>Feature sequence001 802 1101 gene locus_tag LOCUS_00010 802 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1830 1408 gene locus_tag LOCUS_00020 1830 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1421 1430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2029 1823 gene locus_tag LOCUS_00030 2029 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3098 3442 gene locus_tag LOCUS_00040 3098 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3771 4586 gene locus_tag LOCUS_00050 3771 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4599 5042 gene locus_tag LOCUS_00060 4599 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5120 5611 gene locus_tag LOCUS_00070 5120 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5613 6104 gene locus_tag LOCUS_00080 5613 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6321 6800 gene locus_tag LOCUS_00090 6321 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6784 7119 gene locus_tag LOCUS_00100 6784 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7217 7396 gene locus_tag LOCUS_00110 7217 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7344 7817 gene locus_tag LOCUS_00120 7344 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7798 8553 gene locus_tag LOCUS_00130 7798 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 8580 9218 gene locus_tag LOCUS_00140 8580 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12240 9358 gene locus_tag LOCUS_00150 12240 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12678 12274 gene locus_tag LOCUS_00160 12678 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13396 12662 gene locus_tag LOCUS_00170 13396 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13740 13408 gene locus_tag LOCUS_00180 13740 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14400 13855 gene locus_tag LOCUS_00190 14400 13855 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_00190 15005 14451 gene locus_tag LOCUS_00200 15005 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15246 15007 gene locus_tag LOCUS_00210 15246 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15688 15251 gene locus_tag LOCUS_00220 15688 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 16361 15930 gene locus_tag LOCUS_00230 16361 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 16604 16380 gene locus_tag LOCUS_00240 16604 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 17451 16711 gene locus_tag LOCUS_00250 17451 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 17885 17454 gene locus_tag LOCUS_00260 17885 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 18140 17904 gene locus_tag LOCUS_00270 18140 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18709 18143 gene locus_tag LOCUS_00280 18709 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 19711 18740 gene locus_tag LOCUS_00290 19711 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 20608 20231 gene locus_tag LOCUS_00300 20608 20231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 20928 20653 gene locus_tag LOCUS_00310 20928 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 21393 21172 gene locus_tag LOCUS_00320 21393 21172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 22058 21741 gene locus_tag LOCUS_00330 22058 21741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22264 22067 gene locus_tag LOCUS_00340 22264 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 22544 22278 gene locus_tag LOCUS_00350 22544 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 22732 22544 gene locus_tag LOCUS_00360 22732 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 22886 23077 gene locus_tag LOCUS_00370 22886 23077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 23602 23057 gene locus_tag LOCUS_00380 23602 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 24211 24759 gene locus_tag LOCUS_00390 24211 24759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 24963 26030 gene locus_tag LOCUS_00400 24963 26030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 26133 26630 gene locus_tag LOCUS_00410 26133 26630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 26860 28326 gene locus_tag LOCUS_00420 26860 28326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 28842 28459 gene locus_tag LOCUS_00430 28842 28459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 28993 29529 gene locus_tag LOCUS_00440 28993 29529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 29544 30803 gene locus_tag LOCUS_00450 29544 30803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 30833 46756 gene locus_tag LOCUS_00460 30833 46756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47367 46903 gene locus_tag LOCUS_00470 47367 46903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47497 49548 gene locus_tag LOCUS_00480 47497 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50227 49760 gene locus_tag LOCUS_00490 50227 49760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52525 50345 gene locus_tag LOCUS_00500 52525 50345 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387707.1 protein_id gnl|my_center|LOCUS_00500 52608 52811 gene locus_tag LOCUS_00510 52608 52811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 53721 54440 gene locus_tag LOCUS_00520 53721 54440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54484 56049 gene locus_tag LOCUS_00530 54484 56049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56148 56537 gene locus_tag LOCUS_00540 56148 56537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 56556 57242 gene locus_tag LOCUS_00550 56556 57242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57248 58405 gene locus_tag LOCUS_00560 57248 58405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58431 59102 gene locus_tag LOCUS_00570 58431 59102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59128 59739 gene locus_tag LOCUS_00580 59128 59739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 >Feature sequence002 1043 33 gene locus_tag LOCUS_00590 1043 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1660 1085 gene locus_tag LOCUS_00600 1660 1085 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_00600 4364 1827 gene locus_tag LOCUS_00610 4364 1827 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_00610 6148 4544 gene locus_tag LOCUS_00620 6148 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7955 6522 gene locus_tag LOCUS_00630 7955 6522 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_00630 15955 8381 gene locus_tag LOCUS_00640 gene sprA 15955 8381 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_00640 16671 16057 gene locus_tag LOCUS_00650 gene ruvA 16671 16057 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_00650 17059 17958 gene locus_tag LOCUS_00660 17059 17958 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_00660 20015 18228 gene locus_tag LOCUS_00670 20015 18228 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_00670 23513 21504 gene locus_tag LOCUS_00680 23513 21504 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 protein_id gnl|my_center|LOCUS_00680 26684 23547 gene locus_tag LOCUS_00690 26684 23547 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791958.1 protein_id gnl|my_center|LOCUS_00690 28239 26956 gene locus_tag LOCUS_00700 28239 26956 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_00700 29657 28254 gene locus_tag LOCUS_00710 29657 28254 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_00710 29835 31727 gene locus_tag LOCUS_00720 gene dxs 29835 31727 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_00720 31724 33067 gene locus_tag LOCUS_00730 gene trkA 31724 33067 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_00730 33110 34567 gene locus_tag LOCUS_00740 33110 34567 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_00740 34640 35602 gene locus_tag LOCUS_00750 34640 35602 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_00750 36698 35700 gene locus_tag LOCUS_00760 36698 35700 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_00760 37606 36788 gene locus_tag LOCUS_00770 37606 36788 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_00770 37781 38725 gene locus_tag LOCUS_00780 37781 38725 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_00780 40717 39137 gene locus_tag LOCUS_00790 40717 39137 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992604.1 protein_id gnl|my_center|LOCUS_00790 40873 41373 gene locus_tag LOCUS_00800 40873 41373 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_00800 41390 41890 gene locus_tag LOCUS_00810 41390 41890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 41959 42405 gene locus_tag LOCUS_00820 41959 42405 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786482.1 protein_id gnl|my_center|LOCUS_00820 42469 43362 gene locus_tag LOCUS_00830 42469 43362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291991.1 protein_id gnl|my_center|LOCUS_00830 44242 43730 gene locus_tag LOCUS_00840 44242 43730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 45246 44257 gene locus_tag LOCUS_00850 45246 44257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 46452 46201 gene locus_tag LOCUS_00860 46452 46201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 48179 46446 gene locus_tag LOCUS_00870 48179 46446 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108473.1 protein_id gnl|my_center|LOCUS_00870 48649 49944 gene locus_tag LOCUS_00880 48649 49944 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_00880 50002 50949 gene locus_tag LOCUS_00890 gene cysK 50002 50949 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_00890 52409 51117 gene locus_tag LOCUS_00900 52409 51117 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence003 212 221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2941 1871 gene locus_tag LOCUS_00910 2941 1871 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_00910 3288 4163 gene locus_tag LOCUS_00920 gene pdxS 3288 4163 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_00920 4229 4798 gene locus_tag LOCUS_00930 gene pdxT 4229 4798 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 protein_id gnl|my_center|LOCUS_00930 6289 4988 gene locus_tag LOCUS_00940 6289 4988 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_00940 6414 6653 gene locus_tag LOCUS_00950 6414 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6874 7719 gene locus_tag LOCUS_00960 gene folP 6874 7719 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_00960 7716 8486 gene locus_tag LOCUS_00970 gene cdaA 7716 8486 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_00970 8810 9856 gene locus_tag LOCUS_00980 gene pta 8810 9856 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762631.1 protein_id gnl|my_center|LOCUS_00980 9897 11099 gene locus_tag LOCUS_00990 9897 11099 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_00990 11322 12284 gene locus_tag LOCUS_01000 11322 12284 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_01000 13138 12374 gene locus_tag LOCUS_01010 13138 12374 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_01010 13520 13200 gene locus_tag LOCUS_01020 13520 13200 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_01020 14342 13653 gene locus_tag LOCUS_01030 gene radC 14342 13653 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_01030 15409 14351 gene locus_tag LOCUS_01040 15409 14351 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303125.1 protein_id gnl|my_center|LOCUS_01040 16039 15473 gene locus_tag LOCUS_01050 gene efp 16039 15473 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_01050 16261 16416 gene locus_tag LOCUS_01060 gene rpmH 16261 16416 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_01060 16578 17300 gene locus_tag LOCUS_01070 16578 17300 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784340.1 protein_id gnl|my_center|LOCUS_01070 17345 18511 gene locus_tag LOCUS_01080 17345 18511 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_01080 18517 19512 gene locus_tag LOCUS_01090 18517 19512 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_01090 19678 20829 gene locus_tag LOCUS_01100 19678 20829 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_01100 22358 20883 gene locus_tag LOCUS_01110 22358 20883 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_01110 23583 22369 gene locus_tag LOCUS_01120 23583 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01120 24888 23836 gene locus_tag LOCUS_01130 24888 23836 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_01130 26030 25068 gene locus_tag LOCUS_01140 26030 25068 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_01140 27466 26180 gene locus_tag LOCUS_01150 27466 26180 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_01150 28036 27611 gene locus_tag LOCUS_01160 28036 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 28469 29512 gene locus_tag LOCUS_01170 28469 29512 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_01170 31162 29546 gene locus_tag LOCUS_01180 31162 29546 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764305.1 protein_id gnl|my_center|LOCUS_01180 31466 33727 gene locus_tag LOCUS_01190 31466 33727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_01190 33837 36017 gene locus_tag LOCUS_01200 33837 36017 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_01200 36894 36112 gene locus_tag LOCUS_01210 36894 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 38619 36958 gene locus_tag LOCUS_01220 38619 36958 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_01220 39184 38630 gene locus_tag LOCUS_01230 39184 38630 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_01230 39990 39208 gene locus_tag LOCUS_01240 gene proC 39990 39208 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_01240 42189 40114 gene locus_tag LOCUS_01250 42189 40114 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_01250 43224 42211 gene locus_tag LOCUS_01260 43224 42211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 43592 43284 gene locus_tag LOCUS_01270 43592 43284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 44179 43811 gene locus_tag LOCUS_01280 44179 43811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 44558 45247 gene locus_tag LOCUS_01290 44558 45247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 45198 45554 gene locus_tag LOCUS_01300 45198 45554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 46468 45713 gene locus_tag LOCUS_01310 46468 45713 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_01310 46738 47085 gene locus_tag LOCUS_01320 46738 47085 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227977.1 protein_id gnl|my_center|LOCUS_01320 48567 47425 gene locus_tag LOCUS_01330 48567 47425 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_01330 49678 48677 gene locus_tag LOCUS_01340 gene argC 49678 48677 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_01340 50882 49680 gene locus_tag LOCUS_01350 50882 49680 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_01350 51564 50959 gene locus_tag LOCUS_01360 51564 50959 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_01360 52085 51597 gene locus_tag LOCUS_01370 gene argR 52085 51597 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence004 1188 256 gene locus_tag LOCUS_01380 1188 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2055 1222 gene locus_tag LOCUS_01390 2055 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3013 2042 gene locus_tag LOCUS_01400 3013 2042 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_01400 5734 3035 gene locus_tag LOCUS_01410 5734 3035 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_01410 5850 5924 gene locus_tag LOCUS_t00010 5850 5924 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6928 5969 gene locus_tag LOCUS_01420 6928 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 7352 6930 gene locus_tag LOCUS_01430 7352 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 8040 10010 gene locus_tag LOCUS_01440 8040 10010 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_01440 10092 11702 gene locus_tag LOCUS_01450 10092 11702 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_01450 12505 11840 gene locus_tag LOCUS_01460 gene aat 12505 11840 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_01460 14797 12512 gene locus_tag LOCUS_01470 gene clpA 14797 12512 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_01470 15216 14914 gene locus_tag LOCUS_01480 gene clpS 15216 14914 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279894.1 protein_id gnl|my_center|LOCUS_01480 15790 15227 gene locus_tag LOCUS_01490 15790 15227 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_01490 16553 18610 gene locus_tag LOCUS_01500 16553 18610 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_01500 19739 18756 gene locus_tag LOCUS_01510 19739 18756 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_01510 20039 21379 gene locus_tag LOCUS_01520 20039 21379 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_01520 22082 22399 gene locus_tag LOCUS_01530 22082 22399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 22433 23662 gene locus_tag LOCUS_01540 22433 23662 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_01540 23757 25220 gene locus_tag LOCUS_01550 23757 25220 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_01550 25610 26119 gene locus_tag LOCUS_01560 25610 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 26163 26354 gene locus_tag LOCUS_01570 26163 26354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 26577 26810 gene locus_tag LOCUS_01580 26577 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 26844 28985 gene locus_tag LOCUS_01590 26844 28985 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_01590 32069 29256 gene locus_tag LOCUS_01600 32069 29256 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_01600 34226 32277 gene locus_tag LOCUS_01610 34226 32277 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_01610 34594 36141 gene locus_tag LOCUS_01620 34594 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37697 36540 gene locus_tag LOCUS_01630 37697 36540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 38523 37717 gene locus_tag LOCUS_01640 38523 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 40618 39368 gene locus_tag LOCUS_01650 40618 39368 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_01650 40860 41399 gene locus_tag LOCUS_01660 40860 41399 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796886.1 protein_id gnl|my_center|LOCUS_01660 42935 41748 gene locus_tag LOCUS_01670 42935 41748 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence005 1530 775 gene locus_tag LOCUS_01680 1530 775 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_01680 2213 1620 gene locus_tag LOCUS_01690 gene folE 2213 1620 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_01690 2976 2299 gene locus_tag LOCUS_01700 2976 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5170 3080 gene locus_tag LOCUS_01710 5170 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5795 5211 gene locus_tag LOCUS_01720 5795 5211 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_01720 5950 7392 gene locus_tag LOCUS_01730 5950 7392 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_01730 7568 8779 gene locus_tag LOCUS_01740 7568 8779 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_01740 8813 12079 gene locus_tag LOCUS_01750 8813 12079 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_01750 12107 13501 gene locus_tag LOCUS_01760 12107 13501 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_01760 13532 14314 gene locus_tag LOCUS_01770 gene lpxA 13532 14314 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783787.1 protein_id gnl|my_center|LOCUS_01770 14575 15453 gene locus_tag LOCUS_01780 14575 15453 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_01780 15480 15707 gene locus_tag LOCUS_01790 15480 15707 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_01790 15740 16585 gene locus_tag LOCUS_01800 15740 16585 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_01800 16596 17312 gene locus_tag LOCUS_01810 gene truB 16596 17312 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_01810 17379 18563 gene locus_tag LOCUS_01820 gene queA 17379 18563 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_01820 18657 19064 gene locus_tag LOCUS_01830 gene folK 18657 19064 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_01830 19073 19720 gene locus_tag LOCUS_01840 19073 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20850 19630 gene locus_tag LOCUS_01850 20850 19630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 21223 22770 gene locus_tag LOCUS_01860 21223 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22889 24688 gene locus_tag LOCUS_01870 22889 24688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 24708 25760 gene locus_tag LOCUS_01880 24708 25760 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 protein_id gnl|my_center|LOCUS_01880 25816 26958 gene locus_tag LOCUS_01890 25816 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 27250 28548 gene locus_tag LOCUS_01900 27250 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 28535 33847 gene locus_tag LOCUS_01910 28535 33847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 34221 33952 gene locus_tag LOCUS_01920 gene rpsO 34221 33952 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_01920 34402 36204 gene locus_tag LOCUS_01930 gene typA 34402 36204 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_01930 36296 37264 gene locus_tag LOCUS_01940 36296 37264 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_01940 38893 38030 gene locus_tag LOCUS_01950 38893 38030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 40517 38961 gene locus_tag LOCUS_01960 40517 38961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 41231 40746 gene locus_tag LOCUS_01970 41231 40746 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_01970 41956 41258 gene locus_tag LOCUS_01980 gene mtnN 41956 41258 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 protein_id gnl|my_center|LOCUS_01980 42769 42092 gene locus_tag LOCUS_01990 42769 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence006 127 507 gene locus_tag LOCUS_02000 gene rpsL 127 507 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_02000 721 1170 gene locus_tag LOCUS_02010 gene rpsG 721 1170 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_02010 1200 3314 gene locus_tag LOCUS_02020 gene fusA 1200 3314 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_02020 3428 3733 gene locus_tag LOCUS_02030 gene rpsJ 3428 3733 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_02030 3754 4368 gene locus_tag LOCUS_02040 gene rplC 3754 4368 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_02040 4368 4997 gene locus_tag LOCUS_02050 gene rplD 4368 4997 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_02050 5015 5308 gene locus_tag LOCUS_02060 gene rplW 5015 5308 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_02060 5317 6144 gene locus_tag LOCUS_02070 gene rplB 5317 6144 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_02070 6155 6421 gene locus_tag LOCUS_02080 gene rpsS 6155 6421 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_02080 6458 6862 gene locus_tag LOCUS_02090 gene rplV 6458 6862 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_02090 6872 7609 gene locus_tag LOCUS_02100 gene rpsC 6872 7609 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_02100 7626 8054 gene locus_tag LOCUS_02110 gene rplP 7626 8054 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_02110 8057 8251 gene locus_tag LOCUS_02120 gene rpmC 8057 8251 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_02120 8254 8520 gene locus_tag LOCUS_02130 gene rpsQ 8254 8520 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_02130 8523 8888 gene locus_tag LOCUS_02140 gene rplN 8523 8888 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_02140 8909 9226 gene locus_tag LOCUS_02150 gene rplX 8909 9226 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_02150 9226 9780 gene locus_tag LOCUS_02160 gene rplE 9226 9780 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_02160 9786 10088 gene locus_tag LOCUS_02170 gene rpsN 9786 10088 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_02170 10160 10555 gene locus_tag LOCUS_02180 gene rpsH 10160 10555 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_02180 10570 11142 gene locus_tag LOCUS_02190 gene rplF 10570 11142 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_02190 11161 11505 gene locus_tag LOCUS_02200 gene rplR 11161 11505 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_02200 11512 12024 gene locus_tag LOCUS_02210 gene rpsE 11512 12024 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_02210 12041 12217 gene locus_tag LOCUS_02220 gene rpmD 12041 12217 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_02220 12244 12690 gene locus_tag LOCUS_02230 gene rplO 12244 12690 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_02230 12695 14032 gene locus_tag LOCUS_02240 gene secY 12695 14032 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_02240 14048 14848 gene locus_tag LOCUS_02250 gene map 14048 14848 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_02250 14851 15069 gene locus_tag LOCUS_02260 gene infA 14851 15069 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_02260 15302 15682 gene locus_tag LOCUS_02270 gene rpsM 15302 15682 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_02270 15703 16092 gene locus_tag LOCUS_02280 gene rpsK 15703 16092 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_02280 16135 16740 gene locus_tag LOCUS_02290 gene rpsD 16135 16740 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_02290 16792 17748 gene locus_tag LOCUS_02300 16792 17748 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_02300 17782 18267 gene locus_tag LOCUS_02310 gene rplQ 17782 18267 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_02310 18445 19308 gene locus_tag LOCUS_02320 18445 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 19720 19352 gene locus_tag LOCUS_02330 19720 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 20009 23050 gene locus_tag LOCUS_02340 20009 23050 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_02340 23196 24416 gene locus_tag LOCUS_02350 gene fucP 23196 24416 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_02350 24621 25634 gene locus_tag LOCUS_02360 24621 25634 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_02360 25999 26484 gene locus_tag LOCUS_02370 25999 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 27459 26656 gene locus_tag LOCUS_02380 27459 26656 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_02380 30256 28394 gene locus_tag LOCUS_02390 30256 28394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 32387 30279 gene locus_tag LOCUS_02400 32387 30279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 33968 32412 gene locus_tag LOCUS_02410 33968 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 35837 33981 gene locus_tag LOCUS_02420 35837 33981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 <37028 35893 gene locus_tag LOCUS_02430 <37028 35893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794256.1:FimB/Mfa2 family fimbrial subunit >Feature sequence007 19 1353 gene locus_tag LOCUS_02440 gene ftsZ 19 1353 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_02440 2095 1370 gene locus_tag LOCUS_02450 gene recO 2095 1370 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_02450 2220 2292 gene locus_tag LOCUS_t00020 2220 2292 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2330 2584 gene locus_tag LOCUS_02460 gene rpsT 2330 2584 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_02460 2877 4847 gene locus_tag LOCUS_02470 gene gyrB 2877 4847 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_02470 5017 7341 gene locus_tag LOCUS_02480 5017 7341 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_02480 7477 8235 gene locus_tag LOCUS_02490 7477 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8982 8347 gene locus_tag LOCUS_02500 8982 8347 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_02500 9740 9075 gene locus_tag LOCUS_02510 gene ung 9740 9075 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_02510 11294 9798 gene locus_tag LOCUS_02520 gene gpmI 11294 9798 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_02520 12520 11441 gene locus_tag LOCUS_02530 12520 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12724 13587 gene locus_tag LOCUS_02540 12724 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 13675 16227 gene locus_tag LOCUS_02550 13675 16227 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_02550 16390 16728 gene locus_tag LOCUS_02560 16390 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 16725 17840 gene locus_tag LOCUS_02570 16725 17840 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_02570 18026 18850 gene locus_tag LOCUS_02580 18026 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 19008 20636 gene locus_tag LOCUS_02590 19008 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20876 21664 gene locus_tag LOCUS_02600 20876 21664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 21834 22832 gene locus_tag LOCUS_02610 21834 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 22970 23845 gene locus_tag LOCUS_02620 22970 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23903 26452 gene locus_tag LOCUS_02630 23903 26452 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_02630 29033 26679 gene locus_tag LOCUS_02640 29033 26679 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_02640 29453 30445 gene locus_tag LOCUS_02650 gene rhuM 29453 30445 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_02650 31475 30705 gene locus_tag LOCUS_02660 gene trmB 31475 30705 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_02660 34250 31614 gene locus_tag LOCUS_02670 34250 31614 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_02670 35056 34298 gene locus_tag LOCUS_02680 35056 34298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 36005 35172 gene locus_tag LOCUS_02690 36005 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 36839 36042 gene locus_tag LOCUS_02700 36839 36042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence008 30 2021 gene locus_tag LOCUS_02710 30 2021 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_02710 2718 2116 gene locus_tag LOCUS_02720 gene rsxA 2718 2116 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_02720 3343 2759 gene locus_tag LOCUS_02730 3343 2759 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_02730 4024 3350 gene locus_tag LOCUS_02740 4024 3350 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_02740 5039 4038 gene locus_tag LOCUS_02750 5039 4038 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_02750 6442 5090 gene locus_tag LOCUS_02760 gene rsxC 6442 5090 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_02760 7339 6446 gene locus_tag LOCUS_02770 7339 6446 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_02770 7781 7368 gene locus_tag LOCUS_02780 7781 7368 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_02780 8107 8460 gene locus_tag LOCUS_02790 8107 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 9590 8556 gene locus_tag LOCUS_02800 gene hisC 9590 8556 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_02800 10883 9600 gene locus_tag LOCUS_02810 gene hisD 10883 9600 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_02810 11764 10913 gene locus_tag LOCUS_02820 gene hisG 11764 10913 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_02820 11990 13138 gene locus_tag LOCUS_02830 11990 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 14312 13200 gene locus_tag LOCUS_02840 14312 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 15497 14373 gene locus_tag LOCUS_02850 15497 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 16212 15559 gene locus_tag LOCUS_02860 gene queC 16212 15559 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_02860 17689 16238 gene locus_tag LOCUS_02870 gene radA 17689 16238 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_02870 17890 18849 gene locus_tag LOCUS_02880 17890 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 20404 19556 gene locus_tag LOCUS_02890 20404 19556 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_02890 20704 20519 gene locus_tag LOCUS_02900 20704 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 22304 20853 gene locus_tag LOCUS_02910 22304 20853 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_02910 23819 22320 gene locus_tag LOCUS_02920 23819 22320 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_02920 25808 23853 gene locus_tag LOCUS_02930 gene nuoL 25808 23853 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_02930 26123 25815 gene locus_tag LOCUS_02940 gene nuoK 26123 25815 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_02940 26647 26120 gene locus_tag LOCUS_02950 26647 26120 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_02950 27193 26663 gene locus_tag LOCUS_02960 27193 26663 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109090.1 protein_id gnl|my_center|LOCUS_02960 28313 27228 gene locus_tag LOCUS_02970 gene nuoH 28313 27228 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109091.1 protein_id gnl|my_center|LOCUS_02970 29887 28316 gene locus_tag LOCUS_02980 29887 28316 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760950.1 protein_id gnl|my_center|LOCUS_02980 30632 29907 gene locus_tag LOCUS_02990 30632 29907 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_02990 30973 30623 gene locus_tag LOCUS_03000 30973 30623 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_03000 31450 33594 gene locus_tag LOCUS_03010 31450 33594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 33573 34223 gene locus_tag LOCUS_03020 33573 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 34174 35175 gene locus_tag LOCUS_03030 34174 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 36282 35335 gene locus_tag LOCUS_03040 36282 35335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence009 273 2846 gene locus_tag LOCUS_03050 273 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3165 6347 gene locus_tag LOCUS_03060 3165 6347 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_03060 6363 8000 gene locus_tag LOCUS_03070 6363 8000 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_03070 8013 9434 gene locus_tag LOCUS_03080 8013 9434 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_03080 9612 9460 gene locus_tag LOCUS_03090 9612 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9684 10178 gene locus_tag LOCUS_03100 9684 10178 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_03100 14403 11251 gene locus_tag LOCUS_03110 14403 11251 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_03110 16762 14420 gene locus_tag LOCUS_03120 16762 14420 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_03120 18785 16794 gene locus_tag LOCUS_03130 18785 16794 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_03130 19808 18843 gene locus_tag LOCUS_03140 19808 18843 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_03140 20316 21467 gene locus_tag LOCUS_03150 20316 21467 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_03150 21697 24696 gene locus_tag LOCUS_03160 21697 24696 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_03160 24725 26398 gene locus_tag LOCUS_03170 24725 26398 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_03170 26712 28283 gene locus_tag LOCUS_03180 26712 28283 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762102.1 protein_id gnl|my_center|LOCUS_03180 28321 29856 gene locus_tag LOCUS_03190 28321 29856 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_03190 29945 31183 gene locus_tag LOCUS_03200 29945 31183 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 protein_id gnl|my_center|LOCUS_03200 31250 31259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31325 32800 gene locus_tag LOCUS_03210 31325 32800 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795196.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence010 1580 996 gene locus_tag LOCUS_03220 1580 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2325 1600 gene locus_tag LOCUS_03230 2325 1600 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_03230 5944 2351 gene locus_tag LOCUS_03240 5944 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6655 5984 gene locus_tag LOCUS_03250 6655 5984 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_03250 7741 6749 gene locus_tag LOCUS_03260 7741 6749 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_03260 8168 9232 gene locus_tag LOCUS_03270 8168 9232 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_03270 9302 10798 gene locus_tag LOCUS_03280 9302 10798 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_03280 10814 12124 gene locus_tag LOCUS_03290 10814 12124 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_03290 12156 12851 gene locus_tag LOCUS_03300 12156 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 13080 13610 gene locus_tag LOCUS_03310 13080 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 13748 15052 gene locus_tag LOCUS_03320 13748 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 15986 15168 gene locus_tag LOCUS_03330 15986 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 16150 17859 gene locus_tag LOCUS_03340 16150 17859 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_03340 17934 18707 gene locus_tag LOCUS_03350 gene nudC 17934 18707 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_03350 18787 19965 gene locus_tag LOCUS_03360 18787 19965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_03360 20537 20085 gene locus_tag LOCUS_03370 20537 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 20734 21855 gene locus_tag LOCUS_03380 gene dnaN 20734 21855 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_03380 21900 22763 gene locus_tag LOCUS_03390 21900 22763 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_03390 22812 24047 gene locus_tag LOCUS_03400 gene coaBC 22812 24047 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_03400 24085 24972 gene locus_tag LOCUS_03410 24085 24972 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_03410 25012 26682 gene locus_tag LOCUS_03420 gene recN 25012 26682 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_03420 26685 28331 gene locus_tag LOCUS_03430 26685 28331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 28471 28546 gene locus_tag LOCUS_t00030 28471 28546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 <1 1556 gene locus_tag LOCUS_03440 <1 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768282.1:RagB/SusD family nutrient uptake outer membrane protein 1576 3435 gene locus_tag LOCUS_03450 1576 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 3598 5244 gene locus_tag LOCUS_03460 3598 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5248 5712 gene locus_tag LOCUS_03470 5248 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6169 6789 gene locus_tag LOCUS_03480 6169 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_03480 8109 7144 gene locus_tag LOCUS_03490 8109 7144 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_03490 8342 8351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10770 8779 gene locus_tag LOCUS_03500 10770 8779 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_03500 13872 10783 gene locus_tag LOCUS_03510 13872 10783 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_03510 15709 14123 gene locus_tag LOCUS_03520 15709 14123 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_03520 17768 15762 gene locus_tag LOCUS_03530 17768 15762 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_03530 21770 17853 gene locus_tag LOCUS_03540 21770 17853 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_03540 22077 23219 gene locus_tag LOCUS_03550 22077 23219 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_03550 23274 24707 gene locus_tag LOCUS_03560 23274 24707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 24899 26020 gene locus_tag LOCUS_03570 24899 26020 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_03570 26038 27003 gene locus_tag LOCUS_03580 26038 27003 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_03580 26048 26057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27321 28649 gene locus_tag LOCUS_03590 27321 28649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 28805 29512 gene locus_tag LOCUS_03600 28805 29512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_03600 31291 31082 gene locus_tag LOCUS_03610 31291 31082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence012 4835 69 gene locus_tag LOCUS_03620 4835 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7680 4951 gene locus_tag LOCUS_03630 7680 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10753 7718 gene locus_tag LOCUS_03640 10753 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11335 11039 gene locus_tag LOCUS_03650 11335 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11697 11401 gene locus_tag LOCUS_03660 11697 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 12232 11774 gene locus_tag LOCUS_03670 12232 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 13067 12225 gene locus_tag LOCUS_03680 13067 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 13592 13122 gene locus_tag LOCUS_03690 13592 13122 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_03690 14603 13596 gene locus_tag LOCUS_03700 14603 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 15675 14683 gene locus_tag LOCUS_03710 15675 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 15867 16346 gene locus_tag LOCUS_03720 15867 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 16359 17924 gene locus_tag LOCUS_03730 16359 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 17941 18360 gene locus_tag LOCUS_03740 17941 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 18400 19686 gene locus_tag LOCUS_03750 18400 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 19740 20999 gene locus_tag LOCUS_03760 19740 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21709 21293 gene locus_tag LOCUS_03770 21709 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 22274 21717 gene locus_tag LOCUS_03780 22274 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 22524 22219 gene locus_tag LOCUS_03790 22524 22219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 23281 22580 gene locus_tag LOCUS_03800 23281 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 23723 23220 gene locus_tag LOCUS_03810 23723 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 24021 23758 gene locus_tag LOCUS_03820 24021 23758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 24247 24071 gene locus_tag LOCUS_03830 24247 24071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 24494 24240 gene locus_tag LOCUS_03840 24494 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 25090 24506 gene locus_tag LOCUS_03850 25090 24506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 26036 25122 gene locus_tag LOCUS_03860 26036 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 28215 26074 gene locus_tag LOCUS_03870 28215 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 28861 28415 gene locus_tag LOCUS_03880 28861 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 29166 29555 gene locus_tag LOCUS_03890 29166 29555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 29828 29622 gene locus_tag LOCUS_03900 29828 29622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 29965 30714 gene locus_tag LOCUS_03910 29965 30714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence013 158 2929 gene locus_tag LOCUS_03920 158 2929 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_03920 4096 2975 gene locus_tag LOCUS_03930 gene dinB 4096 2975 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760075.1 protein_id gnl|my_center|LOCUS_03930 4345 6645 gene locus_tag LOCUS_03940 4345 6645 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_03940 6788 8674 gene locus_tag LOCUS_03950 6788 8674 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107965.1 protein_id gnl|my_center|LOCUS_03950 9307 8810 gene locus_tag LOCUS_03960 9307 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 11297 9321 gene locus_tag LOCUS_03970 11297 9321 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045899299.1 protein_id gnl|my_center|LOCUS_03970 11874 11488 gene locus_tag LOCUS_03980 11874 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12962 14731 gene locus_tag LOCUS_03990 12962 14731 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764485.1 protein_id gnl|my_center|LOCUS_03990 14737 16239 gene locus_tag LOCUS_04000 14737 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 16442 19531 gene locus_tag LOCUS_04010 16442 19531 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_04010 19533 21299 gene locus_tag LOCUS_04020 19533 21299 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_04020 21364 23082 gene locus_tag LOCUS_04030 21364 23082 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_04030 23282 24397 gene locus_tag LOCUS_04040 23282 24397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_04040 24445 25335 gene locus_tag LOCUS_04050 24445 25335 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_04050 25668 27539 gene locus_tag LOCUS_04060 25668 27539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 28459 27860 gene locus_tag LOCUS_04070 28459 27860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence014 <1 3062 gene locus_tag LOCUS_04080 <1 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202496.1:TonB-dependent receptor 3089 4741 gene locus_tag LOCUS_04090 3089 4741 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_04090 4778 6610 gene locus_tag LOCUS_04100 4778 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6723 8477 gene locus_tag LOCUS_04110 6723 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8481 8945 gene locus_tag LOCUS_04120 8481 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 9963 9103 gene locus_tag LOCUS_04130 9963 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9224 9233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10509 10808 gene locus_tag LOCUS_04140 10509 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 10789 11028 gene locus_tag LOCUS_04150 10789 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 11021 11302 gene locus_tag LOCUS_04160 11021 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 12605 11394 gene locus_tag LOCUS_04170 gene gluP 12605 11394 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785331.1 protein_id gnl|my_center|LOCUS_04170 12864 13925 gene locus_tag LOCUS_04180 12864 13925 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_04180 21806 14073 gene locus_tag LOCUS_04190 21806 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 24294 22162 gene locus_tag LOCUS_04200 24294 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 24997 24455 gene locus_tag LOCUS_04210 gene xpt 24997 24455 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786581.1 protein_id gnl|my_center|LOCUS_04210 25195 26181 gene locus_tag LOCUS_04220 25195 26181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 27596 26289 gene locus_tag LOCUS_04230 27596 26289 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_04230 28298 27801 gene locus_tag LOCUS_04240 28298 27801 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence015 2289 7 gene locus_tag LOCUS_04250 2289 7 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_04250 3654 2311 gene locus_tag LOCUS_04260 3654 2311 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_04260 4460 3732 gene locus_tag LOCUS_04270 4460 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5372 4461 gene locus_tag LOCUS_04280 5372 4461 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_04280 6199 5435 gene locus_tag LOCUS_04290 6199 5435 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_04290 6299 7063 gene locus_tag LOCUS_04300 gene surE 6299 7063 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_04300 7060 8367 gene locus_tag LOCUS_04310 gene lpxB 7060 8367 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_04310 9319 8453 gene locus_tag LOCUS_04320 9319 8453 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_04320 11439 9331 gene locus_tag LOCUS_04330 gene ftsH 11439 9331 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_04330 11464 11473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11904 11545 gene locus_tag LOCUS_04340 gene rsfS 11904 11545 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_04340 12086 12157 gene locus_tag LOCUS_t00040 12086 12157 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12191 12262 gene locus_tag LOCUS_t00050 12191 12262 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14279 12516 gene locus_tag LOCUS_04350 14279 12516 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_04350 15354 14428 gene locus_tag LOCUS_04360 15354 14428 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_04360 17131 15668 gene locus_tag LOCUS_04370 17131 15668 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_04370 18205 17201 gene locus_tag LOCUS_04380 18205 17201 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_04380 18389 19198 gene locus_tag LOCUS_04390 gene rsmA 18389 19198 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_04390 19213 19773 gene locus_tag LOCUS_04400 gene frr 19213 19773 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_04400 19813 20745 gene locus_tag LOCUS_04410 gene rsgA 19813 20745 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_04410 20757 21704 gene locus_tag LOCUS_04420 20757 21704 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_04420 22201 21805 gene locus_tag LOCUS_tm00010 22201 21805 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 22869 22390 gene locus_tag LOCUS_04430 22869 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 24119 22872 gene locus_tag LOCUS_04440 24119 22872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_04440 24683 24150 gene locus_tag LOCUS_04450 24683 24150 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107759.1 protein_id gnl|my_center|LOCUS_04450 25596 25081 gene locus_tag LOCUS_04460 25596 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 26243 25785 gene locus_tag LOCUS_04470 gene queF 26243 25785 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_04470 26990 26298 gene locus_tag LOCUS_04480 26990 26298 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence016 44 841 gene locus_tag LOCUS_04490 44 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 906 1832 gene locus_tag LOCUS_04500 906 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1977 3674 gene locus_tag LOCUS_04510 gene ettA 1977 3674 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_04510 5417 4260 gene locus_tag LOCUS_04520 5417 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7370 5460 gene locus_tag LOCUS_04530 7370 5460 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_04530 8615 7977 gene locus_tag LOCUS_04540 8615 7977 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 protein_id gnl|my_center|LOCUS_04540 9912 8680 gene locus_tag LOCUS_04550 9912 8680 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_04550 10148 10426 gene locus_tag LOCUS_04560 10148 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10448 11050 gene locus_tag LOCUS_04570 10448 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 11806 11075 gene locus_tag LOCUS_04580 11806 11075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_04580 13337 11817 gene locus_tag LOCUS_04590 13337 11817 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_04590 14079 13378 gene locus_tag LOCUS_04600 14079 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 14342 16390 gene locus_tag LOCUS_04610 14342 16390 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202778.1 protein_id gnl|my_center|LOCUS_04610 18102 16465 gene locus_tag LOCUS_04620 18102 16465 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_04620 20856 18160 gene locus_tag LOCUS_04630 20856 18160 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765337.1 protein_id gnl|my_center|LOCUS_04630 23709 21043 gene locus_tag LOCUS_04640 23709 21043 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_04640 24061 24498 gene locus_tag LOCUS_04650 24061 24498 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_04650 24737 26722 gene locus_tag LOCUS_04660 24737 26722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence017 1654 3594 gene locus_tag LOCUS_04670 1654 3594 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712488.1 protein_id gnl|my_center|LOCUS_04670 3976 5130 gene locus_tag LOCUS_04680 3976 5130 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_04680 5180 5941 gene locus_tag LOCUS_04690 5180 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_04690 5946 6734 gene locus_tag LOCUS_04700 5946 6734 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_04700 6739 7539 gene locus_tag LOCUS_04710 6739 7539 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 protein_id gnl|my_center|LOCUS_04710 9159 7594 gene locus_tag LOCUS_04720 9159 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 9348 10145 gene locus_tag LOCUS_04730 9348 10145 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_04730 11524 10178 gene locus_tag LOCUS_04740 11524 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 12645 11572 gene locus_tag LOCUS_04750 12645 11572 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_04750 13711 12653 gene locus_tag LOCUS_04760 13711 12653 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_04760 14634 13708 gene locus_tag LOCUS_04770 14634 13708 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_04770 16529 14676 gene locus_tag LOCUS_04780 16529 14676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_04780 18013 16679 gene locus_tag LOCUS_04790 gene miaB 18013 16679 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_04790 19056 18070 gene locus_tag LOCUS_04800 19056 18070 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_04800 20101 19106 gene locus_tag LOCUS_04810 20101 19106 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_04810 20227 21495 gene locus_tag LOCUS_04820 20227 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 21851 22423 gene locus_tag LOCUS_04830 21851 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 23760 22507 gene locus_tag LOCUS_04840 23760 22507 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_04840 24442 25578 gene locus_tag LOCUS_04850 24442 25578 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107183.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence018 160 1596 gene locus_tag LOCUS_04860 160 1596 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_04860 1603 2424 gene locus_tag LOCUS_04870 1603 2424 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_04870 3370 2453 gene locus_tag LOCUS_04880 3370 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4473 3388 gene locus_tag LOCUS_04890 4473 3388 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_04890 5209 4490 gene locus_tag LOCUS_04900 gene ispD 5209 4490 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 protein_id gnl|my_center|LOCUS_04900 6621 5263 gene locus_tag LOCUS_04910 6621 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 6804 7829 gene locus_tag LOCUS_04920 6804 7829 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_04920 9403 7916 gene locus_tag LOCUS_04930 9403 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9874 9434 gene locus_tag LOCUS_04940 9874 9434 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_04940 10905 9895 gene locus_tag LOCUS_04950 10905 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11648 10992 gene locus_tag LOCUS_04960 11648 10992 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099642.1 protein_id gnl|my_center|LOCUS_04960 12570 11665 gene locus_tag LOCUS_04970 12570 11665 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_04970 13587 12583 gene locus_tag LOCUS_04980 13587 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 14872 13727 gene locus_tag LOCUS_04990 14872 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 16822 14876 gene locus_tag LOCUS_05000 16822 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 17510 16923 gene locus_tag LOCUS_05010 gene nadD 17510 16923 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_05010 18186 17611 gene locus_tag LOCUS_05020 gene gmk 18186 17611 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_05020 19206 18340 gene locus_tag LOCUS_05030 19206 18340 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_05030 19355 20002 gene locus_tag LOCUS_05040 gene tsaB 19355 20002 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_05040 20047 20658 gene locus_tag LOCUS_05050 20047 20658 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_05050 20683 21993 gene locus_tag LOCUS_05060 gene murA 20683 21993 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_05060 22016 22537 gene locus_tag LOCUS_05070 gene rimM 22016 22537 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_05070 22546 23709 gene locus_tag LOCUS_05080 22546 23709 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_05080 23812 25194 gene locus_tag LOCUS_05090 gene rseP 23812 25194 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence019 1419 76 gene locus_tag LOCUS_05100 1419 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1601 1700 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2617 1817 gene locus_tag LOCUS_05110 2617 1817 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_05110 3174 2617 gene locus_tag LOCUS_05120 3174 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4446 3175 gene locus_tag LOCUS_05130 4446 3175 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_05130 4685 5218 gene locus_tag LOCUS_05140 4685 5218 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_05140 5256 5828 gene locus_tag LOCUS_05150 5256 5828 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_05150 6596 6003 gene locus_tag LOCUS_05160 6596 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6989 6762 gene locus_tag LOCUS_05170 6989 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9918 7198 gene locus_tag LOCUS_05180 gene ppdK 9918 7198 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_05180 10731 12368 gene locus_tag LOCUS_05190 gene rlmD 10731 12368 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_05190 12393 13562 gene locus_tag LOCUS_05200 12393 13562 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107936.1 protein_id gnl|my_center|LOCUS_05200 14923 13631 gene locus_tag LOCUS_05210 14923 13631 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_05210 15063 16667 gene locus_tag LOCUS_05220 15063 16667 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_05220 16746 18683 gene locus_tag LOCUS_05230 gene yidC 16746 18683 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_05230 18856 19149 gene locus_tag LOCUS_05240 18856 19149 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_05240 19142 19507 gene locus_tag LOCUS_05250 19142 19507 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759699.1 protein_id gnl|my_center|LOCUS_05250 19677 19883 gene locus_tag LOCUS_05260 19677 19883 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_05260 20034 20432 gene locus_tag LOCUS_05270 20034 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 20448 21389 gene locus_tag LOCUS_05280 20448 21389 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_05280 21470 21916 gene locus_tag LOCUS_05290 21470 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 23490 22027 gene locus_tag LOCUS_05300 23490 22027 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_05300 24574 23600 gene locus_tag LOCUS_05310 24574 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence020 2892 28 gene locus_tag LOCUS_05320 2892 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5627 3066 gene locus_tag LOCUS_05330 5627 3066 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765772.1 protein_id gnl|my_center|LOCUS_05330 7056 5668 gene locus_tag LOCUS_05340 7056 5668 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 protein_id gnl|my_center|LOCUS_05340 10354 7184 gene locus_tag LOCUS_05350 10354 7184 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_05350 13253 10452 gene locus_tag LOCUS_05360 13253 10452 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_05360 16776 13486 gene locus_tag LOCUS_05370 16776 13486 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107554.1 protein_id gnl|my_center|LOCUS_05370 20744 16845 gene locus_tag LOCUS_05380 20744 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 24274 21560 gene locus_tag LOCUS_05390 24274 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303161.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence021 2688 838 gene locus_tag LOCUS_05400 2688 838 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_05400 2956 4284 gene locus_tag LOCUS_05410 2956 4284 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_05410 4672 5154 gene locus_tag LOCUS_05420 4672 5154 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_05420 7904 5490 gene locus_tag LOCUS_05430 gene galB 7904 5490 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_05430 11030 8076 gene locus_tag LOCUS_05440 11030 8076 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_05440 15371 11208 gene locus_tag LOCUS_05450 15371 11208 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_05450 16572 15556 gene locus_tag LOCUS_05460 16572 15556 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_05460 17497 16859 gene locus_tag LOCUS_05470 17497 16859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786122.1 protein_id gnl|my_center|LOCUS_05470 20149 17579 gene locus_tag LOCUS_05480 20149 17579 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_05480 20363 20899 gene locus_tag LOCUS_05490 20363 20899 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_05490 20887 21348 gene locus_tag LOCUS_05500 20887 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 21432 22097 gene locus_tag LOCUS_05510 21432 22097 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_05510 22143 22952 gene locus_tag LOCUS_05520 22143 22952 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_05520 24195 23041 gene locus_tag LOCUS_05530 24195 23041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence022 <1 701 gene locus_tag LOCUS_05540 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657631.1:DUF4827 domain-containing protein 751 2142 gene locus_tag LOCUS_05550 gene glmM 751 2142 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_05550 3140 2400 gene locus_tag LOCUS_05560 3140 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3698 3147 gene locus_tag LOCUS_05570 3698 3147 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767469.1 protein_id gnl|my_center|LOCUS_05570 7262 3828 gene locus_tag LOCUS_05580 7262 3828 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_05580 8097 7387 gene locus_tag LOCUS_05590 8097 7387 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_05590 9026 8223 gene locus_tag LOCUS_05600 9026 8223 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_05600 9556 9104 gene locus_tag LOCUS_05610 9556 9104 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_05610 10590 9622 gene locus_tag LOCUS_05620 10590 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_05620 11964 10696 gene locus_tag LOCUS_05630 gene purD 11964 10696 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_05630 14351 12093 gene locus_tag LOCUS_05640 14351 12093 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_05640 15985 14480 gene locus_tag LOCUS_05650 15985 14480 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_05650 16919 15969 gene locus_tag LOCUS_05660 16919 15969 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_05660 21574 17060 gene locus_tag LOCUS_05670 21574 17060 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107756.1 protein_id gnl|my_center|LOCUS_05670 23029 21689 gene locus_tag LOCUS_05680 23029 21689 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence023 293 4591 gene locus_tag LOCUS_05690 293 4591 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_05690 4913 6160 gene locus_tag LOCUS_05700 4913 6160 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_05700 6358 8052 gene locus_tag LOCUS_05710 6358 8052 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_05710 8240 9265 gene locus_tag LOCUS_05720 8240 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9378 9842 gene locus_tag LOCUS_05730 9378 9842 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_05730 9937 11085 gene locus_tag LOCUS_05740 9937 11085 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_05740 11951 11190 gene locus_tag LOCUS_05750 11951 11190 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107473.1 protein_id gnl|my_center|LOCUS_05750 12234 13250 gene locus_tag LOCUS_05760 12234 13250 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_05760 13282 13464 gene locus_tag LOCUS_05770 13282 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05770 13471 13815 gene locus_tag LOCUS_05780 13471 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05780 14017 14658 gene locus_tag LOCUS_05790 gene hisH 14017 14658 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_05790 14655 15374 gene locus_tag LOCUS_05800 gene hisA 14655 15374 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_05800 15416 16195 gene locus_tag LOCUS_05810 gene hisF 15416 16195 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_05810 16226 16873 gene locus_tag LOCUS_05820 gene hisIE 16226 16873 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_05820 16902 17618 gene locus_tag LOCUS_05830 16902 17618 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_05830 17671 18990 gene locus_tag LOCUS_05840 17671 18990 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_05840 19107 20264 gene locus_tag LOCUS_05850 gene lysA 19107 20264 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_05850 20322 21479 gene locus_tag LOCUS_05860 20322 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 21558 22331 gene locus_tag LOCUS_05870 21558 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence024 835 77 gene locus_tag LOCUS_05880 835 77 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_05880 2223 865 gene locus_tag LOCUS_05890 2223 865 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_05890 3230 2232 gene locus_tag LOCUS_05900 3230 2232 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_05900 5099 3369 gene locus_tag LOCUS_05910 gene lysS 5099 3369 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_05910 6010 6462 gene locus_tag LOCUS_05920 6010 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6466 7638 gene locus_tag LOCUS_05930 6466 7638 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_05930 7688 9466 gene locus_tag LOCUS_05940 gene menD 7688 9466 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786027.1 protein_id gnl|my_center|LOCUS_05940 9537 10358 gene locus_tag LOCUS_05950 gene menB 9537 10358 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_05950 10631 10557 gene locus_tag LOCUS_t00060 10631 10557 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11220 10816 gene locus_tag LOCUS_05960 gene secG 11220 10816 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_05960 12019 11249 gene locus_tag LOCUS_05970 12019 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_05970 12643 12179 gene locus_tag LOCUS_05980 12643 12179 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_05980 14016 12697 gene locus_tag LOCUS_05990 14016 12697 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_05990 15331 14123 gene locus_tag LOCUS_06000 gene pdxA 15331 14123 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_06000 16231 15341 gene locus_tag LOCUS_06010 16231 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17369 16305 gene locus_tag LOCUS_06020 gene rlmN 17369 16305 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_06020 17506 21315 gene locus_tag LOCUS_06030 17506 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence025 21 1151 gene locus_tag LOCUS_06040 21 1151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_06040 1213 1731 gene locus_tag LOCUS_06050 1213 1731 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_06050 2627 1836 gene locus_tag LOCUS_06060 2627 1836 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_06060 4761 3019 gene locus_tag LOCUS_06070 4761 3019 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_06070 6914 4812 gene locus_tag LOCUS_06080 6914 4812 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_06080 8646 6943 gene locus_tag LOCUS_06090 8646 6943 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_06090 11678 8742 gene locus_tag LOCUS_06100 11678 8742 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_06100 11981 13594 gene locus_tag LOCUS_06110 11981 13594 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764305.1 protein_id gnl|my_center|LOCUS_06110 13645 15873 gene locus_tag LOCUS_06120 13645 15873 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_06120 16038 18263 gene locus_tag LOCUS_06130 gene bglX 16038 18263 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108030.1 protein_id gnl|my_center|LOCUS_06130 18399 19604 gene locus_tag LOCUS_06140 18399 19604 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_06140 20622 19954 gene locus_tag LOCUS_06150 20622 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 21597 20677 gene locus_tag LOCUS_06160 21597 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence026 595 368 gene locus_tag LOCUS_06170 595 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 791 2947 gene locus_tag LOCUS_06180 791 2947 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_06180 4069 2996 gene locus_tag LOCUS_06190 4069 2996 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108601.1 protein_id gnl|my_center|LOCUS_06190 4545 4081 gene locus_tag LOCUS_06200 4545 4081 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_06200 7042 4562 gene locus_tag LOCUS_06210 7042 4562 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_06210 7345 8709 gene locus_tag LOCUS_06220 7345 8709 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_06220 8805 10133 gene locus_tag LOCUS_06230 8805 10133 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_06230 10212 11003 gene locus_tag LOCUS_06240 10212 11003 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_06240 11683 11018 gene locus_tag LOCUS_06250 11683 11018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_06250 14171 11787 gene locus_tag LOCUS_06260 14171 11787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_06260 15503 14250 gene locus_tag LOCUS_06270 15503 14250 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_06270 17105 15765 gene locus_tag LOCUS_06280 17105 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 18014 17334 gene locus_tag LOCUS_06290 18014 17334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_06290 20405 18063 gene locus_tag LOCUS_06300 20405 18063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_06300 20767 21285 gene locus_tag LOCUS_06310 20767 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 21410 22177 gene locus_tag LOCUS_06320 21410 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence027 312 3446 gene locus_tag LOCUS_06330 312 3446 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_06330 3485 5521 gene locus_tag LOCUS_06340 3485 5521 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_06340 5590 8415 gene locus_tag LOCUS_06350 5590 8415 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_06350 8437 10215 gene locus_tag LOCUS_06360 8437 10215 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_06360 13307 10296 gene locus_tag LOCUS_06370 13307 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06370 14567 13317 gene locus_tag LOCUS_06380 14567 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06380 14791 14800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14921 15106 gene locus_tag LOCUS_06390 14921 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 15241 17325 gene locus_tag LOCUS_06400 gene rhgX 15241 17325 CDS product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 protein_id gnl|my_center|LOCUS_06400 17445 19031 gene locus_tag LOCUS_06410 17445 19031 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840507.1 protein_id gnl|my_center|LOCUS_06410 19107 22115 gene locus_tag LOCUS_06420 19107 22115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence028 66 2057 gene locus_tag LOCUS_06430 66 2057 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203129.1 protein_id gnl|my_center|LOCUS_06430 2094 4961 gene locus_tag LOCUS_06440 2094 4961 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_06440 4984 6786 gene locus_tag LOCUS_06450 4984 6786 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_06450 6805 7881 gene locus_tag LOCUS_06460 6805 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 7918 10122 gene locus_tag LOCUS_06470 7918 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 10416 11477 gene locus_tag LOCUS_06480 10416 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11532 12938 gene locus_tag LOCUS_06490 11532 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13605 15455 gene locus_tag LOCUS_06500 13605 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 15696 16259 gene locus_tag LOCUS_06510 15696 16259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 16432 19038 gene locus_tag LOCUS_06520 16432 19038 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_06520 19103 21499 gene locus_tag LOCUS_06530 19103 21499 CDS product TlpA family protein disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767534.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence029 557 1720 gene locus_tag LOCUS_06540 557 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2315 2944 gene locus_tag LOCUS_06550 2315 2944 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_06550 2913 3929 gene locus_tag LOCUS_06560 2913 3929 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_06560 4145 5050 gene locus_tag LOCUS_06570 4145 5050 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_06570 5088 6554 gene locus_tag LOCUS_06580 gene gldK 5088 6554 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_06580 6560 7285 gene locus_tag LOCUS_06590 6560 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7337 8368 gene locus_tag LOCUS_06600 7337 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8485 9516 gene locus_tag LOCUS_06610 8485 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9567 10277 gene locus_tag LOCUS_06620 9567 10277 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_06620 10402 12675 gene locus_tag LOCUS_06630 gene priA 10402 12675 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_06630 14396 12759 gene locus_tag LOCUS_06640 14396 12759 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_06640 16660 14579 gene locus_tag LOCUS_06650 16660 14579 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_06650 16771 18288 gene locus_tag LOCUS_06660 gene gltX 16771 18288 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_06660 18395 19684 gene locus_tag LOCUS_06670 18395 19684 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_06670 20328 19804 gene locus_tag LOCUS_06680 20328 19804 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_06680 21584 20382 gene locus_tag LOCUS_06690 21584 20382 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence030 430 59 gene locus_tag LOCUS_06700 430 59 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_06700 1552 707 gene locus_tag LOCUS_06710 1552 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2390 1566 gene locus_tag LOCUS_06720 2390 1566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_06720 5352 2650 gene locus_tag LOCUS_06730 gene polA 5352 2650 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_06730 5520 6497 gene locus_tag LOCUS_06740 5520 6497 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_06740 7585 6650 gene locus_tag LOCUS_06750 gene deoC 7585 6650 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_06750 7978 7652 gene locus_tag LOCUS_06760 7978 7652 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_06760 8235 7975 gene locus_tag LOCUS_06770 8235 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8709 8257 gene locus_tag LOCUS_06780 gene dtd 8709 8257 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_06780 10619 8829 gene locus_tag LOCUS_06790 gene uvrC 10619 8829 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_06790 11319 10789 gene locus_tag LOCUS_06800 11319 10789 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_06800 13485 11614 gene locus_tag LOCUS_06810 gene mnmG 13485 11614 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_06810 13798 14391 gene locus_tag LOCUS_06820 13798 14391 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_06820 14424 16406 gene locus_tag LOCUS_06830 14424 16406 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_06830 16422 17180 gene locus_tag LOCUS_06840 16422 17180 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_06840 17878 19401 gene locus_tag LOCUS_06850 17878 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 19524 20477 gene locus_tag LOCUS_06860 19524 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 21091 21441 gene locus_tag LOCUS_06870 21091 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence031 399 73 gene locus_tag LOCUS_06880 399 73 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_06880 3137 591 gene locus_tag LOCUS_06890 3137 591 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_06890 3847 3206 gene locus_tag LOCUS_06900 3847 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4145 3840 gene locus_tag LOCUS_06910 4145 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 8998 4667 gene locus_tag LOCUS_06920 gene rpoC 8998 4667 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_06920 12842 9030 gene locus_tag LOCUS_06930 gene rpoB 12842 9030 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_06930 13331 12954 gene locus_tag LOCUS_06940 gene rplL 13331 12954 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_06940 13905 13387 gene locus_tag LOCUS_06950 gene rplJ 13905 13387 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_06950 14616 13924 gene locus_tag LOCUS_06960 gene rplA 14616 13924 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_06960 15078 14638 gene locus_tag LOCUS_06970 gene rplK 15078 14638 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_06970 15682 15140 gene locus_tag LOCUS_06980 gene nusG 15682 15140 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_06980 15883 15695 gene locus_tag LOCUS_06990 gene secE 15883 15695 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_06990 15972 15899 gene locus_tag LOCUS_t00070 15972 15899 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 17231 16035 gene locus_tag LOCUS_07000 gene tuf 17231 16035 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_07000 17372 17300 gene locus_tag LOCUS_t00080 17372 17300 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17459 17386 gene locus_tag LOCUS_t00090 17459 17386 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17554 17472 gene locus_tag LOCUS_t00100 17554 17472 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 17644 17570 gene locus_tag LOCUS_t00110 17644 17570 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18044 17745 gene locus_tag LOCUS_07010 gene raiA 18044 17745 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_07010 18951 18067 gene locus_tag LOCUS_07020 gene xerC 18951 18067 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_07020 19223 19032 gene locus_tag LOCUS_07030 gene rpsU 19223 19032 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_07030 21107 19362 gene locus_tag LOCUS_07040 21107 19362 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence032 141 3380 gene locus_tag LOCUS_07050 141 3380 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_07050 3415 5463 gene locus_tag LOCUS_07060 3415 5463 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_07060 5531 7942 gene locus_tag LOCUS_07070 5531 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8667 8059 gene locus_tag LOCUS_07080 8667 8059 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_07080 10683 8701 gene locus_tag LOCUS_07090 10683 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12097 10883 gene locus_tag LOCUS_07100 12097 10883 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_07100 13483 12134 gene locus_tag LOCUS_07110 gene sufD 13483 12134 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_07110 14247 13492 gene locus_tag LOCUS_07120 gene sufC 14247 13492 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_07120 16111 14660 gene locus_tag LOCUS_07130 gene sufB 16111 14660 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_07130 19156 16250 gene locus_tag LOCUS_07140 gene infB 19156 16250 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_07140 20483 19221 gene locus_tag LOCUS_07150 gene nusA 20483 19221 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763665.1 protein_id gnl|my_center|LOCUS_07150 20987 20487 gene locus_tag LOCUS_07160 gene rimP 20987 20487 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence033 389 1426 gene locus_tag LOCUS_07170 389 1426 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_07170 1541 2491 gene locus_tag LOCUS_07180 1541 2491 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_07180 2498 3232 gene locus_tag LOCUS_07190 gene ubiE 2498 3232 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_07190 3261 4007 gene locus_tag LOCUS_07200 3261 4007 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_07200 4106 5290 gene locus_tag LOCUS_07210 4106 5290 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_07210 5309 6418 gene locus_tag LOCUS_07220 gene prfA 5309 6418 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_07220 6637 7482 gene locus_tag LOCUS_07230 gene pyrF 6637 7482 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_07230 7772 8806 gene locus_tag LOCUS_07240 gene lpxD 7772 8806 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_07240 8821 10203 gene locus_tag LOCUS_07250 8821 10203 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_07250 10219 10989 gene locus_tag LOCUS_07260 gene lpxA 10219 10989 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_07260 11083 11994 gene locus_tag LOCUS_07270 gene miaA 11083 11994 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_07270 12729 12055 gene locus_tag LOCUS_07280 12729 12055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_07280 15171 12787 gene locus_tag LOCUS_07290 15171 12787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555642.1 protein_id gnl|my_center|LOCUS_07290 16511 15261 gene locus_tag LOCUS_07300 16511 15261 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761527.1 protein_id gnl|my_center|LOCUS_07300 18048 16528 gene locus_tag LOCUS_07310 18048 16528 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_07310 19410 18181 gene locus_tag LOCUS_07320 19410 18181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_07320 20947 19478 gene locus_tag LOCUS_07330 20947 19478 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence034 381 1412 gene locus_tag LOCUS_07340 gene gap 381 1412 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_07340 1526 2494 gene locus_tag LOCUS_07350 gene miaA 1526 2494 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_07350 2617 3456 gene locus_tag LOCUS_07360 2617 3456 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785352.1 protein_id gnl|my_center|LOCUS_07360 4264 3560 gene locus_tag LOCUS_07370 4264 3560 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_07370 4489 6432 gene locus_tag LOCUS_07380 4489 6432 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_07380 6450 7718 gene locus_tag LOCUS_07390 6450 7718 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_07390 7777 9213 gene locus_tag LOCUS_07400 7777 9213 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_07400 11231 9510 gene locus_tag LOCUS_07410 11231 9510 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109159.1 protein_id gnl|my_center|LOCUS_07410 13340 11322 gene locus_tag LOCUS_07420 13340 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15093 13540 gene locus_tag LOCUS_07430 15093 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17140 15203 gene locus_tag LOCUS_07440 17140 15203 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_07440 <20419 17160 gene locus_tag LOCUS_07450 <20419 17160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109108.1:TonB-dependent receptor >Feature sequence035 1974 91 gene locus_tag LOCUS_07460 gene pulA 1974 91 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_07460 4318 2183 gene locus_tag LOCUS_07470 4318 2183 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_07470 7155 4513 gene locus_tag LOCUS_07480 7155 4513 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_07480 8682 7321 gene locus_tag LOCUS_07490 8682 7321 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_07490 9703 8702 gene locus_tag LOCUS_07500 9703 8702 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_07500 9992 9777 gene locus_tag LOCUS_07510 9992 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10013 13069 gene locus_tag LOCUS_07520 10013 13069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108938.1 protein_id gnl|my_center|LOCUS_07520 13091 14731 gene locus_tag LOCUS_07530 gene susD 13091 14731 CDS product starch-binding outer membrane lipoprotein SusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767005.1 protein_id gnl|my_center|LOCUS_07530 14759 15913 gene locus_tag LOCUS_07540 14759 15913 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767006.1 protein_id gnl|my_center|LOCUS_07540 15984 17495 gene locus_tag LOCUS_07550 15984 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 17618 17878 gene locus_tag LOCUS_07560 17618 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 17866 18147 gene locus_tag LOCUS_07570 gene vapD 17866 18147 CDS product endoribonuclease VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271050.1 protein_id gnl|my_center|LOCUS_07570 18283 18855 gene locus_tag LOCUS_07580 18283 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 18842 19171 gene locus_tag LOCUS_07590 18842 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence036 1553 102 gene locus_tag LOCUS_07600 gene xylE 1553 102 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107448.1 protein_id gnl|my_center|LOCUS_07600 1718 2674 gene locus_tag LOCUS_07610 gene metF 1718 2674 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_07610 2785 3897 gene locus_tag LOCUS_07620 2785 3897 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_07620 3987 5399 gene locus_tag LOCUS_07630 3987 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5399 5884 gene locus_tag LOCUS_07640 5399 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 7377 5914 gene locus_tag LOCUS_07650 gene rodA 7377 5914 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_07650 9275 7425 gene locus_tag LOCUS_07660 gene mrdA 9275 7425 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_07660 9775 9293 gene locus_tag LOCUS_07670 gene mreD 9775 9293 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_07670 10723 9845 gene locus_tag LOCUS_07680 gene mreC 10723 9845 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_07680 11799 10810 gene locus_tag LOCUS_07690 11799 10810 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_07690 12557 11964 gene locus_tag LOCUS_07700 12557 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12819 12974 gene locus_tag LOCUS_07710 12819 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 13006 15522 gene locus_tag LOCUS_07720 gene clpB 13006 15522 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_07720 17673 15709 gene locus_tag LOCUS_07730 17673 15709 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107562.1 protein_id gnl|my_center|LOCUS_07730 19764 17773 gene locus_tag LOCUS_07740 19764 17773 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence037 186 1643 gene locus_tag LOCUS_07750 186 1643 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_07750 1680 2066 gene locus_tag LOCUS_07760 1680 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2728 2177 gene locus_tag LOCUS_07770 2728 2177 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_07770 4964 2907 gene locus_tag LOCUS_07780 gene htpG 4964 2907 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_07780 5837 5037 gene locus_tag LOCUS_07790 5837 5037 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_07790 7058 5910 gene locus_tag LOCUS_07800 7058 5910 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_07800 8139 7156 gene locus_tag LOCUS_07810 8139 7156 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760615.1 protein_id gnl|my_center|LOCUS_07810 8712 8155 gene locus_tag LOCUS_07820 gene yihA 8712 8155 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_07820 10693 8864 gene locus_tag LOCUS_07830 10693 8864 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_07830 10863 13544 gene locus_tag LOCUS_07840 10863 13544 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_07840 13633 14922 gene locus_tag LOCUS_07850 13633 14922 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_07850 14998 15981 gene locus_tag LOCUS_07860 14998 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 17710 16124 gene locus_tag LOCUS_07870 17710 16124 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_07870 17874 18548 gene locus_tag LOCUS_07880 17874 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 18530 18539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18733 19119 gene locus_tag LOCUS_07890 18733 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 19715 19365 gene locus_tag LOCUS_07900 19715 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence038 2958 544 gene locus_tag LOCUS_07910 2958 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5709 2995 gene locus_tag LOCUS_07920 5709 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6860 5778 gene locus_tag LOCUS_07930 6860 5778 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_07930 8715 6976 gene locus_tag LOCUS_07940 8715 6976 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107602.1 protein_id gnl|my_center|LOCUS_07940 10123 8765 gene locus_tag LOCUS_07950 10123 8765 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_07950 10729 10184 gene locus_tag LOCUS_07960 10729 10184 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202750.1 protein_id gnl|my_center|LOCUS_07960 11710 11138 gene locus_tag LOCUS_07970 11710 11138 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_07970 12265 11714 gene locus_tag LOCUS_07980 12265 11714 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_07980 16023 12292 gene locus_tag LOCUS_07990 gene purL 16023 12292 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814911.1 protein_id gnl|my_center|LOCUS_07990 16311 17165 gene locus_tag LOCUS_08000 16311 17165 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_08000 17424 18635 gene locus_tag LOCUS_08010 17424 18635 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_08010 18954 18718 gene locus_tag LOCUS_08020 18954 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 19215 19910 gene locus_tag LOCUS_08030 19215 19910 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence039 271 597 gene locus_tag LOCUS_08040 271 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1026 1571 gene locus_tag LOCUS_08050 1026 1571 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_08050 3628 1844 gene locus_tag LOCUS_08060 gene rpsA 3628 1844 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_08060 4025 5455 gene locus_tag LOCUS_08070 4025 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5586 6563 gene locus_tag LOCUS_08080 gene pfkA 5586 6563 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_08080 6918 8444 gene locus_tag LOCUS_08090 gene atpD 6918 8444 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_08090 8463 8702 gene locus_tag LOCUS_08100 gene atpC 8463 8702 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_08100 8739 9188 gene locus_tag LOCUS_08110 8739 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9199 10308 gene locus_tag LOCUS_08120 gene atpB 9199 10308 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_08120 10368 10610 gene locus_tag LOCUS_08130 10368 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10736 11236 gene locus_tag LOCUS_08140 gene atpF 10736 11236 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_08140 11245 11781 gene locus_tag LOCUS_08150 gene atpH 11245 11781 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_08150 11867 13453 gene locus_tag LOCUS_08160 gene atpA 11867 13453 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_08160 13460 14434 gene locus_tag LOCUS_08170 13460 14434 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_08170 16401 14536 gene locus_tag LOCUS_08180 gene recQ 16401 14536 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_08180 16563 18569 gene locus_tag LOCUS_08190 16563 18569 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_08190 18824 19327 gene locus_tag LOCUS_08200 18824 19327 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence040 <1 1526 gene locus_tag LOCUS_08210 <1 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790424.1:ribonuclease Y 1642 2340 gene locus_tag LOCUS_08220 1642 2340 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_08220 2760 2482 gene locus_tag LOCUS_08230 2760 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3750 3082 gene locus_tag LOCUS_08240 3750 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5574 3931 gene locus_tag LOCUS_08250 gene hcp 5574 3931 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062937.1 protein_id gnl|my_center|LOCUS_08250 6053 5754 gene locus_tag LOCUS_08260 gene trxA 6053 5754 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_08260 6065 6074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7124 6198 gene locus_tag LOCUS_08270 7124 6198 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_08270 7738 7160 gene locus_tag LOCUS_08280 7738 7160 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_08280 7948 7757 gene locus_tag LOCUS_08290 7948 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8353 7955 gene locus_tag LOCUS_08300 8353 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10708 8444 gene locus_tag LOCUS_08310 gene ccsA 10708 8444 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_08310 12591 10870 gene locus_tag LOCUS_08320 12591 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12614 12623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13956 12730 gene locus_tag LOCUS_08330 13956 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 15357 14056 gene locus_tag LOCUS_08340 15357 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_08340 15716 16672 gene locus_tag LOCUS_08350 15716 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 17449 16817 gene locus_tag LOCUS_08360 17449 16817 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_08360 18601 17474 gene locus_tag LOCUS_08370 gene cls 18601 17474 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_08370 19731 18751 gene locus_tag LOCUS_08380 19731 18751 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence041 113 424 gene locus_tag LOCUS_08390 113 424 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080550.1 protein_id gnl|my_center|LOCUS_08390 865 1380 gene locus_tag LOCUS_08400 865 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1467 2336 gene locus_tag LOCUS_08410 gene murQ 1467 2336 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_08410 4841 2283 gene locus_tag LOCUS_08420 4841 2283 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_08420 5117 7354 gene locus_tag LOCUS_08430 5117 7354 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_08430 8319 7633 gene locus_tag LOCUS_08440 8319 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10212 8335 gene locus_tag LOCUS_08450 10212 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10743 10231 gene locus_tag LOCUS_08460 10743 10231 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_08460 10981 12273 gene locus_tag LOCUS_08470 10981 12273 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_08470 12279 12740 gene locus_tag LOCUS_08480 gene umuD 12279 12740 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_08480 13000 14373 gene locus_tag LOCUS_08490 13000 14373 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_08490 15502 14495 gene locus_tag LOCUS_08500 15502 14495 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_08500 15784 17178 gene locus_tag LOCUS_08510 15784 17178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_08510 17281 18330 gene locus_tag LOCUS_08520 gene gutB 17281 18330 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_08520 18499 19383 gene locus_tag LOCUS_08530 18499 19383 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence042 252 905 gene locus_tag LOCUS_08540 gene pflA 252 905 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_08540 1212 886 gene locus_tag LOCUS_08550 1212 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1270 2022 gene locus_tag LOCUS_08560 1270 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2899 3771 gene locus_tag LOCUS_08570 2899 3771 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764772.1 protein_id gnl|my_center|LOCUS_08570 4828 4058 gene locus_tag LOCUS_08580 4828 4058 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_08580 6237 4957 gene locus_tag LOCUS_08590 6237 4957 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_08590 6833 6369 gene locus_tag LOCUS_08600 gene pyrI 6833 6369 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_08600 7825 6878 gene locus_tag LOCUS_08610 gene pyrB 7825 6878 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_08610 7942 10266 gene locus_tag LOCUS_08620 7942 10266 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_08620 10446 12914 gene locus_tag LOCUS_08630 gene pheT 10446 12914 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_08630 12989 13732 gene locus_tag LOCUS_08640 12989 13732 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_08640 14043 13876 gene locus_tag LOCUS_08650 14043 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14087 14371 gene locus_tag LOCUS_08660 14087 14371 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_08660 14958 14575 gene locus_tag LOCUS_08670 14958 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 15062 16855 gene locus_tag LOCUS_08680 gene lepA 15062 16855 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_08680 16899 17501 gene locus_tag LOCUS_08690 16899 17501 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_08690 18015 17593 gene locus_tag LOCUS_08700 18015 17593 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_08700 18568 18071 gene locus_tag LOCUS_08710 gene pth 18568 18071 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_08710 19298 18693 gene locus_tag LOCUS_08720 19298 18693 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence043 1662 31 gene locus_tag LOCUS_08730 1662 31 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_08730 3206 1752 gene locus_tag LOCUS_08740 3206 1752 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_08740 4641 3226 gene locus_tag LOCUS_08750 4641 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6123 4669 gene locus_tag LOCUS_08760 gene guaB 6123 4669 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_08760 8440 6257 gene locus_tag LOCUS_08770 gene recQ 8440 6257 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_08770 9743 8511 gene locus_tag LOCUS_08780 gene clpX 9743 8511 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_08780 10415 9753 gene locus_tag LOCUS_08790 gene clpP 10415 9753 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_08790 11908 10550 gene locus_tag LOCUS_08800 gene tig 11908 10550 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_08800 12891 12070 gene locus_tag LOCUS_08810 gene lptB 12891 12070 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_08810 13068 13814 gene locus_tag LOCUS_08820 13068 13814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_08820 13817 14578 gene locus_tag LOCUS_08830 13817 14578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_08830 15086 14658 gene locus_tag LOCUS_08840 15086 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 16421 15108 gene locus_tag LOCUS_08850 gene der 16421 15108 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_08850 17464 16550 gene locus_tag LOCUS_08860 gene era 17464 16550 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_08860 18565 17552 gene locus_tag LOCUS_08870 18565 17552 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_08870 18750 18565 gene locus_tag LOCUS_08880 gene rpmF 18750 18565 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_08880 19298 18780 gene locus_tag LOCUS_08890 19298 18780 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764107.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence044 3998 33 gene locus_tag LOCUS_08900 3998 33 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109153.1 protein_id gnl|my_center|LOCUS_08900 4328 5020 gene locus_tag LOCUS_08910 4328 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5125 6720 gene locus_tag LOCUS_08920 5125 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6819 8975 gene locus_tag LOCUS_08930 6819 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 9023 10372 gene locus_tag LOCUS_08940 9023 10372 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109157.1 protein_id gnl|my_center|LOCUS_08940 10512 11786 gene locus_tag LOCUS_08950 10512 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11833 12675 gene locus_tag LOCUS_08960 11833 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12679 15807 gene locus_tag LOCUS_08970 12679 15807 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108634.1 protein_id gnl|my_center|LOCUS_08970 15823 17415 gene locus_tag LOCUS_08980 15823 17415 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_08980 17536 18411 gene locus_tag LOCUS_08990 17536 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 18455 19363 gene locus_tag LOCUS_09000 18455 19363 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109140.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence045 84 1487 gene locus_tag LOCUS_09010 gene potA 84 1487 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_09010 1675 2304 gene locus_tag LOCUS_09020 1675 2304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_09020 2301 3149 gene locus_tag LOCUS_09030 2301 3149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_09030 3222 4559 gene locus_tag LOCUS_09040 3222 4559 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202988.1 protein_id gnl|my_center|LOCUS_09040 4716 4798 gene locus_tag LOCUS_t00120 4716 4798 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6382 4910 gene locus_tag LOCUS_09050 6382 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7812 6604 gene locus_tag LOCUS_09060 7812 6604 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_09060 8927 7815 gene locus_tag LOCUS_09070 gene gmd 8927 7815 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_09070 9145 8948 gene locus_tag LOCUS_09080 9145 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9056 9065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10687 9224 gene locus_tag LOCUS_09090 10687 9224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_09090 10880 11362 gene locus_tag LOCUS_09100 10880 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11373 12188 gene locus_tag LOCUS_09110 11373 12188 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_09110 12319 12849 gene locus_tag LOCUS_09120 12319 12849 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_09120 14325 12901 gene locus_tag LOCUS_09130 gene cls 14325 12901 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_09130 14336 14345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16315 14354 gene locus_tag LOCUS_09140 16315 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 16516 19008 gene locus_tag LOCUS_09150 16516 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence046 2493 301 gene locus_tag LOCUS_09160 2493 301 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_09160 2647 3396 gene locus_tag LOCUS_09170 2647 3396 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_09170 3453 4130 gene locus_tag LOCUS_09180 3453 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4159 5235 gene locus_tag LOCUS_09190 gene hisB 4159 5235 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_09190 6418 5357 gene locus_tag LOCUS_09200 6418 5357 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_09200 6788 7456 gene locus_tag LOCUS_09210 6788 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 7482 9506 gene locus_tag LOCUS_09220 7482 9506 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107315.1 protein_id gnl|my_center|LOCUS_09220 9506 10411 gene locus_tag LOCUS_09230 9506 10411 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_09230 10551 11057 gene locus_tag LOCUS_09240 10551 11057 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_09240 11076 12068 gene locus_tag LOCUS_09250 11076 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 12065 12529 gene locus_tag LOCUS_09260 12065 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 13199 12513 gene locus_tag LOCUS_09270 gene mtrA 13199 12513 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929974.1 protein_id gnl|my_center|LOCUS_09270 14652 13234 gene locus_tag LOCUS_09280 14652 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 14842 17007 gene locus_tag LOCUS_09290 14842 17007 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_09290 17457 17059 gene locus_tag LOCUS_09300 17457 17059 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_09300 17600 18886 gene locus_tag LOCUS_09310 17600 18886 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence047 103 1668 gene locus_tag LOCUS_09320 103 1668 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_09320 2822 1785 gene locus_tag LOCUS_09330 2822 1785 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785146.1 protein_id gnl|my_center|LOCUS_09330 5128 3008 gene locus_tag LOCUS_09340 5128 3008 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_09340 7204 5159 gene locus_tag LOCUS_09350 7204 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 9950 7401 gene locus_tag LOCUS_09360 9950 7401 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_09360 10737 9973 gene locus_tag LOCUS_09370 10737 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 11387 10899 gene locus_tag LOCUS_09380 11387 10899 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_09380 11607 11777 gene locus_tag LOCUS_09390 11607 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 13352 11868 gene locus_tag LOCUS_09400 13352 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 16033 13451 gene locus_tag LOCUS_09410 16033 13451 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_09410 16206 16502 gene locus_tag LOCUS_09420 16206 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 <18890 16735 gene locus_tag LOCUS_09430 <18890 16735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108117.1:TonB-dependent receptor >Feature sequence048 2362 266 gene locus_tag LOCUS_09440 gene recG 2362 266 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_09440 2506 6831 gene locus_tag LOCUS_09450 2506 6831 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765809.1 protein_id gnl|my_center|LOCUS_09450 6895 9345 gene locus_tag LOCUS_09460 6895 9345 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_09460 9296 10612 gene locus_tag LOCUS_09470 9296 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 10749 13229 gene locus_tag LOCUS_09480 10749 13229 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_09480 13285 14745 gene locus_tag LOCUS_09490 13285 14745 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 protein_id gnl|my_center|LOCUS_09490 14785 18771 gene locus_tag LOCUS_09500 14785 18771 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107573.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence049 <1 3167 gene locus_tag LOCUS_09510 <1 3167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202118.1:TonB-dependent receptor 3250 4968 gene locus_tag LOCUS_09520 3250 4968 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_09520 5374 6795 gene locus_tag LOCUS_09530 5374 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7888 6920 gene locus_tag LOCUS_09540 7888 6920 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_09540 8317 9306 gene locus_tag LOCUS_09550 8317 9306 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_09550 10304 9348 gene locus_tag LOCUS_09560 10304 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11085 10291 gene locus_tag LOCUS_09570 11085 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 11869 11162 gene locus_tag LOCUS_09580 11869 11162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_09580 14776 12905 gene locus_tag LOCUS_09590 14776 12905 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_09590 15335 14829 gene locus_tag LOCUS_09600 gene purE 15335 14829 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_09600 16013 15405 gene locus_tag LOCUS_09610 16013 15405 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_09610 17581 16049 gene locus_tag LOCUS_09620 gene rpoN 17581 16049 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_09620 18204 17623 gene locus_tag LOCUS_09630 18204 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence050 584 186 gene locus_tag LOCUS_09640 584 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2706 601 gene locus_tag LOCUS_09650 2706 601 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_09650 3642 2773 gene locus_tag LOCUS_09660 3642 2773 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_09660 3837 5495 gene locus_tag LOCUS_09670 3837 5495 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_09670 7330 5555 gene locus_tag LOCUS_09680 7330 5555 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109291.1 protein_id gnl|my_center|LOCUS_09680 7414 8316 gene locus_tag LOCUS_09690 7414 8316 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_09690 8356 8766 gene locus_tag LOCUS_09700 8356 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9186 9638 gene locus_tag LOCUS_09710 9186 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9791 11626 gene locus_tag LOCUS_09720 9791 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12739 11951 gene locus_tag LOCUS_09730 12739 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 13158 12784 gene locus_tag LOCUS_09740 13158 12784 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_09740 14411 13212 gene locus_tag LOCUS_09750 gene ilvA 14411 13212 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_09750 14689 17538 gene locus_tag LOCUS_09760 14689 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09760 17535 18353 gene locus_tag LOCUS_09770 17535 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence051 1008 184 gene locus_tag LOCUS_09780 1008 184 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_09780 1322 3340 gene locus_tag LOCUS_09790 1322 3340 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_09790 3479 3979 gene locus_tag LOCUS_09800 3479 3979 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_09800 4027 4788 gene locus_tag LOCUS_09810 4027 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4816 5724 gene locus_tag LOCUS_09820 4816 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5870 7759 gene locus_tag LOCUS_09830 5870 7759 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_09830 9300 7858 gene locus_tag LOCUS_09840 9300 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 9763 11010 gene locus_tag LOCUS_09850 9763 11010 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_09850 11045 12250 gene locus_tag LOCUS_09860 11045 12250 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_09860 12312 15581 gene locus_tag LOCUS_09870 12312 15581 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_09870 15736 17676 gene locus_tag LOCUS_09880 15736 17676 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence052 1484 39 gene locus_tag LOCUS_09890 gene ftsA 1484 39 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_09890 2314 1520 gene locus_tag LOCUS_09900 2314 1520 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_09900 3718 2342 gene locus_tag LOCUS_09910 gene murC 3718 2342 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_09910 4830 3718 gene locus_tag LOCUS_09920 gene murG 4830 3718 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_09920 6203 4926 gene locus_tag LOCUS_09930 6203 4926 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_09930 7582 6245 gene locus_tag LOCUS_09940 gene murD 7582 6245 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_09940 8893 7625 gene locus_tag LOCUS_09950 gene mraY 8893 7625 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_09950 10384 8927 gene locus_tag LOCUS_09960 10384 8927 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_09960 12623 10467 gene locus_tag LOCUS_09970 12623 10467 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_09970 13066 12620 gene locus_tag LOCUS_09980 13066 12620 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763719.1 protein_id gnl|my_center|LOCUS_09980 13977 13063 gene locus_tag LOCUS_09990 gene rsmH 13977 13063 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_09990 14294 15121 gene locus_tag LOCUS_10000 14294 15121 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_10000 15193 16188 gene locus_tag LOCUS_10010 15193 16188 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_10010 16512 18182 gene locus_tag LOCUS_10020 16512 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence053 64 1266 gene locus_tag LOCUS_10030 64 1266 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_10030 1356 2147 gene locus_tag LOCUS_10040 gene nagB 1356 2147 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_10040 3324 2251 gene locus_tag LOCUS_10050 3324 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4834 3353 gene locus_tag LOCUS_10060 4834 3353 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_10060 8016 4849 gene locus_tag LOCUS_10070 8016 4849 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_10070 8583 8059 gene locus_tag LOCUS_10080 8583 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802922.1 protein_id gnl|my_center|LOCUS_10080 9073 8924 gene locus_tag LOCUS_10090 9073 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 9017 10036 gene locus_tag LOCUS_10100 9017 10036 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_10100 10795 10184 gene locus_tag LOCUS_10110 10795 10184 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_10110 11101 12873 gene locus_tag LOCUS_10120 11101 12873 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764484.1 protein_id gnl|my_center|LOCUS_10120 13404 15162 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacacacccacgaagggtgtgac 15628 15338 gene locus_tag LOCUS_10130 gene cas2 15628 15338 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263664.1 protein_id gnl|my_center|LOCUS_10130 16654 15632 gene locus_tag LOCUS_10140 gene cas1c 16654 15632 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_10140 17309 16638 gene locus_tag LOCUS_10150 gene cas4 17309 16638 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_10150 18210 17317 gene locus_tag LOCUS_10160 gene cas7c 18210 17317 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence054 183 974 gene locus_tag LOCUS_10170 183 974 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_10170 1004 2539 gene locus_tag LOCUS_10180 1004 2539 CDS product DUF4992 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765814.1 protein_id gnl|my_center|LOCUS_10180 2566 5883 gene locus_tag LOCUS_10190 2566 5883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107583.1 protein_id gnl|my_center|LOCUS_10190 5918 8128 gene locus_tag LOCUS_10200 5918 8128 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765813.1 protein_id gnl|my_center|LOCUS_10200 9220 8765 gene locus_tag LOCUS_10210 9220 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11823 9196 gene locus_tag LOCUS_10220 11823 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12042 13757 gene locus_tag LOCUS_10230 12042 13757 CDS product thrombospondin type 3 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765812.1 protein_id gnl|my_center|LOCUS_10230 13803 14435 gene locus_tag LOCUS_10240 13803 14435 CDS product DUF3826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765811.1 protein_id gnl|my_center|LOCUS_10240 14524 17253 gene locus_tag LOCUS_10250 14524 17253 CDS product DUF6298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765768.1 protein_id gnl|my_center|LOCUS_10250 17278 17544 gene locus_tag LOCUS_10260 17278 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence055 158 904 gene locus_tag LOCUS_10270 gene kdsB 158 904 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_10270 972 2372 gene locus_tag LOCUS_10280 gene tilS 972 2372 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_10280 2473 4041 gene locus_tag LOCUS_10290 2473 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4136 5011 gene locus_tag LOCUS_10300 4136 5011 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_10300 5450 7117 gene locus_tag LOCUS_10310 5450 7117 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109207.1 protein_id gnl|my_center|LOCUS_10310 7160 10354 gene locus_tag LOCUS_10320 7160 10354 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_10320 10405 13398 gene locus_tag LOCUS_10330 10405 13398 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_10330 13534 14151 gene locus_tag LOCUS_10340 13534 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 14646 14212 gene locus_tag LOCUS_10350 14646 14212 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789808.1 protein_id gnl|my_center|LOCUS_10350 15557 16753 gene locus_tag LOCUS_10360 15557 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 17538 17927 gene locus_tag LOCUS_10370 17538 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence056 109 828 gene locus_tag LOCUS_10380 109 828 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_10380 825 1799 gene locus_tag LOCUS_10390 825 1799 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_10390 1949 2728 gene locus_tag LOCUS_10400 1949 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3721 2804 gene locus_tag LOCUS_10410 3721 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3960 5330 gene locus_tag LOCUS_10420 gene nhaD 3960 5330 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_10420 7498 5612 gene locus_tag LOCUS_10430 7498 5612 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764484.1 protein_id gnl|my_center|LOCUS_10430 8198 7743 gene locus_tag LOCUS_10440 8198 7743 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760274.1 protein_id gnl|my_center|LOCUS_10440 9216 12209 gene locus_tag LOCUS_10450 9216 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 12228 15035 gene locus_tag LOCUS_10460 12228 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 15040 17754 gene locus_tag LOCUS_10470 15040 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence057 651 208 gene locus_tag LOCUS_10480 gene rpiB 651 208 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_10480 2949 925 gene locus_tag LOCUS_10490 2949 925 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_10490 2955 2964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4622 3051 gene locus_tag LOCUS_10500 4622 3051 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_10500 6297 4705 gene locus_tag LOCUS_10510 6297 4705 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_10510 7927 6386 gene locus_tag LOCUS_10520 gene araA 7927 6386 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_10520 8691 7993 gene locus_tag LOCUS_10530 8691 7993 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_10530 9335 8760 gene locus_tag LOCUS_10540 9335 8760 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_10540 11423 9699 gene locus_tag LOCUS_10550 11423 9699 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_10550 12778 11591 gene locus_tag LOCUS_10560 12778 11591 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_10560 14150 12990 gene locus_tag LOCUS_10570 gene galK 14150 12990 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_10570 15599 14253 gene locus_tag LOCUS_10580 15599 14253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_10580 16851 15766 gene locus_tag LOCUS_10590 16851 15766 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence058 <1 666 gene locus_tag LOCUS_10600 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768315.1:translation initiation factor IF-3 747 944 gene locus_tag LOCUS_10610 gene rpmI 747 944 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_10610 1035 1328 gene locus_tag LOCUS_10620 gene rplT 1035 1328 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_10620 1558 1851 gene locus_tag LOCUS_10630 1558 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1839 2015 gene locus_tag LOCUS_10640 1839 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3278 2112 gene locus_tag LOCUS_10650 3278 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4145 3354 gene locus_tag LOCUS_10660 4145 3354 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761029.1 protein_id gnl|my_center|LOCUS_10660 5341 4154 gene locus_tag LOCUS_10670 5341 4154 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108955.1 protein_id gnl|my_center|LOCUS_10670 6172 5624 gene locus_tag LOCUS_10680 6172 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 6860 6405 gene locus_tag LOCUS_10690 6860 6405 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 protein_id gnl|my_center|LOCUS_10690 10942 7064 gene locus_tag LOCUS_10700 10942 7064 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108684.1 protein_id gnl|my_center|LOCUS_10700 12697 10988 gene locus_tag LOCUS_10710 12697 10988 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_10710 15779 12735 gene locus_tag LOCUS_10720 15779 12735 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_10720 16218 16370 gene locus_tag LOCUS_10730 16218 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 16422 16823 gene locus_tag LOCUS_10740 16422 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence059 134 2563 gene locus_tag LOCUS_10750 134 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2746 6117 gene locus_tag LOCUS_10760 2746 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6145 12885 gene locus_tag LOCUS_10770 6145 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 13386 13847 gene locus_tag LOCUS_10780 gene rplM 13386 13847 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_10780 13858 14244 gene locus_tag LOCUS_10790 gene rpsI 13858 14244 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_10790 14402 15172 gene locus_tag LOCUS_10800 gene rpsB 14402 15172 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_10800 15281 16276 gene locus_tag LOCUS_10810 gene tsf 15281 16276 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence060 60 686 gene locus_tag LOCUS_10820 60 686 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_10820 688 1311 gene locus_tag LOCUS_10830 gene nqrE 688 1311 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_10830 1330 2604 gene locus_tag LOCUS_10840 gene nqrF 1330 2604 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_10840 5308 3020 gene locus_tag LOCUS_10850 5308 3020 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_10850 5483 6103 gene locus_tag LOCUS_10860 5483 6103 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_10860 7146 6172 gene locus_tag LOCUS_10870 7146 6172 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_10870 7260 8027 gene locus_tag LOCUS_10880 7260 8027 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_10880 8139 8657 gene locus_tag LOCUS_10890 8139 8657 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802822.1 protein_id gnl|my_center|LOCUS_10890 8698 9414 gene locus_tag LOCUS_10900 8698 9414 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_10900 9582 10061 gene locus_tag LOCUS_10910 9582 10061 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_10910 10079 11353 gene locus_tag LOCUS_10920 10079 11353 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_10920 11452 12816 gene locus_tag LOCUS_10930 gene hisS 11452 12816 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_10930 12974 13918 gene locus_tag LOCUS_10940 12974 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 14342 13911 gene locus_tag LOCUS_10950 14342 13911 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766752.1 protein_id gnl|my_center|LOCUS_10950 15257 14715 gene locus_tag LOCUS_10960 15257 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 15380 15634 gene locus_tag LOCUS_10970 15380 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence061 2355 277 gene locus_tag LOCUS_10980 2355 277 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_10980 4689 2494 gene locus_tag LOCUS_10990 4689 2494 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_10990 8190 4957 gene locus_tag LOCUS_11000 gene carB 8190 4957 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_11000 8482 9219 gene locus_tag LOCUS_11010 8482 9219 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_11010 9216 10589 gene locus_tag LOCUS_11020 9216 10589 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_11020 10630 11208 gene locus_tag LOCUS_11030 10630 11208 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_11030 12236 11295 gene locus_tag LOCUS_11040 12236 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_11040 12688 12248 gene locus_tag LOCUS_11050 12688 12248 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_11050 13873 12692 gene locus_tag LOCUS_11060 gene purT 13873 12692 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_11060 14495 13878 gene locus_tag LOCUS_11070 14495 13878 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_11070 15895 14522 gene locus_tag LOCUS_11080 15895 14522 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence062 3295 731 gene locus_tag LOCUS_11090 3295 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5583 3982 gene locus_tag LOCUS_11100 5583 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6570 7142 gene locus_tag LOCUS_11110 6570 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7923 7204 gene locus_tag LOCUS_11120 7923 7204 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_11120 8542 8144 gene locus_tag LOCUS_11130 8542 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10153 8705 gene locus_tag LOCUS_11140 gene lepB 10153 8705 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_11140 10929 10168 gene locus_tag LOCUS_11150 gene dapB 10929 10168 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_11150 11170 11595 gene locus_tag LOCUS_11160 11170 11595 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_11160 12018 13310 gene locus_tag LOCUS_11170 12018 13310 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_11170 13441 14460 gene locus_tag LOCUS_11180 gene dprA 13441 14460 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_11180 14722 15708 gene locus_tag LOCUS_11190 gene dusB 14722 15708 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence063 <1 1621 gene locus_tag LOCUS_11200 <1 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107693.1:glycogen/starch synthase 1702 4260 gene locus_tag LOCUS_11210 1702 4260 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_11210 5447 4509 gene locus_tag LOCUS_11220 5447 4509 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_11220 6132 5539 gene locus_tag LOCUS_11230 6132 5539 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_11230 6306 7430 gene locus_tag LOCUS_11240 gene nspC 6306 7430 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_11240 7624 7697 gene locus_tag LOCUS_t00130 7624 7697 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7763 7847 gene locus_tag LOCUS_t00140 7763 7847 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7862 7935 gene locus_tag LOCUS_t00150 7862 7935 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7973 8055 gene locus_tag LOCUS_t00160 7973 8055 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8078 8162 gene locus_tag LOCUS_t00170 8078 8162 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8182 8255 gene locus_tag LOCUS_t00180 8182 8255 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8291 8833 gene locus_tag LOCUS_11250 8291 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8872 9318 gene locus_tag LOCUS_11260 gene ssb 8872 9318 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_11260 9461 10702 gene locus_tag LOCUS_11270 9461 10702 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_11270 10709 11344 gene locus_tag LOCUS_11280 10709 11344 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_11280 11423 12469 gene locus_tag LOCUS_11290 11423 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 12527 13318 gene locus_tag LOCUS_11300 12527 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 13528 14076 gene locus_tag LOCUS_11310 13528 14076 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791456.1 protein_id gnl|my_center|LOCUS_11310 14162 14494 gene locus_tag LOCUS_11320 14162 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 15071 14682 gene locus_tag LOCUS_11330 15071 14682 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence064 295 1125 gene locus_tag LOCUS_11340 295 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2727 1213 gene locus_tag LOCUS_11350 2727 1213 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_11350 2854 3393 gene locus_tag LOCUS_11360 gene hpt 2854 3393 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_11360 3404 3646 gene locus_tag LOCUS_11370 3404 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3794 4366 gene locus_tag LOCUS_11380 3794 4366 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_11380 4482 5642 gene locus_tag LOCUS_11390 gene obgE 4482 5642 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_11390 5669 6511 gene locus_tag LOCUS_11400 gene pgeF 5669 6511 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109232.1 protein_id gnl|my_center|LOCUS_11400 6735 7871 gene locus_tag LOCUS_11410 6735 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 6741 6750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8228 8028 gene locus_tag LOCUS_11420 8228 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 9433 8249 gene locus_tag LOCUS_11430 9433 8249 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_11430 11186 9564 gene locus_tag LOCUS_11440 11186 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11283 11080 gene locus_tag LOCUS_11450 11283 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 11899 11306 gene locus_tag LOCUS_11460 11899 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 12221 11988 gene locus_tag LOCUS_11470 12221 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 12324 13073 gene locus_tag LOCUS_11480 12324 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11480 13701 13351 gene locus_tag LOCUS_11490 13701 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 15252 13711 gene locus_tag LOCUS_11500 15252 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence065 342 3269 gene locus_tag LOCUS_11510 342 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3679 6804 gene locus_tag LOCUS_11520 3679 6804 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_11520 6854 8611 gene locus_tag LOCUS_11530 6854 8611 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_11530 8696 10519 gene locus_tag LOCUS_11540 8696 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 10651 12315 gene locus_tag LOCUS_11550 10651 12315 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_11550 12427 13461 gene locus_tag LOCUS_11560 12427 13461 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_11560 13601 15052 gene locus_tag LOCUS_11570 13601 15052 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence066 549 58 gene locus_tag LOCUS_11580 549 58 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766217.1 protein_id gnl|my_center|LOCUS_11580 1366 584 gene locus_tag LOCUS_11590 1366 584 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766218.1 protein_id gnl|my_center|LOCUS_11590 3500 1410 gene locus_tag LOCUS_11600 3500 1410 CDS product subtilase family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766219.1 protein_id gnl|my_center|LOCUS_11600 5580 3532 gene locus_tag LOCUS_11610 5580 3532 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766220.1 protein_id gnl|my_center|LOCUS_11610 8286 5602 gene locus_tag LOCUS_11620 8286 5602 CDS product DUF4458 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766221.1 protein_id gnl|my_center|LOCUS_11620 9866 8286 gene locus_tag LOCUS_11630 9866 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10787 9885 gene locus_tag LOCUS_11640 10787 9885 CDS product DUF4984 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107167.1 protein_id gnl|my_center|LOCUS_11640 12329 10803 gene locus_tag LOCUS_11650 12329 10803 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_11650 15268 12350 gene locus_tag LOCUS_11660 15268 12350 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence067 368 21 gene locus_tag LOCUS_11670 368 21 CDS product SH3 beta-barrel fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202459.1 protein_id gnl|my_center|LOCUS_11670 1552 1983 gene locus_tag LOCUS_11680 gene updY 1552 1983 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_11680 2042 2524 gene locus_tag LOCUS_11690 2042 2524 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203521.1 protein_id gnl|my_center|LOCUS_11690 3238 3804 gene locus_tag LOCUS_11700 3238 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4077 5171 gene locus_tag LOCUS_11710 4077 5171 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_11710 5187 6317 gene locus_tag LOCUS_11720 5187 6317 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_11720 6322 7347 gene locus_tag LOCUS_11730 gene pseB 6322 7347 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_11730 7354 8517 gene locus_tag LOCUS_11740 gene pseC 7354 8517 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_11740 8518 9351 gene locus_tag LOCUS_11750 8518 9351 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_11750 9356 10135 gene locus_tag LOCUS_11760 9356 10135 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_11760 10235 11455 gene locus_tag LOCUS_11770 10235 11455 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_11770 11554 12873 gene locus_tag LOCUS_11780 gene pseG 11554 12873 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870575.1 protein_id gnl|my_center|LOCUS_11780 12873 13901 gene locus_tag LOCUS_11790 gene pseI 12873 13901 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_11790 13903 14886 gene locus_tag LOCUS_11800 13903 14886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence068 <1 1090 gene locus_tag LOCUS_11810 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963871.1:alkaline phosphatase family protein 1250 2428 gene locus_tag LOCUS_11820 1250 2428 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_11820 2355 3353 gene locus_tag LOCUS_11830 2355 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3426 4610 gene locus_tag LOCUS_11840 3426 4610 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_11840 4660 5685 gene locus_tag LOCUS_11850 4660 5685 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_11850 6754 5675 gene locus_tag LOCUS_11860 6754 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201889.1 protein_id gnl|my_center|LOCUS_11860 9657 6991 gene locus_tag LOCUS_11870 gene mgtA 9657 6991 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107551.1 protein_id gnl|my_center|LOCUS_11870 11131 9821 gene locus_tag LOCUS_11880 11131 9821 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_11880 11936 11250 gene locus_tag LOCUS_11890 11936 11250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_11890 12125 12598 gene locus_tag LOCUS_11900 12125 12598 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_11900 13504 12668 gene locus_tag LOCUS_11910 13504 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence069 305 733 gene locus_tag LOCUS_11920 305 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 944 1366 gene locus_tag LOCUS_11930 944 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1744 2232 gene locus_tag LOCUS_11940 1744 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2490 2942 gene locus_tag LOCUS_11950 2490 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2972 3406 gene locus_tag LOCUS_11960 2972 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3388 5922 gene locus_tag LOCUS_11970 3388 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5940 6500 gene locus_tag LOCUS_11980 5940 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 8356 6698 gene locus_tag LOCUS_11990 8356 6698 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_11990 11338 8432 gene locus_tag LOCUS_12000 11338 8432 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_12000 13243 11387 gene locus_tag LOCUS_12010 13243 11387 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_12010 14515 13268 gene locus_tag LOCUS_12020 gene hflX 14515 13268 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence070 615 624 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 693 780 gene locus_tag LOCUS_t00190 693 780 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 807 879 gene locus_tag LOCUS_t00200 807 879 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1025 2308 gene locus_tag LOCUS_12030 1025 2308 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_12030 2556 2873 gene locus_tag LOCUS_12040 gene rplU 2556 2873 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_12040 2893 3183 gene locus_tag LOCUS_12050 gene rpmA 2893 3183 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_12050 3474 4766 gene locus_tag LOCUS_12060 gene serS 3474 4766 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_12060 4981 7323 gene locus_tag LOCUS_12070 4981 7323 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_12070 8791 7418 gene locus_tag LOCUS_12080 8791 7418 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_12080 9338 8784 gene locus_tag LOCUS_12090 9338 8784 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_12090 10233 9418 gene locus_tag LOCUS_12100 10233 9418 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_12100 10936 10379 gene locus_tag LOCUS_12110 10936 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 11892 11002 gene locus_tag LOCUS_12120 gene mazG 11892 11002 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_12120 12092 14173 gene locus_tag LOCUS_12130 gene rho 12092 14173 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence071 216 1049 gene locus_tag LOCUS_12140 216 1049 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_12140 1100 2269 gene locus_tag LOCUS_12150 1100 2269 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_12150 2290 3357 gene locus_tag LOCUS_12160 2290 3357 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_12160 3426 4208 gene locus_tag LOCUS_12170 3426 4208 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_12170 4305 5705 gene locus_tag LOCUS_12180 4305 5705 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_12180 6347 7159 gene locus_tag LOCUS_12190 6347 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7232 8584 gene locus_tag LOCUS_12200 gene ffh 7232 8584 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_12200 8615 9493 gene locus_tag LOCUS_12210 gene folD 8615 9493 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_12210 9598 12138 gene locus_tag LOCUS_12220 9598 12138 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_12220 12473 14230 gene locus_tag LOCUS_12230 gene ilvD 12473 14230 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence072 1648 737 gene locus_tag LOCUS_12240 1648 737 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_12240 2291 3151 gene locus_tag LOCUS_12250 2291 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3160 4149 gene locus_tag LOCUS_12260 3160 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4157 4768 gene locus_tag LOCUS_12270 4157 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5359 5117 gene locus_tag LOCUS_12280 5359 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5726 5415 gene locus_tag LOCUS_12290 5726 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8962 6770 gene locus_tag LOCUS_12300 8962 6770 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_12300 9941 9054 gene locus_tag LOCUS_12310 gene fabD 9941 9054 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_12310 10675 10151 gene locus_tag LOCUS_12320 gene rplI 10675 10151 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_12320 10964 10695 gene locus_tag LOCUS_12330 gene rpsR 10964 10695 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_12330 11311 10967 gene locus_tag LOCUS_12340 gene rpsF 11311 10967 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_12340 11564 11764 gene locus_tag LOCUS_12350 11564 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 12527 11829 gene locus_tag LOCUS_12360 12527 11829 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_12360 14100 12577 gene locus_tag LOCUS_12370 14100 12577 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence073 2226 253 gene locus_tag LOCUS_12380 2226 253 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949065.1 protein_id gnl|my_center|LOCUS_12380 2789 2244 gene locus_tag LOCUS_12390 2789 2244 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_12390 4050 2830 gene locus_tag LOCUS_12400 4050 2830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_12400 5205 5846 gene locus_tag LOCUS_12410 5205 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6179 5880 gene locus_tag LOCUS_12420 6179 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6409 6774 gene locus_tag LOCUS_12430 6409 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12430 6774 9602 gene locus_tag LOCUS_12440 6774 9602 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_12440 9626 11392 gene locus_tag LOCUS_12450 9626 11392 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_12450 11416 12396 gene locus_tag LOCUS_12460 11416 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 12460 14163 gene locus_tag LOCUS_12470 12460 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence074 1945 395 gene locus_tag LOCUS_12480 1945 395 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_12480 2893 1988 gene locus_tag LOCUS_12490 2893 1988 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791938.1 protein_id gnl|my_center|LOCUS_12490 3100 3014 gene locus_tag LOCUS_t00210 3100 3014 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3194 3121 gene locus_tag LOCUS_t00220 3194 3121 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3936 3310 gene locus_tag LOCUS_12500 3936 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5294 3957 gene locus_tag LOCUS_12510 gene argH 5294 3957 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_12510 5771 5310 gene locus_tag LOCUS_12520 5771 5310 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_12520 6422 5790 gene locus_tag LOCUS_12530 gene pyrE 6422 5790 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_12530 7136 6564 gene locus_tag LOCUS_12540 7136 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 7888 7358 gene locus_tag LOCUS_12550 7888 7358 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_12550 9147 8113 gene locus_tag LOCUS_12560 9147 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9235 10272 gene locus_tag LOCUS_12570 gene ribD 9235 10272 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_12570 10340 10498 gene locus_tag LOCUS_12580 10340 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 13945 10652 gene locus_tag LOCUS_12590 13945 10652 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143257291.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence075 33 308 gene locus_tag LOCUS_12600 33 308 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_12600 1249 446 gene locus_tag LOCUS_12610 1249 446 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_12610 2234 1419 gene locus_tag LOCUS_12620 2234 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3085 2252 gene locus_tag LOCUS_12630 3085 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4041 3100 gene locus_tag LOCUS_12640 4041 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6994 4340 gene locus_tag LOCUS_12650 6994 4340 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_12650 7636 7115 gene locus_tag LOCUS_12660 7636 7115 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_12660 7791 7720 gene locus_tag LOCUS_t00230 7791 7720 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9159 7858 gene locus_tag LOCUS_12670 gene tyrS 9159 7858 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_12670 9922 9473 gene locus_tag LOCUS_12680 gene rnpA 9922 9473 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_12680 10692 9943 gene locus_tag LOCUS_12690 10692 9943 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_12690 13021 11747 gene locus_tag LOCUS_12700 gene metK 13021 11747 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_12700 <14125 13169 gene locus_tag LOCUS_12710 <14125 13169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791940.1:site-specific tyrosine recombinase XerD >Feature sequence076 2177 225 gene locus_tag LOCUS_12720 gene thrS 2177 225 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_12720 2481 3515 gene locus_tag LOCUS_12730 2481 3515 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_12730 5842 4265 gene locus_tag LOCUS_12740 5842 4265 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_12740 6642 8861 gene locus_tag LOCUS_12750 6642 8861 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_12750 11142 9112 gene locus_tag LOCUS_12760 11142 9112 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_12760 11699 11139 gene locus_tag LOCUS_12770 gene def 11699 11139 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_12770 12109 11696 gene locus_tag LOCUS_12780 gene ruvX 12109 11696 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_12780 12634 12158 gene locus_tag LOCUS_12790 12634 12158 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_12790 12957 13169 gene locus_tag LOCUS_12800 12957 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 13210 13560 gene locus_tag LOCUS_12810 13210 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 13635 13895 gene locus_tag LOCUS_12820 13635 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence077 170 1207 gene locus_tag LOCUS_12830 gene asnA 170 1207 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_12830 3176 1347 gene locus_tag LOCUS_12840 3176 1347 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_12840 3290 3637 gene locus_tag LOCUS_12850 3290 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3768 4208 gene locus_tag LOCUS_12860 3768 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815012.1 protein_id gnl|my_center|LOCUS_12860 4338 5168 gene locus_tag LOCUS_12870 4338 5168 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766210.1 protein_id gnl|my_center|LOCUS_12870 5168 6499 gene locus_tag LOCUS_12880 5168 6499 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_12880 6500 7408 gene locus_tag LOCUS_12890 6500 7408 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766201.1 protein_id gnl|my_center|LOCUS_12890 7677 8774 gene locus_tag LOCUS_12900 7677 8774 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_12900 8979 9641 gene locus_tag LOCUS_12910 8979 9641 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760542.1 protein_id gnl|my_center|LOCUS_12910 9664 10404 gene locus_tag LOCUS_12920 9664 10404 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_12920 10530 13808 gene locus_tag LOCUS_12930 gene mfd 10530 13808 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence078 1232 27 gene locus_tag LOCUS_12940 1232 27 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_12940 2282 1266 gene locus_tag LOCUS_12950 2282 1266 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_12950 3170 2286 gene locus_tag LOCUS_12960 3170 2286 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_12960 4607 3213 gene locus_tag LOCUS_12970 gene mtaB 4607 3213 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_12970 5082 4909 gene locus_tag LOCUS_12980 5082 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5663 6784 gene locus_tag LOCUS_12990 5663 6784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_12990 9436 6950 gene locus_tag LOCUS_13000 9436 6950 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_13000 10260 9526 gene locus_tag LOCUS_13010 gene mtgA 10260 9526 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_13010 10955 10260 gene locus_tag LOCUS_13020 10955 10260 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_13020 11190 12671 gene locus_tag LOCUS_13030 gene proS 11190 12671 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_13030 12758 13123 gene locus_tag LOCUS_13040 12758 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 13271 13666 gene locus_tag LOCUS_13050 13271 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence079 167 331 gene locus_tag LOCUS_13060 167 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 488 2119 gene locus_tag LOCUS_13070 gene sulP 488 2119 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_13070 3034 2294 gene locus_tag LOCUS_13080 3034 2294 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_13080 4592 3039 gene locus_tag LOCUS_13090 4592 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6287 4608 gene locus_tag LOCUS_13100 6287 4608 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108284.1 protein_id gnl|my_center|LOCUS_13100 6969 6424 gene locus_tag LOCUS_13110 gene yfcE 6969 6424 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_13110 7155 6988 gene locus_tag LOCUS_13120 7155 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7355 7101 gene locus_tag LOCUS_13130 7355 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7640 10081 gene locus_tag LOCUS_13140 gene thrA 7640 10081 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_13140 10137 11387 gene locus_tag LOCUS_13150 10137 11387 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_13150 11463 12764 gene locus_tag LOCUS_13160 gene thrC 11463 12764 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_13160 12853 13809 gene locus_tag LOCUS_13170 12853 13809 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence080 53 1639 gene locus_tag LOCUS_13180 53 1639 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_13180 1734 3539 gene locus_tag LOCUS_13190 1734 3539 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_13190 3635 4702 gene locus_tag LOCUS_13200 gene fmt 3635 4702 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_13200 4751 5323 gene locus_tag LOCUS_13210 4751 5323 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_13210 7509 5530 gene locus_tag LOCUS_13220 7509 5530 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_13220 8378 7509 gene locus_tag LOCUS_13230 8378 7509 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_13230 8631 9509 gene locus_tag LOCUS_13240 8631 9509 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_13240 10529 9618 gene locus_tag LOCUS_13250 10529 9618 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 protein_id gnl|my_center|LOCUS_13250 12117 10666 gene locus_tag LOCUS_13260 12117 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 13811 12123 gene locus_tag LOCUS_13270 13811 12123 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence081 48 1427 gene locus_tag LOCUS_13280 48 1427 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870126.1 protein_id gnl|my_center|LOCUS_13280 1518 2555 gene locus_tag LOCUS_13290 1518 2555 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763044.1 protein_id gnl|my_center|LOCUS_13290 2703 4124 gene locus_tag LOCUS_13300 2703 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4224 5087 gene locus_tag LOCUS_13310 4224 5087 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_13310 6757 5369 gene locus_tag LOCUS_13320 6757 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 9624 6793 gene locus_tag LOCUS_13330 9624 6793 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_13330 10753 9683 gene locus_tag LOCUS_13340 10753 9683 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108586.1 protein_id gnl|my_center|LOCUS_13340 11083 11658 gene locus_tag LOCUS_13350 11083 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13595 11805 gene locus_tag LOCUS_13360 13595 11805 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence082 87 2099 gene locus_tag LOCUS_13370 87 2099 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_13370 2133 5060 gene locus_tag LOCUS_13380 2133 5060 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_13380 6585 5188 gene locus_tag LOCUS_13390 6585 5188 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_13390 9350 6819 gene locus_tag LOCUS_13400 gene feoB 9350 6819 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_13400 12943 9599 gene locus_tag LOCUS_13410 gene secA 12943 9599 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_13410 13473 13114 gene locus_tag LOCUS_13420 13473 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence083 559 996 gene locus_tag LOCUS_13430 559 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1059 1448 gene locus_tag LOCUS_13440 1059 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2955 1621 gene locus_tag LOCUS_13450 2955 1621 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_13450 4816 3428 gene locus_tag LOCUS_13460 4816 3428 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_13460 5705 4893 gene locus_tag LOCUS_13470 5705 4893 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_13470 5881 6732 gene locus_tag LOCUS_13480 gene panC 5881 6732 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_13480 6792 7136 gene locus_tag LOCUS_13490 6792 7136 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785327.1 protein_id gnl|my_center|LOCUS_13490 10843 7388 gene locus_tag LOCUS_13500 10843 7388 CDS product exonuclease SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267196.1 protein_id gnl|my_center|LOCUS_13500 12177 10840 gene locus_tag LOCUS_13510 12177 10840 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203161.1 protein_id gnl|my_center|LOCUS_13510 12582 13220 gene locus_tag LOCUS_13520 12582 13220 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence084 251 3415 gene locus_tag LOCUS_13530 251 3415 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_13530 3616 5064 gene locus_tag LOCUS_13540 3616 5064 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_13540 7224 5635 gene locus_tag LOCUS_13550 gene nadB 7224 5635 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_13550 7376 7795 gene locus_tag LOCUS_13560 7376 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7806 9101 gene locus_tag LOCUS_13570 7806 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 9174 10427 gene locus_tag LOCUS_13580 9174 10427 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_13580 10586 11635 gene locus_tag LOCUS_13590 gene mutY 10586 11635 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291960.1 protein_id gnl|my_center|LOCUS_13590 11673 12461 gene locus_tag LOCUS_13600 11673 12461 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766067.1 protein_id gnl|my_center|LOCUS_13600 13178 12636 gene locus_tag LOCUS_13610 13178 12636 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence085 953 165 gene locus_tag LOCUS_13620 953 165 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_13620 2340 1102 gene locus_tag LOCUS_13630 2340 1102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_13630 3125 2352 gene locus_tag LOCUS_13640 3125 2352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_13640 4331 3150 gene locus_tag LOCUS_13650 4331 3150 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_13650 6065 4731 gene locus_tag LOCUS_13660 6065 4731 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_13660 6973 6308 gene locus_tag LOCUS_13670 6973 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8886 7183 gene locus_tag LOCUS_13680 8886 7183 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_13680 9944 8922 gene locus_tag LOCUS_13690 9944 8922 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_13690 10871 10002 gene locus_tag LOCUS_13700 10871 10002 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_13700 11234 12400 gene locus_tag LOCUS_13710 11234 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 13094 12492 gene locus_tag LOCUS_13720 13094 12492 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence086 <1 504 gene locus_tag LOCUS_13730 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761921.1:type II 3-dehydroquinate dehydratase 507 1145 gene locus_tag LOCUS_13740 507 1145 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_13740 2439 1210 gene locus_tag LOCUS_13750 2439 1210 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_13750 2807 2472 gene locus_tag LOCUS_13760 gene rbfA 2807 2472 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_13760 3681 2845 gene locus_tag LOCUS_13770 gene murI 3681 2845 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_13770 4229 3678 gene locus_tag LOCUS_13780 4229 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4768 4331 gene locus_tag LOCUS_13790 4768 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5422 4910 gene locus_tag LOCUS_13800 5422 4910 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_13800 8070 5434 gene locus_tag LOCUS_13810 8070 5434 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_13810 8876 8124 gene locus_tag LOCUS_13820 8876 8124 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_13820 9567 8878 gene locus_tag LOCUS_13830 9567 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 10960 9581 gene locus_tag LOCUS_13840 10960 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12776 11163 gene locus_tag LOCUS_13850 gene pckA 12776 11163 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence087 1875 916 gene locus_tag LOCUS_13860 1875 916 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_13860 2613 1996 gene locus_tag LOCUS_13870 2613 1996 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304269.1 protein_id gnl|my_center|LOCUS_13870 4152 2848 gene locus_tag LOCUS_13880 4152 2848 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291471.1 protein_id gnl|my_center|LOCUS_13880 6485 4149 gene locus_tag LOCUS_13890 6485 4149 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291467.1 protein_id gnl|my_center|LOCUS_13890 8071 6503 gene locus_tag LOCUS_13900 8071 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 9583 8081 gene locus_tag LOCUS_13910 9583 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 11025 9673 gene locus_tag LOCUS_13920 11025 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9687 9696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11197 11036 gene locus_tag LOCUS_13930 11197 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 12869 11163 gene locus_tag LOCUS_13940 12869 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 11169 11178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence088 151 5739 gene locus_tag LOCUS_13950 151 5739 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_13950 5809 6852 gene locus_tag LOCUS_13960 5809 6852 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_13960 6872 7750 gene locus_tag LOCUS_13970 6872 7750 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_13970 8688 7996 gene locus_tag LOCUS_13980 gene cmk 8688 7996 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_13980 9662 8760 gene locus_tag LOCUS_13990 9662 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9871 10608 gene locus_tag LOCUS_14000 9871 10608 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_14000 10659 11633 gene locus_tag LOCUS_14010 10659 11633 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_14010 11660 12484 gene locus_tag LOCUS_14020 11660 12484 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence089 56 2620 gene locus_tag LOCUS_14030 56 2620 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_14030 2630 4366 gene locus_tag LOCUS_14040 2630 4366 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_14040 6885 4429 gene locus_tag LOCUS_14050 6885 4429 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_14050 9911 7089 gene locus_tag LOCUS_14060 9911 7089 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_14060 10521 9979 gene locus_tag LOCUS_14070 10521 9979 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_14070 12363 10588 gene locus_tag LOCUS_14080 12363 10588 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence090 1784 66 gene locus_tag LOCUS_14090 1784 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2911 2066 gene locus_tag LOCUS_14100 2911 2066 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_14100 3303 2914 gene locus_tag LOCUS_14110 3303 2914 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_14110 6359 3453 gene locus_tag LOCUS_14120 gene uvrA 6359 3453 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_14120 6870 6400 gene locus_tag LOCUS_14130 gene rlmH 6870 6400 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_14130 7178 6867 gene locus_tag LOCUS_14140 7178 6867 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_14140 7354 9105 gene locus_tag LOCUS_14150 7354 9105 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_14150 10199 9171 gene locus_tag LOCUS_14160 10199 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 10574 12013 gene locus_tag LOCUS_14170 10574 12013 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence091 1 387 gene locus_tag LOCUS_14180 1 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14180 1004 1444 gene locus_tag LOCUS_14190 1004 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2408 1659 gene locus_tag LOCUS_14200 2408 1659 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_14200 4678 2453 gene locus_tag LOCUS_14210 4678 2453 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_14210 6890 4914 gene locus_tag LOCUS_14220 6890 4914 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_14220 6985 6994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8109 7219 gene locus_tag LOCUS_14230 8109 7219 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_14230 8925 8161 gene locus_tag LOCUS_14240 8925 8161 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_14240 9134 8997 gene locus_tag LOCUS_14250 9134 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 9576 9355 gene locus_tag LOCUS_14260 9576 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 9983 9591 gene locus_tag LOCUS_14270 9983 9591 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_14270 10513 9992 gene locus_tag LOCUS_14280 10513 9992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_14280 11791 11384 gene locus_tag LOCUS_14290 11791 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107173.1 protein_id gnl|my_center|LOCUS_14290 12220 12014 gene locus_tag LOCUS_14300 12220 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence092 <1 1406 gene locus_tag LOCUS_14310 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786392.1:ATP-binding protein 1518 3650 gene locus_tag LOCUS_14320 1518 3650 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_14320 3665 3955 gene locus_tag LOCUS_14330 3665 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4156 4074 gene locus_tag LOCUS_t00240 4156 4074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4314 5459 gene locus_tag LOCUS_14340 4314 5459 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_14340 5515 6792 gene locus_tag LOCUS_14350 5515 6792 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_14350 9719 6909 gene locus_tag LOCUS_14360 9719 6909 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_14360 9825 11387 gene locus_tag LOCUS_14370 9825 11387 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_14370 11368 12063 gene locus_tag LOCUS_14380 11368 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence093 1608 124 gene locus_tag LOCUS_14390 1608 124 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_14390 3784 1637 gene locus_tag LOCUS_14400 3784 1637 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_14400 4285 6072 gene locus_tag LOCUS_14410 gene asnB 4285 6072 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 protein_id gnl|my_center|LOCUS_14410 6132 10655 gene locus_tag LOCUS_14420 gene gltB 6132 10655 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_14420 10675 12018 gene locus_tag LOCUS_14430 10675 12018 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence094 259 8 gene locus_tag LOCUS_14440 259 8 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_14440 1928 450 gene locus_tag LOCUS_14450 1928 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2898 2017 gene locus_tag LOCUS_14460 2898 2017 CDS product DUF5689 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767130.1 protein_id gnl|my_center|LOCUS_14460 5527 2978 gene locus_tag LOCUS_14470 5527 2978 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_14470 5860 6927 gene locus_tag LOCUS_14480 5860 6927 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_14480 6929 7498 gene locus_tag LOCUS_14490 6929 7498 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_14490 7502 8131 gene locus_tag LOCUS_14500 gene udk 7502 8131 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_14500 8841 8179 gene locus_tag LOCUS_14510 8841 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8999 9556 gene locus_tag LOCUS_14520 gene phoE 8999 9556 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_14520 9652 10410 gene locus_tag LOCUS_14530 9652 10410 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_14530 12091 10484 gene locus_tag LOCUS_14540 12091 10484 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence095 1168 107 gene locus_tag LOCUS_14550 gene rnc 1168 107 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_14550 2420 1158 gene locus_tag LOCUS_14560 gene fabF 2420 1158 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_14560 2679 2443 gene locus_tag LOCUS_14570 2679 2443 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_14570 2911 2714 gene locus_tag LOCUS_14580 2911 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2905 3510 gene locus_tag LOCUS_14590 2905 3510 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_14590 3579 4664 gene locus_tag LOCUS_14600 3579 4664 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_14600 5078 6070 gene locus_tag LOCUS_14610 gene nadA 5078 6070 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_14610 6246 8165 gene locus_tag LOCUS_14620 6246 8165 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_14620 9592 8474 gene locus_tag LOCUS_14630 9592 8474 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_14630 10597 9647 gene locus_tag LOCUS_14640 10597 9647 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_14640 11682 10585 gene locus_tag LOCUS_14650 11682 10585 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence096 4587 1135 gene locus_tag LOCUS_14660 4587 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 8729 4866 gene locus_tag LOCUS_14670 8729 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 9172 11034 gene locus_tag LOCUS_14680 9172 11034 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303096.1 protein_id gnl|my_center|LOCUS_14680 11061 11804 gene locus_tag LOCUS_14690 11061 11804 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108722.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence097 119 280 gene locus_tag LOCUS_14700 119 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 658 903 gene locus_tag LOCUS_14710 658 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 989 998 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1000 1395 gene locus_tag LOCUS_14720 1000 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1500 1757 gene locus_tag LOCUS_14730 1500 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2657 1644 gene locus_tag LOCUS_14740 2657 1644 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_14740 3374 2673 gene locus_tag LOCUS_14750 3374 2673 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_14750 3618 4121 gene locus_tag LOCUS_14760 3618 4121 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_14760 4196 4675 gene locus_tag LOCUS_14770 gene smpB 4196 4675 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_14770 4801 7605 gene locus_tag LOCUS_14780 gene metH 4801 7605 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_14780 7745 8365 gene locus_tag LOCUS_14790 7745 8365 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_14790 8500 9360 gene locus_tag LOCUS_14800 gene map 8500 9360 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_14800 9388 10422 gene locus_tag LOCUS_14810 gene tsaD 9388 10422 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_14810 10450 10956 gene locus_tag LOCUS_14820 10450 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 11110 11373 gene locus_tag LOCUS_14830 gene rpmB 11110 11373 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_14830 11379 11567 gene locus_tag LOCUS_14840 gene rpmG 11379 11567 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_14840 11613 11771 gene locus_tag LOCUS_14850 11613 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence098 697 131 gene locus_tag LOCUS_14860 697 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 851 777 gene locus_tag LOCUS_t00250 851 777 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 961 887 gene locus_tag LOCUS_t00260 961 887 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2422 1232 gene locus_tag LOCUS_14870 2422 1232 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_14870 2641 3657 gene locus_tag LOCUS_14880 2641 3657 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_14880 4572 3856 gene locus_tag LOCUS_14890 4572 3856 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_14890 4792 7257 gene locus_tag LOCUS_14900 gene lon 4792 7257 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_14900 7254 8381 gene locus_tag LOCUS_14910 gene tgt 7254 8381 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_14910 8458 9741 gene locus_tag LOCUS_14920 8458 9741 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_14920 9766 11646 gene locus_tag LOCUS_14930 9766 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence099 1119 40 gene locus_tag LOCUS_14940 1119 40 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_14940 1807 1208 gene locus_tag LOCUS_14950 1807 1208 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795926.1 protein_id gnl|my_center|LOCUS_14950 4522 1904 gene locus_tag LOCUS_14960 4522 1904 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_14960 4635 5246 gene locus_tag LOCUS_14970 4635 5246 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_14970 5302 5311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5337 6518 gene locus_tag LOCUS_14980 5337 6518 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_14980 6618 7490 gene locus_tag LOCUS_14990 6618 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7509 9965 gene locus_tag LOCUS_15000 7509 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 9955 11466 gene locus_tag LOCUS_15010 gene dnaB 9955 11466 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence100 1231 191 gene locus_tag LOCUS_15020 1231 191 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_15020 2152 1241 gene locus_tag LOCUS_15030 2152 1241 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_15030 2164 2173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4671 2323 gene locus_tag LOCUS_15040 4671 2323 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_15040 9506 4737 gene locus_tag LOCUS_15050 9506 4737 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_15050 10188 9520 gene locus_tag LOCUS_15060 10188 9520 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_15060 10975 10217 gene locus_tag LOCUS_15070 gene fabG 10975 10217 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_15070 <11588 11006 gene locus_tag LOCUS_15080 <11588 11006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792010.1:TetR/AcrR family transcriptional regulator >Feature sequence101 1178 324 gene locus_tag LOCUS_15090 1178 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2370 1240 gene locus_tag LOCUS_15100 2370 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2664 2479 gene locus_tag LOCUS_15110 2664 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3367 3038 gene locus_tag LOCUS_15120 3367 3038 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765860.1 protein_id gnl|my_center|LOCUS_15120 5529 3412 gene locus_tag LOCUS_15130 5529 3412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_15130 6108 5695 gene locus_tag LOCUS_15140 6108 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6789 7928 gene locus_tag LOCUS_15150 gene araJ 6789 7928 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_15150 7992 10133 gene locus_tag LOCUS_15160 gene dcp 7992 10133 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_15160 10712 10212 gene locus_tag LOCUS_15170 10712 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence102 142 960 gene locus_tag LOCUS_15180 142 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2057 1128 gene locus_tag LOCUS_15190 2057 1128 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645220.1 protein_id gnl|my_center|LOCUS_15190 4125 2215 gene locus_tag LOCUS_15200 4125 2215 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_15200 4511 5092 gene locus_tag LOCUS_15210 4511 5092 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_15210 6303 5272 gene locus_tag LOCUS_15220 6303 5272 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_15220 8107 6359 gene locus_tag LOCUS_15230 8107 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 8599 8132 gene locus_tag LOCUS_15240 8599 8132 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005928359.1 protein_id gnl|my_center|LOCUS_15240 11011 8789 gene locus_tag LOCUS_15250 11011 8789 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence103 472 2 gene locus_tag LOCUS_15260 472 2 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_15260 834 490 gene locus_tag LOCUS_15270 834 490 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_15270 1749 889 gene locus_tag LOCUS_15280 gene bamD 1749 889 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_15280 1886 4030 gene locus_tag LOCUS_15290 gene uvrB 1886 4030 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_15290 4408 4638 gene locus_tag LOCUS_15300 4408 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5608 5021 gene locus_tag LOCUS_15310 5608 5021 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_15310 7056 5722 gene locus_tag LOCUS_15320 7056 5722 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_15320 8120 7203 gene locus_tag LOCUS_15330 8120 7203 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_15330 8210 8219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9475 8408 gene locus_tag LOCUS_15340 gene serC 9475 8408 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_15340 11138 9819 gene locus_tag LOCUS_15350 11138 9819 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence104 1661 105 gene locus_tag LOCUS_15360 1661 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1946 2200 gene locus_tag LOCUS_15370 1946 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2696 2331 gene locus_tag LOCUS_15380 gene rplS 2696 2331 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_15380 2964 3740 gene locus_tag LOCUS_15390 2964 3740 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_15390 3809 4723 gene locus_tag LOCUS_15400 3809 4723 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_15400 6470 4833 gene locus_tag LOCUS_15410 6470 4833 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_15410 10649 6702 gene locus_tag LOCUS_15420 10649 6702 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence105 3 881 gene locus_tag LOCUS_15430 gene rfbA 3 881 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_15430 1226 3535 gene locus_tag LOCUS_15440 1226 3535 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_15440 3625 4053 gene locus_tag LOCUS_15450 3625 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_15450 6315 4168 gene locus_tag LOCUS_15460 6315 4168 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_15460 7784 6516 gene locus_tag LOCUS_15470 7784 6516 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_15470 8456 7797 gene locus_tag LOCUS_15480 gene lptC 8456 7797 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_15480 9802 8519 gene locus_tag LOCUS_15490 9802 8519 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence106 2197 23 gene locus_tag LOCUS_15500 2197 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5458 2219 gene locus_tag LOCUS_15510 5458 2219 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_15510 7592 5484 gene locus_tag LOCUS_15520 7592 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 7838 8848 gene locus_tag LOCUS_15530 7838 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 10206 9526 gene locus_tag LOCUS_15540 10206 9526 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964148.1 protein_id gnl|my_center|LOCUS_15540 <11190 10262 gene locus_tag LOCUS_15550 <11190 10262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201883.1:HAMP domain-containing sensor histidine kinase >Feature sequence107 1088 621 gene locus_tag LOCUS_15560 1088 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1287 1081 gene locus_tag LOCUS_15570 1287 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1992 1438 gene locus_tag LOCUS_15580 1992 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3214 1997 gene locus_tag LOCUS_15590 3214 1997 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_15590 3847 3341 gene locus_tag LOCUS_15600 3847 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4332 3988 gene locus_tag LOCUS_15610 4332 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5090 4338 gene locus_tag LOCUS_15620 5090 4338 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_15620 5844 5263 gene locus_tag LOCUS_15630 5844 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5999 5865 gene locus_tag LOCUS_15640 5999 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6214 5999 gene locus_tag LOCUS_15650 6214 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7510 6545 gene locus_tag LOCUS_15660 7510 6545 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_15660 7990 8892 gene locus_tag LOCUS_15670 7990 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8997 9758 gene locus_tag LOCUS_15680 8997 9758 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_15680 9845 10471 gene locus_tag LOCUS_15690 9845 10471 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_15690 10986 10609 gene locus_tag LOCUS_15700 10986 10609 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence108 209 1585 gene locus_tag LOCUS_15710 gene pyk 209 1585 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_15710 1827 2579 gene locus_tag LOCUS_15720 1827 2579 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_15720 2649 4553 gene locus_tag LOCUS_15730 gene glmS 2649 4553 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_15730 4700 6583 gene locus_tag LOCUS_15740 4700 6583 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_15740 6650 7735 gene locus_tag LOCUS_15750 gene carA 6650 7735 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_15750 7748 10981 gene locus_tag LOCUS_15760 gene carB 7748 10981 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence109 821 2392 gene locus_tag LOCUS_15770 821 2392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_15770 2550 5459 gene locus_tag LOCUS_15780 2550 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5476 7869 gene locus_tag LOCUS_15790 5476 7869 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_15790 8027 10126 gene locus_tag LOCUS_15800 8027 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 10931 10218 gene locus_tag LOCUS_15810 10931 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence110 386 2722 gene locus_tag LOCUS_15820 386 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3073 4149 gene locus_tag LOCUS_15830 3073 4149 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_15830 4205 6697 gene locus_tag LOCUS_15840 gene galB 4205 6697 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_15840 7009 9723 gene locus_tag LOCUS_15850 7009 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence111 60 1724 gene locus_tag LOCUS_15860 60 1724 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_15860 2544 1939 gene locus_tag LOCUS_15870 2544 1939 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_15870 3793 2837 gene locus_tag LOCUS_15880 3793 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4127 5440 gene locus_tag LOCUS_15890 4127 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 7297 5765 gene locus_tag LOCUS_15900 7297 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10634 7317 gene locus_tag LOCUS_15910 10634 7317 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence112 88 627 gene locus_tag LOCUS_15920 88 627 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_15920 681 1067 gene locus_tag LOCUS_15930 681 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109213.1 protein_id gnl|my_center|LOCUS_15930 1162 1563 gene locus_tag LOCUS_15940 1162 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_15940 1760 3517 gene locus_tag LOCUS_15950 gene aspS 1760 3517 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_15950 3780 4091 gene locus_tag LOCUS_15960 3780 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4310 4633 gene locus_tag LOCUS_15970 4310 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4746 6233 gene locus_tag LOCUS_15980 4746 6233 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_15980 6451 7491 gene locus_tag LOCUS_15990 6451 7491 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_15990 9264 7672 gene locus_tag LOCUS_16000 9264 7672 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_16000 10606 9401 gene locus_tag LOCUS_16010 10606 9401 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence113 203 2095 gene locus_tag LOCUS_16020 203 2095 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_16020 2117 3328 gene locus_tag LOCUS_16030 2117 3328 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_16030 3495 4634 gene locus_tag LOCUS_16040 3495 4634 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_16040 4885 5721 gene locus_tag LOCUS_16050 4885 5721 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_16050 5752 6396 gene locus_tag LOCUS_16060 5752 6396 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_16060 6397 7044 gene locus_tag LOCUS_16070 6397 7044 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765212.1 protein_id gnl|my_center|LOCUS_16070 7078 7926 gene locus_tag LOCUS_16080 7078 7926 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_16080 7931 8890 gene locus_tag LOCUS_16090 7931 8890 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_16090 8996 10414 gene locus_tag LOCUS_16100 8996 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence114 646 236 gene locus_tag LOCUS_16110 gene tsaE 646 236 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_16110 2228 660 gene locus_tag LOCUS_16120 2228 660 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_16120 2500 2775 gene locus_tag LOCUS_16130 2500 2775 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763960.1 protein_id gnl|my_center|LOCUS_16130 2772 3374 gene locus_tag LOCUS_16140 2772 3374 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_16140 6657 3433 gene locus_tag LOCUS_16150 6657 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 7485 6682 gene locus_tag LOCUS_16160 7485 6682 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759703.1 protein_id gnl|my_center|LOCUS_16160 7888 7505 gene locus_tag LOCUS_16170 7888 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_16170 9275 8034 gene locus_tag LOCUS_16180 gene aroA 9275 8034 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_16180 10538 9312 gene locus_tag LOCUS_16190 10538 9312 CDS product zinc-dependent metalloproteinase lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013547570.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence115 677 243 gene locus_tag LOCUS_16200 gene ybeY 677 243 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_16200 1182 697 gene locus_tag LOCUS_16210 gene coaD 1182 697 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783477.1 protein_id gnl|my_center|LOCUS_16210 2228 1194 gene locus_tag LOCUS_16220 gene ruvB 2228 1194 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_16220 2510 3481 gene locus_tag LOCUS_16230 2510 3481 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_16230 5254 3671 gene locus_tag LOCUS_16240 5254 3671 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_16240 7401 5392 gene locus_tag LOCUS_16250 7401 5392 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_16250 8652 7501 gene locus_tag LOCUS_16260 8652 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_16260 10201 8864 gene locus_tag LOCUS_16270 10201 8864 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence116 1539 49 gene locus_tag LOCUS_16280 gene tet(35) 1539 49 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_16280 3021 1915 gene locus_tag LOCUS_16290 gene ald 3021 1915 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_16290 3235 3942 gene locus_tag LOCUS_16300 3235 3942 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_16300 3984 5402 gene locus_tag LOCUS_16310 3984 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067457.1 protein_id gnl|my_center|LOCUS_16310 5412 5948 gene locus_tag LOCUS_16320 gene trxA 5412 5948 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_16320 6097 7404 gene locus_tag LOCUS_16330 gene eno 6097 7404 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_16330 7588 8334 gene locus_tag LOCUS_16340 7588 8334 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_16340 8474 8725 gene locus_tag LOCUS_16350 8474 8725 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_16350 8718 8951 gene locus_tag LOCUS_16360 8718 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 9528 9782 gene locus_tag LOCUS_16370 9528 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence117 68 541 gene locus_tag LOCUS_16380 68 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 490 969 gene locus_tag LOCUS_16390 490 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1198 2136 gene locus_tag LOCUS_16400 1198 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2387 3202 gene locus_tag LOCUS_16410 2387 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3217 3840 gene locus_tag LOCUS_16420 3217 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3837 4250 gene locus_tag LOCUS_16430 3837 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4262 5512 gene locus_tag LOCUS_16440 4262 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5722 5928 gene locus_tag LOCUS_16450 5722 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5949 8384 gene locus_tag LOCUS_16460 5949 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8377 9861 gene locus_tag LOCUS_16470 8377 9861 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence118 <1 912 gene locus_tag LOCUS_16480 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107516.1:signal recognition particle-docking protein FtsY 932 2233 gene locus_tag LOCUS_16490 gene rimO 932 2233 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_16490 2244 2534 gene locus_tag LOCUS_16500 2244 2534 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_16500 2531 4033 gene locus_tag LOCUS_16510 2531 4033 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202863.1 protein_id gnl|my_center|LOCUS_16510 6163 4178 gene locus_tag LOCUS_16520 gene ligA 6163 4178 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_16520 6684 6163 gene locus_tag LOCUS_16530 6684 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8213 6948 gene locus_tag LOCUS_16540 8213 6948 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723690.1 protein_id gnl|my_center|LOCUS_16540 10307 8277 gene locus_tag LOCUS_16550 10307 8277 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence119 1448 81 gene locus_tag LOCUS_16560 1448 81 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765905.1 protein_id gnl|my_center|LOCUS_16560 1653 3437 gene locus_tag LOCUS_16570 gene sppA 1653 3437 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_16570 3474 4697 gene locus_tag LOCUS_16580 gene lpxK 3474 4697 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_16580 4627 5391 gene locus_tag LOCUS_16590 4627 5391 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_16590 5472 6581 gene locus_tag LOCUS_16600 gene thiL 5472 6581 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_16600 6674 6747 gene locus_tag LOCUS_t00270 6674 6747 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6858 8273 gene locus_tag LOCUS_16610 6858 8273 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_16610 8972 8292 gene locus_tag LOCUS_16620 gene tsaA 8972 8292 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_16620 9083 9961 gene locus_tag LOCUS_16630 9083 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence120 254 907 gene locus_tag LOCUS_16640 254 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1458 955 gene locus_tag LOCUS_16650 1458 955 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_16650 2279 1674 gene locus_tag LOCUS_16660 2279 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2464 2979 gene locus_tag LOCUS_16670 2464 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2994 3596 gene locus_tag LOCUS_16680 2994 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3639 7109 gene locus_tag LOCUS_16690 3639 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7102 7560 gene locus_tag LOCUS_16700 7102 7560 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971009.1 protein_id gnl|my_center|LOCUS_16700 7557 8573 gene locus_tag LOCUS_16710 7557 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 8887 9414 gene locus_tag LOCUS_16720 8887 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence121 154 759 gene locus_tag LOCUS_16730 154 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 796 1767 gene locus_tag LOCUS_16740 796 1767 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_16740 1755 2237 gene locus_tag LOCUS_16750 1755 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2188 2907 gene locus_tag LOCUS_16760 2188 2907 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_16760 2911 3927 gene locus_tag LOCUS_16770 2911 3927 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_16770 3983 4606 gene locus_tag LOCUS_16780 3983 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4653 6752 gene locus_tag LOCUS_16790 4653 6752 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_16790 6800 7246 gene locus_tag LOCUS_16800 6800 7246 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_16800 7274 9007 gene locus_tag LOCUS_16810 7274 9007 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_16810 9009 9545 gene locus_tag LOCUS_16820 9009 9545 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence122 308 1318 gene locus_tag LOCUS_16830 gene trpD 308 1318 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_16830 1337 2143 gene locus_tag LOCUS_16840 gene trpC 1337 2143 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_16840 2274 2894 gene locus_tag LOCUS_16850 2274 2894 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_16850 2967 3743 gene locus_tag LOCUS_16860 gene trpA 2967 3743 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_16860 3770 4969 gene locus_tag LOCUS_16870 gene trpB 3770 4969 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_16870 5008 6543 gene locus_tag LOCUS_16880 5008 6543 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_16880 6613 7182 gene locus_tag LOCUS_16890 6613 7182 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_16890 8262 7282 gene locus_tag LOCUS_16900 8262 7282 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_16900 8425 9102 gene locus_tag LOCUS_16910 8425 9102 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_16910 9187 9741 gene locus_tag LOCUS_16920 9187 9741 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence123 682 41 gene locus_tag LOCUS_16930 682 41 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_16930 1445 693 gene locus_tag LOCUS_16940 1445 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2148 1519 gene locus_tag LOCUS_16950 2148 1519 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323440.1 protein_id gnl|my_center|LOCUS_16950 2695 3573 gene locus_tag LOCUS_16960 2695 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3586 4041 gene locus_tag LOCUS_16970 3586 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323438.1 protein_id gnl|my_center|LOCUS_16970 4042 4404 gene locus_tag LOCUS_16980 4042 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323437.1 protein_id gnl|my_center|LOCUS_16980 4394 4804 gene locus_tag LOCUS_16990 4394 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5446 6288 gene locus_tag LOCUS_17000 5446 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6580 8013 gene locus_tag LOCUS_17010 gene mobV 6580 8013 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323434.1 protein_id gnl|my_center|LOCUS_17010 8093 9403 gene locus_tag LOCUS_17020 8093 9403 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203051.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence124 900 400 gene locus_tag LOCUS_17030 900 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1405 890 gene locus_tag LOCUS_17040 1405 890 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_17040 2426 1656 gene locus_tag LOCUS_17050 gene argB 2426 1656 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_17050 4394 2502 gene locus_tag LOCUS_17060 gene speA 4394 2502 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_17060 4989 4462 gene locus_tag LOCUS_17070 4989 4462 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_17070 7370 5043 gene locus_tag LOCUS_17080 gene topA 7370 5043 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_17080 8010 7477 gene locus_tag LOCUS_17090 8010 7477 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108496.1 protein_id gnl|my_center|LOCUS_17090 9527 8073 gene locus_tag LOCUS_17100 9527 8073 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence125 305 679 gene locus_tag LOCUS_17110 305 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1351 2208 gene locus_tag LOCUS_17120 1351 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2221 2934 gene locus_tag LOCUS_17130 2221 2934 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_17130 3177 4502 gene locus_tag LOCUS_17140 3177 4502 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_17140 4499 5083 gene locus_tag LOCUS_17150 4499 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5061 8453 gene locus_tag LOCUS_17160 5061 8453 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_17160 8450 9616 gene locus_tag LOCUS_17170 8450 9616 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence126 173 724 gene locus_tag LOCUS_17180 173 724 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_17180 735 1454 gene locus_tag LOCUS_17190 735 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1355 1546 gene locus_tag LOCUS_17200 1355 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1594 4113 gene locus_tag LOCUS_17210 1594 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 5374 4118 gene locus_tag LOCUS_17220 5374 4118 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_17220 5742 8237 gene locus_tag LOCUS_17230 5742 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 9261 8389 gene locus_tag LOCUS_17240 9261 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence127 302 126 gene locus_tag LOCUS_17250 302 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1271 711 gene locus_tag LOCUS_17260 1271 711 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_17260 2399 1314 gene locus_tag LOCUS_17270 2399 1314 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_17270 3279 2458 gene locus_tag LOCUS_17280 3279 2458 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_17280 3896 3279 gene locus_tag LOCUS_17290 3896 3279 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_17290 5378 3918 gene locus_tag LOCUS_17300 5378 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5701 6537 gene locus_tag LOCUS_17310 5701 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7289 6747 gene locus_tag LOCUS_17320 7289 6747 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_17320 8325 7294 gene locus_tag LOCUS_17330 8325 7294 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_17330 9004 8408 gene locus_tag LOCUS_17340 9004 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence128 3892 1892 gene locus_tag LOCUS_17350 3892 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4677 3889 gene locus_tag LOCUS_17360 4677 3889 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_17360 5457 4843 gene locus_tag LOCUS_17370 5457 4843 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_17370 6496 5540 gene locus_tag LOCUS_17380 6496 5540 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_17380 9436 6575 gene locus_tag LOCUS_17390 gene leuS 9436 6575 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence129 92 448 gene locus_tag LOCUS_17400 92 448 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_17400 559 1827 gene locus_tag LOCUS_17410 559 1827 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_17410 2276 3223 gene locus_tag LOCUS_17420 2276 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3227 4645 gene locus_tag LOCUS_17430 3227 4645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_17430 4657 4830 gene locus_tag LOCUS_17440 4657 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4857 7055 gene locus_tag LOCUS_17450 4857 7055 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_17450 7052 7825 gene locus_tag LOCUS_17460 gene cas5c 7052 7825 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence130 258 70 gene locus_tag LOCUS_17470 258 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 804 577 gene locus_tag LOCUS_17480 804 577 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_17480 1173 910 gene locus_tag LOCUS_17490 1173 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1390 1489 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1495 1773 gene locus_tag LOCUS_17500 1495 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3965 2490 gene locus_tag LOCUS_17510 3965 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4706 4323 gene locus_tag LOCUS_17520 4706 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5017 4853 gene locus_tag LOCUS_17530 5017 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5757 5293 gene locus_tag LOCUS_17540 5757 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6379 5801 gene locus_tag LOCUS_17550 6379 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7048 6656 gene locus_tag LOCUS_17560 7048 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 8538 7051 gene locus_tag LOCUS_17570 8538 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8958 8740 gene locus_tag LOCUS_17580 8958 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence131 175 495 gene locus_tag LOCUS_17590 175 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 651 1859 gene locus_tag LOCUS_17600 651 1859 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_17600 1912 5100 gene locus_tag LOCUS_17610 1912 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5218 6381 gene locus_tag LOCUS_17620 5218 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17620 9184 6473 gene locus_tag LOCUS_17630 9184 6473 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765726.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence132 2417 360 gene locus_tag LOCUS_17640 2417 360 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_17640 4268 2871 gene locus_tag LOCUS_17650 4268 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6027 4321 gene locus_tag LOCUS_17660 6027 4321 CDS product MAC/perforin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108830.1 protein_id gnl|my_center|LOCUS_17660 7353 6052 gene locus_tag LOCUS_17670 7353 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108831.1 protein_id gnl|my_center|LOCUS_17670 7640 7924 gene locus_tag LOCUS_17680 7640 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8079 8609 gene locus_tag LOCUS_17690 8079 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 9141 8818 gene locus_tag LOCUS_17700 9141 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence133 221 565 gene locus_tag LOCUS_17710 221 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1467 640 gene locus_tag LOCUS_17720 1467 640 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765359.1 protein_id gnl|my_center|LOCUS_17720 3284 1590 gene locus_tag LOCUS_17730 3284 1590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765358.1 protein_id gnl|my_center|LOCUS_17730 4454 3291 gene locus_tag LOCUS_17740 4454 3291 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_17740 5723 4494 gene locus_tag LOCUS_17750 5723 4494 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_17750 5901 5680 gene locus_tag LOCUS_17760 5901 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 6791 5997 gene locus_tag LOCUS_17770 6791 5997 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_17770 7328 6894 gene locus_tag LOCUS_17780 7328 6894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072995.1 protein_id gnl|my_center|LOCUS_17780 9049 7571 gene locus_tag LOCUS_17790 9049 7571 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence134 146 2215 gene locus_tag LOCUS_17800 146 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3249 2260 gene locus_tag LOCUS_17810 3249 2260 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_17810 3504 3938 gene locus_tag LOCUS_17820 3504 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3935 4546 gene locus_tag LOCUS_17830 3935 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4640 7195 gene locus_tag LOCUS_17840 4640 7195 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_17840 8094 7273 gene locus_tag LOCUS_17850 8094 7273 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_17850 8907 8140 gene locus_tag LOCUS_17860 8907 8140 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence135 <1 600 gene locus_tag LOCUS_17870 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791742.1:fumarylacetoacetate hydrolase family protein 627 4205 gene locus_tag LOCUS_17880 627 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4229 5416 gene locus_tag LOCUS_17890 gene porV 4229 5416 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_17890 5453 5932 gene locus_tag LOCUS_17900 gene ispF 5453 5932 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_17900 6783 8057 gene locus_tag LOCUS_17910 6783 8057 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_17910 8054 8830 gene locus_tag LOCUS_17920 8054 8830 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence136 104 1486 gene locus_tag LOCUS_17930 104 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2216 1509 gene locus_tag LOCUS_17940 2216 1509 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_17940 2495 3598 gene locus_tag LOCUS_17950 2495 3598 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765612.1 protein_id gnl|my_center|LOCUS_17950 3712 4155 gene locus_tag LOCUS_17960 3712 4155 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_17960 4207 6309 gene locus_tag LOCUS_17970 4207 6309 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_17970 6324 7433 gene locus_tag LOCUS_17980 6324 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7651 8808 gene locus_tag LOCUS_17990 7651 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence137 991 149 gene locus_tag LOCUS_18000 991 149 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_18000 2142 1249 gene locus_tag LOCUS_18010 2142 1249 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202722.1 protein_id gnl|my_center|LOCUS_18010 2286 3047 gene locus_tag LOCUS_18020 2286 3047 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_18020 3361 3603 gene locus_tag LOCUS_18030 3361 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4539 3697 gene locus_tag LOCUS_18040 4539 3697 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_18040 5591 4659 gene locus_tag LOCUS_18050 5591 4659 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_18050 5782 6462 gene locus_tag LOCUS_18060 5782 6462 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_18060 7139 6642 gene locus_tag LOCUS_18070 7139 6642 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_18070 7753 7136 gene locus_tag LOCUS_18080 7753 7136 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323418.1 protein_id gnl|my_center|LOCUS_18080 8159 7782 gene locus_tag LOCUS_18090 8159 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence138 1750 86 gene locus_tag LOCUS_18100 1750 86 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_18100 2684 1833 gene locus_tag LOCUS_18110 gene nadC 2684 1833 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_18110 2954 2733 gene locus_tag LOCUS_18120 2954 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3909 2959 gene locus_tag LOCUS_18130 3909 2959 CDS product DUF4296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660240.1 protein_id gnl|my_center|LOCUS_18130 4642 3914 gene locus_tag LOCUS_18140 4642 3914 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_18140 5029 4646 gene locus_tag LOCUS_18150 5029 4646 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_18150 8757 5146 gene locus_tag LOCUS_18160 gene ileS 8757 5146 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence139 3807 619 gene locus_tag LOCUS_18170 3807 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 6012 4198 gene locus_tag LOCUS_18180 6012 4198 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_18180 8608 6032 gene locus_tag LOCUS_18190 8608 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence140 1865 438 gene locus_tag LOCUS_18200 gene asnS 1865 438 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_18200 3312 1882 gene locus_tag LOCUS_18210 3312 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4774 3428 gene locus_tag LOCUS_18220 gene purB 4774 3428 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_18220 4977 4902 gene locus_tag LOCUS_t00280 4977 4902 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5107 5032 gene locus_tag LOCUS_t00290 5107 5032 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6714 5563 gene locus_tag LOCUS_18230 6714 5563 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760698.1 protein_id gnl|my_center|LOCUS_18230 8726 6807 gene locus_tag LOCUS_18240 gene mutL 8726 6807 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence141 2120 213 gene locus_tag LOCUS_18250 2120 213 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_18250 2851 2303 gene locus_tag LOCUS_18260 2851 2303 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_18260 3621 2857 gene locus_tag LOCUS_18270 3621 2857 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_18270 4700 3618 gene locus_tag LOCUS_18280 4700 3618 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_18280 4934 4704 gene locus_tag LOCUS_18290 4934 4704 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_18290 5182 5003 gene locus_tag LOCUS_18300 5182 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 6603 5380 gene locus_tag LOCUS_18310 6603 5380 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_18310 7791 6706 gene locus_tag LOCUS_18320 gene trpS 7791 6706 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_18320 8671 7880 gene locus_tag LOCUS_18330 8671 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence142 61 2568 gene locus_tag LOCUS_18340 61 2568 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_18340 2583 3404 gene locus_tag LOCUS_18350 2583 3404 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_18350 3433 5910 gene locus_tag LOCUS_18360 3433 5910 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_18360 6147 7532 gene locus_tag LOCUS_18370 6147 7532 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_18370 7447 7456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7533 7703 gene locus_tag LOCUS_18380 7533 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7651 8586 gene locus_tag LOCUS_18390 gene kduI 7651 8586 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence143 1578 82 gene locus_tag LOCUS_18400 1578 82 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_18400 3488 1758 gene locus_tag LOCUS_18410 3488 1758 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798980.1 protein_id gnl|my_center|LOCUS_18410 4544 3501 gene locus_tag LOCUS_18420 4544 3501 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_18420 5672 4707 gene locus_tag LOCUS_18430 5672 4707 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 protein_id gnl|my_center|LOCUS_18430 7047 5914 gene locus_tag LOCUS_18440 gene rfbB 7047 5914 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_18440 8016 7144 gene locus_tag LOCUS_18450 gene rfbD 8016 7144 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence144 28 945 gene locus_tag LOCUS_18460 28 945 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_18460 975 2162 gene locus_tag LOCUS_18470 975 2162 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_18470 2183 3460 gene locus_tag LOCUS_18480 2183 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3487 6834 gene locus_tag LOCUS_18490 3487 6834 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_18490 6895 8409 gene locus_tag LOCUS_18500 gene nanU 6895 8409 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence145 608 192 gene locus_tag LOCUS_18510 608 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2021 843 gene locus_tag LOCUS_18520 2021 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18520 3973 1946 gene locus_tag LOCUS_18530 3973 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18530 5229 3970 gene locus_tag LOCUS_18540 5229 3970 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167385843.1 protein_id gnl|my_center|LOCUS_18540 7595 5232 gene locus_tag LOCUS_18550 7595 5232 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_18550 7857 7618 gene locus_tag LOCUS_18560 7857 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence146 3993 808 gene locus_tag LOCUS_18570 3993 808 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_18570 5162 4014 gene locus_tag LOCUS_18580 5162 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6709 5159 gene locus_tag LOCUS_18590 6709 5159 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_18590 7124 6717 gene locus_tag LOCUS_18600 7124 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7370 7669 gene locus_tag LOCUS_18610 7370 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence147 1509 784 gene locus_tag LOCUS_18620 1509 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2092 1640 gene locus_tag LOCUS_18630 2092 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2493 2347 gene locus_tag LOCUS_18640 2493 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2862 2680 gene locus_tag LOCUS_18650 2862 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4549 3155 gene locus_tag LOCUS_18660 4549 3155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_18660 7686 4645 gene locus_tag LOCUS_18670 gene ebgA 7686 4645 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence148 256 570 gene locus_tag LOCUS_18680 256 570 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005820814.1 protein_id gnl|my_center|LOCUS_18680 1162 743 gene locus_tag LOCUS_18690 1162 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2935 1607 gene locus_tag LOCUS_18700 2935 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3391 4791 gene locus_tag LOCUS_18710 3391 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8133 5257 gene locus_tag LOCUS_18720 8133 5257 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence149 113 922 gene locus_tag LOCUS_18730 113 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 932 3133 gene locus_tag LOCUS_18740 gene amyE 932 3133 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234692.1 protein_id gnl|my_center|LOCUS_18740 4243 3179 gene locus_tag LOCUS_18750 4243 3179 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_18750 4373 6181 gene locus_tag LOCUS_18760 4373 6181 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_18760 6344 7471 gene locus_tag LOCUS_18770 gene prfB 6344 7471 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_18770 7492 7641 gene locus_tag LOCUS_18780 7492 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7646 8146 gene locus_tag LOCUS_18790 7646 8146 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence150 454 651 gene locus_tag LOCUS_18800 454 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 945 1595 gene locus_tag LOCUS_18810 945 1595 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_18810 1850 2623 gene locus_tag LOCUS_18820 1850 2623 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_18820 2648 4342 gene locus_tag LOCUS_18830 gene thiC 2648 4342 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_18830 4347 5486 gene locus_tag LOCUS_18840 gene thiH 4347 5486 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_18840 7816 5645 gene locus_tag LOCUS_18850 7816 5645 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence151 <1 1955 gene locus_tag LOCUS_18860 <1 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765057.1:glutamine synthetase III 2218 3534 gene locus_tag LOCUS_18870 2218 3534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_18870 5847 3802 gene locus_tag LOCUS_18880 5847 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 <8035 5919 gene locus_tag LOCUS_18890 <8035 5919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986497.1:M6 family metalloprotease domain-containing protein >Feature sequence152 919 1566 gene locus_tag LOCUS_18900 919 1566 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_18900 1932 3437 gene locus_tag LOCUS_18910 1932 3437 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_18910 4314 3535 gene locus_tag LOCUS_18920 4314 3535 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_18920 6323 4350 gene locus_tag LOCUS_18930 6323 4350 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_18930 <7899 6375 gene locus_tag LOCUS_18940 <7899 6375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767560.1:GH3 auxin-responsive promoter family protein >Feature sequence153 1277 4513 gene locus_tag LOCUS_18950 1277 4513 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_18950 5960 4581 gene locus_tag LOCUS_18960 5960 4581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_18960 6583 6230 gene locus_tag LOCUS_18970 6583 6230 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 protein_id gnl|my_center|LOCUS_18970 7163 6669 gene locus_tag LOCUS_18980 gene fldA 7163 6669 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence154 132 1280 gene locus_tag LOCUS_18990 132 1280 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_18990 1375 2250 gene locus_tag LOCUS_19000 1375 2250 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_19000 2293 3201 gene locus_tag LOCUS_19010 2293 3201 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_19010 3301 5079 gene locus_tag LOCUS_19020 3301 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6618 5182 gene locus_tag LOCUS_19030 6618 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 7654 6602 gene locus_tag LOCUS_19040 gene speB 7654 6602 CDS product cysteine proteinase exotoxin SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922720.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence155 243 1118 gene locus_tag LOCUS_19050 243 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1137 2234 gene locus_tag LOCUS_19060 1137 2234 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_19060 2344 5367 gene locus_tag LOCUS_19070 gene secDF 2344 5367 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_19070 5596 5524 gene locus_tag LOCUS_t00300 5596 5524 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5602 6714 gene locus_tag LOCUS_19080 5602 6714 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_19080 7632 6775 gene locus_tag LOCUS_19090 7632 6775 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence156 566 207 gene locus_tag LOCUS_19100 566 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 775 563 gene locus_tag LOCUS_19110 775 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2679 934 gene locus_tag LOCUS_19120 2679 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3584 2679 gene locus_tag LOCUS_19130 3584 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5368 3581 gene locus_tag LOCUS_19140 5368 3581 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_19140 5896 5459 gene locus_tag LOCUS_19150 gene dut 5896 5459 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_19150 6064 7401 gene locus_tag LOCUS_19160 6064 7401 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence157 435 1040 gene locus_tag LOCUS_19170 435 1040 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_19170 1820 1239 gene locus_tag LOCUS_19180 1820 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3444 1849 gene locus_tag LOCUS_19190 3444 1849 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_19190 6573 3463 gene locus_tag LOCUS_19200 6573 3463 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_19200 7754 6948 gene locus_tag LOCUS_19210 7754 6948 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence158 1092 160 gene locus_tag LOCUS_19220 gene trxB 1092 160 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_19220 1277 2377 gene locus_tag LOCUS_19230 1277 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2890 4485 gene locus_tag LOCUS_19240 2890 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4540 4707 gene locus_tag LOCUS_19250 4540 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4697 5212 gene locus_tag LOCUS_19260 4697 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5448 5600 gene locus_tag LOCUS_19270 5448 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5715 5858 gene locus_tag LOCUS_19280 5715 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5858 6367 gene locus_tag LOCUS_19290 5858 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 6980 7147 gene locus_tag LOCUS_19300 6980 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7137 7607 gene locus_tag LOCUS_19310 7137 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence159 <1 2426 gene locus_tag LOCUS_19320 <1 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:carboxypeptidase-like regulatory domain-containing protein 2603 4168 gene locus_tag LOCUS_19330 2603 4168 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_19330 4245 4394 gene locus_tag LOCUS_19340 4245 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4405 4830 gene locus_tag LOCUS_19350 4405 4830 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_19350 5004 5813 gene locus_tag LOCUS_19360 gene moeB 5004 5813 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_19360 6035 6304 gene locus_tag LOCUS_19370 6035 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 <7745 6567 gene locus_tag LOCUS_19380 <7745 6567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966754.1:GIY-YIG nuclease family protein >Feature sequence160 335 607 gene locus_tag LOCUS_19390 335 607 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789740.1 protein_id gnl|my_center|LOCUS_19390 654 2282 gene locus_tag LOCUS_19400 gene groL 654 2282 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_19400 2678 2893 gene locus_tag LOCUS_19410 2678 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2871 4418 gene locus_tag LOCUS_19420 2871 4418 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_19420 4510 5235 gene locus_tag LOCUS_19430 4510 5235 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_19430 5267 6877 gene locus_tag LOCUS_19440 gene guaA 5267 6877 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764459.1 protein_id gnl|my_center|LOCUS_19440 7190 7017 gene locus_tag LOCUS_19450 7190 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence161 113 877 gene locus_tag LOCUS_19460 113 877 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_19460 1452 907 gene locus_tag LOCUS_19470 1452 907 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763367.1 protein_id gnl|my_center|LOCUS_19470 2207 1485 gene locus_tag LOCUS_19480 2207 1485 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_19480 2392 3825 gene locus_tag LOCUS_19490 2392 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5215 4628 gene locus_tag LOCUS_19500 gene rfbC 5215 4628 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_19500 7520 5589 gene locus_tag LOCUS_19510 7520 5589 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence162 <1 1167 gene locus_tag LOCUS_19520 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203671.1:aminopeptidase P family protein 1264 2475 gene locus_tag LOCUS_19530 1264 2475 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_19530 2622 4346 gene locus_tag LOCUS_19540 gene recJ 2622 4346 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_19540 4366 6273 gene locus_tag LOCUS_19550 4366 6273 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_19550 7440 6397 gene locus_tag LOCUS_19560 gene ilvC 7440 6397 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence163 231 1571 gene locus_tag LOCUS_19570 231 1571 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_19570 4173 1732 gene locus_tag LOCUS_19580 4173 1732 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_19580 4557 5447 gene locus_tag LOCUS_19590 4557 5447 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_19590 6164 5859 gene locus_tag LOCUS_19600 6164 5859 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764277.1 protein_id gnl|my_center|LOCUS_19600 6718 6167 gene locus_tag LOCUS_19610 6718 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109081.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence164 26 757 gene locus_tag LOCUS_19620 26 757 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_19620 830 1540 gene locus_tag LOCUS_19630 gene pyrH 830 1540 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_19630 2349 1621 gene locus_tag LOCUS_19640 gene pssA 2349 1621 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_19640 3045 2353 gene locus_tag LOCUS_19650 3045 2353 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_19650 3211 6921 gene locus_tag LOCUS_19660 gene dnaE 3211 6921 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_19660 6974 7288 gene locus_tag LOCUS_19670 gene trxA 6974 7288 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence165 979 209 gene locus_tag LOCUS_19680 979 209 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_19680 2118 1066 gene locus_tag LOCUS_19690 gene murB 2118 1066 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_19690 3033 2176 gene locus_tag LOCUS_19700 3033 2176 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769737.1 protein_id gnl|my_center|LOCUS_19700 3083 3092 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3158 4198 gene locus_tag LOCUS_19710 gene pheS 3158 4198 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_19710 4310 4861 gene locus_tag LOCUS_19720 4310 4861 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_19720 6123 4945 gene locus_tag LOCUS_19730 6123 4945 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109125.1 protein_id gnl|my_center|LOCUS_19730 7395 6217 gene locus_tag LOCUS_19740 7395 6217 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence166 188 664 gene locus_tag LOCUS_19750 188 664 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_19750 718 1374 gene locus_tag LOCUS_19760 718 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1915 2973 gene locus_tag LOCUS_19770 1915 2973 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795918.1 protein_id gnl|my_center|LOCUS_19770 3524 3045 gene locus_tag LOCUS_19780 3524 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3972 3571 gene locus_tag LOCUS_19790 3972 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4547 4008 gene locus_tag LOCUS_19800 4547 4008 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760363.1 protein_id gnl|my_center|LOCUS_19800 4762 5943 gene locus_tag LOCUS_19810 4762 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 5966 6775 gene locus_tag LOCUS_19820 5966 6775 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence167 79 510 gene locus_tag LOCUS_19830 79 510 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_19830 507 1211 gene locus_tag LOCUS_19840 507 1211 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_19840 1525 2823 gene locus_tag LOCUS_19850 1525 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3601 3700 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4722 4240 gene locus_tag LOCUS_19860 gene cdd 4722 4240 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_19860 4804 4989 gene locus_tag LOCUS_19870 4804 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 6266 4977 gene locus_tag LOCUS_19880 6266 4977 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_19880 7182 6325 gene locus_tag LOCUS_19890 7182 6325 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence168 370 17 gene locus_tag LOCUS_19900 370 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 711 920 gene locus_tag LOCUS_19910 711 920 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_19910 920 1078 gene locus_tag LOCUS_19920 920 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1038 1289 gene locus_tag LOCUS_19930 1038 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1289 1732 gene locus_tag LOCUS_19940 1289 1732 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_19940 1729 2184 gene locus_tag LOCUS_19950 1729 2184 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_19950 2208 3446 gene locus_tag LOCUS_19960 2208 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3504 4442 gene locus_tag LOCUS_19970 3504 4442 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_19970 5177 4503 gene locus_tag LOCUS_19980 5177 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6156 5158 gene locus_tag LOCUS_19990 6156 5158 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_19990 6765 6157 gene locus_tag LOCUS_20000 6765 6157 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence169 2958 376 gene locus_tag LOCUS_20010 2958 376 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_20010 3668 2988 gene locus_tag LOCUS_20020 3668 2988 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_20020 4567 3746 gene locus_tag LOCUS_20030 gene thiD 4567 3746 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_20030 5579 4638 gene locus_tag LOCUS_20040 5579 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 5601 5610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6594 5713 gene locus_tag LOCUS_20050 6594 5713 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_20050 6758 6673 gene locus_tag LOCUS_t00310 6758 6673 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6961 7060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence170 176 1843 gene locus_tag LOCUS_20060 176 1843 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_20060 1872 3539 gene locus_tag LOCUS_20070 1872 3539 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_20070 4092 3649 gene locus_tag LOCUS_20080 4092 3649 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_20080 4707 4144 gene locus_tag LOCUS_20090 gene coaE 4707 4144 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_20090 5735 4755 gene locus_tag LOCUS_20100 5735 4755 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_20100 6042 5728 gene locus_tag LOCUS_20110 gene yajC 6042 5728 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_20110 7079 6093 gene locus_tag LOCUS_20120 gene nusB 7079 6093 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence171 56 1459 gene locus_tag LOCUS_20130 gene uxaC 56 1459 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_20130 1512 2882 gene locus_tag LOCUS_20140 1512 2882 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_20140 2922 2931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3083 5200 gene locus_tag LOCUS_20150 3083 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 6742 6960 gene locus_tag LOCUS_20160 6742 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence172 <1 4754 gene locus_tag LOCUS_20170 <1 4754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055166304.1:tape measure protein 4758 5174 gene locus_tag LOCUS_20180 4758 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence173 176 1051 gene locus_tag LOCUS_20190 176 1051 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767195.1 protein_id gnl|my_center|LOCUS_20190 1482 2981 gene locus_tag LOCUS_20200 gene rhaB 1482 2981 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_20200 3048 4301 gene locus_tag LOCUS_20210 3048 4301 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_20210 4473 5504 gene locus_tag LOCUS_20220 gene rhaT 4473 5504 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_20220 5524 5841 gene locus_tag LOCUS_20230 gene rhaM 5524 5841 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_20230 6870 6061 gene locus_tag LOCUS_20240 gene rhaD 6870 6061 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence174 95 1867 gene locus_tag LOCUS_20250 gene fucI 95 1867 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_20250 1917 2552 gene locus_tag LOCUS_20260 1917 2552 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783908.1 protein_id gnl|my_center|LOCUS_20260 2673 4064 gene locus_tag LOCUS_20270 2673 4064 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764990.1 protein_id gnl|my_center|LOCUS_20270 4149 5447 gene locus_tag LOCUS_20280 gene fucP 4149 5447 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_20280 6650 5514 gene locus_tag LOCUS_20290 gene mnmA 6650 5514 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence175 4224 4949 gene locus_tag LOCUS_20300 4224 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 <6930 5896 gene locus_tag LOCUS_20310 <6930 5896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767133.1:DNA/RNA non-specific endonuclease >Feature sequence176 49 927 gene locus_tag LOCUS_20320 49 927 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_20320 950 1402 gene locus_tag LOCUS_20330 950 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1471 2421 gene locus_tag LOCUS_20340 1471 2421 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_20340 2452 3564 gene locus_tag LOCUS_20350 gene wecB 2452 3564 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_20350 4422 3661 gene locus_tag LOCUS_20360 4422 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4898 5578 gene locus_tag LOCUS_20370 4898 5578 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_20370 5612 6829 gene locus_tag LOCUS_20380 5612 6829 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence177 241 170 gene locus_tag LOCUS_t00320 241 170 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 803 582 gene locus_tag LOCUS_20390 803 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1695 892 gene locus_tag LOCUS_20400 1695 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1845 3095 gene locus_tag LOCUS_20410 1845 3095 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_20410 3189 3839 gene locus_tag LOCUS_20420 3189 3839 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776695.1 protein_id gnl|my_center|LOCUS_20420 3892 5400 gene locus_tag LOCUS_20430 3892 5400 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767799.1 protein_id gnl|my_center|LOCUS_20430 6851 5487 gene locus_tag LOCUS_20440 6851 5487 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence178 1737 610 gene locus_tag LOCUS_20450 1737 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107960.1 protein_id gnl|my_center|LOCUS_20450 1979 3097 gene locus_tag LOCUS_20460 1979 3097 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_20460 3157 6735 gene locus_tag LOCUS_20470 gene nifJ 3157 6735 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence179 96 1352 gene locus_tag LOCUS_20480 96 1352 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_20480 1440 3908 gene locus_tag LOCUS_20490 gene galB 1440 3908 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_20490 4310 5836 gene locus_tag LOCUS_20500 4310 5836 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence180 1394 651 gene locus_tag LOCUS_20510 1394 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1851 1612 gene locus_tag LOCUS_20520 1851 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20520 3574 1826 gene locus_tag LOCUS_20530 3574 1826 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 1871 1880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4517 3600 gene locus_tag LOCUS_20540 gene metA 4517 3600 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_20540 6668 4635 gene locus_tag LOCUS_20550 6668 4635 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence181 36 644 gene locus_tag LOCUS_20560 36 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 690 1916 gene locus_tag LOCUS_20570 690 1916 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_20570 1936 2967 gene locus_tag LOCUS_20580 gene recA 1936 2967 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 protein_id gnl|my_center|LOCUS_20580 3259 5163 gene locus_tag LOCUS_20590 gene dnaK 3259 5163 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_20590 5371 6594 gene locus_tag LOCUS_20600 5371 6594 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109064.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence182 2 1465 gene locus_tag LOCUS_20610 2 1465 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_20610 1624 2484 gene locus_tag LOCUS_20620 1624 2484 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_20620 2574 3188 gene locus_tag LOCUS_20630 2574 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5527 3335 gene locus_tag LOCUS_20640 5527 3335 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_20640 6308 5529 gene locus_tag LOCUS_20650 6308 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence183 440 862 gene locus_tag LOCUS_20660 440 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3291 883 gene locus_tag LOCUS_20670 3291 883 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_20670 4941 3670 gene locus_tag LOCUS_20680 gene uxuA 4941 3670 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_20680 6572 4983 gene locus_tag LOCUS_20690 6572 4983 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence184 1549 269 gene locus_tag LOCUS_20700 1549 269 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_20700 1759 2631 gene locus_tag LOCUS_20710 1759 2631 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_20710 2818 4218 gene locus_tag LOCUS_20720 gene mnmE 2818 4218 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_20720 4368 4180 gene locus_tag LOCUS_20730 4368 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4529 5461 gene locus_tag LOCUS_20740 4529 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 5586 6560 gene locus_tag LOCUS_20750 5586 6560 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109328.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence185 906 466 gene locus_tag LOCUS_20760 906 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1414 920 gene locus_tag LOCUS_20770 1414 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802421.1 protein_id gnl|my_center|LOCUS_20770 2287 1607 gene locus_tag LOCUS_20780 2287 1607 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_20780 3193 2333 gene locus_tag LOCUS_20790 3193 2333 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_20790 3710 3216 gene locus_tag LOCUS_20800 3710 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4407 3733 gene locus_tag LOCUS_20810 4407 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5182 4442 gene locus_tag LOCUS_20820 5182 4442 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640660.1 protein_id gnl|my_center|LOCUS_20820 5422 5183 gene locus_tag LOCUS_20830 5422 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 6463 5423 gene locus_tag LOCUS_20840 6463 5423 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence186 2219 132 gene locus_tag LOCUS_20850 2219 132 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_20850 2353 2670 gene locus_tag LOCUS_20860 2353 2670 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_20860 4356 2794 gene locus_tag LOCUS_20870 4356 2794 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_20870 4637 6076 gene locus_tag LOCUS_20880 4637 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 6449 6237 gene locus_tag LOCUS_20890 6449 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence187 1205 348 gene locus_tag LOCUS_20900 gene lgt 1205 348 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_20900 2327 1224 gene locus_tag LOCUS_20910 gene ychF 2327 1224 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_20910 3308 2472 gene locus_tag LOCUS_20920 gene dinD 3308 2472 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_20920 3754 3413 gene locus_tag LOCUS_20930 3754 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3914 3705 gene locus_tag LOCUS_20940 3914 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4112 3918 gene locus_tag LOCUS_20950 4112 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5513 4404 gene locus_tag LOCUS_20960 5513 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 6148 5765 gene locus_tag LOCUS_20970 6148 5765 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392799.1 protein_id gnl|my_center|LOCUS_20970 6423 6259 gene locus_tag LOCUS_20980 6423 6259 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence188 344 901 gene locus_tag LOCUS_20990 344 901 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_20990 969 3614 gene locus_tag LOCUS_21000 969 3614 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769700.1 protein_id gnl|my_center|LOCUS_21000 3737 4078 gene locus_tag LOCUS_21010 3737 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_21010 4089 6398 gene locus_tag LOCUS_21020 4089 6398 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence189 2053 482 gene locus_tag LOCUS_21030 2053 482 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_21030 3612 2404 gene locus_tag LOCUS_21040 3612 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 6306 3694 gene locus_tag LOCUS_21050 gene gyrA 6306 3694 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence190 1439 177 gene locus_tag LOCUS_21060 1439 177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_21060 2694 1531 gene locus_tag LOCUS_21070 2694 1531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_21070 3683 2700 gene locus_tag LOCUS_21080 3683 2700 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_21080 5341 3833 gene locus_tag LOCUS_21090 5341 3833 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_21090 5421 5430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence191 2 1252 gene locus_tag LOCUS_21100 2 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2580 1678 gene locus_tag LOCUS_21110 2580 1678 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_21110 2919 2707 gene locus_tag LOCUS_21120 2919 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 5299 3059 gene locus_tag LOCUS_21130 5299 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 5967 5464 gene locus_tag LOCUS_21140 5967 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence192 103 2199 gene locus_tag LOCUS_21150 103 2199 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_21150 2339 3367 gene locus_tag LOCUS_21160 2339 3367 CDS product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295062.1 protein_id gnl|my_center|LOCUS_21160 3638 3994 gene locus_tag LOCUS_21170 3638 3994 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_21170 4193 5455 gene locus_tag LOCUS_21180 4193 5455 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_21180 5486 6202 gene locus_tag LOCUS_21190 5486 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence193 3 212 gene locus_tag LOCUS_21200 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 284 766 gene locus_tag LOCUS_21210 284 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 802 2976 gene locus_tag LOCUS_21220 802 2976 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 protein_id gnl|my_center|LOCUS_21220 3138 4745 gene locus_tag LOCUS_21230 3138 4745 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_21230 5913 4885 gene locus_tag LOCUS_21240 5913 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence194 53 1156 gene locus_tag LOCUS_21250 53 1156 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_21250 1663 1262 gene locus_tag LOCUS_21260 1663 1262 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_21260 2247 1780 gene locus_tag LOCUS_21270 gene greA 2247 1780 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_21270 5919 2434 gene locus_tag LOCUS_21280 5919 2434 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence195 348 1187 gene locus_tag LOCUS_21290 gene dapF 348 1187 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_21290 1252 2484 gene locus_tag LOCUS_21300 1252 2484 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_21300 2540 4729 gene locus_tag LOCUS_21310 2540 4729 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_21310 5210 5010 gene locus_tag LOCUS_21320 5210 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence196 898 284 gene locus_tag LOCUS_21330 898 284 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763213.1 protein_id gnl|my_center|LOCUS_21330 1840 980 gene locus_tag LOCUS_21340 gene ispE 1840 980 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_21340 2119 3255 gene locus_tag LOCUS_21350 2119 3255 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_21350 3262 5256 gene locus_tag LOCUS_21360 3262 5256 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence197 197 3184 gene locus_tag LOCUS_21370 197 3184 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_21370 3271 4755 gene locus_tag LOCUS_21380 3271 4755 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_21380 4793 5695 gene locus_tag LOCUS_21390 4793 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence198 1705 224 gene locus_tag LOCUS_21400 1705 224 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_21400 1987 1916 gene locus_tag LOCUS_t00330 1987 1916 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2092 2019 gene locus_tag LOCUS_t00340 2092 2019 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3777 2293 gene locus_tag LOCUS_21410 3777 2293 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_21410 4425 3790 gene locus_tag LOCUS_21420 gene ruvC 4425 3790 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_21420 5091 4447 gene locus_tag LOCUS_21430 5091 4447 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_21430 5876 5253 gene locus_tag LOCUS_21440 gene rsmG 5876 5253 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence199 879 2498 gene locus_tag LOCUS_21450 879 2498 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_21450 2589 3254 gene locus_tag LOCUS_21460 2589 3254 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_21460 3309 4469 gene locus_tag LOCUS_21470 gene dnaJ 3309 4469 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_21470 4595 5827 gene locus_tag LOCUS_21480 4595 5827 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence200 298 387 gene locus_tag LOCUS_t00350 298 387 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 481 1347 gene locus_tag LOCUS_21490 481 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1362 1664 gene locus_tag LOCUS_21500 1362 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1840 4065 gene locus_tag LOCUS_21510 1840 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4130 5047 gene locus_tag LOCUS_21520 4130 5047 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_21520 5093 5734 gene locus_tag LOCUS_21530 5093 5734 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence201 100 708 gene locus_tag LOCUS_21540 100 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1309 749 gene locus_tag LOCUS_21550 1309 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3924 1348 gene locus_tag LOCUS_21560 3924 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4382 3999 gene locus_tag LOCUS_21570 4382 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4946 4416 gene locus_tag LOCUS_21580 4946 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 5533 5111 gene locus_tag LOCUS_21590 5533 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence202 297 446 gene locus_tag LOCUS_21600 297 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3530 690 gene locus_tag LOCUS_21610 gene uvrA 3530 690 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_21610 4168 3527 gene locus_tag LOCUS_21620 4168 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence203 2904 868 gene locus_tag LOCUS_21630 2904 868 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658523.1 protein_id gnl|my_center|LOCUS_21630 3339 2953 gene locus_tag LOCUS_21640 3339 2953 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767034.1 protein_id gnl|my_center|LOCUS_21640 3507 5162 gene locus_tag LOCUS_21650 3507 5162 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_21650 5206 5499 gene locus_tag LOCUS_21660 5206 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence204 1183 122 gene locus_tag LOCUS_21670 gene leuB 1183 122 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_21670 3022 1424 gene locus_tag LOCUS_21680 3022 1424 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_21680 3615 3025 gene locus_tag LOCUS_21690 gene leuD 3615 3025 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_21690 5121 3727 gene locus_tag LOCUS_21700 gene leuC 5121 3727 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_21700 <5746 5158 gene locus_tag LOCUS_21710 <5746 5158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763196.1:2-isopropylmalate synthase >Feature sequence205 <1 999 gene locus_tag LOCUS_21720 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964247.1:DNA cytosine methyltransferase 1001 3097 gene locus_tag LOCUS_21730 1001 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3137 5230 gene locus_tag LOCUS_21740 3137 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5548 5246 gene locus_tag LOCUS_21750 5548 5246 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence206 119 1684 gene locus_tag LOCUS_21760 119 1684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_21760 1871 4195 gene locus_tag LOCUS_21770 1871 4195 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_21770 4250 4843 gene locus_tag LOCUS_21780 4250 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 5605 4847 gene locus_tag LOCUS_21790 5605 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence207 3075 7 gene locus_tag LOCUS_21800 3075 7 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109155.1 protein_id gnl|my_center|LOCUS_21800 3559 3843 gene locus_tag LOCUS_21810 3559 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3921 5366 gene locus_tag LOCUS_21820 3921 5366 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence208 1397 987 gene locus_tag LOCUS_21830 1397 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 4819 1505 gene locus_tag LOCUS_21840 4819 1505 CDS product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107983.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence209 265 1122 gene locus_tag LOCUS_21850 265 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1119 4253 gene locus_tag LOCUS_21860 1119 4253 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922218.1 protein_id gnl|my_center|LOCUS_21860 4264 4548 gene locus_tag LOCUS_21870 4264 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence210 560 1414 gene locus_tag LOCUS_21880 560 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1570 1932 gene locus_tag LOCUS_21890 1570 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1997 2743 gene locus_tag LOCUS_21900 1997 2743 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_21900 2861 4174 gene locus_tag LOCUS_21910 2861 4174 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_21910 5183 4287 gene locus_tag LOCUS_21920 5183 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence211 62 1069 gene locus_tag LOCUS_21930 62 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1071 2078 gene locus_tag LOCUS_21940 1071 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2465 3100 gene locus_tag LOCUS_21950 2465 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3787 5331 gene locus_tag LOCUS_21960 3787 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence212 957 34 gene locus_tag LOCUS_21970 957 34 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_21970 1980 1078 gene locus_tag LOCUS_21980 1980 1078 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_21980 3214 2135 gene locus_tag LOCUS_21990 3214 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_21990 4167 3298 gene locus_tag LOCUS_22000 4167 3298 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_22000 5297 4302 gene locus_tag LOCUS_22010 5297 4302 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence213 2744 66 gene locus_tag LOCUS_22020 2744 66 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_22020 3014 3784 gene locus_tag LOCUS_22030 3014 3784 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_22030 5167 3893 gene locus_tag LOCUS_22040 5167 3893 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence214 656 2671 gene locus_tag LOCUS_22050 656 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3634 2744 gene locus_tag LOCUS_22060 3634 2744 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_22060 3718 4293 gene locus_tag LOCUS_22070 3718 4293 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_22070 4332 5000 gene locus_tag LOCUS_22080 4332 5000 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence215 1829 120 gene locus_tag LOCUS_22090 1829 120 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_22090 2172 4472 gene locus_tag LOCUS_22100 gene rnr 2172 4472 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_22100 5108 4539 gene locus_tag LOCUS_22110 5108 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence216 772 161 gene locus_tag LOCUS_22120 772 161 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_22120 1520 897 gene locus_tag LOCUS_22130 1520 897 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_22130 2917 1736 gene locus_tag LOCUS_22140 2917 1736 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_22140 3183 2950 gene locus_tag LOCUS_22150 3183 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4837 3539 gene locus_tag LOCUS_22160 4837 3539 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence217 415 1305 gene locus_tag LOCUS_22170 415 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3643 1388 gene locus_tag LOCUS_22180 3643 1388 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_22180 4957 3734 gene locus_tag LOCUS_22190 gene pepT 4957 3734 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_22190 5121 5047 gene locus_tag LOCUS_t00360 5121 5047 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence218 436 59 gene locus_tag LOCUS_22200 436 59 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_22200 540 986 gene locus_tag LOCUS_22210 540 986 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_22210 1913 1062 gene locus_tag LOCUS_22220 1913 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_22220 2798 2061 gene locus_tag LOCUS_22230 gene rsmI 2798 2061 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_22230 2993 3475 gene locus_tag LOCUS_22240 2993 3475 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_22240 3573 4781 gene locus_tag LOCUS_22250 3573 4781 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_22250 4848 4921 gene locus_tag LOCUS_t00370 4848 4921 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence219 274 1290 gene locus_tag LOCUS_22260 274 1290 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_22260 3763 1637 gene locus_tag LOCUS_22270 3763 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3925 5022 gene locus_tag LOCUS_22280 3925 5022 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence220 190 1446 gene locus_tag LOCUS_22290 190 1446 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_22290 1572 2039 gene locus_tag LOCUS_22300 1572 2039 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_22300 2179 2988 gene locus_tag LOCUS_22310 gene djlA 2179 2988 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_22310 3895 3068 gene locus_tag LOCUS_22320 3895 3068 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_22320 4734 3928 gene locus_tag LOCUS_22330 4734 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence221 47 1303 gene locus_tag LOCUS_22340 47 1303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_22340 2206 1361 gene locus_tag LOCUS_22350 2206 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4556 3546 gene locus_tag LOCUS_22360 4556 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence222 148 1527 gene locus_tag LOCUS_22370 148 1527 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_22370 1653 4475 gene locus_tag LOCUS_22380 1653 4475 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence223 76 735 gene locus_tag LOCUS_22390 gene upp 76 735 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_22390 2679 1120 gene locus_tag LOCUS_22400 2679 1120 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_22400 3001 4662 gene locus_tag LOCUS_22410 3001 4662 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence224 76 2 gene locus_tag LOCUS_t00380 76 2 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 174 101 gene locus_tag LOCUS_t00390 174 101 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1972 260 gene locus_tag LOCUS_22420 1972 260 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789610.1 protein_id gnl|my_center|LOCUS_22420 2151 3659 gene locus_tag LOCUS_22430 2151 3659 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_22430 3682 4170 gene locus_tag LOCUS_22440 3682 4170 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_22440 4184 4795 gene locus_tag LOCUS_22450 gene recR 4184 4795 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence225 3155 51 gene locus_tag LOCUS_22460 3155 51 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_22460 4671 3325 gene locus_tag LOCUS_22470 4671 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence226 1369 782 gene locus_tag LOCUS_22480 gene rfbC 1369 782 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_22480 2284 1376 gene locus_tag LOCUS_22490 gene rfbA 2284 1376 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence227 91 3135 gene locus_tag LOCUS_22500 91 3135 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence228 61 2421 gene locus_tag LOCUS_22510 61 2421 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_22510 2464 3066 gene locus_tag LOCUS_22520 gene pnuC 2464 3066 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_22520 4622 3204 gene locus_tag LOCUS_22530 gene dnaA 4622 3204 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence229 1896 262 gene locus_tag LOCUS_22540 1896 262 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_22540 2105 3325 gene locus_tag LOCUS_22550 2105 3325 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797457.1 protein_id gnl|my_center|LOCUS_22550 4298 3432 gene locus_tag LOCUS_22560 4298 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence230 125 1357 gene locus_tag LOCUS_22570 125 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2741 1494 gene locus_tag LOCUS_22580 2741 1494 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_22580 2974 4323 gene locus_tag LOCUS_22590 gene rmuC 2974 4323 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence231 607 3531 gene locus_tag LOCUS_22600 607 3531 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_22600 3561 4547 gene locus_tag LOCUS_22610 3561 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence232 1682 522 gene locus_tag LOCUS_22620 gene pseC 1682 522 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_22620 2722 1700 gene locus_tag LOCUS_22630 gene pseB 2722 1700 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_22630 4008 2893 gene locus_tag LOCUS_22640 gene gmd 4008 2893 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence233 316 1380 gene locus_tag LOCUS_22650 316 1380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_22650 1480 4143 gene locus_tag LOCUS_22660 gene mutS 1480 4143 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence234 199 1158 gene locus_tag LOCUS_22670 199 1158 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_22670 1540 1193 gene locus_tag LOCUS_22680 1540 1193 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_22680 1653 4313 gene locus_tag LOCUS_22690 gene alaS 1653 4313 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence235 2980 398 gene locus_tag LOCUS_22700 2980 398 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_22700 3708 2998 gene locus_tag LOCUS_22710 3708 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4184 3705 gene locus_tag LOCUS_22720 4184 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence236 107 628 gene locus_tag LOCUS_22730 107 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761056.1 protein_id gnl|my_center|LOCUS_22730 677 1276 gene locus_tag LOCUS_22740 677 1276 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_22740 1273 1737 gene locus_tag LOCUS_22750 1273 1737 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_22750 1842 2351 gene locus_tag LOCUS_22760 1842 2351 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_22760 2893 2354 gene locus_tag LOCUS_22770 2893 2354 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_22770 4381 2918 gene locus_tag LOCUS_22780 4381 2918 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence237 1372 11 gene locus_tag LOCUS_22790 1372 11 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_22790 1573 3777 gene locus_tag LOCUS_22800 1573 3777 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence238 1168 332 gene locus_tag LOCUS_22810 1168 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1708 1717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1773 3059 gene locus_tag LOCUS_22820 1773 3059 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence239 1088 243 gene locus_tag LOCUS_22830 1088 243 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_22830 2129 1242 gene locus_tag LOCUS_22840 gene dapA 2129 1242 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_22840 2352 3092 gene locus_tag LOCUS_22850 gene truA 2352 3092 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_22850 3160 4077 gene locus_tag LOCUS_22860 3160 4077 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence240 43 2643 gene locus_tag LOCUS_22870 43 2643 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_22870 2679 4217 gene locus_tag LOCUS_22880 2679 4217 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence241 696 403 gene locus_tag LOCUS_22890 696 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1843 821 gene locus_tag LOCUS_22900 1843 821 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_22900 3262 1883 gene locus_tag LOCUS_22910 3262 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3428 4102 gene locus_tag LOCUS_22920 3428 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence242 207 281 gene locus_tag LOCUS_t00400 207 281 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 374 1249 gene locus_tag LOCUS_22930 374 1249 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_22930 2706 1351 gene locus_tag LOCUS_22940 2706 1351 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_22940 4145 2781 gene locus_tag LOCUS_22950 4145 2781 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence243 676 1998 gene locus_tag LOCUS_22960 676 1998 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_22960 2317 3759 gene locus_tag LOCUS_22970 2317 3759 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence244 50 2320 gene locus_tag LOCUS_22980 50 2320 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_22980 2323 3669 gene locus_tag LOCUS_22990 2323 3669 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence245 288 28 gene locus_tag LOCUS_23000 288 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2379 340 gene locus_tag LOCUS_23010 2379 340 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_23010 2706 2380 gene locus_tag LOCUS_23020 2706 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3603 2722 gene locus_tag LOCUS_23030 3603 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4066 3761 gene locus_tag LOCUS_23040 4066 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence246 733 62 gene locus_tag LOCUS_23050 733 62 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_23050 1279 821 gene locus_tag LOCUS_23060 1279 821 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_23060 1640 2851 gene locus_tag LOCUS_23070 1640 2851 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence247 695 42 gene locus_tag LOCUS_23080 695 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2039 699 gene locus_tag LOCUS_23090 2039 699 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_23090 <4119 2162 gene locus_tag LOCUS_23100 <4119 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291482.1:conjugal transfer protein MobC >Feature sequence248 221 1486 gene locus_tag LOCUS_23110 221 1486 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_23110 1486 1923 gene locus_tag LOCUS_23120 1486 1923 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_23120 1916 2458 gene locus_tag LOCUS_23130 1916 2458 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence249 1611 55 gene locus_tag LOCUS_23140 1611 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3232 1796 gene locus_tag LOCUS_23150 3232 1796 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_23150 3858 3274 gene locus_tag LOCUS_23160 3858 3274 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence250 198 2729 gene locus_tag LOCUS_23170 198 2729 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_23170 2757 3884 gene locus_tag LOCUS_23180 2757 3884 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence251 150 752 gene locus_tag LOCUS_23190 150 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2467 749 gene locus_tag LOCUS_23200 2467 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence252 753 244 gene locus_tag LOCUS_23210 753 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1982 750 gene locus_tag LOCUS_23220 1982 750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_23220 2398 3021 gene locus_tag LOCUS_23230 2398 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence253 <1 735 gene locus_tag LOCUS_23240 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172461640.1:tetratricopeptide repeat protein 798 3398 gene locus_tag LOCUS_23250 798 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence254 1119 454 gene locus_tag LOCUS_23260 1119 454 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_23260 2717 1413 gene locus_tag LOCUS_23270 2717 1413 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_23270 2836 3771 gene locus_tag LOCUS_23280 2836 3771 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence255 1694 123 gene locus_tag LOCUS_23290 1694 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2660 1719 gene locus_tag LOCUS_23300 2660 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3617 2715 gene locus_tag LOCUS_23310 3617 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence256 1037 357 gene locus_tag LOCUS_23320 1037 357 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_23320 1714 1040 gene locus_tag LOCUS_23330 1714 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2437 1886 gene locus_tag LOCUS_23340 2437 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23340 2510 2519 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3322 2702 gene locus_tag LOCUS_23350 3322 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence257 65 727 gene locus_tag LOCUS_23360 65 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 785 1600 gene locus_tag LOCUS_23370 785 1600 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_23370 1713 2333 gene locus_tag LOCUS_23380 1713 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794225.1 protein_id gnl|my_center|LOCUS_23380 3590 2361 gene locus_tag LOCUS_23390 3590 2361 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence258 771 683 gene locus_tag LOCUS_t00410 771 683 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3619 1082 gene locus_tag LOCUS_23400 3619 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence259 96 1019 gene locus_tag LOCUS_23410 96 1019 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_23410 1733 1092 gene locus_tag LOCUS_23420 1733 1092 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_23420 <3718 1994 gene locus_tag LOCUS_23430 <3718 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798520.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence260 <1 569 gene locus_tag LOCUS_23440 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790695.1:porin family protein 3630 727 gene locus_tag LOCUS_23450 3630 727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence261 373 5 gene locus_tag LOCUS_23460 373 5 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788387.1 protein_id gnl|my_center|LOCUS_23460 653 1171 gene locus_tag LOCUS_23470 653 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1323 3119 gene locus_tag LOCUS_23480 1323 3119 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_23480 3552 3184 gene locus_tag LOCUS_23490 3552 3184 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784727.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence262 70 969 gene locus_tag LOCUS_23500 70 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1012 2019 gene locus_tag LOCUS_23510 1012 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2032 3576 gene locus_tag LOCUS_23520 2032 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence263 84 1526 gene locus_tag LOCUS_23530 84 1526 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_23530 1539 3566 gene locus_tag LOCUS_23540 1539 3566 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence264 137 1411 gene locus_tag LOCUS_23550 137 1411 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_23550 1559 3532 gene locus_tag LOCUS_23560 1559 3532 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence265 24 905 gene locus_tag LOCUS_23570 24 905 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_23570 3279 862 gene locus_tag LOCUS_23580 3279 862 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792029.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence266 357 2489 gene locus_tag LOCUS_23590 357 2489 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_23590 <3616 2667 gene locus_tag LOCUS_23600 <3616 2667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107573.1:family 78 glycoside hydrolase catalytic domain note possible pseudo, frameshifted >Feature sequence267 303 2369 gene locus_tag LOCUS_23610 gene metG 303 2369 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_23610 3142 2462 gene locus_tag LOCUS_23620 3142 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence268 229 1275 gene locus_tag LOCUS_23630 gene aroB 229 1275 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_23630 2328 1315 gene locus_tag LOCUS_23640 2328 1315 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_23640 3573 2449 gene locus_tag LOCUS_23650 3573 2449 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence269 267 731 gene locus_tag LOCUS_23660 267 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1174 794 gene locus_tag LOCUS_23670 1174 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1704 1228 gene locus_tag LOCUS_23680 gene ribH 1704 1228 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_23680 2442 1747 gene locus_tag LOCUS_23690 2442 1747 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence270 1571 543 gene locus_tag LOCUS_23700 1571 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2392 1844 gene locus_tag LOCUS_23710 2392 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 <3510 2497 gene locus_tag LOCUS_23720 <3510 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109025.1:DNA primase >Feature sequence271 221 832 gene locus_tag LOCUS_23730 221 832 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_23730 838 1485 gene locus_tag LOCUS_23740 gene nth 838 1485 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_23740 2713 1589 gene locus_tag LOCUS_23750 gene aroC 2713 1589 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_23750 3449 2841 gene locus_tag LOCUS_23760 3449 2841 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence272 186 413 gene locus_tag LOCUS_23770 186 413 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_23770 489 2027 gene locus_tag LOCUS_23780 489 2027 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_23780 2181 3272 gene locus_tag LOCUS_23790 gene cydB 2181 3272 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence273 >Feature sequence274 777 121 gene locus_tag LOCUS_23800 777 121 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817347.1 protein_id gnl|my_center|LOCUS_23800 1092 3257 gene locus_tag LOCUS_23810 1092 3257 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence275 31 1746 gene locus_tag LOCUS_23820 gene ilvB 31 1746 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_23820 1783 2331 gene locus_tag LOCUS_23830 gene ilvN 1783 2331 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence276 922 80 gene locus_tag LOCUS_23840 922 80 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_23840 1665 919 gene locus_tag LOCUS_23850 1665 919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_23850 3231 1840 gene locus_tag LOCUS_23860 3231 1840 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence277 669 67 gene locus_tag LOCUS_23870 669 67 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_23870 1845 688 gene locus_tag LOCUS_23880 1845 688 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_23880 3241 1886 gene locus_tag LOCUS_23890 3241 1886 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence278 1555 110 gene locus_tag LOCUS_23900 1555 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1921 1646 gene locus_tag LOCUS_23910 1921 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3153 2116 gene locus_tag LOCUS_23920 gene galE 3153 2116 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence279 833 159 gene locus_tag LOCUS_23930 833 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2285 927 gene locus_tag LOCUS_23940 2285 927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_23940 3140 2373 gene locus_tag LOCUS_23950 3140 2373 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence280 2 2992 gene locus_tag LOCUS_23960 2 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence281 2004 883 gene locus_tag LOCUS_23970 2004 883 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_23970 2989 2237 gene locus_tag LOCUS_23980 2989 2237 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence282 23 1237 gene locus_tag LOCUS_23990 23 1237 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_23990 1371 2834 gene locus_tag LOCUS_24000 1371 2834 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence283 1730 174 gene locus_tag LOCUS_24010 1730 174 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_24010 2860 1874 gene locus_tag LOCUS_24020 2860 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence284 338 1291 gene locus_tag LOCUS_24030 338 1291 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_24030 2333 1359 gene locus_tag LOCUS_24040 2333 1359 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence285 45 1178 gene locus_tag LOCUS_24050 45 1178 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_24050 2776 1361 gene locus_tag LOCUS_24060 2776 1361 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence286 242 1891 gene locus_tag LOCUS_24070 242 1891 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence287 >Feature sequence288 <1 1523 gene locus_tag LOCUS_24080 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791488.1:aspartate ammonia-lyase 2495 1641 gene locus_tag LOCUS_24090 2495 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2827 2753 gene locus_tag LOCUS_t00420 2827 2753 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence289 52 855 gene locus_tag LOCUS_24100 52 855 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_24100 2447 1164 gene locus_tag LOCUS_24110 2447 1164 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence290 211 2706 gene locus_tag LOCUS_24120 211 2706 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence291 570 579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 586 801 gene locus_tag LOCUS_24130 586 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2553 979 gene locus_tag LOCUS_24140 gene guaA 2553 979 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence292 1833 268 gene locus_tag LOCUS_24150 1833 268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_24150 <2795 1918 gene locus_tag LOCUS_24160 <2795 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461645.1:Rpn family recombination-promoting nuclease/putative transposase >Feature sequence293 2525 1635 gene locus_tag LOCUS_24170 2525 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence294 >Feature sequence295 113 1081 gene locus_tag LOCUS_24180 113 1081 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_24180 1088 1330 gene locus_tag LOCUS_24190 1088 1330 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_24190 1320 2075 gene locus_tag LOCUS_24200 1320 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2449 2105 gene locus_tag LOCUS_24210 2449 2105 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence296 1960 749 gene locus_tag LOCUS_24220 gene fucP 1960 749 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence297 182 1471 gene locus_tag LOCUS_24230 182 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2189 1491 gene locus_tag LOCUS_24240 2189 1491 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763963.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence298 594 85 gene locus_tag LOCUS_24250 594 85 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_24250 1501 773 gene locus_tag LOCUS_24260 1501 773 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_24260 2066 1515 gene locus_tag LOCUS_24270 2066 1515 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791762.1 protein_id gnl|my_center|LOCUS_24270 2537 2076 gene locus_tag LOCUS_24280 gene bcp 2537 2076 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence299 1973 1452 gene locus_tag LOCUS_24290 1973 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 <2535 1983 gene locus_tag LOCUS_24300 <2535 1983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_122014502.1:tyrosine-type recombinase/integrase >Feature sequence300 2148 952 gene locus_tag LOCUS_24310 gene fucP 2148 952 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_24310