag LOCUS_11590 gene upp 16948 17601 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_11590 19409 17997 gene locus_tag LOCUS_11600 gene rpoN 19409 17997 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_11600 19973 19413 gene locus_tag LOCUS_11610 19973 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 20457 19978 gene locus_tag LOCUS_11620 20457 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 20632 21954 gene locus_tag LOCUS_11630 gene miaB 20632 21954 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_11630 21965 23548 gene locus_tag LOCUS_11640 gene cls 21965 23548 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_11640 24793 23591 gene locus_tag LOCUS_11650 24793 23591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 25848 24802 gene locus_tag LOCUS_11660 25848 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 27641 25869 gene locus_tag LOCUS_11670 27641 25869 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_11670 30521 27654 gene locus_tag LOCUS_11680 30521 27654 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_11680 32405 30534 gene locus_tag LOCUS_11690 32405 30534 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_11690 35584 32405 gene locus_tag LOCUS_11700 35584 32405 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_11700 37173 35596 gene locus_tag LOCUS_11710 37173 35596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 39237 37237 gene locus_tag LOCUS_11720 39237 37237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 40752 39250 gene locus_tag LOCUS_11730 40752 39250 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_11730 44828 40866 gene locus_tag LOCUS_11740 44828 40866 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_11740 46065 44983 gene locus_tag LOCUS_11750 46065 44983 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_11750 46208 48097 gene locus_tag LOCUS_11760 46208 48097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 48219 49013 gene locus_tag LOCUS_11770 48219 49013 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_11770 49049 50119 gene locus_tag LOCUS_11780 49049 50119 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_11780 50124 51572 gene locus_tag LOCUS_11790 50124 51572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_11790 51637 52734 gene locus_tag LOCUS_11800 51637 52734 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767206.1 protein_id gnl|my_center|LOCUS_11800 52747 53589 gene locus_tag LOCUS_11810 gene kduI 52747 53589 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_11810 53769 53996 gene locus_tag LOCUS_11820 53769 53996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 54227 54448 gene locus_tag LOCUS_11830 54227 54448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 56859 54679 gene locus_tag LOCUS_11840 56859 54679 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_11840 58704 57205 gene locus_tag LOCUS_11850 58704 57205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 59154 61223 gene locus_tag LOCUS_11860 59154 61223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_11860 61235 62401 gene locus_tag LOCUS_11870 61235 62401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 63583 62582 gene locus_tag LOCUS_11880 63583 62582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 64560 64751 gene locus_tag LOCUS_11890 64560 64751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 64672 64860 gene locus_tag LOCUS_11900 64672 64860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 64944 68021 gene locus_tag LOCUS_11910 64944 68021 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_11910 68036 69706 gene locus_tag LOCUS_11920 68036 69706 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_11920 69889 70410 gene locus_tag LOCUS_11930 gene mraZ 69889 70410 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_11930 70423 71382 gene locus_tag LOCUS_11940 gene rsmH 70423 71382 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_11940 71379 71735 gene locus_tag LOCUS_11950 71379 71735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 71741 73870 gene locus_tag LOCUS_11960 71741 73870 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_11960 73867 75375 gene locus_tag LOCUS_11970 73867 75375 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_11970 75372 76682 gene locus_tag LOCUS_11980 gene mraY 75372 76682 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_11980 76696 78036 gene locus_tag LOCUS_11990 gene murD 76696 78036 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_11990 78050 79525 gene locus_tag LOCUS_12000 78050 79525 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_12000 79527 80675 gene locus_tag LOCUS_12010 gene murG 79527 80675 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_12010 80678 82042 gene locus_tag LOCUS_12020 gene murC 80678 82042 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_12020 82039 82815 gene locus_tag LOCUS_12030 82039 82815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 82827 84458 gene locus_tag LOCUS_12040 82827 84458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 84471 85748 gene locus_tag LOCUS_12050 84471 85748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 85807 86691 gene locus_tag LOCUS_12060 85807 86691 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_12060 86715 88637 gene locus_tag LOCUS_12070 86715 88637 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_12070 92160 88642 gene locus_tag LOCUS_12080 92160 88642 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 protein_id gnl|my_center|LOCUS_12080 93797 92433 gene locus_tag LOCUS_12090 93797 92433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 94194 93841 gene locus_tag LOCUS_12100 94194 93841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 95141 94191 gene locus_tag LOCUS_12110 95141 94191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 96839 95148 gene locus_tag LOCUS_12120 96839 95148 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_12120 99940 96839 gene locus_tag LOCUS_12130 99940 96839 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_12130 101609 99954 gene locus_tag LOCUS_12140 101609 99954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 103098 101623 gene locus_tag LOCUS_12150 103098 101623 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_12150 104066 103137 gene locus_tag LOCUS_12160 104066 103137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 105840 104056 gene locus_tag LOCUS_12170 105840 104056 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_12170 107210 105876 gene locus_tag LOCUS_12180 107210 105876 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_12180 107336 108355 gene locus_tag LOCUS_12190 107336 108355 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_12190 110175 108430 gene locus_tag LOCUS_12200 gene gltX 110175 108430 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_12200 111287 110178 gene locus_tag LOCUS_12210 111287 110178 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_12210 111678 111274 gene locus_tag LOCUS_12220 111678 111274 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_12220 112153 111683 gene locus_tag LOCUS_12230 gene greA 112153 111683 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_12230 112668 113585 gene locus_tag LOCUS_12240 112668 113585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 114400 114212 gene locus_tag LOCUS_12250 114400 114212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 115846 114413 gene locus_tag LOCUS_12260 gene xseA 115846 114413 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_12260 115924 116517 gene locus_tag LOCUS_12270 gene yihA 115924 116517 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_12270 116527 117498 gene locus_tag LOCUS_12280 116527 117498 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_12280 117502 117789 gene locus_tag LOCUS_12290 117502 117789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 117865 119175 gene locus_tag LOCUS_12300 gene der 117865 119175 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760766.1 protein_id gnl|my_center|LOCUS_12300 119185 119829 gene locus_tag LOCUS_12310 119185 119829 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_12310 119833 120630 gene locus_tag LOCUS_12320 119833 120630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 120632 121708 gene locus_tag LOCUS_12330 120632 121708 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence11 1811 147 gene locus_tag LOCUS_12340 1811 147 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_12340 5216 1899 gene locus_tag LOCUS_12350 5216 1899 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202000.1 protein_id gnl|my_center|LOCUS_12350 7567 6695 gene locus_tag LOCUS_12360 7567 6695 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_12360 7643 8896 gene locus_tag LOCUS_12370 7643 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 8900 10654 gene locus_tag LOCUS_12380 8900 10654 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_12380 10673 12988 gene locus_tag LOCUS_12390 10673 12988 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_12390 14609 13317 gene locus_tag LOCUS_12400 14609 13317 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723690.1 protein_id gnl|my_center|LOCUS_12400 14919 15188 gene locus_tag LOCUS_12410 14919 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 15191 15487 gene locus_tag LOCUS_12420 15191 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 15816 17351 gene locus_tag LOCUS_12430 gene rny 15816 17351 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_12430 17385 19445 gene locus_tag LOCUS_12440 17385 19445 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_12440 19678 20994 gene locus_tag LOCUS_12450 19678 20994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 21941 21060 gene locus_tag LOCUS_12460 21941 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 22963 21941 gene locus_tag LOCUS_12470 22963 21941 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_12470 23118 24416 gene locus_tag LOCUS_12480 23118 24416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_12480 24413 25852 gene locus_tag LOCUS_12490 24413 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 25869 27743 gene locus_tag LOCUS_12500 25869 27743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 27872 28906 gene locus_tag LOCUS_12510 27872 28906 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_12510 30744 28903 gene locus_tag LOCUS_12520 30744 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 31627 30749 gene locus_tag LOCUS_12530 31627 30749 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_12530 33441 31642 gene locus_tag LOCUS_12540 33441 31642 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_12540 36534 33448 gene locus_tag LOCUS_12550 36534 33448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_12550 36621 39821 gene locus_tag LOCUS_12560 36621 39821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 39830 40747 gene locus_tag LOCUS_12570 39830 40747 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815888.1 protein_id gnl|my_center|LOCUS_12570 40771 42831 gene locus_tag LOCUS_12580 40771 42831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 44159 42909 gene locus_tag LOCUS_12590 44159 42909 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_12590 45647 44232 gene locus_tag LOCUS_12600 gene rhaB 45647 44232 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_12600 45798 46694 gene locus_tag LOCUS_12610 45798 46694 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_12610 51044 47511 gene locus_tag LOCUS_12620 51044 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 51894 51439 gene locus_tag LOCUS_12630 51894 51439 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295275.1 protein_id gnl|my_center|LOCUS_12630 56455 51914 gene locus_tag LOCUS_12640 56455 51914 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_12640 56574 57596 gene locus_tag LOCUS_12650 gene tsaD 56574 57596 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_12650 57618 59336 gene locus_tag LOCUS_12660 57618 59336 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_12660 60129 59401 gene locus_tag LOCUS_12670 60129 59401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 60732 60163 gene locus_tag LOCUS_12680 60732 60163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 61392 61180 gene locus_tag LOCUS_12690 61392 61180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 61634 62869 gene locus_tag LOCUS_12700 61634 62869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 62932 63417 gene locus_tag LOCUS_12710 gene umuD 62932 63417 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_12710 63405 64667 gene locus_tag LOCUS_12720 63405 64667 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_12720 65513 64719 gene locus_tag LOCUS_12730 65513 64719 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_12730 65715 65497 gene locus_tag LOCUS_12740 65715 65497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 66913 65702 gene locus_tag LOCUS_12750 66913 65702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 67756 66995 gene locus_tag LOCUS_12760 gene rsmG 67756 66995 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_12760 68352 67753 gene locus_tag LOCUS_12770 68352 67753 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_12770 70978 68324 gene locus_tag LOCUS_12780 gene polA 70978 68324 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_12780 71869 71252 gene locus_tag LOCUS_12790 71869 71252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973256.1 protein_id gnl|my_center|LOCUS_12790 72793 71873 gene locus_tag LOCUS_12800 72793 71873 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_12800 72910 74304 gene locus_tag LOCUS_12810 72910 74304 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_12810 74513 74902 gene locus_tag LOCUS_12820 74513 74902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 75963 74911 gene locus_tag LOCUS_12830 gene gpsA 75963 74911 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878372.1 protein_id gnl|my_center|LOCUS_12830 76070 76948 gene locus_tag LOCUS_12840 76070 76948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 76987 78207 gene locus_tag LOCUS_12850 76987 78207 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_12850 78398 78835 gene locus_tag LOCUS_12860 78398 78835 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_12860 78920 78994 gene locus_tag LOCUS_t00180 78920 78994 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 79105 79578 gene locus_tag LOCUS_12870 79105 79578 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_12870 79626 80258 gene locus_tag LOCUS_12880 79626 80258 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_12880 82256 80652 gene locus_tag LOCUS_12890 gene pckA 82256 80652 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_12890 82449 84416 gene locus_tag LOCUS_12900 82449 84416 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_12900 85333 84392 gene locus_tag LOCUS_12910 85333 84392 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_12910 86920 85418 gene locus_tag LOCUS_12920 86920 85418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 87302 86922 gene locus_tag LOCUS_12930 gene folB 87302 86922 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_12930 88156 87425 gene locus_tag LOCUS_12940 88156 87425 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_12940 88270 89328 gene locus_tag LOCUS_12950 88270 89328 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082772.1 protein_id gnl|my_center|LOCUS_12950 89318 91348 gene locus_tag LOCUS_12960 89318 91348 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_12960 92561 91491 gene locus_tag LOCUS_12970 92561 91491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 94667 93369 gene locus_tag LOCUS_12980 94667 93369 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_12980 97715 94674 gene locus_tag LOCUS_12990 97715 94674 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_12990 98127 97717 gene locus_tag LOCUS_13000 98127 97717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 98791 98132 gene locus_tag LOCUS_13010 98791 98132 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_13010 100673 98823 gene locus_tag LOCUS_13020 100673 98823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_13020 101650 100676 gene locus_tag LOCUS_13030 101650 100676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 101737 103782 gene locus_tag LOCUS_13040 101737 103782 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_13040 103782 104618 gene locus_tag LOCUS_13050 103782 104618 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_13050 105929 104754 gene locus_tag LOCUS_13060 105929 104754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766585.1 protein_id gnl|my_center|LOCUS_13060 106091 107344 gene locus_tag LOCUS_13070 106091 107344 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence12 3363 268 gene locus_tag LOCUS_13080 3363 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3561 3412 gene locus_tag LOCUS_13090 3561 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5911 4040 gene locus_tag LOCUS_13100 5911 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6270 7937 gene locus_tag LOCUS_13110 6270 7937 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_13110 8068 9717 gene locus_tag LOCUS_13120 gene ettA 8068 9717 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_13120 9789 9965 gene locus_tag LOCUS_13130 9789 9965 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_13130 12206 10104 gene locus_tag LOCUS_13140 12206 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12325 12921 gene locus_tag LOCUS_13150 12325 12921 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_13150 13780 13016 gene locus_tag LOCUS_13160 13780 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 14220 14408 gene locus_tag LOCUS_13170 14220 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 14745 16121 gene locus_tag LOCUS_13180 14745 16121 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_13180 16126 16968 gene locus_tag LOCUS_13190 16126 16968 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_13190 17481 17408 gene locus_tag LOCUS_t00190 17481 17408 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 17805 20021 gene locus_tag LOCUS_13200 gene priA 17805 20021 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_13200 20418 21188 gene locus_tag LOCUS_13210 20418 21188 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_13210 21194 22132 gene locus_tag LOCUS_13220 21194 22132 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_13220 22141 23172 gene locus_tag LOCUS_13230 22141 23172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 23188 24795 gene locus_tag LOCUS_13240 23188 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 26610 24799 gene locus_tag LOCUS_13250 26610 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 26779 27894 gene locus_tag LOCUS_13260 26779 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 27898 30195 gene locus_tag LOCUS_13270 27898 30195 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_13270 35119 30335 gene locus_tag LOCUS_13280 35119 30335 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_13280 35325 35651 gene locus_tag LOCUS_13290 35325 35651 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_13290 35663 37246 gene locus_tag LOCUS_13300 35663 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 37681 38673 gene locus_tag LOCUS_13310 gene obgE 37681 38673 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_13310 38652 39344 gene locus_tag LOCUS_13320 38652 39344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 40758 39295 gene locus_tag LOCUS_13330 40758 39295 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_13330 41343 40900 gene locus_tag LOCUS_13340 gene dut 41343 40900 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_13340 42571 41414 gene locus_tag LOCUS_13350 42571 41414 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_13350 43727 42636 gene locus_tag LOCUS_13360 43727 42636 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_13360 44877 43732 gene locus_tag LOCUS_13370 gene tgt 44877 43732 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_13370 44979 46295 gene locus_tag LOCUS_13380 44979 46295 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_13380 46684 46292 gene locus_tag LOCUS_13390 46684 46292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 47102 47452 gene locus_tag LOCUS_13400 47102 47452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 49143 48025 gene locus_tag LOCUS_13410 gene rfbB 49143 48025 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_13410 50196 49150 gene locus_tag LOCUS_13420 gene pdxA 50196 49150 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_13420 50786 50265 gene locus_tag LOCUS_13430 gene rnhA 50786 50265 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_13430 50920 51843 gene locus_tag LOCUS_13440 gene rfbD 50920 51843 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_13440 51858 52733 gene locus_tag LOCUS_13450 gene rfbA 51858 52733 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_13450 52776 53330 gene locus_tag LOCUS_13460 gene rfbC 52776 53330 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_13460 55465 53363 gene locus_tag LOCUS_13470 gene recG 55465 53363 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_13470 55962 55522 gene locus_tag LOCUS_13480 55962 55522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 56199 57137 gene locus_tag LOCUS_13490 56199 57137 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_13490 57143 59404 gene locus_tag LOCUS_13500 57143 59404 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_13500 60075 59485 gene locus_tag LOCUS_13510 60075 59485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 60961 60713 gene locus_tag LOCUS_13520 60961 60713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 61140 60901 gene locus_tag LOCUS_13530 61140 60901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 62870 62798 gene locus_tag LOCUS_t00200 62870 62798 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63109 63954 gene locus_tag LOCUS_13540 gene fabD 63109 63954 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_13540 63978 67505 gene locus_tag LOCUS_13550 gene nifJ 63978 67505 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_13550 68639 67782 gene locus_tag LOCUS_13560 68639 67782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 69001 69363 gene locus_tag LOCUS_13570 69001 69363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 69356 70009 gene locus_tag LOCUS_13580 69356 70009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 70282 70821 gene locus_tag LOCUS_13590 70282 70821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 70818 71024 gene locus_tag LOCUS_13600 70818 71024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 72734 71538 gene locus_tag LOCUS_13610 72734 71538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 73139 73696 gene locus_tag LOCUS_13620 73139 73696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785162.1 protein_id gnl|my_center|LOCUS_13620 73768 75195 gene locus_tag LOCUS_13630 73768 75195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 75201 75413 gene locus_tag LOCUS_13640 75201 75413 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 protein_id gnl|my_center|LOCUS_13640 75744 77846 gene locus_tag LOCUS_13650 75744 77846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 78133 78696 gene locus_tag LOCUS_13660 78133 78696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 81619 78794 gene locus_tag LOCUS_13670 81619 78794 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_13670 81850 81638 gene locus_tag LOCUS_13680 81850 81638 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_13680 82004 82834 gene locus_tag LOCUS_13690 82004 82834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 83740 82868 gene locus_tag LOCUS_13700 83740 82868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 85709 85536 gene locus_tag LOCUS_13710 85709 85536 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_13710 86841 85789 gene locus_tag LOCUS_13720 86841 85789 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_13720 88047 86848 gene locus_tag LOCUS_13730 88047 86848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 88355 90292 gene locus_tag LOCUS_13740 88355 90292 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_13740 90305 90862 gene locus_tag LOCUS_13750 90305 90862 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_13750 90875 92581 gene locus_tag LOCUS_13760 90875 92581 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_13760 94467 92617 gene locus_tag LOCUS_13770 94467 92617 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764450.1 protein_id gnl|my_center|LOCUS_13770 94832 94473 gene locus_tag LOCUS_13780 94832 94473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 96266 95094 gene locus_tag LOCUS_13790 96266 95094 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_13790 97116 96394 gene locus_tag LOCUS_13800 97116 96394 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987068.1 protein_id gnl|my_center|LOCUS_13800 98659 97178 gene locus_tag LOCUS_13810 gene glpK 98659 97178 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence13 2067 145 gene locus_tag LOCUS_13820 2067 145 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765908.1 protein_id gnl|my_center|LOCUS_13820 2152 2622 gene locus_tag LOCUS_13830 2152 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2622 3995 gene locus_tag LOCUS_13840 2622 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4013 6778 gene locus_tag LOCUS_13850 gene leuS 4013 6778 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_13850 6782 7714 gene locus_tag LOCUS_13860 6782 7714 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_13860 7814 8899 gene locus_tag LOCUS_13870 7814 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9651 8944 gene locus_tag LOCUS_13880 9651 8944 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_13880 10044 9652 gene locus_tag LOCUS_13890 10044 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 11326 10094 gene locus_tag LOCUS_13900 gene fabF 11326 10094 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_13900 12367 11378 gene locus_tag LOCUS_13910 gene fabK 12367 11378 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_13910 13304 12357 gene locus_tag LOCUS_13920 13304 12357 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_13920 15709 13529 gene locus_tag LOCUS_13930 15709 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 17737 15839 gene locus_tag LOCUS_13940 17737 15839 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813804.1 protein_id gnl|my_center|LOCUS_13940 20878 17750 gene locus_tag LOCUS_13950 20878 17750 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201911.1 protein_id gnl|my_center|LOCUS_13950 22553 20901 gene locus_tag LOCUS_13960 22553 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 22745 23629 gene locus_tag LOCUS_13970 22745 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 24513 23644 gene locus_tag LOCUS_13980 24513 23644 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_13980 24583 25020 gene locus_tag LOCUS_13990 24583 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 25277 25017 gene locus_tag LOCUS_14000 gene yidD 25277 25017 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814320.1 protein_id gnl|my_center|LOCUS_14000 25635 25267 gene locus_tag LOCUS_14010 gene rnpA 25635 25267 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_14010 26387 25644 gene locus_tag LOCUS_14020 26387 25644 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_14020 27052 26420 gene locus_tag LOCUS_14030 27052 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 27405 27058 gene locus_tag LOCUS_14040 27405 27058 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_14040 27503 30586 gene locus_tag LOCUS_14050 27503 30586 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_14050 30697 31035 gene locus_tag LOCUS_14060 30697 31035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 31007 31795 gene locus_tag LOCUS_14070 31007 31795 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_14070 31795 32277 gene locus_tag LOCUS_14080 31795 32277 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_14080 32277 33185 gene locus_tag LOCUS_14090 gene cynR 32277 33185 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952477.1 protein_id gnl|my_center|LOCUS_14090 33866 33432 gene locus_tag LOCUS_14100 33866 33432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 34415 34050 gene locus_tag LOCUS_14110 34415 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 35331 34423 gene locus_tag LOCUS_14120 35331 34423 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_14120 35480 36733 gene locus_tag LOCUS_14130 35480 36733 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_14130 36837 37721 gene locus_tag LOCUS_14140 gene lgt 36837 37721 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_14140 37725 38501 gene locus_tag LOCUS_14150 37725 38501 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_14150 38700 39302 gene locus_tag LOCUS_14160 38700 39302 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_14160 39309 40844 gene locus_tag LOCUS_14170 39309 40844 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_14170 40865 41902 gene locus_tag LOCUS_14180 40865 41902 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_14180 41915 45025 gene locus_tag LOCUS_14190 41915 45025 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_14190 45062 45355 gene locus_tag LOCUS_14200 45062 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_14200 45491 45805 gene locus_tag LOCUS_14210 gene trxA 45491 45805 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_14210 45828 46478 gene locus_tag LOCUS_14220 45828 46478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 46492 47028 gene locus_tag LOCUS_14230 46492 47028 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532550.1 protein_id gnl|my_center|LOCUS_14230 47044 48027 gene locus_tag LOCUS_14240 47044 48027 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_14240 48024 49118 gene locus_tag LOCUS_14250 48024 49118 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_14250 49137 50474 gene locus_tag LOCUS_14260 49137 50474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 50467 50925 gene locus_tag LOCUS_14270 50467 50925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 50912 51748 gene locus_tag LOCUS_14280 gene trmB 50912 51748 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_14280 53109 51841 gene locus_tag LOCUS_14290 53109 51841 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_14290 53257 55698 gene locus_tag LOCUS_14300 53257 55698 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_14300 55800 57221 gene locus_tag LOCUS_14310 55800 57221 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_14310 57345 58529 gene locus_tag LOCUS_14320 gene purT 57345 58529 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_14320 59461 58550 gene locus_tag LOCUS_14330 59461 58550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_14330 59500 59886 gene locus_tag LOCUS_14340 59500 59886 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_14340 60194 61708 gene locus_tag LOCUS_14350 60194 61708 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_14350 63226 61982 gene locus_tag LOCUS_14360 63226 61982 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_14360 64841 63939 gene locus_tag LOCUS_14370 64841 63939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 65312 64923 gene locus_tag LOCUS_14380 65312 64923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 65801 65388 gene locus_tag LOCUS_14390 65801 65388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 66165 65833 gene locus_tag LOCUS_14400 66165 65833 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_14400 67731 66265 gene locus_tag LOCUS_14410 67731 66265 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_14410 68828 67860 gene locus_tag LOCUS_14420 68828 67860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 69123 70127 gene locus_tag LOCUS_14430 69123 70127 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_14430 70787 70963 gene locus_tag LOCUS_14440 70787 70963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 71332 71252 gene locus_tag LOCUS_t00210 71332 71252 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 75110 71454 gene locus_tag LOCUS_14450 75110 71454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 75571 75377 gene locus_tag LOCUS_14460 gene rpsU 75571 75377 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_14460 75713 76870 gene locus_tag LOCUS_14470 75713 76870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 76924 77637 gene locus_tag LOCUS_14480 76924 77637 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_14480 77911 78010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78287 79549 gene locus_tag LOCUS_14490 78287 79549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 79651 80877 gene locus_tag LOCUS_14500 79651 80877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14500 81308 81523 gene locus_tag LOCUS_14510 81308 81523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 81543 81770 gene locus_tag LOCUS_14520 81543 81770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 81882 84143 gene locus_tag LOCUS_14530 81882 84143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 84130 85821 gene locus_tag LOCUS_14540 84130 85821 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787447.1 protein_id gnl|my_center|LOCUS_14540 86051 86221 gene locus_tag LOCUS_14550 86051 86221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 86248 86595 gene locus_tag LOCUS_14560 86248 86595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 86629 87141 gene locus_tag LOCUS_14570 86629 87141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 87486 87585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 87822 88133 gene locus_tag LOCUS_14580 gene rplU 87822 88133 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_14580 88154 88414 gene locus_tag LOCUS_14590 gene rpmA 88154 88414 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_14590 88585 89856 gene locus_tag LOCUS_14600 gene serS 88585 89856 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_14600 89894 90448 gene locus_tag LOCUS_14610 gene ruvC 89894 90448 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_14610 90530 93499 gene locus_tag LOCUS_14620 90530 93499 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence14 1033 1335 gene locus_tag LOCUS_14630 1033 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1337 3244 gene locus_tag LOCUS_14640 gene mutL 1337 3244 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_14640 3267 3959 gene locus_tag LOCUS_14650 3267 3959 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_14650 3974 5068 gene locus_tag LOCUS_14660 3974 5068 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_14660 5200 5299 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6134 5559 gene locus_tag LOCUS_14670 6134 5559 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_14670 6837 6148 gene locus_tag LOCUS_14680 6837 6148 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_14680 9349 6938 gene locus_tag LOCUS_14690 gene feoB 9349 6938 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_14690 9772 12501 gene locus_tag LOCUS_14700 9772 12501 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203196.1 protein_id gnl|my_center|LOCUS_14700 12543 12914 gene locus_tag LOCUS_14710 12543 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 12911 14440 gene locus_tag LOCUS_14720 12911 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555797.1 protein_id gnl|my_center|LOCUS_14720 14476 15918 gene locus_tag LOCUS_14730 14476 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 17106 16339 gene locus_tag LOCUS_14740 17106 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 18762 17113 gene locus_tag LOCUS_14750 18762 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 19472 18870 gene locus_tag LOCUS_14760 19472 18870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 20055 19465 gene locus_tag LOCUS_14770 20055 19465 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_14770 20708 20052 gene locus_tag LOCUS_14780 20708 20052 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_14780 21895 20903 gene locus_tag LOCUS_14790 gene tsf 21895 20903 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_14790 22767 21913 gene locus_tag LOCUS_14800 gene rpsB 22767 21913 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_14800 23393 23004 gene locus_tag LOCUS_14810 gene rpsI 23393 23004 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_14810 23854 23402 gene locus_tag LOCUS_14820 gene rplM 23854 23402 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_14820 24230 24733 gene locus_tag LOCUS_14830 24230 24733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 24690 24941 gene locus_tag LOCUS_14840 24690 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 25004 26209 gene locus_tag LOCUS_14850 25004 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 27630 26650 gene locus_tag LOCUS_14860 gene pfkA 27630 26650 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_14860 27752 28786 gene locus_tag LOCUS_14870 gene dusB 27752 28786 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_14870 28799 29956 gene locus_tag LOCUS_14880 gene lpxK 28799 29956 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_14880 32091 29953 gene locus_tag LOCUS_14890 32091 29953 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_14890 33770 32226 gene locus_tag LOCUS_14900 33770 32226 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_14900 35682 34036 gene locus_tag LOCUS_14910 35682 34036 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_14910 38895 35710 gene locus_tag LOCUS_14920 38895 35710 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_14920 39739 40587 gene locus_tag LOCUS_14930 39739 40587 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_14930 40819 43965 gene locus_tag LOCUS_14940 40819 43965 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_14940 43986 45566 gene locus_tag LOCUS_14950 43986 45566 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_14950 45587 46504 gene locus_tag LOCUS_14960 45587 46504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 46695 48236 gene locus_tag LOCUS_14970 46695 48236 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_14970 49485 48394 gene locus_tag LOCUS_14980 49485 48394 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_14980 50342 49488 gene locus_tag LOCUS_14990 50342 49488 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_14990 51541 50339 gene locus_tag LOCUS_15000 51541 50339 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_15000 52374 51544 gene locus_tag LOCUS_15010 52374 51544 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_15010 53271 52702 gene locus_tag LOCUS_15020 gene frr 53271 52702 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_15020 54042 53338 gene locus_tag LOCUS_15030 gene pyrH 54042 53338 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_15030 56979 55648 gene locus_tag LOCUS_15040 56979 55648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 57016 57115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57202 57570 gene locus_tag LOCUS_15050 57202 57570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 58068 58167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58213 58312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58677 58589 gene locus_tag LOCUS_t00220 58677 58589 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59813 61714 gene locus_tag LOCUS_15060 59813 61714 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_15060 61735 62529 gene locus_tag LOCUS_15070 gene nagB 61735 62529 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 protein_id gnl|my_center|LOCUS_15070 62625 63701 gene locus_tag LOCUS_15080 62625 63701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 64101 67856 gene locus_tag LOCUS_15090 64101 67856 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263132.1 protein_id gnl|my_center|LOCUS_15090 67860 68576 gene locus_tag LOCUS_15100 67860 68576 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_15100 68599 70167 gene locus_tag LOCUS_15110 gene cysS 68599 70167 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_15110 70179 70850 gene locus_tag LOCUS_15120 gene rpe 70179 70850 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_15120 72613 70871 gene locus_tag LOCUS_15130 72613 70871 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830048.1 protein_id gnl|my_center|LOCUS_15130 73447 72623 gene locus_tag LOCUS_15140 73447 72623 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042772.1 protein_id gnl|my_center|LOCUS_15140 75293 73551 gene locus_tag LOCUS_15150 75293 73551 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830048.1 protein_id gnl|my_center|LOCUS_15150 77146 75308 gene locus_tag LOCUS_15160 77146 75308 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_15160 80526 77161 gene locus_tag LOCUS_15170 80526 77161 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761957.1 protein_id gnl|my_center|LOCUS_15170 81117 84791 gene locus_tag LOCUS_15180 81117 84791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 85659 85856 gene locus_tag LOCUS_15190 85659 85856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 85860 86363 gene locus_tag LOCUS_15200 85860 86363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 87198 86581 gene locus_tag LOCUS_15210 87198 86581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 87791 88897 gene locus_tag LOCUS_15220 87791 88897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_15220 88960 89151 gene locus_tag LOCUS_15230 88960 89151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 89302 89616 gene locus_tag LOCUS_15240 89302 89616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence15 836 393 gene locus_tag LOCUS_15250 gene rplI 836 393 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_15250 1130 852 gene locus_tag LOCUS_15260 gene rpsR 1130 852 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_15260 1558 1148 gene locus_tag LOCUS_15270 gene rpsF 1558 1148 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_15270 3134 1677 gene locus_tag LOCUS_15280 3134 1677 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_15280 4234 3197 gene locus_tag LOCUS_15290 4234 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 5156 4245 gene locus_tag LOCUS_15300 5156 4245 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_15300 6769 5312 gene locus_tag LOCUS_15310 6769 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7523 6825 gene locus_tag LOCUS_15320 7523 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 9550 7523 gene locus_tag LOCUS_15330 9550 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11141 10527 gene locus_tag LOCUS_15340 11141 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 11776 11222 gene locus_tag LOCUS_15350 11776 11222 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_15350 12066 12953 gene locus_tag LOCUS_15360 12066 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 13152 14714 gene locus_tag LOCUS_15370 13152 14714 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_15370 14721 16415 gene locus_tag LOCUS_15380 14721 16415 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_15380 16453 17172 gene locus_tag LOCUS_15390 16453 17172 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_15390 17253 17876 gene locus_tag LOCUS_15400 17253 17876 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_15400 17863 19287 gene locus_tag LOCUS_15410 17863 19287 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_15410 19274 20662 gene locus_tag LOCUS_15420 19274 20662 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_15420 20725 21351 gene locus_tag LOCUS_15430 20725 21351 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_15430 21361 22467 gene locus_tag LOCUS_15440 21361 22467 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_15440 22464 23822 gene locus_tag LOCUS_15450 gene trkA 22464 23822 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_15450 24184 23870 gene locus_tag LOCUS_15460 24184 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 24665 24219 gene locus_tag LOCUS_15470 24665 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 24935 25933 gene locus_tag LOCUS_15480 24935 25933 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_15480 28082 26202 gene locus_tag LOCUS_15490 28082 26202 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_15490 28621 28923 gene locus_tag LOCUS_15500 28621 28923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 29419 30183 gene locus_tag LOCUS_15510 29419 30183 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_15510 31611 30196 gene locus_tag LOCUS_15520 gene uxaC 31611 30196 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_15520 31854 32477 gene locus_tag LOCUS_15530 31854 32477 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_15530 32491 33669 gene locus_tag LOCUS_15540 gene dnaJ 32491 33669 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_15540 33670 34530 gene locus_tag LOCUS_15550 33670 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 34530 35567 gene locus_tag LOCUS_15560 34530 35567 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_15560 35578 36237 gene locus_tag LOCUS_15570 35578 36237 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_15570 36357 36737 gene locus_tag LOCUS_15580 gene rplS 36357 36737 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_15580 36778 36852 gene locus_tag LOCUS_t00230 36778 36852 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36901 36974 gene locus_tag LOCUS_t00240 36901 36974 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38117 38788 gene locus_tag LOCUS_15590 38117 38788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 38835 39959 gene locus_tag LOCUS_15600 38835 39959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 41063 40128 gene locus_tag LOCUS_15610 41063 40128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 41276 43387 gene locus_tag LOCUS_15620 41276 43387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 45382 43394 gene locus_tag LOCUS_15630 45382 43394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 47260 45389 gene locus_tag LOCUS_15640 47260 45389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 48686 47271 gene locus_tag LOCUS_15650 48686 47271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 50133 48676 gene locus_tag LOCUS_15660 50133 48676 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_15660 53663 50145 gene locus_tag LOCUS_15670 53663 50145 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_15670 54687 53692 gene locus_tag LOCUS_15680 54687 53692 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_15680 55267 54737 gene locus_tag LOCUS_15690 55267 54737 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760954.1 protein_id gnl|my_center|LOCUS_15690 55785 55285 gene locus_tag LOCUS_15700 55785 55285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 59095 55820 gene locus_tag LOCUS_15710 gene secA 59095 55820 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_15710 59943 59284 gene locus_tag LOCUS_15720 59943 59284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 60354 61448 gene locus_tag LOCUS_15730 60354 61448 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_15730 62327 61452 gene locus_tag LOCUS_15740 62327 61452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 63140 62334 gene locus_tag LOCUS_15750 63140 62334 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_15750 63220 64275 gene locus_tag LOCUS_15760 63220 64275 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_15760 64268 65644 gene locus_tag LOCUS_15770 64268 65644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 65653 66480 gene locus_tag LOCUS_15780 65653 66480 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_15780 69567 66703 gene locus_tag LOCUS_15790 gene uvrA 69567 66703 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_15790 70460 70981 gene locus_tag LOCUS_15800 70460 70981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 71490 71083 gene locus_tag LOCUS_15810 71490 71083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 72096 71557 gene locus_tag LOCUS_15820 72096 71557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 74704 72293 gene locus_tag LOCUS_15830 74704 72293 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109376.1 protein_id gnl|my_center|LOCUS_15830 75714 74788 gene locus_tag LOCUS_15840 75714 74788 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence16 339 752 gene locus_tag LOCUS_15850 339 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1007 2071 gene locus_tag LOCUS_15860 1007 2071 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_15860 2112 3380 gene locus_tag LOCUS_15870 2112 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3755 3423 gene locus_tag LOCUS_15880 3755 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5025 3769 gene locus_tag LOCUS_15890 5025 3769 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_15890 5954 5022 gene locus_tag LOCUS_15900 5954 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6538 5951 gene locus_tag LOCUS_15910 6538 5951 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_15910 7076 6552 gene locus_tag LOCUS_15920 7076 6552 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_15920 7412 7083 gene locus_tag LOCUS_15930 7412 7083 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_15930 7499 10162 gene locus_tag LOCUS_15940 7499 10162 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_15940 10199 10612 gene locus_tag LOCUS_15950 10199 10612 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_15950 10653 10892 gene locus_tag LOCUS_15960 10653 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10892 11677 gene locus_tag LOCUS_15970 gene tatC 10892 11677 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760986.1 protein_id gnl|my_center|LOCUS_15970 11678 13627 gene locus_tag LOCUS_15980 11678 13627 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_15980 13650 14555 gene locus_tag LOCUS_15990 13650 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 14558 15640 gene locus_tag LOCUS_16000 14558 15640 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_16000 16987 15719 gene locus_tag LOCUS_16010 16987 15719 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_16010 18043 16997 gene locus_tag LOCUS_16020 18043 16997 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_16020 18600 18154 gene locus_tag LOCUS_16030 18600 18154 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_16030 19083 20297 gene locus_tag LOCUS_16040 19083 20297 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_16040 20383 21555 gene locus_tag LOCUS_16050 20383 21555 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_16050 23316 22033 gene locus_tag LOCUS_16060 23316 22033 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_16060 24327 23341 gene locus_tag LOCUS_16070 24327 23341 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_16070 25641 24379 gene locus_tag LOCUS_16080 25641 24379 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_16080 25900 27060 gene locus_tag LOCUS_16090 25900 27060 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_16090 27130 28815 gene locus_tag LOCUS_16100 27130 28815 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_16100 28876 30255 gene locus_tag LOCUS_16110 gene rlmD 28876 30255 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_16110 32572 30389 gene locus_tag LOCUS_16120 32572 30389 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_16120 32755 34149 gene locus_tag LOCUS_16130 32755 34149 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_16130 34153 34896 gene locus_tag LOCUS_16140 34153 34896 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_16140 35008 37917 gene locus_tag LOCUS_16150 35008 37917 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_16150 37920 39470 gene locus_tag LOCUS_16160 37920 39470 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_16160 40722 39493 gene locus_tag LOCUS_16170 gene pfp 40722 39493 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_16170 40898 42997 gene locus_tag LOCUS_16180 gene ligA 40898 42997 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_16180 43008 43979 gene locus_tag LOCUS_16190 43008 43979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 43976 46195 gene locus_tag LOCUS_16200 43976 46195 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_16200 46225 48018 gene locus_tag LOCUS_16210 46225 48018 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_16210 48018 48968 gene locus_tag LOCUS_16220 48018 48968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 48940 50274 gene locus_tag LOCUS_16230 48940 50274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 50944 50279 gene locus_tag LOCUS_16240 50944 50279 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_16240 51817 50987 gene locus_tag LOCUS_16250 51817 50987 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_16250 53810 51810 gene locus_tag LOCUS_16260 gene ftsH 53810 51810 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695721.1 protein_id gnl|my_center|LOCUS_16260 54186 53800 gene locus_tag LOCUS_16270 gene rsfS 54186 53800 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_16270 54439 54990 gene locus_tag LOCUS_16280 54439 54990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 55637 54987 gene locus_tag LOCUS_16290 gene rpe 55637 54987 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_16290 57063 55639 gene locus_tag LOCUS_16300 57063 55639 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_16300 58503 57076 gene locus_tag LOCUS_16310 gene dnaA 58503 57076 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_16310 59789 58809 gene locus_tag LOCUS_16320 59789 58809 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_16320 60326 60126 gene locus_tag LOCUS_16330 60326 60126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 60358 62787 gene locus_tag LOCUS_16340 60358 62787 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_16340 62916 64787 gene locus_tag LOCUS_16350 gene rho 62916 64787 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_16350 68286 65047 gene locus_tag LOCUS_16360 gene carB 68286 65047 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_16360 69376 68300 gene locus_tag LOCUS_16370 gene carA 69376 68300 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_16370 71132 69774 gene locus_tag LOCUS_16380 71132 69774 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_16380 72557 71226 gene locus_tag LOCUS_16390 72557 71226 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_16390 72754 74163 gene locus_tag LOCUS_16400 gene mnmE 72754 74163 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_16400 74690 75115 gene locus_tag LOCUS_16410 74690 75115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence17 775 155 gene locus_tag LOCUS_16420 775 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1450 818 gene locus_tag LOCUS_16430 1450 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2085 1462 gene locus_tag LOCUS_16440 2085 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3249 2236 gene locus_tag LOCUS_16450 3249 2236 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_16450 6582 3256 gene locus_tag LOCUS_16460 6582 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 7065 6616 gene locus_tag LOCUS_16470 7065 6616 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_16470 7424 7801 gene locus_tag LOCUS_16480 7424 7801 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_16480 9002 8145 gene locus_tag LOCUS_16490 9002 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 10611 9541 gene locus_tag LOCUS_16500 10611 9541 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_16500 13945 10826 gene locus_tag LOCUS_16510 13945 10826 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_16510 14954 13950 gene locus_tag LOCUS_16520 14954 13950 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803349.1 protein_id gnl|my_center|LOCUS_16520 14877 15113 gene locus_tag LOCUS_16530 14877 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 15818 15492 gene locus_tag LOCUS_16540 15818 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 16191 16290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17848 16454 gene locus_tag LOCUS_16550 gene gltA 17848 16454 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_16550 18690 17848 gene locus_tag LOCUS_16560 18690 17848 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_16560 18958 20949 gene locus_tag LOCUS_16570 18958 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 20998 23889 gene locus_tag LOCUS_16580 20998 23889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_16580 27449 23886 gene locus_tag LOCUS_16590 gene metH 27449 23886 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_16590 28376 27474 gene locus_tag LOCUS_16600 gene metF 28376 27474 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_16600 29173 28409 gene locus_tag LOCUS_16610 gene tsaA 29173 28409 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_16610 29690 29163 gene locus_tag LOCUS_16620 29690 29163 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_16620 29939 31105 gene locus_tag LOCUS_16630 gene buk 29939 31105 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_16630 31115 32161 gene locus_tag LOCUS_16640 31115 32161 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_16640 32165 32437 gene locus_tag LOCUS_16650 32165 32437 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_16650 32451 32681 gene locus_tag LOCUS_16660 32451 32681 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_16660 32685 33764 gene locus_tag LOCUS_16670 32685 33764 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_16670 33776 34549 gene locus_tag LOCUS_16680 33776 34549 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_16680 34562 35107 gene locus_tag LOCUS_16690 34562 35107 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_16690 36247 35129 gene locus_tag LOCUS_16700 36247 35129 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_16700 38666 36252 gene locus_tag LOCUS_16710 38666 36252 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_16710 38966 40132 gene locus_tag LOCUS_16720 38966 40132 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_16720 40191 42536 gene locus_tag LOCUS_16730 40191 42536 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_16730 43159 42533 gene locus_tag LOCUS_16740 43159 42533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 43466 46111 gene locus_tag LOCUS_16750 43466 46111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 46118 46699 gene locus_tag LOCUS_16760 gene purN 46118 46699 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_16760 47518 46781 gene locus_tag LOCUS_16770 47518 46781 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_16770 48519 47515 gene locus_tag LOCUS_16780 48519 47515 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_16780 49201 48563 gene locus_tag LOCUS_16790 49201 48563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 51661 49562 gene locus_tag LOCUS_16800 51661 49562 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_16800 51934 51716 gene locus_tag LOCUS_16810 51934 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 52774 51947 gene locus_tag LOCUS_16820 52774 51947 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_16820 54093 52816 gene locus_tag LOCUS_16830 54093 52816 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_16830 55182 54280 gene locus_tag LOCUS_16840 55182 54280 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_16840 56045 55182 gene locus_tag LOCUS_16850 56045 55182 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764605.1 protein_id gnl|my_center|LOCUS_16850 57581 56088 gene locus_tag LOCUS_16860 57581 56088 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_16860 58124 57744 gene locus_tag LOCUS_16870 58124 57744 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_16870 58211 59173 gene locus_tag LOCUS_16880 gene nusB 58211 59173 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_16880 59204 59545 gene locus_tag LOCUS_16890 gene yajC 59204 59545 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_16890 59651 60550 gene locus_tag LOCUS_16900 59651 60550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 60547 61170 gene locus_tag LOCUS_16910 gene coaE 60547 61170 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_16910 61174 61668 gene locus_tag LOCUS_16920 61174 61668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 61668 62972 gene locus_tag LOCUS_16930 gene rimO 61668 62972 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_16930 63003 63932 gene locus_tag LOCUS_16940 63003 63932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 63937 65538 gene locus_tag LOCUS_16950 gene glpA 63937 65538 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857281.1 protein_id gnl|my_center|LOCUS_16950 65551 66810 gene locus_tag LOCUS_16960 gene glpB 65551 66810 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176408.1 protein_id gnl|my_center|LOCUS_16960 66843 68081 gene locus_tag LOCUS_16970 gene glpC 66843 68081 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 protein_id gnl|my_center|LOCUS_16970 68565 70178 gene locus_tag LOCUS_16980 68565 70178 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_16980 70221 70994 gene locus_tag LOCUS_16990 70221 70994 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_16990 71436 73778 gene locus_tag LOCUS_17000 71436 73778 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence18 2002 134 gene locus_tag LOCUS_17010 gene dxs 2002 134 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_17010 2103 3527 gene locus_tag LOCUS_17020 2103 3527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_17020 3827 5125 gene locus_tag LOCUS_17030 3827 5125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_17030 5122 5973 gene locus_tag LOCUS_17040 gene dapF 5122 5973 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_17040 6006 6755 gene locus_tag LOCUS_17050 6006 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6827 7507 gene locus_tag LOCUS_17060 6827 7507 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_17060 8040 7516 gene locus_tag LOCUS_17070 gene rimM 8040 7516 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_17070 8611 8045 gene locus_tag LOCUS_17080 8611 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8763 8846 gene locus_tag LOCUS_t00250 8763 8846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8934 10658 gene locus_tag LOCUS_17090 8934 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 12365 10716 gene locus_tag LOCUS_17100 12365 10716 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_17100 12461 13717 gene locus_tag LOCUS_17110 12461 13717 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_17110 13723 14232 gene locus_tag LOCUS_17120 13723 14232 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_17120 14235 14879 gene locus_tag LOCUS_17130 14235 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 14891 15241 gene locus_tag LOCUS_17140 14891 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 15388 17583 gene locus_tag LOCUS_17150 gene clpB 15388 17583 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_17150 19732 17645 gene locus_tag LOCUS_17160 19732 17645 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_17160 22568 19740 gene locus_tag LOCUS_17170 22568 19740 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_17170 24181 22556 gene locus_tag LOCUS_17180 24181 22556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 25476 24184 gene locus_tag LOCUS_17190 25476 24184 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108914.1 protein_id gnl|my_center|LOCUS_17190 28480 25511 gene locus_tag LOCUS_17200 28480 25511 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108915.1 protein_id gnl|my_center|LOCUS_17200 30266 28500 gene locus_tag LOCUS_17210 30266 28500 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_17210 30325 30762 gene locus_tag LOCUS_17220 30325 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 30765 31823 gene locus_tag LOCUS_17230 gene pheS 30765 31823 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_17230 31927 32002 gene locus_tag LOCUS_t00260 31927 32002 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32061 32831 gene locus_tag LOCUS_17240 gene pnuC 32061 32831 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621371.1 protein_id gnl|my_center|LOCUS_17240 33016 33273 gene locus_tag LOCUS_17250 33016 33273 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_17250 35065 33422 gene locus_tag LOCUS_17260 35065 33422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 35842 35066 gene locus_tag LOCUS_17270 35842 35066 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_17270 35979 36857 gene locus_tag LOCUS_17280 35979 36857 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_17280 36877 37119 gene locus_tag LOCUS_17290 36877 37119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 37123 37953 gene locus_tag LOCUS_17300 37123 37953 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_17300 37972 38727 gene locus_tag LOCUS_17310 37972 38727 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_17310 39365 38658 gene locus_tag LOCUS_17320 39365 38658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 39720 40091 gene locus_tag LOCUS_17330 gene rplP 39720 40091 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_17330 40109 40306 gene locus_tag LOCUS_17340 gene rpmC 40109 40306 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_17340 40318 40572 gene locus_tag LOCUS_17350 gene rpsQ 40318 40572 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_17350 40574 40939 gene locus_tag LOCUS_17360 gene rplN 40574 40939 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_17360 40952 41269 gene locus_tag LOCUS_17370 gene rplX 40952 41269 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_17370 41272 41874 gene locus_tag LOCUS_17380 gene rplE 41272 41874 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_17380 41880 42149 gene locus_tag LOCUS_17390 gene rpsN 41880 42149 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_17390 42228 42623 gene locus_tag LOCUS_17400 gene rpsH 42228 42623 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_17400 42641 43201 gene locus_tag LOCUS_17410 gene rplF 42641 43201 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_17410 43217 43579 gene locus_tag LOCUS_17420 gene rplR 43217 43579 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_17420 43590 44108 gene locus_tag LOCUS_17430 gene rpsE 43590 44108 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_17430 44123 44302 gene locus_tag LOCUS_17440 gene rpmD 44123 44302 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055719.1 protein_id gnl|my_center|LOCUS_17440 44319 44771 gene locus_tag LOCUS_17450 gene rplO 44319 44771 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_17450 44774 46114 gene locus_tag LOCUS_17460 gene secY 44774 46114 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_17460 46136 46909 gene locus_tag LOCUS_17470 gene map 46136 46909 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_17470 46922 47140 gene locus_tag LOCUS_17480 gene infA 46922 47140 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_17480 47308 47685 gene locus_tag LOCUS_17490 gene rpsM 47308 47685 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_17490 47699 48085 gene locus_tag LOCUS_17500 gene rpsK 47699 48085 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_17500 48111 48713 gene locus_tag LOCUS_17510 gene rpsD 48111 48713 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_17510 48738 49745 gene locus_tag LOCUS_17520 48738 49745 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_17520 49748 50236 gene locus_tag LOCUS_17530 gene rplQ 49748 50236 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_17530 50412 52601 gene locus_tag LOCUS_17540 50412 52601 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_17540 52633 53685 gene locus_tag LOCUS_17550 52633 53685 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 protein_id gnl|my_center|LOCUS_17550 54152 53682 gene locus_tag LOCUS_17560 gene purE 54152 53682 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093510.1 protein_id gnl|my_center|LOCUS_17560 55141 54170 gene locus_tag LOCUS_17570 gene miaA 55141 54170 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_17570 58054 55145 gene locus_tag LOCUS_17580 58054 55145 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_17580 58249 58704 gene locus_tag LOCUS_17590 gene smpB 58249 58704 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_17590 61047 59737 gene locus_tag LOCUS_17600 gene metK 61047 59737 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_17600 61453 64734 gene locus_tag LOCUS_17610 61453 64734 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_17610 64752 66776 gene locus_tag LOCUS_17620 64752 66776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence19 1874 306 gene locus_tag LOCUS_17630 1874 306 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_17630 3687 2086 gene locus_tag LOCUS_17640 3687 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 7130 3951 gene locus_tag LOCUS_17650 7130 3951 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_17650 7531 8856 gene locus_tag LOCUS_17660 gene ffh 7531 8856 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_17660 10213 9002 gene locus_tag LOCUS_17670 gene lysA 10213 9002 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_17670 10572 11546 gene locus_tag LOCUS_17680 10572 11546 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_17680 11798 11580 gene locus_tag LOCUS_17690 11798 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 11706 12173 gene locus_tag LOCUS_17700 11706 12173 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108669.1 protein_id gnl|my_center|LOCUS_17700 12232 13062 gene locus_tag LOCUS_17710 12232 13062 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_17710 13075 13902 gene locus_tag LOCUS_17720 13075 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 13915 14271 gene locus_tag LOCUS_17730 13915 14271 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_17730 14285 15091 gene locus_tag LOCUS_17740 14285 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 15097 15843 gene locus_tag LOCUS_17750 15097 15843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 17278 16310 gene locus_tag LOCUS_17760 17278 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 19016 17958 gene locus_tag LOCUS_17770 gene pdxB 19016 17958 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_17770 19364 19020 gene locus_tag LOCUS_17780 19364 19020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 20464 19367 gene locus_tag LOCUS_17790 gene recF 20464 19367 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_17790 21738 20572 gene locus_tag LOCUS_17800 21738 20572 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_17800 24186 21739 gene locus_tag LOCUS_17810 24186 21739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 26195 24189 gene locus_tag LOCUS_17820 26195 24189 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_17820 27144 26197 gene locus_tag LOCUS_17830 27144 26197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 29482 27170 gene locus_tag LOCUS_17840 29482 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 31797 29488 gene locus_tag LOCUS_17850 31797 29488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 33304 31808 gene locus_tag LOCUS_17860 33304 31808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 36421 33317 gene locus_tag LOCUS_17870 36421 33317 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_17870 38237 36693 gene locus_tag LOCUS_17880 38237 36693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 38393 39085 gene locus_tag LOCUS_17890 38393 39085 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_17890 39091 39843 gene locus_tag LOCUS_17900 39091 39843 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_17900 40303 41865 gene locus_tag LOCUS_17910 40303 41865 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_17910 41870 42796 gene locus_tag LOCUS_17920 41870 42796 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_17920 42812 43255 gene locus_tag LOCUS_17930 42812 43255 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_17930 43260 44402 gene locus_tag LOCUS_17940 43260 44402 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_17940 45111 44473 gene locus_tag LOCUS_17950 45111 44473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 45941 45162 gene locus_tag LOCUS_17960 45941 45162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 46067 46675 gene locus_tag LOCUS_17970 46067 46675 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_17970 46675 47277 gene locus_tag LOCUS_17980 46675 47277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 47299 49053 gene locus_tag LOCUS_17990 47299 49053 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_17990 49043 50365 gene locus_tag LOCUS_18000 49043 50365 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_18000 50365 50991 gene locus_tag LOCUS_18010 50365 50991 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_18010 50984 52822 gene locus_tag LOCUS_18020 50984 52822 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100251.1 protein_id gnl|my_center|LOCUS_18020 52847 53266 gene locus_tag LOCUS_18030 52847 53266 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_18030 53288 54748 gene locus_tag LOCUS_18040 gene glmM 53288 54748 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_18040 55163 56227 gene locus_tag LOCUS_18050 55163 56227 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_18050 56289 57617 gene locus_tag LOCUS_18060 56289 57617 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_18060 58370 58636 gene locus_tag LOCUS_18070 58370 58636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 58638 58853 gene locus_tag LOCUS_18080 58638 58853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 60612 59497 gene locus_tag LOCUS_18090 60612 59497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 60794 61483 gene locus_tag LOCUS_18100 60794 61483 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_18100 61974 61705 gene locus_tag LOCUS_18110 61974 61705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 62585 62316 gene locus_tag LOCUS_18120 62585 62316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence20 678 2063 gene locus_tag LOCUS_18130 678 2063 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250495.1 protein_id gnl|my_center|LOCUS_18130 2130 2525 gene locus_tag LOCUS_18140 2130 2525 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_18140 2607 3308 gene locus_tag LOCUS_18150 2607 3308 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_18150 3413 5038 gene locus_tag LOCUS_18160 3413 5038 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_18160 5044 5634 gene locus_tag LOCUS_18170 5044 5634 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_18170 5631 6947 gene locus_tag LOCUS_18180 5631 6947 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_18180 6962 8260 gene locus_tag LOCUS_18190 6962 8260 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_18190 8962 8264 gene locus_tag LOCUS_18200 8962 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 9830 10441 gene locus_tag LOCUS_18210 9830 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 11954 10674 gene locus_tag LOCUS_18220 11954 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 12244 12026 gene locus_tag LOCUS_18230 12244 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 13676 12270 gene locus_tag LOCUS_18240 13676 12270 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766763.1 protein_id gnl|my_center|LOCUS_18240 17025 13687 gene locus_tag LOCUS_18250 17025 13687 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_18250 21050 17202 gene locus_tag LOCUS_18260 21050 17202 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_18260 23091 21052 gene locus_tag LOCUS_18270 23091 21052 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_18270 25061 23127 gene locus_tag LOCUS_18280 25061 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 27097 25073 gene locus_tag LOCUS_18290 27097 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 27581 27117 gene locus_tag LOCUS_18300 27581 27117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 29423 27603 gene locus_tag LOCUS_18310 29423 27603 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_18310 32716 29435 gene locus_tag LOCUS_18320 32716 29435 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_18320 33932 32742 gene locus_tag LOCUS_18330 33932 32742 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_18330 34508 34161 gene locus_tag LOCUS_18340 gene rbfA 34508 34161 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_18340 34878 34465 gene locus_tag LOCUS_18350 34878 34465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 35950 34859 gene locus_tag LOCUS_18360 35950 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 36513 36205 gene locus_tag LOCUS_18370 36513 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 36696 37058 gene locus_tag LOCUS_18380 36696 37058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 37147 37662 gene locus_tag LOCUS_18390 37147 37662 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_18390 39186 37966 gene locus_tag LOCUS_18400 39186 37966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_18400 39953 39210 gene locus_tag LOCUS_18410 39953 39210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_18410 41149 39980 gene locus_tag LOCUS_18420 41149 39980 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_18420 42503 41151 gene locus_tag LOCUS_18430 42503 41151 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_18430 42675 44930 gene locus_tag LOCUS_18440 42675 44930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 45350 45165 gene locus_tag LOCUS_18450 45350 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 46129 45347 gene locus_tag LOCUS_18460 46129 45347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 47085 46117 gene locus_tag LOCUS_18470 47085 46117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 50954 47853 gene locus_tag LOCUS_18480 50954 47853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 53015 50967 gene locus_tag LOCUS_18490 53015 50967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 53243 53076 gene locus_tag LOCUS_18500 53243 53076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 53233 55236 gene locus_tag LOCUS_18510 53233 55236 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_18510 55431 55910 gene locus_tag LOCUS_18520 55431 55910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 56138 56854 gene locus_tag LOCUS_18530 56138 56854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 56970 57057 gene locus_tag LOCUS_t00270 56970 57057 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 744 262 gene locus_tag LOCUS_18540 744 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1164 961 gene locus_tag LOCUS_18550 1164 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2082 1180 gene locus_tag LOCUS_18560 2082 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2672 2451 gene locus_tag LOCUS_18570 2672 2451 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_18570 2845 3432 gene locus_tag LOCUS_18580 gene folE 2845 3432 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_18580 3539 4654 gene locus_tag LOCUS_18590 gene trpS 3539 4654 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_18590 4654 5052 gene locus_tag LOCUS_18600 4654 5052 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794500.1 protein_id gnl|my_center|LOCUS_18600 5052 5543 gene locus_tag LOCUS_18610 5052 5543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_18610 5837 6940 gene locus_tag LOCUS_18620 5837 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6961 10521 gene locus_tag LOCUS_18630 6961 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 10541 12124 gene locus_tag LOCUS_18640 10541 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 12142 14040 gene locus_tag LOCUS_18650 12142 14040 CDS product subtilase family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766219.1 protein_id gnl|my_center|LOCUS_18650 14037 15968 gene locus_tag LOCUS_18660 14037 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 15958 19164 gene locus_tag LOCUS_18670 15958 19164 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_18670 19176 20732 gene locus_tag LOCUS_18680 19176 20732 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_18680 20748 22892 gene locus_tag LOCUS_18690 20748 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 23016 23918 gene locus_tag LOCUS_18700 23016 23918 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_18700 24926 24273 gene locus_tag LOCUS_18710 gene ppaX 24926 24273 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_18710 25046 25606 gene locus_tag LOCUS_18720 25046 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 25628 26344 gene locus_tag LOCUS_18730 25628 26344 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_18730 26908 27840 gene locus_tag LOCUS_18740 26908 27840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 28874 28281 gene locus_tag LOCUS_18750 28874 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 30186 29071 gene locus_tag LOCUS_18760 30186 29071 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203721.1 protein_id gnl|my_center|LOCUS_18760 31038 30190 gene locus_tag LOCUS_18770 31038 30190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 32177 31035 gene locus_tag LOCUS_18780 32177 31035 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167408.1 protein_id gnl|my_center|LOCUS_18780 33202 32174 gene locus_tag LOCUS_18790 33202 32174 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_18790 34038 33205 gene locus_tag LOCUS_18800 34038 33205 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838868.1 protein_id gnl|my_center|LOCUS_18800 35790 34042 gene locus_tag LOCUS_18810 35790 34042 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_18810 37337 35787 gene locus_tag LOCUS_18820 37337 35787 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_18820 38401 37373 gene locus_tag LOCUS_18830 38401 37373 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_18830 39239 38550 gene locus_tag LOCUS_18840 gene mtgA 39239 38550 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_18840 39720 39253 gene locus_tag LOCUS_18850 39720 39253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 40665 39724 gene locus_tag LOCUS_18860 40665 39724 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_18860 41211 40747 gene locus_tag LOCUS_18870 41211 40747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 43639 41216 gene locus_tag LOCUS_18880 43639 41216 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_18880 44678 43659 gene locus_tag LOCUS_18890 gene rlmN 44678 43659 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_18890 44808 45836 gene locus_tag LOCUS_18900 gene recA 44808 45836 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_18900 46357 45833 gene locus_tag LOCUS_18910 46357 45833 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_18910 46511 47371 gene locus_tag LOCUS_18920 46511 47371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 47445 48155 gene locus_tag LOCUS_18930 gene rsmI 47445 48155 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_18930 48168 49313 gene locus_tag LOCUS_18940 48168 49313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 50526 49651 gene locus_tag LOCUS_18950 gene xerD 50526 49651 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_18950 52532 50526 gene locus_tag LOCUS_18960 52532 50526 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_18960 52646 53968 gene locus_tag LOCUS_18970 52646 53968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 54077 54721 gene locus_tag LOCUS_18980 54077 54721 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_18980 54753 55340 gene locus_tag LOCUS_18990 gene pth 54753 55340 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_18990 55475 55651 gene locus_tag LOCUS_19000 55475 55651 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_19000 56479 55724 gene locus_tag LOCUS_19010 gene tpiA 56479 55724 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence22 1803 184 gene locus_tag LOCUS_19020 1803 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4883 1815 gene locus_tag LOCUS_19030 4883 1815 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_19030 5993 4896 gene locus_tag LOCUS_19040 5993 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 7550 6015 gene locus_tag LOCUS_19050 7550 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8322 7555 gene locus_tag LOCUS_19060 8322 7555 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_19060 9489 8326 gene locus_tag LOCUS_19070 gene nagA 9489 8326 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_19070 10769 9483 gene locus_tag LOCUS_19080 10769 9483 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_19080 11999 10848 gene locus_tag LOCUS_19090 11999 10848 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767092.1 protein_id gnl|my_center|LOCUS_19090 12146 13195 gene locus_tag LOCUS_19100 12146 13195 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_19100 13869 13201 gene locus_tag LOCUS_19110 13869 13201 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_19110 14912 13881 gene locus_tag LOCUS_19120 14912 13881 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_19120 15543 15349 gene locus_tag LOCUS_19130 15543 15349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 16429 15659 gene locus_tag LOCUS_19140 gene truA 16429 15659 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_19140 16474 17466 gene locus_tag LOCUS_19150 16474 17466 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_19150 17501 18394 gene locus_tag LOCUS_19160 17501 18394 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_19160 18397 19449 gene locus_tag LOCUS_19170 18397 19449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 19449 20432 gene locus_tag LOCUS_19180 19449 20432 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_19180 20429 21439 gene locus_tag LOCUS_19190 20429 21439 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_19190 21436 22212 gene locus_tag LOCUS_19200 21436 22212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 22217 24856 gene locus_tag LOCUS_19210 22217 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 26659 24929 gene locus_tag LOCUS_19220 26659 24929 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_19220 26918 28492 gene locus_tag LOCUS_19230 26918 28492 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_19230 28947 28495 gene locus_tag LOCUS_19240 gene tsaE 28947 28495 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_19240 30140 28932 gene locus_tag LOCUS_19250 30140 28932 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_19250 31783 30140 gene locus_tag LOCUS_19260 31783 30140 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_19260 32168 35284 gene locus_tag LOCUS_19270 32168 35284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 37142 35484 gene locus_tag LOCUS_19280 37142 35484 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_19280 37707 37147 gene locus_tag LOCUS_19290 37707 37147 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_19290 38375 37737 gene locus_tag LOCUS_19300 38375 37737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 38663 39655 gene locus_tag LOCUS_19310 38663 39655 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_19310 39862 41511 gene locus_tag LOCUS_19320 39862 41511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_19320 41983 41489 gene locus_tag LOCUS_19330 41983 41489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 42243 42509 gene locus_tag LOCUS_19340 42243 42509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 42511 43557 gene locus_tag LOCUS_19350 42511 43557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_19350 43608 44735 gene locus_tag LOCUS_19360 43608 44735 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_19360 44871 44797 gene locus_tag LOCUS_t00280 44871 44797 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45102 45761 gene locus_tag LOCUS_19370 45102 45761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_19370 45782 46543 gene locus_tag LOCUS_19380 45782 46543 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_19380 47045 46584 gene locus_tag LOCUS_19390 47045 46584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_19390 47454 47053 gene locus_tag LOCUS_19400 47454 47053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 48027 47482 gene locus_tag LOCUS_19410 48027 47482 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_19410 48137 49927 gene locus_tag LOCUS_19420 gene lepA 48137 49927 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_19420 49932 50606 gene locus_tag LOCUS_19430 49932 50606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 50682 52454 gene locus_tag LOCUS_19440 gene fucI 50682 52454 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_19440 52464 53786 gene locus_tag LOCUS_19450 gene fucP 52464 53786 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_19450 54984 53788 gene locus_tag LOCUS_19460 54984 53788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence23 1 75 gene locus_tag LOCUS_t00290 1 75 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 107 187 gene locus_tag LOCUS_t00300 107 187 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 195 270 gene locus_tag LOCUS_t00310 195 270 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 280 352 gene locus_tag LOCUS_t00320 280 352 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 393 1586 gene locus_tag LOCUS_19470 gene tuf 393 1586 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_19470 1634 1705 gene locus_tag LOCUS_t00330 1634 1705 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1789 1977 gene locus_tag LOCUS_19480 1789 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1993 2556 gene locus_tag LOCUS_19490 gene nusG 1993 2556 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_19490 2566 3009 gene locus_tag LOCUS_19500 gene rplK 2566 3009 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_19500 3024 3731 gene locus_tag LOCUS_19510 gene rplA 3024 3731 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_19510 3746 4276 gene locus_tag LOCUS_19520 gene rplJ 3746 4276 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_19520 4304 4678 gene locus_tag LOCUS_19530 gene rplL 4304 4678 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_19530 4779 8597 gene locus_tag LOCUS_19540 gene rpoB 4779 8597 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_19540 8610 12875 gene locus_tag LOCUS_19550 gene rpoC 8610 12875 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_19550 14225 13218 gene locus_tag LOCUS_19560 14225 13218 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083018.1 protein_id gnl|my_center|LOCUS_19560 14357 14590 gene locus_tag LOCUS_19570 14357 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 14606 15664 gene locus_tag LOCUS_19580 14606 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 15661 16221 gene locus_tag LOCUS_19590 15661 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 17149 16334 gene locus_tag LOCUS_19600 17149 16334 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 protein_id gnl|my_center|LOCUS_19600 18845 17436 gene locus_tag LOCUS_19610 gene purD 18845 17436 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_19610 20654 19071 gene locus_tag LOCUS_19620 gene purH 20654 19071 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_19620 21741 20671 gene locus_tag LOCUS_19630 21741 20671 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765031.1 protein_id gnl|my_center|LOCUS_19630 22188 21745 gene locus_tag LOCUS_19640 22188 21745 CDS product radical SAM-associated putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797215.1 protein_id gnl|my_center|LOCUS_19640 23308 22274 gene locus_tag LOCUS_19650 gene purM 23308 22274 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_19650 24786 23605 gene locus_tag LOCUS_19660 gene purF 24786 23605 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879025.1 protein_id gnl|my_center|LOCUS_19660 24682 25005 gene locus_tag LOCUS_19670 24682 25005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 26765 25305 gene locus_tag LOCUS_19680 26765 25305 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_19680 28207 26777 gene locus_tag LOCUS_19690 28207 26777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 30058 28223 gene locus_tag LOCUS_19700 30058 28223 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_19700 33415 30062 gene locus_tag LOCUS_19710 33415 30062 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 protein_id gnl|my_center|LOCUS_19710 34393 33743 gene locus_tag LOCUS_19720 34393 33743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 34982 34377 gene locus_tag LOCUS_19730 34982 34377 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_19730 35136 35333 gene locus_tag LOCUS_19740 35136 35333 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_19740 35330 35659 gene locus_tag LOCUS_19750 35330 35659 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_19750 35820 36617 gene locus_tag LOCUS_19760 35820 36617 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_19760 36730 38343 gene locus_tag LOCUS_19770 36730 38343 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_19770 39904 38723 gene locus_tag LOCUS_19780 39904 38723 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_19780 40067 41089 gene locus_tag LOCUS_19790 40067 41089 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_19790 41145 42116 gene locus_tag LOCUS_19800 41145 42116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 42843 42163 gene locus_tag LOCUS_19810 42843 42163 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_19810 43118 44815 gene locus_tag LOCUS_19820 43118 44815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 45002 45901 gene locus_tag LOCUS_19830 45002 45901 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_19830 46005 46499 gene locus_tag LOCUS_19840 46005 46499 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_19840 46894 47412 gene locus_tag LOCUS_19850 46894 47412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 47406 47633 gene locus_tag LOCUS_19860 47406 47633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 47894 47712 gene locus_tag LOCUS_19870 47894 47712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 48137 49285 gene locus_tag LOCUS_19880 48137 49285 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_19880 49552 49325 gene locus_tag LOCUS_19890 49552 49325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 49765 50181 gene locus_tag LOCUS_19900 49765 50181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 50651 52168 gene locus_tag LOCUS_19910 50651 52168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence24 188 1276 gene locus_tag LOCUS_19920 188 1276 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_19920 1292 2446 gene locus_tag LOCUS_19930 1292 2446 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_19930 2536 2609 gene locus_tag LOCUS_t00340 2536 2609 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2665 2738 gene locus_tag LOCUS_t00350 2665 2738 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2806 3342 gene locus_tag LOCUS_19940 2806 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3349 3975 gene locus_tag LOCUS_19950 3349 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4014 4682 gene locus_tag LOCUS_19960 4014 4682 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_19960 4891 5334 gene locus_tag LOCUS_19970 4891 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5364 5786 gene locus_tag LOCUS_19980 5364 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 8058 6031 gene locus_tag LOCUS_19990 8058 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 8522 8193 gene locus_tag LOCUS_20000 8522 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 9571 8516 gene locus_tag LOCUS_20010 9571 8516 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_20010 10657 9593 gene locus_tag LOCUS_20020 10657 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 11359 10664 gene locus_tag LOCUS_20030 11359 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 11837 11343 gene locus_tag LOCUS_20040 11837 11343 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267583.1 protein_id gnl|my_center|LOCUS_20040 12868 11936 gene locus_tag LOCUS_20050 gene rsgA 12868 11936 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_20050 13566 13105 gene locus_tag LOCUS_20060 gene queF 13566 13105 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_20060 14361 13645 gene locus_tag LOCUS_20070 14361 13645 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_20070 14521 15504 gene locus_tag LOCUS_20080 14521 15504 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_20080 15744 18149 gene locus_tag LOCUS_20090 15744 18149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_20090 18338 19423 gene locus_tag LOCUS_20100 18338 19423 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_20100 19472 19481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19525 20004 gene locus_tag LOCUS_20110 19525 20004 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762403.1 protein_id gnl|my_center|LOCUS_20110 20173 21573 gene locus_tag LOCUS_20120 gene glpT 20173 21573 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948732.1 protein_id gnl|my_center|LOCUS_20120 21622 23622 gene locus_tag LOCUS_20130 21622 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 23667 27011 gene locus_tag LOCUS_20140 23667 27011 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_20140 27024 28901 gene locus_tag LOCUS_20150 27024 28901 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_20150 28926 31916 gene locus_tag LOCUS_20160 28926 31916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 32488 32709 gene locus_tag LOCUS_20170 32488 32709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 34016 33474 gene locus_tag LOCUS_20180 34016 33474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 35472 34222 gene locus_tag LOCUS_20190 35472 34222 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_20190 36890 35580 gene locus_tag LOCUS_20200 36890 35580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 38358 37276 gene locus_tag LOCUS_20210 38358 37276 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_20210 40497 38773 gene locus_tag LOCUS_20220 40497 38773 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203291.1 protein_id gnl|my_center|LOCUS_20220 41137 40463 gene locus_tag LOCUS_20230 41137 40463 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_20230 41895 41149 gene locus_tag LOCUS_20240 41895 41149 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_20240 43023 41905 gene locus_tag LOCUS_20250 43023 41905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_20250 44134 43028 gene locus_tag LOCUS_20260 44134 43028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_20260 44876 44136 gene locus_tag LOCUS_20270 44876 44136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 45793 44876 gene locus_tag LOCUS_20280 45793 44876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 46692 45793 gene locus_tag LOCUS_20290 46692 45793 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_20290 47441 46827 gene locus_tag LOCUS_20300 47441 46827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence25 76 468 gene locus_tag LOCUS_20310 76 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 622 966 gene locus_tag LOCUS_20320 622 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 973 2193 gene locus_tag LOCUS_20330 973 2193 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042373263.1 protein_id gnl|my_center|LOCUS_20330 2261 2749 gene locus_tag LOCUS_20340 2261 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3512 4537 gene locus_tag LOCUS_20350 3512 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4545 6566 gene locus_tag LOCUS_20360 4545 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202019.1 protein_id gnl|my_center|LOCUS_20360 6577 7356 gene locus_tag LOCUS_20370 gene lepB 6577 7356 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_20370 8145 9374 gene locus_tag LOCUS_20380 8145 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 9580 10569 gene locus_tag LOCUS_20390 9580 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 10905 12395 gene locus_tag LOCUS_20400 10905 12395 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_20400 12478 13533 gene locus_tag LOCUS_20410 12478 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 13667 14182 gene locus_tag LOCUS_20420 13667 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 14406 15473 gene locus_tag LOCUS_20430 14406 15473 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_20430 15477 18620 gene locus_tag LOCUS_20440 15477 18620 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_20440 18649 21783 gene locus_tag LOCUS_20450 18649 21783 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_20450 22184 22642 gene locus_tag LOCUS_20460 22184 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107174.1 protein_id gnl|my_center|LOCUS_20460 24054 25043 gene locus_tag LOCUS_20470 24054 25043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 25377 26906 gene locus_tag LOCUS_20480 25377 26906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 26934 28289 gene locus_tag LOCUS_20490 26934 28289 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_20490 28296 29204 gene locus_tag LOCUS_20500 28296 29204 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420918.1 protein_id gnl|my_center|LOCUS_20500 29204 30067 gene locus_tag LOCUS_20510 29204 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 30064 31002 gene locus_tag LOCUS_20520 gene ccsA 30064 31002 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_20520 31355 33130 gene locus_tag LOCUS_20530 gene aspS 31355 33130 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_20530 33418 34764 gene locus_tag LOCUS_20540 33418 34764 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618671.1 protein_id gnl|my_center|LOCUS_20540 35349 36791 gene locus_tag LOCUS_20550 35349 36791 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_20550 36816 37310 gene locus_tag LOCUS_20560 36816 37310 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_20560 37313 40333 gene locus_tag LOCUS_20570 37313 40333 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201991.1 protein_id gnl|my_center|LOCUS_20570 42208 40337 gene locus_tag LOCUS_20580 42208 40337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 43327 42413 gene locus_tag LOCUS_20590 43327 42413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 44105 43335 gene locus_tag LOCUS_20600 44105 43335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 45576 44137 gene locus_tag LOCUS_20610 45576 44137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 45693 46451 gene locus_tag LOCUS_20620 gene rsmA 45693 46451 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_20620 46733 46820 gene locus_tag LOCUS_t00360 46733 46820 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 2152 611 gene locus_tag LOCUS_20630 2152 611 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109317.1 protein_id gnl|my_center|LOCUS_20630 4984 2168 gene locus_tag LOCUS_20640 4984 2168 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109314.1 protein_id gnl|my_center|LOCUS_20640 6584 5163 gene locus_tag LOCUS_20650 6584 5163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_20650 7539 6619 gene locus_tag LOCUS_20660 7539 6619 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_20660 8136 7597 gene locus_tag LOCUS_20670 8136 7597 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_20670 9841 8150 gene locus_tag LOCUS_20680 9841 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 11914 9911 gene locus_tag LOCUS_20690 11914 9911 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766238.1 protein_id gnl|my_center|LOCUS_20690 13342 11951 gene locus_tag LOCUS_20700 13342 11951 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_20700 16767 13342 gene locus_tag LOCUS_20710 16767 13342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_20710 17822 16767 gene locus_tag LOCUS_20720 17822 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 18187 17822 gene locus_tag LOCUS_20730 18187 17822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 18327 18932 gene locus_tag LOCUS_20740 18327 18932 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_20740 20470 19133 gene locus_tag LOCUS_20750 20470 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 22419 20503 gene locus_tag LOCUS_20760 22419 20503 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107269.1 protein_id gnl|my_center|LOCUS_20760 25734 22435 gene locus_tag LOCUS_20770 25734 22435 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_20770 26760 25783 gene locus_tag LOCUS_20780 26760 25783 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_20780 27009 28646 gene locus_tag LOCUS_20790 27009 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 28918 30210 gene locus_tag LOCUS_20800 28918 30210 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766205.1 protein_id gnl|my_center|LOCUS_20800 30215 33307 gene locus_tag LOCUS_20810 30215 33307 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546332.1 protein_id gnl|my_center|LOCUS_20810 35112 33304 gene locus_tag LOCUS_20820 35112 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 37056 35128 gene locus_tag LOCUS_20830 37056 35128 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992484.1 protein_id gnl|my_center|LOCUS_20830 37194 37451 gene locus_tag LOCUS_20840 37194 37451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 38316 37942 gene locus_tag LOCUS_20850 38316 37942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 38428 38643 gene locus_tag LOCUS_20860 38428 38643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 39311 38670 gene locus_tag LOCUS_20870 39311 38670 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_20870 39642 39322 gene locus_tag LOCUS_20880 39642 39322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 40084 39659 gene locus_tag LOCUS_20890 40084 39659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 40983 40633 gene locus_tag LOCUS_20900 40983 40633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 41912 41271 gene locus_tag LOCUS_20910 41912 41271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 42601 42341 gene locus_tag LOCUS_20920 42601 42341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 42869 42968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43322 43696 gene locus_tag LOCUS_20930 43322 43696 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_20930 44249 45472 gene locus_tag LOCUS_20940 44249 45472 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_20940 45945 45619 gene locus_tag LOCUS_20950 45945 45619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 46641 46171 gene locus_tag LOCUS_20960 gene greA 46641 46171 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence27 1474 620 gene locus_tag LOCUS_20970 1474 620 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203479.1 protein_id gnl|my_center|LOCUS_20970 2186 1524 gene locus_tag LOCUS_20980 2186 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3379 2387 gene locus_tag LOCUS_20990 3379 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3879 5456 gene locus_tag LOCUS_21000 3879 5456 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_21000 5482 6183 gene locus_tag LOCUS_21010 5482 6183 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582836.1 protein_id gnl|my_center|LOCUS_21010 7777 6464 gene locus_tag LOCUS_21020 7777 6464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_21020 8158 11976 gene locus_tag LOCUS_21030 gene dnaE 8158 11976 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_21030 12359 12673 gene locus_tag LOCUS_21040 12359 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 12676 13026 gene locus_tag LOCUS_21050 12676 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 13030 13263 gene locus_tag LOCUS_21060 13030 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 13267 15612 gene locus_tag LOCUS_21070 13267 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 15635 17185 gene locus_tag LOCUS_21080 15635 17185 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_21080 18147 17164 gene locus_tag LOCUS_21090 18147 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 18443 20251 gene locus_tag LOCUS_21100 18443 20251 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_21100 21971 20607 gene locus_tag LOCUS_21110 21971 20607 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760379.1 protein_id gnl|my_center|LOCUS_21110 22915 22223 gene locus_tag LOCUS_21120 22915 22223 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_21120 23017 22943 gene locus_tag LOCUS_t00370 23017 22943 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23137 23066 gene locus_tag LOCUS_t00380 23137 23066 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 24656 23202 gene locus_tag LOCUS_21130 24656 23202 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_21130 25250 24762 gene locus_tag LOCUS_21140 gene ispF 25250 24762 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380896.1 protein_id gnl|my_center|LOCUS_21140 25375 28209 gene locus_tag LOCUS_21150 25375 28209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 28190 29206 gene locus_tag LOCUS_21160 28190 29206 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_21160 29855 30142 gene locus_tag LOCUS_21170 29855 30142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 30899 31276 gene locus_tag LOCUS_21180 30899 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 31549 32706 gene locus_tag LOCUS_21190 gene buk 31549 32706 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_21190 34145 32826 gene locus_tag LOCUS_21200 34145 32826 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_21200 35247 34150 gene locus_tag LOCUS_21210 35247 34150 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_21210 36594 35341 gene locus_tag LOCUS_21220 36594 35341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_21220 37966 36662 gene locus_tag LOCUS_21230 37966 36662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_21230 38692 37970 gene locus_tag LOCUS_21240 38692 37970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_21240 39061 40044 gene locus_tag LOCUS_21250 39061 40044 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_21250 40840 40055 gene locus_tag LOCUS_21260 40840 40055 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764105.1 protein_id gnl|my_center|LOCUS_21260 41069 41302 gene locus_tag LOCUS_21270 41069 41302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence28 282 49 gene locus_tag LOCUS_21280 282 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1594 392 gene locus_tag LOCUS_21290 1594 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3086 1611 gene locus_tag LOCUS_21300 3086 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3553 3107 gene locus_tag LOCUS_21310 3553 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5037 3598 gene locus_tag LOCUS_21320 5037 3598 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_21320 8113 5051 gene locus_tag LOCUS_21330 8113 5051 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202056.1 protein_id gnl|my_center|LOCUS_21330 8407 9003 gene locus_tag LOCUS_21340 gene gmk 8407 9003 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_21340 9011 9649 gene locus_tag LOCUS_21350 gene nadD 9011 9649 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_21350 9831 10208 gene locus_tag LOCUS_21360 9831 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10541 10975 gene locus_tag LOCUS_21370 10541 10975 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_21370 12032 11088 gene locus_tag LOCUS_21380 12032 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 12670 12053 gene locus_tag LOCUS_21390 12670 12053 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_21390 12829 13836 gene locus_tag LOCUS_21400 12829 13836 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_21400 13865 17416 gene locus_tag LOCUS_21410 13865 17416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_21410 17419 18912 gene locus_tag LOCUS_21420 gene nanU 17419 18912 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_21420 18938 20986 gene locus_tag LOCUS_21430 18938 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 21002 21898 gene locus_tag LOCUS_21440 21002 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 22397 22696 gene locus_tag LOCUS_21450 22397 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 22741 22812 gene locus_tag LOCUS_t00390 22741 22812 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22924 23502 gene locus_tag LOCUS_21460 22924 23502 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_21460 23521 24063 gene locus_tag LOCUS_21470 gene upgY 23521 24063 CDS product capsular polysaccharide transcription antiterminator UpgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784914.1 protein_id gnl|my_center|LOCUS_21470 24335 24772 gene locus_tag LOCUS_21480 24335 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_21480 24797 24943 gene locus_tag LOCUS_21490 24797 24943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 24988 26493 gene locus_tag LOCUS_21500 24988 26493 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108671.1 protein_id gnl|my_center|LOCUS_21500 26520 26759 gene locus_tag LOCUS_21510 26520 26759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 26862 28406 gene locus_tag LOCUS_21520 26862 28406 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_21520 28403 29518 gene locus_tag LOCUS_21530 28403 29518 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_21530 30124 30684 gene locus_tag LOCUS_21540 30124 30684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 30972 31826 gene locus_tag LOCUS_21550 30972 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 31838 32470 gene locus_tag LOCUS_21560 31838 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 32470 33390 gene locus_tag LOCUS_21570 32470 33390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 33794 35110 gene locus_tag LOCUS_21580 33794 35110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 35241 36488 gene locus_tag LOCUS_21590 35241 36488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 36542 37330 gene locus_tag LOCUS_21600 36542 37330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 37361 37744 gene locus_tag LOCUS_21610 37361 37744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 37990 38328 gene locus_tag LOCUS_21620 37990 38328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 38452 39720 gene locus_tag LOCUS_21630 38452 39720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 39966 40820 gene locus_tag LOCUS_21640 39966 40820 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097856.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence29 514 1473 gene locus_tag LOCUS_21650 514 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3110 2283 gene locus_tag LOCUS_21660 3110 2283 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_21660 3934 3107 gene locus_tag LOCUS_21670 3934 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5425 4025 gene locus_tag LOCUS_21680 5425 4025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_21680 6348 5428 gene locus_tag LOCUS_21690 6348 5428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_21690 7388 6345 gene locus_tag LOCUS_21700 gene holA 7388 6345 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_21700 9649 7400 gene locus_tag LOCUS_21710 9649 7400 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_21710 9962 9669 gene locus_tag LOCUS_21720 9962 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10716 9952 gene locus_tag LOCUS_21730 10716 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 11448 10954 gene locus_tag LOCUS_21740 11448 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 11955 11554 gene locus_tag LOCUS_21750 11955 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 13417 12092 gene locus_tag LOCUS_21760 13417 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 13801 13484 gene locus_tag LOCUS_21770 13801 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 16057 14414 gene locus_tag LOCUS_21780 16057 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 16551 16141 gene locus_tag LOCUS_21790 16551 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 16851 16555 gene locus_tag LOCUS_21800 16851 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21800 17154 16852 gene locus_tag LOCUS_21810 17154 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 18118 17144 gene locus_tag LOCUS_21820 gene xerC 18118 17144 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_21820 18804 18151 gene locus_tag LOCUS_21830 18804 18151 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_21830 19420 18881 gene locus_tag LOCUS_21840 19420 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 21657 19651 gene locus_tag LOCUS_21850 gene ccsA 21657 19651 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680415.1 protein_id gnl|my_center|LOCUS_21850 23240 21657 gene locus_tag LOCUS_21860 23240 21657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 24515 23391 gene locus_tag LOCUS_21870 24515 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 25803 24562 gene locus_tag LOCUS_21880 25803 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_21880 26815 27750 gene locus_tag LOCUS_21890 26815 27750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 27925 28278 gene locus_tag LOCUS_21900 27925 28278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 28718 29731 gene locus_tag LOCUS_21910 28718 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 29849 30223 gene locus_tag LOCUS_21920 29849 30223 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_21920 30547 30302 gene locus_tag LOCUS_21930 30547 30302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 31695 31378 gene locus_tag LOCUS_21940 31695 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21940 32187 32032 gene locus_tag LOCUS_21950 32187 32032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 32172 32690 gene locus_tag LOCUS_21960 32172 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 32716 32916 gene locus_tag LOCUS_21970 32716 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 32934 33203 gene locus_tag LOCUS_21980 32934 33203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 34050 33211 gene locus_tag LOCUS_21990 34050 33211 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202990.1 protein_id gnl|my_center|LOCUS_21990 34576 34124 gene locus_tag LOCUS_22000 34576 34124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 35930 34659 gene locus_tag LOCUS_22010 35930 34659 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_22010 36680 36000 gene locus_tag LOCUS_22020 36680 36000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_22020 37128 36895 gene locus_tag LOCUS_22030 37128 36895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22030 >Feature sequence30 1449 424 gene locus_tag LOCUS_22040 1449 424 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_22040 2378 1485 gene locus_tag LOCUS_22050 gene rbsK 2378 1485 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_22050 4354 2732 gene locus_tag LOCUS_22060 gene groL 4354 2732 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_22060 4643 4377 gene locus_tag LOCUS_22070 4643 4377 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_22070 4911 10454 gene locus_tag LOCUS_22080 4911 10454 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_22080 10458 12716 gene locus_tag LOCUS_22090 gene pbpC 10458 12716 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_22090 13517 12717 gene locus_tag LOCUS_22100 13517 12717 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 protein_id gnl|my_center|LOCUS_22100 14040 13963 gene locus_tag LOCUS_t00400 14040 13963 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16356 14275 gene locus_tag LOCUS_22110 16356 14275 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_22110 17861 16353 gene locus_tag LOCUS_22120 17861 16353 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766031.1 protein_id gnl|my_center|LOCUS_22120 19869 17989 gene locus_tag LOCUS_22130 19869 17989 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_22130 25533 20062 gene locus_tag LOCUS_22140 25533 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 27013 25631 gene locus_tag LOCUS_22150 27013 25631 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_22150 27078 28235 gene locus_tag LOCUS_22160 27078 28235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 28296 29669 gene locus_tag LOCUS_22170 28296 29669 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_22170 29844 32564 gene locus_tag LOCUS_22180 gene ppdK 29844 32564 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_22180 33998 33087 gene locus_tag LOCUS_22190 33998 33087 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_22190 34149 34778 gene locus_tag LOCUS_22200 gene upp 34149 34778 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_22200 34791 35360 gene locus_tag LOCUS_22210 34791 35360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 36413 35466 gene locus_tag LOCUS_22220 36413 35466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence31 1379 162 gene locus_tag LOCUS_22230 1379 162 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_22230 1452 2117 gene locus_tag LOCUS_22240 1452 2117 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_22240 2114 2944 gene locus_tag LOCUS_22250 2114 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3767 3866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3906 4976 gene locus_tag LOCUS_22260 3906 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 5048 6289 gene locus_tag LOCUS_22270 5048 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 6433 8370 gene locus_tag LOCUS_22280 6433 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 10780 8543 gene locus_tag LOCUS_22290 10780 8543 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_22290 11872 11126 gene locus_tag LOCUS_22300 gene gpmA 11872 11126 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295282.1 protein_id gnl|my_center|LOCUS_22300 13440 11950 gene locus_tag LOCUS_22310 13440 11950 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787423.1 protein_id gnl|my_center|LOCUS_22310 14081 13437 gene locus_tag LOCUS_22320 gene nth 14081 13437 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_22320 14820 14086 gene locus_tag LOCUS_22330 14820 14086 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_22330 14938 17922 gene locus_tag LOCUS_22340 14938 17922 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_22340 17928 19778 gene locus_tag LOCUS_22350 17928 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 19929 21938 gene locus_tag LOCUS_22360 gene gyrB 19929 21938 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_22360 21960 23225 gene locus_tag LOCUS_22370 21960 23225 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_22370 23240 24070 gene locus_tag LOCUS_22380 23240 24070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_22380 24080 26125 gene locus_tag LOCUS_22390 24080 26125 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_22390 26149 27465 gene locus_tag LOCUS_22400 gene tig 26149 27465 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_22400 27468 28139 gene locus_tag LOCUS_22410 gene clpP 27468 28139 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_22410 28139 29374 gene locus_tag LOCUS_22420 gene clpX 28139 29374 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_22420 30553 29474 gene locus_tag LOCUS_22430 30553 29474 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_22430 31335 31979 gene locus_tag LOCUS_22440 31335 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 32149 33513 gene locus_tag LOCUS_22450 32149 33513 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_22450 33567 34325 gene locus_tag LOCUS_22460 gene pyrF 33567 34325 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_22460 34617 36182 gene locus_tag LOCUS_22470 34617 36182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence32 805 1584 gene locus_tag LOCUS_22480 805 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1595 1957 gene locus_tag LOCUS_22490 1595 1957 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_22490 3278 2082 gene locus_tag LOCUS_22500 3278 2082 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_22500 3622 3954 gene locus_tag LOCUS_22510 3622 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3963 4319 gene locus_tag LOCUS_22520 3963 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 7924 4352 gene locus_tag LOCUS_22530 7924 4352 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_22530 8115 11219 gene locus_tag LOCUS_22540 8115 11219 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_22540 11233 13056 gene locus_tag LOCUS_22550 11233 13056 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_22550 13145 14854 gene locus_tag LOCUS_22560 13145 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 15043 16365 gene locus_tag LOCUS_22570 15043 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 16372 17703 gene locus_tag LOCUS_22580 16372 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 17706 19700 gene locus_tag LOCUS_22590 17706 19700 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_22590 19835 21313 gene locus_tag LOCUS_22600 19835 21313 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108686.1 protein_id gnl|my_center|LOCUS_22600 21321 23363 gene locus_tag LOCUS_22610 21321 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 23384 25075 gene locus_tag LOCUS_22620 23384 25075 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764450.1 protein_id gnl|my_center|LOCUS_22620 26020 25193 gene locus_tag LOCUS_22630 gene ubiE 26020 25193 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_22630 26924 26025 gene locus_tag LOCUS_22640 gene menA 26924 26025 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_22640 27061 28134 gene locus_tag LOCUS_22650 27061 28134 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_22650 28147 29955 gene locus_tag LOCUS_22660 gene uvrC 28147 29955 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_22660 30407 31768 gene locus_tag LOCUS_22670 30407 31768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence33 527 130 gene locus_tag LOCUS_tm00010 527 130 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 941 1801 gene locus_tag LOCUS_22680 941 1801 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_22680 1873 2274 gene locus_tag LOCUS_22690 1873 2274 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_22690 2279 3817 gene locus_tag LOCUS_22700 2279 3817 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839799.1 protein_id gnl|my_center|LOCUS_22700 3941 4204 gene locus_tag LOCUS_22710 3941 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4234 4626 gene locus_tag LOCUS_22720 4234 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4819 7722 gene locus_tag LOCUS_22730 4819 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 9225 7825 gene locus_tag LOCUS_22740 9225 7825 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_22740 10395 9229 gene locus_tag LOCUS_22750 10395 9229 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_22750 11544 10405 gene locus_tag LOCUS_22760 11544 10405 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764441.1 protein_id gnl|my_center|LOCUS_22760 11736 12728 gene locus_tag LOCUS_22770 11736 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 12794 13819 gene locus_tag LOCUS_22780 12794 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 15079 13880 gene locus_tag LOCUS_22790 gene iolU 15079 13880 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_22790 15708 15076 gene locus_tag LOCUS_22800 15708 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 15818 17530 gene locus_tag LOCUS_22810 15818 17530 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_22810 17548 19671 gene locus_tag LOCUS_22820 17548 19671 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_22820 20040 20969 gene locus_tag LOCUS_22830 20040 20969 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 protein_id gnl|my_center|LOCUS_22830 23320 21800 gene locus_tag LOCUS_22840 23320 21800 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037401.1 protein_id gnl|my_center|LOCUS_22840 24046 23324 gene locus_tag LOCUS_22850 24046 23324 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_22850 27283 24059 gene locus_tag LOCUS_22860 27283 24059 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_22860 27426 28841 gene locus_tag LOCUS_22870 27426 28841 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence34 819 2060 gene locus_tag LOCUS_22880 819 2060 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178657.1 protein_id gnl|my_center|LOCUS_22880 2518 2057 gene locus_tag LOCUS_22890 2518 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2662 4896 gene locus_tag LOCUS_22900 2662 4896 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_22900 5723 4893 gene locus_tag LOCUS_22910 5723 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5981 7246 gene locus_tag LOCUS_22920 5981 7246 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_22920 7246 8139 gene locus_tag LOCUS_22930 7246 8139 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_22930 10041 8158 gene locus_tag LOCUS_22940 10041 8158 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_22940 10295 10729 gene locus_tag LOCUS_22950 10295 10729 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_22950 10740 11669 gene locus_tag LOCUS_22960 10740 11669 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_22960 11666 12301 gene locus_tag LOCUS_22970 11666 12301 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798768.1 protein_id gnl|my_center|LOCUS_22970 12454 13578 gene locus_tag LOCUS_22980 12454 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_22980 13591 14298 gene locus_tag LOCUS_22990 13591 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 14298 15161 gene locus_tag LOCUS_23000 14298 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 15358 15431 gene locus_tag LOCUS_t00410 15358 15431 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17014 16073 gene locus_tag LOCUS_23010 17014 16073 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_23010 18588 17011 gene locus_tag LOCUS_23020 18588 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23020 20263 18983 gene locus_tag LOCUS_23030 20263 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 20510 21784 gene locus_tag LOCUS_23040 20510 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 25359 22093 gene locus_tag LOCUS_23050 25359 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence35 1061 2605 gene locus_tag LOCUS_23060 1061 2605 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_23060 2660 3973 gene locus_tag LOCUS_23070 2660 3973 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_23070 4514 5194 gene locus_tag LOCUS_23080 4514 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5892 5701 gene locus_tag LOCUS_23090 5892 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 6069 7274 gene locus_tag LOCUS_23100 6069 7274 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_23100 7608 7315 gene locus_tag LOCUS_23110 7608 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 8153 10198 gene locus_tag LOCUS_23120 8153 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10286 12031 gene locus_tag LOCUS_23130 10286 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761175.1 protein_id gnl|my_center|LOCUS_23130 13541 12084 gene locus_tag LOCUS_23140 13541 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 15211 13628 gene locus_tag LOCUS_23150 15211 13628 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_23150 15752 15282 gene locus_tag LOCUS_23160 15752 15282 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_23160 16385 15756 gene locus_tag LOCUS_23170 16385 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 17381 16554 gene locus_tag LOCUS_23180 17381 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 18808 17399 gene locus_tag LOCUS_23190 18808 17399 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201962.1 protein_id gnl|my_center|LOCUS_23190 20427 18841 gene locus_tag LOCUS_23200 20427 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 21074 20427 gene locus_tag LOCUS_23210 21074 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 22126 21740 gene locus_tag LOCUS_23220 22126 21740 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_23220 22671 22195 gene locus_tag LOCUS_23230 22671 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 22931 22674 gene locus_tag LOCUS_23240 22931 22674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 23558 23127 gene locus_tag LOCUS_23250 23558 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 24153 23623 gene locus_tag LOCUS_23260 24153 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence36 308 1444 gene locus_tag LOCUS_23270 308 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2062 1667 gene locus_tag LOCUS_23280 2062 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2249 3208 gene locus_tag LOCUS_23290 2249 3208 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_23290 3412 3639 gene locus_tag LOCUS_23300 3412 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5178 3802 gene locus_tag LOCUS_23310 5178 3802 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_23310 5684 5310 gene locus_tag LOCUS_23320 5684 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6464 5739 gene locus_tag LOCUS_23330 6464 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7903 6569 gene locus_tag LOCUS_23340 7903 6569 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_23340 9102 7933 gene locus_tag LOCUS_23350 gene uxuA 9102 7933 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_23350 9947 9129 gene locus_tag LOCUS_23360 9947 9129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_23360 11826 9967 gene locus_tag LOCUS_23370 11826 9967 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_23370 13424 11850 gene locus_tag LOCUS_23380 13424 11850 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706587.1 protein_id gnl|my_center|LOCUS_23380 14012 13470 gene locus_tag LOCUS_23390 14012 13470 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_23390 14701 14009 gene locus_tag LOCUS_23400 14701 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 15438 14725 gene locus_tag LOCUS_23410 15438 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_23410 15554 16588 gene locus_tag LOCUS_23420 15554 16588 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_23420 16585 17133 gene locus_tag LOCUS_23430 16585 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 17188 18216 gene locus_tag LOCUS_23440 17188 18216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 18228 19625 gene locus_tag LOCUS_23450 18228 19625 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_23450 19638 20249 gene locus_tag LOCUS_23460 19638 20249 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_23460 20254 21594 gene locus_tag LOCUS_23470 20254 21594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 22508 21597 gene locus_tag LOCUS_23480 gene ptb 22508 21597 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_23480 23747 22533 gene locus_tag LOCUS_23490 23747 22533 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence37 107 178 gene locus_tag LOCUS_t00420 107 178 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 337 456 gene locus_tag LOCUS_23500 337 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 573 1907 gene locus_tag LOCUS_23510 573 1907 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_23510 1912 3084 gene locus_tag LOCUS_23520 gene galK 1912 3084 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_23520 3081 3821 gene locus_tag LOCUS_23530 3081 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 5064 3973 gene locus_tag LOCUS_23540 gene prfA 5064 3973 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_23540 6305 5187 gene locus_tag LOCUS_23550 6305 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_23550 7297 6479 gene locus_tag LOCUS_23560 gene mazG 7297 6479 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_23560 7534 8835 gene locus_tag LOCUS_23570 7534 8835 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_23570 10185 8842 gene locus_tag LOCUS_23580 10185 8842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766760.1 protein_id gnl|my_center|LOCUS_23580 10694 11761 gene locus_tag LOCUS_23590 10694 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 11895 13376 gene locus_tag LOCUS_23600 11895 13376 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_23600 15056 13698 gene locus_tag LOCUS_23610 15056 13698 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_23610 15184 16131 gene locus_tag LOCUS_23620 15184 16131 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_23620 16134 17504 gene locus_tag LOCUS_23630 16134 17504 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_23630 17656 18882 gene locus_tag LOCUS_23640 17656 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 19562 19894 gene locus_tag LOCUS_23650 19562 19894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 21165 19882 gene locus_tag LOCUS_23660 21165 19882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence38 1613 219 gene locus_tag LOCUS_23670 1613 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2570 1638 gene locus_tag LOCUS_23680 2570 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4306 2588 gene locus_tag LOCUS_23690 4306 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 7526 4338 gene locus_tag LOCUS_23700 7526 4338 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_23700 7982 7548 gene locus_tag LOCUS_23710 7982 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 10028 7995 gene locus_tag LOCUS_23720 10028 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 10509 12431 gene locus_tag LOCUS_23730 10509 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 12686 14158 gene locus_tag LOCUS_23740 12686 14158 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107435.1 protein_id gnl|my_center|LOCUS_23740 14760 15464 gene locus_tag LOCUS_23750 14760 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 15921 15466 gene locus_tag LOCUS_23760 gene bcp 15921 15466 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_23760 16270 15986 gene locus_tag LOCUS_23770 16270 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 16413 16934 gene locus_tag LOCUS_23780 16413 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 19435 18269 gene locus_tag LOCUS_23790 19435 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence39 772 209 gene locus_tag LOCUS_23800 772 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1817 813 gene locus_tag LOCUS_23810 1817 813 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_23810 2955 1837 gene locus_tag LOCUS_23820 gene dnaN 2955 1837 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_23820 3135 4619 gene locus_tag LOCUS_23830 3135 4619 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_23830 4701 5561 gene locus_tag LOCUS_23840 4701 5561 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_23840 5561 7348 gene locus_tag LOCUS_23850 gene argS 5561 7348 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_23850 7359 9080 gene locus_tag LOCUS_23860 7359 9080 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_23860 9181 9516 gene locus_tag LOCUS_23870 9181 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 9918 10595 gene locus_tag LOCUS_23880 9918 10595 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_23880 11405 10587 gene locus_tag LOCUS_23890 11405 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 11606 12328 gene locus_tag LOCUS_23900 11606 12328 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_23900 13313 12351 gene locus_tag LOCUS_23910 13313 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 13810 13310 gene locus_tag LOCUS_23920 13810 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 14312 13797 gene locus_tag LOCUS_23930 14312 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 14603 14920 gene locus_tag LOCUS_23940 14603 14920 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_23940 14974 17913 gene locus_tag LOCUS_23950 14974 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 17917 18576 gene locus_tag LOCUS_23960 17917 18576 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence40 1004 243 gene locus_tag LOCUS_23970 1004 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2107 1001 gene locus_tag LOCUS_23980 2107 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 4994 2379 gene locus_tag LOCUS_23990 4994 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 8250 5056 gene locus_tag LOCUS_24000 8250 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 8439 8263 gene locus_tag LOCUS_24010 8439 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 9696 8479 gene locus_tag LOCUS_24020 9696 8479 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107080.1 protein_id gnl|my_center|LOCUS_24020 12250 9911 gene locus_tag LOCUS_24030 12250 9911 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_24030 13083 12280 gene locus_tag LOCUS_24040 13083 12280 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_24040 14027 13080 gene locus_tag LOCUS_24050 14027 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_24050 15264 14080 gene locus_tag LOCUS_24060 15264 14080 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_24060 15503 15228 gene locus_tag LOCUS_24070 15503 15228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 16100 15615 gene locus_tag LOCUS_24080 16100 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 17376 16195 gene locus_tag LOCUS_24090 17376 16195 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence41 3349 1991 gene locus_tag LOCUS_24100 3349 1991 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_24100 4642 3359 gene locus_tag LOCUS_24110 4642 3359 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_24110 6596 4659 gene locus_tag LOCUS_24120 6596 4659 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_24120 8599 6608 gene locus_tag LOCUS_24130 8599 6608 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107440.1 protein_id gnl|my_center|LOCUS_24130 8726 11470 gene locus_tag LOCUS_24140 8726 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 11473 12717 gene locus_tag LOCUS_24150 11473 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 13776 12601 gene locus_tag LOCUS_24160 13776 12601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_24160 15883 13886 gene locus_tag LOCUS_24170 15883 13886 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence42 1727 789 gene locus_tag LOCUS_24180 1727 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3380 2451 gene locus_tag LOCUS_24190 3380 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 4439 3474 gene locus_tag LOCUS_24200 4439 3474 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905078.1 protein_id gnl|my_center|LOCUS_24200 4998 4420 gene locus_tag LOCUS_24210 4998 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 5896 5006 gene locus_tag LOCUS_24220 5896 5006 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_24220 6051 7454 gene locus_tag LOCUS_24230 gene glpT 6051 7454 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_24230 8212 9120 gene locus_tag LOCUS_24240 gene rhuM 8212 9120 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_24240 9817 9518 gene locus_tag LOCUS_24250 9817 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 10113 9898 gene locus_tag LOCUS_24260 10113 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 11643 10516 gene locus_tag LOCUS_24270 11643 10516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_24270 12299 13375 gene locus_tag LOCUS_24280 12299 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence43 168 2438 gene locus_tag LOCUS_24290 168 2438 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_24290 2793 2892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3342 4316 gene locus_tag LOCUS_24300 3342 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4383 4482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4981 6885 gene locus_tag LOCUS_24310 gene dnaK 4981 6885 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_24310 7507 6983 gene locus_tag LOCUS_24320 7507 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24320 7735 7517 gene locus_tag LOCUS_24330 7735 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24330 7943 7746 gene locus_tag LOCUS_24340 7943 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 8704 7961 gene locus_tag LOCUS_24350 8704 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 8981 8781 gene locus_tag LOCUS_24360 8981 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 9130 9555 gene locus_tag LOCUS_24370 9130 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 9697 9545 gene locus_tag LOCUS_24380 9697 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 9808 11082 gene locus_tag LOCUS_24390 9808 11082 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence44 411 800 gene locus_tag LOCUS_24400 411 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 813 1721 gene locus_tag LOCUS_24410 813 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1921 3654 gene locus_tag LOCUS_24420 1921 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3647 5677 gene locus_tag LOCUS_24430 3647 5677 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_24430 5674 7155 gene locus_tag LOCUS_24440 gene hutH 5674 7155 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797649.1 protein_id gnl|my_center|LOCUS_24440 7152 8387 gene locus_tag LOCUS_24450 gene hutI 7152 8387 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_24450 9067 8468 gene locus_tag LOCUS_24460 9067 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 10574 9072 gene locus_tag LOCUS_24470 10574 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_24470 11090 10701 gene locus_tag LOCUS_24480 11090 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence45 1154 273 gene locus_tag LOCUS_24490 1154 273 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_24490 <3451 1145 gene locus_tag LOCUS_24500 <3451 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107692.1:glycosyltransferase family 1 protein >Feature sequence46 1020 526 gene locus_tag LOCUS_24510 1020 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1523 1176 gene locus_tag LOCUS_24520 gene rbfA 1523 1176 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_24520 <2810 1525 gene locus_tag LOCUS_24530 <2810 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783655.1:tyrosine--tRNA ligase