>Feature sequence001 382 510 gene locus_tag LOCUS_00010 382 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 667 921 gene locus_tag LOCUS_00020 667 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 922 1182 gene locus_tag LOCUS_00030 922 1182 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 protein_id gnl|my_center|LOCUS_00030 1520 2314 gene locus_tag LOCUS_00040 1520 2314 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_00040 2710 7200 gene locus_tag LOCUS_00050 2710 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7148 7390 gene locus_tag LOCUS_00060 7148 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7419 7724 gene locus_tag LOCUS_00070 7419 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7717 8019 gene locus_tag LOCUS_00080 7717 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8000 8311 gene locus_tag LOCUS_00090 8000 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8331 8630 gene locus_tag LOCUS_00100 8331 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8648 8968 gene locus_tag LOCUS_00110 8648 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8992 10353 gene locus_tag LOCUS_00120 8992 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10395 11081 gene locus_tag LOCUS_00130 10395 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12042 11065 gene locus_tag LOCUS_00140 12042 11065 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_00140 12202 13983 gene locus_tag LOCUS_00150 12202 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14094 15197 gene locus_tag LOCUS_00160 14094 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15223 15615 gene locus_tag LOCUS_00170 15223 15615 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_00170 15667 16059 gene locus_tag LOCUS_00180 15667 16059 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_00180 16052 16450 gene locus_tag LOCUS_00190 16052 16450 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_00190 19857 16546 gene locus_tag LOCUS_00200 19857 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22396 19850 gene locus_tag LOCUS_00210 22396 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22502 23737 gene locus_tag LOCUS_00220 22502 23737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23758 24687 gene locus_tag LOCUS_00230 23758 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24711 25625 gene locus_tag LOCUS_00240 24711 25625 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_00240 25729 25813 gene locus_tag LOCUS_t00010 25729 25813 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25852 26016 gene locus_tag LOCUS_00250 25852 26016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26064 26333 gene locus_tag LOCUS_00260 26064 26333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26340 27251 gene locus_tag LOCUS_00270 26340 27251 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_00270 27341 27580 gene locus_tag LOCUS_00280 27341 27580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27715 28353 gene locus_tag LOCUS_00290 27715 28353 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860815.1 protein_id gnl|my_center|LOCUS_00290 28417 29148 gene locus_tag LOCUS_00300 28417 29148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29521 30432 gene locus_tag LOCUS_00310 29521 30432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964063.1 protein_id gnl|my_center|LOCUS_00310 30534 31304 gene locus_tag LOCUS_00320 30534 31304 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459462.1 protein_id gnl|my_center|LOCUS_00320 32489 31392 gene locus_tag LOCUS_00330 gene hisC 32489 31392 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_00330 33299 32583 gene locus_tag LOCUS_00340 33299 32583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33519 35003 gene locus_tag LOCUS_00350 33519 35003 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462118.1 protein_id gnl|my_center|LOCUS_00350 35163 35891 gene locus_tag LOCUS_00360 35163 35891 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_00360 35909 36271 gene locus_tag LOCUS_00370 35909 36271 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_00370 36821 36312 gene locus_tag LOCUS_00380 36821 36312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39292 37316 gene locus_tag LOCUS_00390 39292 37316 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_00390 39579 40805 gene locus_tag LOCUS_00400 39579 40805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_00400 41549 40842 gene locus_tag LOCUS_00410 41549 40842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42903 41566 gene locus_tag LOCUS_00420 42903 41566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_00420 42976 43902 gene locus_tag LOCUS_00430 42976 43902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_00430 43971 44975 gene locus_tag LOCUS_00440 43971 44975 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_00440 45021 46799 gene locus_tag LOCUS_00450 gene dnaG 45021 46799 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_00450 46838 47950 gene locus_tag LOCUS_00460 gene rpoD 46838 47950 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_00460 48005 48736 gene locus_tag LOCUS_00470 48005 48736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48756 50402 gene locus_tag LOCUS_00480 48756 50402 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_00480 50815 51513 gene locus_tag LOCUS_00490 50815 51513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51840 51577 gene locus_tag LOCUS_00500 gene rpsT 51840 51577 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_00500 52065 52976 gene locus_tag LOCUS_00510 gene gpr 52065 52976 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662617.1 protein_id gnl|my_center|LOCUS_00510 53020 54342 gene locus_tag LOCUS_00520 53020 54342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54404 56218 gene locus_tag LOCUS_00530 gene lepA 54404 56218 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_00530 56208 57383 gene locus_tag LOCUS_00540 gene hemW 56208 57383 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_00540 57497 58138 gene locus_tag LOCUS_00550 gene sigK 57497 58138 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_00550 58125 59180 gene locus_tag LOCUS_00560 58125 59180 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_00560 59505 61058 gene locus_tag LOCUS_00570 59505 61058 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_00570 61075 62277 gene locus_tag LOCUS_00580 61075 62277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 62339 64045 gene locus_tag LOCUS_00590 62339 64045 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_00590 64075 65283 gene locus_tag LOCUS_00600 64075 65283 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00600 65325 65495 gene locus_tag LOCUS_00610 65325 65495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65851 66855 gene locus_tag LOCUS_00620 65851 66855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67010 67462 gene locus_tag LOCUS_00630 67010 67462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67527 68219 gene locus_tag LOCUS_00640 67527 68219 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_00640 68324 69937 gene locus_tag LOCUS_00650 68324 69937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 69934 71085 gene locus_tag LOCUS_00660 69934 71085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71110 72435 gene locus_tag LOCUS_00670 71110 72435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72465 75020 gene locus_tag LOCUS_00680 72465 75020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 75043 75534 gene locus_tag LOCUS_00690 75043 75534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75544 76377 gene locus_tag LOCUS_00700 75544 76377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76391 79507 gene locus_tag LOCUS_00710 76391 79507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 79731 81809 gene locus_tag LOCUS_00720 gene topA 79731 81809 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_00720 81970 82755 gene locus_tag LOCUS_00730 gene codY 81970 82755 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_00730 82928 83317 gene locus_tag LOCUS_00740 gene flgB 82928 83317 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_00740 83381 83827 gene locus_tag LOCUS_00750 gene flgC 83381 83827 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_00750 83860 84189 gene locus_tag LOCUS_00760 83860 84189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 84210 85811 gene locus_tag LOCUS_00770 gene fliF 84210 85811 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918789.1 protein_id gnl|my_center|LOCUS_00770 85816 86832 gene locus_tag LOCUS_00780 gene fliG 85816 86832 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_00780 86825 87670 gene locus_tag LOCUS_00790 86825 87670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87685 89007 gene locus_tag LOCUS_00800 gene fliI 87685 89007 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_00800 89013 89468 gene locus_tag LOCUS_00810 89013 89468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 89472 90353 gene locus_tag LOCUS_00820 89472 90353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 90435 91826 gene locus_tag LOCUS_00830 90435 91826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 91853 92575 gene locus_tag LOCUS_00840 91853 92575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 92611 93006 gene locus_tag LOCUS_00850 92611 93006 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_00850 93089 94444 gene locus_tag LOCUS_00860 gene flgE 93089 94444 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986372.1 protein_id gnl|my_center|LOCUS_00860 94560 94745 gene locus_tag LOCUS_00870 94560 94745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94766 95563 gene locus_tag LOCUS_00880 94766 95563 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345490.1 protein_id gnl|my_center|LOCUS_00880 95556 96362 gene locus_tag LOCUS_00890 gene motB 95556 96362 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 protein_id gnl|my_center|LOCUS_00890 96383 96895 gene locus_tag LOCUS_00900 96383 96895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 96941 97921 gene locus_tag LOCUS_00910 gene fliM 96941 97921 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_00910 97928 99259 gene locus_tag LOCUS_00920 gene fliY 97928 99259 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460753.1 protein_id gnl|my_center|LOCUS_00920 99280 99642 gene locus_tag LOCUS_00930 99280 99642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_00930 99644 100012 gene locus_tag LOCUS_00940 99644 100012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100016 100894 gene locus_tag LOCUS_00950 100016 100894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 100912 101181 gene locus_tag LOCUS_00960 gene fliQ 100912 101181 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_00960 101185 101967 gene locus_tag LOCUS_00970 gene fliR 101185 101967 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_00970 101980 103092 gene locus_tag LOCUS_00980 gene flhB 101980 103092 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_00980 103115 105148 gene locus_tag LOCUS_00990 gene flhA 103115 105148 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_00990 105145 106377 gene locus_tag LOCUS_01000 gene flhF 105145 106377 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_01000 106417 107313 gene locus_tag LOCUS_01010 106417 107313 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986948.1 protein_id gnl|my_center|LOCUS_01010 107313 108041 gene locus_tag LOCUS_01020 107313 108041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 108113 108715 gene locus_tag LOCUS_01030 108113 108715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 108717 110789 gene locus_tag LOCUS_01040 108717 110789 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_01040 110808 111275 gene locus_tag LOCUS_01050 110808 111275 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795285.1 protein_id gnl|my_center|LOCUS_01050 111300 111935 gene locus_tag LOCUS_01060 111300 111935 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_01060 111957 112442 gene locus_tag LOCUS_01070 111957 112442 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_01070 112439 112714 gene locus_tag LOCUS_01080 112439 112714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 112750 113514 gene locus_tag LOCUS_01090 gene whiG 112750 113514 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_01090 113576 115177 gene locus_tag LOCUS_01100 113576 115177 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535110.1 protein_id gnl|my_center|LOCUS_01100 115196 115507 gene locus_tag LOCUS_01110 115196 115507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 115524 116369 gene locus_tag LOCUS_01120 115524 116369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 116392 117006 gene locus_tag LOCUS_01130 116392 117006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117205 117969 gene locus_tag LOCUS_01140 gene rpsB 117205 117969 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_01140 118001 118939 gene locus_tag LOCUS_01150 gene tsf 118001 118939 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_01150 119059 119976 gene locus_tag LOCUS_01160 119059 119976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_01160 119989 121035 gene locus_tag LOCUS_01170 119989 121035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_01170 121053 122054 gene locus_tag LOCUS_01180 121053 122054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_01180 122047 123036 gene locus_tag LOCUS_01190 122047 123036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_01190 123084 124772 gene locus_tag LOCUS_01200 123084 124772 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_01200 124896 125834 gene locus_tag LOCUS_01210 124896 125834 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987059.1 protein_id gnl|my_center|LOCUS_01210 125885 126646 gene locus_tag LOCUS_01220 125885 126646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 126659 127354 gene locus_tag LOCUS_01230 gene pyrH 126659 127354 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_01230 127369 127917 gene locus_tag LOCUS_01240 gene frr 127369 127917 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_01240 127998 128723 gene locus_tag LOCUS_01250 127998 128723 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_01250 128727 129551 gene locus_tag LOCUS_01260 128727 129551 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_01260 129598 130755 gene locus_tag LOCUS_01270 129598 130755 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_01270 130762 131820 gene locus_tag LOCUS_01280 gene rseP 130762 131820 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_01280 132016 132759 gene locus_tag LOCUS_01290 132016 132759 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_01290 132740 134113 gene locus_tag LOCUS_01300 132740 134113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 134162 135220 gene locus_tag LOCUS_01310 gene ispG 134162 135220 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_01310 135238 139806 gene locus_tag LOCUS_01320 gene polC 135238 139806 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_01320 139848 140402 gene locus_tag LOCUS_01330 139848 140402 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_01330 141340 140453 gene locus_tag LOCUS_01340 141340 140453 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_01340 141584 141512 gene locus_tag LOCUS_t00020 141584 141512 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 143384 141705 gene locus_tag LOCUS_01350 143384 141705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 145033 143393 gene locus_tag LOCUS_01360 145033 143393 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_01360 145389 146246 gene locus_tag LOCUS_01370 145389 146246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence002 <1 689 gene locus_tag LOCUS_01380 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256783.1:substrate-binding domain-containing protein 1057 695 gene locus_tag LOCUS_01390 gene rsfS 1057 695 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_01390 1656 1084 gene locus_tag LOCUS_01400 gene yqeK 1656 1084 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_01400 2304 1690 gene locus_tag LOCUS_01410 gene nadD 2304 1690 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416411.1 protein_id gnl|my_center|LOCUS_01410 2622 2332 gene locus_tag LOCUS_01420 gene yhbY 2622 2332 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_01420 3932 2637 gene locus_tag LOCUS_01430 gene obgE 3932 2637 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_01430 4280 3996 gene locus_tag LOCUS_01440 gene rpmA 4280 3996 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_01440 4610 4284 gene locus_tag LOCUS_01450 4610 4284 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_01450 4918 4613 gene locus_tag LOCUS_01460 gene rplU 4918 4613 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_01460 6127 5045 gene locus_tag LOCUS_01470 6127 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6909 6232 gene locus_tag LOCUS_01480 6909 6232 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_01480 8815 6893 gene locus_tag LOCUS_01490 8815 6893 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_01490 9271 8870 gene locus_tag LOCUS_01500 9271 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 9716 9357 gene locus_tag LOCUS_01510 gene hisI 9716 9357 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_01510 10305 9718 gene locus_tag LOCUS_01520 gene hisB 10305 9718 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_01520 11615 10320 gene locus_tag LOCUS_01530 gene hisD 11615 10320 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_01530 12336 11686 gene locus_tag LOCUS_01540 gene hisG 12336 11686 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_01540 13471 12338 gene locus_tag LOCUS_01550 13471 12338 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_01550 14151 13612 gene locus_tag LOCUS_01560 gene recU 14151 13612 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_01560 15151 14123 gene locus_tag LOCUS_01570 15151 14123 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_01570 15732 15163 gene locus_tag LOCUS_01580 15732 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16392 15745 gene locus_tag LOCUS_01590 16392 15745 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_01590 17114 16377 gene locus_tag LOCUS_01600 17114 16377 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016603.1 protein_id gnl|my_center|LOCUS_01600 17333 18091 gene locus_tag LOCUS_01610 17333 18091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 19226 18039 gene locus_tag LOCUS_01620 19226 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19928 19317 gene locus_tag LOCUS_01630 19928 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 20435 19941 gene locus_tag LOCUS_01640 gene coaD 20435 19941 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_01640 20986 20432 gene locus_tag LOCUS_01650 gene rsmD 20986 20432 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_01650 23238 20998 gene locus_tag LOCUS_01660 gene gyrA 23238 20998 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_01660 25180 23258 gene locus_tag LOCUS_01670 gene gyrB 25180 23258 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_01670 26068 25202 gene locus_tag LOCUS_01680 26068 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 28203 26146 gene locus_tag LOCUS_01690 gene recG 28203 26146 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_01690 29928 28276 gene locus_tag LOCUS_01700 29928 28276 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_01700 30303 29944 gene locus_tag LOCUS_01710 30303 29944 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_01710 30486 30671 gene locus_tag LOCUS_01720 gene rpmB 30486 30671 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_01720 31292 30720 gene locus_tag LOCUS_01730 31292 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 31472 31332 gene locus_tag LOCUS_01740 31472 31332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 31949 31551 gene locus_tag LOCUS_01750 31949 31551 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966538.1 protein_id gnl|my_center|LOCUS_01750 32850 31936 gene locus_tag LOCUS_01760 32850 31936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 33172 32840 gene locus_tag LOCUS_01770 33172 32840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 34659 33217 gene locus_tag LOCUS_01780 34659 33217 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_01780 36082 34640 gene locus_tag LOCUS_01790 36082 34640 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_01790 38317 36083 gene locus_tag LOCUS_01800 38317 36083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 38856 38452 gene locus_tag LOCUS_01810 38856 38452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 39897 38899 gene locus_tag LOCUS_01820 gene ruvB 39897 38899 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01820 40527 39919 gene locus_tag LOCUS_01830 gene ruvA 40527 39919 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_01830 41009 40524 gene locus_tag LOCUS_01840 41009 40524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 41420 41034 gene locus_tag LOCUS_01850 41420 41034 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_01850 41597 42382 gene locus_tag LOCUS_01860 41597 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 43745 42423 gene locus_tag LOCUS_01870 43745 42423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 44281 43793 gene locus_tag LOCUS_01880 gene leuD 44281 43793 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_01880 45570 44302 gene locus_tag LOCUS_01890 gene leuC 45570 44302 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_01890 46672 45653 gene locus_tag LOCUS_01900 gene ilvC 46672 45653 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_01900 47186 46689 gene locus_tag LOCUS_01910 gene ilvN 47186 46689 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_01910 47772 47281 gene locus_tag LOCUS_01920 gene ilvN 47772 47281 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_01920 49402 47786 gene locus_tag LOCUS_01930 49402 47786 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_01930 49878 49459 gene locus_tag LOCUS_01940 49878 49459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 52367 49887 gene locus_tag LOCUS_01950 52367 49887 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_01950 52509 53093 gene locus_tag LOCUS_01960 52509 53093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 53486 53076 gene locus_tag LOCUS_01970 53486 53076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 54117 53476 gene locus_tag LOCUS_01980 54117 53476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 54259 54717 gene locus_tag LOCUS_01990 54259 54717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 55646 54723 gene locus_tag LOCUS_02000 55646 54723 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_02000 56503 55658 gene locus_tag LOCUS_02010 56503 55658 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704703.1 protein_id gnl|my_center|LOCUS_02010 57374 56520 gene locus_tag LOCUS_02020 57374 56520 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262139.1 protein_id gnl|my_center|LOCUS_02020 59073 57346 gene locus_tag LOCUS_02030 59073 57346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_02030 59776 59198 gene locus_tag LOCUS_02040 59776 59198 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375133.1 protein_id gnl|my_center|LOCUS_02040 60879 59869 gene locus_tag LOCUS_02050 60879 59869 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_02050 61592 60900 gene locus_tag LOCUS_02060 61592 60900 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_02060 62388 61723 gene locus_tag LOCUS_02070 62388 61723 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_02070 64440 62389 gene locus_tag LOCUS_02080 64440 62389 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_02080 65801 64440 gene locus_tag LOCUS_02090 65801 64440 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_02090 67542 65821 gene locus_tag LOCUS_02100 67542 65821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 68668 67583 gene locus_tag LOCUS_02110 gene asd 68668 67583 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_02110 70067 68688 gene locus_tag LOCUS_02120 gene argH 70067 68688 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_02120 70242 71012 gene locus_tag LOCUS_02130 70242 71012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_02130 70990 71814 gene locus_tag LOCUS_02140 70990 71814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963937.1 protein_id gnl|my_center|LOCUS_02140 71902 71828 gene locus_tag LOCUS_t00030 71902 71828 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 72813 71953 gene locus_tag LOCUS_02150 gene mscS 72813 71953 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_02150 75234 72814 gene locus_tag LOCUS_02160 gene glgB 75234 72814 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_02160 75377 75673 gene locus_tag LOCUS_02170 75377 75673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 76954 75791 gene locus_tag LOCUS_02180 76954 75791 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_02180 78052 76961 gene locus_tag LOCUS_02190 gene serC 78052 76961 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02190 79561 78158 gene locus_tag LOCUS_02200 79561 78158 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_02200 81234 79561 gene locus_tag LOCUS_02210 gene ilvB 81234 79561 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_02210 82930 81260 gene locus_tag LOCUS_02220 gene ilvD 82930 81260 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_02220 84591 82927 gene locus_tag LOCUS_02230 84591 82927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 85663 84575 gene locus_tag LOCUS_02240 gene leuB 85663 84575 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_02240 86065 85742 gene locus_tag LOCUS_02250 86065 85742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 87320 86175 gene locus_tag LOCUS_02260 gene tgt 87320 86175 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_02260 88381 87329 gene locus_tag LOCUS_02270 88381 87329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 88605 89705 gene locus_tag LOCUS_02280 gene aroC 88605 89705 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_02280 90819 89743 gene locus_tag LOCUS_02290 90819 89743 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468109.1 protein_id gnl|my_center|LOCUS_02290 91074 91613 gene locus_tag LOCUS_02300 91074 91613 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_02300 91641 92717 gene locus_tag LOCUS_02310 91641 92717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_02310 92710 93531 gene locus_tag LOCUS_02320 92710 93531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_02320 93528 94307 gene locus_tag LOCUS_02330 93528 94307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_02330 94345 95403 gene locus_tag LOCUS_02340 94345 95403 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_02340 96693 95449 gene locus_tag LOCUS_02350 96693 95449 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02350 97306 96710 gene locus_tag LOCUS_02360 97306 96710 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_02360 98957 97263 gene locus_tag LOCUS_02370 98957 97263 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_02370 100250 99027 gene locus_tag LOCUS_02380 100250 99027 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_02380 100893 100267 gene locus_tag LOCUS_02390 100893 100267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 102578 100956 gene locus_tag LOCUS_02400 102578 100956 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_02400 103098 102595 gene locus_tag LOCUS_02410 gene ybeY 103098 102595 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_02410 104209 103082 gene locus_tag LOCUS_02420 104209 103082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 105260 104229 gene locus_tag LOCUS_02430 105260 104229 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_02430 106493 105261 gene locus_tag LOCUS_02440 gene yqfD 106493 105261 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_02440 106763 106524 gene locus_tag LOCUS_02450 106763 106524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 108168 106858 gene locus_tag LOCUS_02460 108168 106858 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_02460 108663 108184 gene locus_tag LOCUS_02470 gene rlmH 108663 108184 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_02470 109151 108660 gene locus_tag LOCUS_02480 109151 108660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 110195 109176 gene locus_tag LOCUS_02490 110195 109176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 111581 110196 gene locus_tag LOCUS_02500 gene gltA 111581 110196 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_02500 112468 111581 gene locus_tag LOCUS_02510 112468 111581 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_02510 113936 112488 gene locus_tag LOCUS_02520 113936 112488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 114815 113970 gene locus_tag LOCUS_02530 gene folD 114815 113970 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_02530 116496 114826 gene locus_tag LOCUS_02540 116496 114826 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_02540 119149 116525 gene locus_tag LOCUS_02550 119149 116525 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_02550 120078 119347 gene locus_tag LOCUS_02560 gene tepA 120078 119347 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_02560 121402 120263 gene locus_tag LOCUS_02570 121402 120263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 122096 121368 gene locus_tag LOCUS_02580 122096 121368 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_02580 122964 122098 gene locus_tag LOCUS_02590 122964 122098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 123379 123038 gene locus_tag LOCUS_02600 123379 123038 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_02600 124660 123467 gene locus_tag LOCUS_02610 gene alr 124660 123467 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_02610 126198 124657 gene locus_tag LOCUS_02620 126198 124657 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_02620 126825 126247 gene locus_tag LOCUS_02630 126825 126247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 127545 126901 gene locus_tag LOCUS_02640 127545 126901 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_02640 127683 129602 gene locus_tag LOCUS_02650 127683 129602 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_02650 130805 129597 gene locus_tag LOCUS_02660 130805 129597 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_02660 131518 130820 gene locus_tag LOCUS_02670 131518 130820 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02670 132948 131536 gene locus_tag LOCUS_02680 132948 131536 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_02680 133921 133010 gene locus_tag LOCUS_02690 133921 133010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 136738 133988 gene locus_tag LOCUS_02700 136738 133988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence003 <1 692 gene locus_tag LOCUS_02710 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 786 1955 gene locus_tag LOCUS_02720 gene dnaJ 786 1955 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_02720 2035 2703 gene locus_tag LOCUS_02730 gene nth 2035 2703 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_02730 2705 3412 gene locus_tag LOCUS_02740 2705 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4001 3378 gene locus_tag LOCUS_02750 4001 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 4179 5705 gene locus_tag LOCUS_02760 4179 5705 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_02760 5738 6769 gene locus_tag LOCUS_02770 5738 6769 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_02770 6787 7269 gene locus_tag LOCUS_02780 6787 7269 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_02780 7266 8450 gene locus_tag LOCUS_02790 7266 8450 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_02790 8469 9587 gene locus_tag LOCUS_02800 8469 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 10685 9648 gene locus_tag LOCUS_02810 10685 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 11130 12488 gene locus_tag LOCUS_02820 11130 12488 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_02820 12506 13534 gene locus_tag LOCUS_02830 12506 13534 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583991.1 protein_id gnl|my_center|LOCUS_02830 13573 14496 gene locus_tag LOCUS_02840 13573 14496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_02840 14515 16032 gene locus_tag LOCUS_02850 14515 16032 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_02850 16041 17513 gene locus_tag LOCUS_02860 16041 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 17498 18610 gene locus_tag LOCUS_02870 17498 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 18740 21163 gene locus_tag LOCUS_02880 18740 21163 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_02880 21178 21876 gene locus_tag LOCUS_02890 21178 21876 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_02890 21876 23303 gene locus_tag LOCUS_02900 21876 23303 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_02900 23303 23803 gene locus_tag LOCUS_02910 gene trmL 23303 23803 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_02910 25939 23831 gene locus_tag LOCUS_02920 25939 23831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 26847 25936 gene locus_tag LOCUS_02930 26847 25936 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_02930 26994 28433 gene locus_tag LOCUS_02940 26994 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 28439 29398 gene locus_tag LOCUS_02950 28439 29398 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_02950 29567 30592 gene locus_tag LOCUS_02960 gene ccpA 29567 30592 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_02960 30612 31973 gene locus_tag LOCUS_02970 30612 31973 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_02970 32058 32954 gene locus_tag LOCUS_02980 32058 32954 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582871.1 protein_id gnl|my_center|LOCUS_02980 32957 33784 gene locus_tag LOCUS_02990 32957 33784 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_02990 33788 36100 gene locus_tag LOCUS_03000 33788 36100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 36123 38045 gene locus_tag LOCUS_03010 36123 38045 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_03010 38157 38363 gene locus_tag LOCUS_03020 38157 38363 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_03020 39225 38431 gene locus_tag LOCUS_03030 39225 38431 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 protein_id gnl|my_center|LOCUS_03030 39346 40212 gene locus_tag LOCUS_03040 39346 40212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 41370 40207 gene locus_tag LOCUS_03050 41370 40207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 41412 41624 gene locus_tag LOCUS_03060 41412 41624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 42782 41739 gene locus_tag LOCUS_03070 42782 41739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 43516 42977 gene locus_tag LOCUS_03080 43516 42977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03080 43650 44084 gene locus_tag LOCUS_03090 43650 44084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 44086 44865 gene locus_tag LOCUS_03100 44086 44865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 44983 45528 gene locus_tag LOCUS_03110 gene spoVT 44983 45528 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_03110 46174 45566 gene locus_tag LOCUS_03120 46174 45566 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_03120 46339 48021 gene locus_tag LOCUS_03130 46339 48021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966456.1 protein_id gnl|my_center|LOCUS_03130 48106 49092 gene locus_tag LOCUS_03140 48106 49092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_03140 49082 50107 gene locus_tag LOCUS_03150 49082 50107 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_03150 50104 51051 gene locus_tag LOCUS_03160 50104 51051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_03160 51062 51964 gene locus_tag LOCUS_03170 51062 51964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_03170 51939 53138 gene locus_tag LOCUS_03180 gene sndB 51939 53138 CDS product N-acetyl-sulfur-metabolite deacetylase SndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243840.1 protein_id gnl|my_center|LOCUS_03180 54604 53156 gene locus_tag LOCUS_03190 54604 53156 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_03190 55877 54630 gene locus_tag LOCUS_03200 55877 54630 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674457.1 protein_id gnl|my_center|LOCUS_03200 56406 59561 gene locus_tag LOCUS_03210 gene ileS 56406 59561 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_03210 59745 62225 gene locus_tag LOCUS_03220 59745 62225 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_03220 62690 62505 gene locus_tag LOCUS_03230 62690 62505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 63788 62739 gene locus_tag LOCUS_03240 63788 62739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 64090 65559 gene locus_tag LOCUS_03250 gene pap 64090 65559 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_03250 65573 66844 gene locus_tag LOCUS_03260 65573 66844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 67957 66806 gene locus_tag LOCUS_03270 gene pseG 67957 66806 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_03270 68991 67939 gene locus_tag LOCUS_03280 gene pseI 68991 67939 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_03280 70242 69040 gene locus_tag LOCUS_03290 gene lysA 70242 69040 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902969.1 protein_id gnl|my_center|LOCUS_03290 70930 70229 gene locus_tag LOCUS_03300 gene pseF 70930 70229 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_03300 71043 72128 gene locus_tag LOCUS_03310 71043 72128 CDS product glycosyltransferase family 52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922741.1 protein_id gnl|my_center|LOCUS_03310 72219 73979 gene locus_tag LOCUS_03320 72219 73979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_03320 73993 75099 gene locus_tag LOCUS_03330 73993 75099 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_03330 75096 76841 gene locus_tag LOCUS_03340 75096 76841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 76875 78005 gene locus_tag LOCUS_03350 gene rffA 76875 78005 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_03350 77995 79824 gene locus_tag LOCUS_03360 77995 79824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 79821 80351 gene locus_tag LOCUS_03370 79821 80351 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102490.1 protein_id gnl|my_center|LOCUS_03370 80367 81344 gene locus_tag LOCUS_03380 80367 81344 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_03380 81341 82990 gene locus_tag LOCUS_03390 81341 82990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 83095 85614 gene locus_tag LOCUS_03400 83095 85614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 85621 87543 gene locus_tag LOCUS_03410 85621 87543 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_03410 87543 88673 gene locus_tag LOCUS_03420 87543 88673 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_03420 88690 89313 gene locus_tag LOCUS_03430 88690 89313 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_03430 89315 90277 gene locus_tag LOCUS_03440 89315 90277 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_03440 90313 91299 gene locus_tag LOCUS_03450 90313 91299 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_03450 91301 92392 gene locus_tag LOCUS_03460 91301 92392 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_03460 92397 93713 gene locus_tag LOCUS_03470 92397 93713 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_03470 93735 94709 gene locus_tag LOCUS_03480 93735 94709 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_03480 94706 95458 gene locus_tag LOCUS_03490 94706 95458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 95479 96657 gene locus_tag LOCUS_03500 95479 96657 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_03500 96629 97882 gene locus_tag LOCUS_03510 96629 97882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 98006 99103 gene locus_tag LOCUS_03520 98006 99103 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925972.1 protein_id gnl|my_center|LOCUS_03520 99125 101005 gene locus_tag LOCUS_03530 gene asnB 99125 101005 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_03530 101021 102115 gene locus_tag LOCUS_03540 101021 102115 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120712.1 protein_id gnl|my_center|LOCUS_03540 102145 104031 gene locus_tag LOCUS_03550 gene asnB 102145 104031 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_03550 104054 105019 gene locus_tag LOCUS_03560 104054 105019 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_03560 105016 105921 gene locus_tag LOCUS_03570 105016 105921 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_03570 105922 106935 gene locus_tag LOCUS_03580 105922 106935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 106998 107711 gene locus_tag LOCUS_03590 106998 107711 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061374.1 protein_id gnl|my_center|LOCUS_03590 107699 108931 gene locus_tag LOCUS_03600 107699 108931 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_03600 108948 111095 gene locus_tag LOCUS_03610 108948 111095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 112216 111092 gene locus_tag LOCUS_03620 112216 111092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 113718 112231 gene locus_tag LOCUS_03630 113718 112231 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_03630 114699 114863 gene locus_tag LOCUS_03640 114699 114863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 115784 115981 gene locus_tag LOCUS_03650 115784 115981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence004 180 1073 gene locus_tag LOCUS_03660 180 1073 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964546.1 protein_id gnl|my_center|LOCUS_03660 1136 1867 gene locus_tag LOCUS_03670 1136 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1909 3432 gene locus_tag LOCUS_03680 1909 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3465 4085 gene locus_tag LOCUS_03690 gene hisH 3465 4085 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_03690 4090 4854 gene locus_tag LOCUS_03700 gene hisF 4090 4854 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_03700 4845 5522 gene locus_tag LOCUS_03710 4845 5522 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_03710 5560 6843 gene locus_tag LOCUS_03720 5560 6843 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_03720 6931 7014 gene locus_tag LOCUS_t00040 6931 7014 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7088 7414 gene locus_tag LOCUS_03730 7088 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7433 10066 gene locus_tag LOCUS_03740 gene polA 7433 10066 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_03740 10067 10663 gene locus_tag LOCUS_03750 gene coaE 10067 10663 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310474.1 protein_id gnl|my_center|LOCUS_03750 10660 12681 gene locus_tag LOCUS_03760 10660 12681 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964331.1 protein_id gnl|my_center|LOCUS_03760 12685 13485 gene locus_tag LOCUS_03770 12685 13485 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_03770 13532 13804 gene locus_tag LOCUS_03780 13532 13804 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_03780 13818 15182 gene locus_tag LOCUS_03790 13818 15182 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_03790 15273 17627 gene locus_tag LOCUS_03800 15273 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 17628 18548 gene locus_tag LOCUS_03810 17628 18548 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_03810 18548 19504 gene locus_tag LOCUS_03820 18548 19504 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_03820 19524 21608 gene locus_tag LOCUS_03830 19524 21608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 21622 22731 gene locus_tag LOCUS_03840 21622 22731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 22744 25023 gene locus_tag LOCUS_03850 22744 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 25065 26354 gene locus_tag LOCUS_03860 25065 26354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 27640 26387 gene locus_tag LOCUS_03870 27640 26387 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_03870 27796 28797 gene locus_tag LOCUS_03880 gene pta 27796 28797 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_03880 28811 30007 gene locus_tag LOCUS_03890 gene ackA 28811 30007 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_03890 30101 30646 gene locus_tag LOCUS_03900 30101 30646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 30649 30828 gene locus_tag LOCUS_03910 gene rpmF 30649 30828 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_03910 30993 32006 gene locus_tag LOCUS_03920 gene plsX 30993 32006 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_03920 32025 32258 gene locus_tag LOCUS_03930 gene acpP 32025 32258 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_03930 32349 33035 gene locus_tag LOCUS_03940 gene rnc 32349 33035 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_03940 33040 36600 gene locus_tag LOCUS_03950 gene smc 33040 36600 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_03950 36600 37565 gene locus_tag LOCUS_03960 gene ftsY 36600 37565 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_03960 37555 38778 gene locus_tag LOCUS_03970 gene ilvA 37555 38778 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_03970 38899 39765 gene locus_tag LOCUS_03980 38899 39765 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_03980 39899 40954 gene locus_tag LOCUS_03990 39899 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 40959 41807 gene locus_tag LOCUS_04000 40959 41807 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_04000 41895 42236 gene locus_tag LOCUS_04010 41895 42236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 42239 43597 gene locus_tag LOCUS_04020 gene ffh 42239 43597 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_04020 43660 43905 gene locus_tag LOCUS_04030 gene rpsP 43660 43905 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_04030 43935 44162 gene locus_tag LOCUS_04040 43935 44162 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_04040 44222 44740 gene locus_tag LOCUS_04050 gene rimM 44222 44740 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_04050 44718 45560 gene locus_tag LOCUS_04060 gene trmD 44718 45560 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_04060 45704 46051 gene locus_tag LOCUS_04070 gene rplS 45704 46051 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_04070 46161 46742 gene locus_tag LOCUS_04080 46161 46742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 46742 47593 gene locus_tag LOCUS_04090 gene ylqF 46742 47593 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296988.1 protein_id gnl|my_center|LOCUS_04090 47590 48132 gene locus_tag LOCUS_04100 gene lepB 47590 48132 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_04100 48144 48923 gene locus_tag LOCUS_04110 48144 48923 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_04110 48932 50590 gene locus_tag LOCUS_04120 48932 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 50601 50891 gene locus_tag LOCUS_04130 50601 50891 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_04130 50900 51265 gene locus_tag LOCUS_04140 50900 51265 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_04140 51298 52173 gene locus_tag LOCUS_04150 gene pgeF 51298 52173 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_04150 52263 52955 gene locus_tag LOCUS_04160 52263 52955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_04160 52984 55566 gene locus_tag LOCUS_04170 52984 55566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 56824 55628 gene locus_tag LOCUS_04180 56824 55628 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_04180 56937 58277 gene locus_tag LOCUS_04190 56937 58277 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_04190 58295 59632 gene locus_tag LOCUS_04200 gene der 58295 59632 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_04200 59634 60290 gene locus_tag LOCUS_04210 gene plsY 59634 60290 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_04210 60323 61360 gene locus_tag LOCUS_04220 60323 61360 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_04220 61391 62338 gene locus_tag LOCUS_04230 61391 62338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 62331 62816 gene locus_tag LOCUS_04240 62331 62816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 62835 64058 gene locus_tag LOCUS_04250 gene tyrS 62835 64058 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04250 64066 64755 gene locus_tag LOCUS_04260 64066 64755 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_04260 64778 65332 gene locus_tag LOCUS_04270 64778 65332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 65471 66952 gene locus_tag LOCUS_04280 gene spoIVA 65471 66952 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_04280 67158 67979 gene locus_tag LOCUS_04290 67158 67979 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_04290 67993 68478 gene locus_tag LOCUS_04300 67993 68478 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_04300 68475 69797 gene locus_tag LOCUS_04310 68475 69797 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460449.1 protein_id gnl|my_center|LOCUS_04310 69816 71546 gene locus_tag LOCUS_04320 69816 71546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 71562 73235 gene locus_tag LOCUS_04330 71562 73235 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_04330 73266 73427 gene locus_tag LOCUS_04340 73266 73427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 73529 74704 gene locus_tag LOCUS_04350 73529 74704 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_04350 74732 76918 gene locus_tag LOCUS_04360 gene nrdD 74732 76918 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_04360 76922 77443 gene locus_tag LOCUS_04370 gene nrdG 76922 77443 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_04370 77430 77864 gene locus_tag LOCUS_04380 gene dutA 77430 77864 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_04380 77950 79398 gene locus_tag LOCUS_04390 77950 79398 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_04390 79647 81164 gene locus_tag LOCUS_04400 gene gguA 79647 81164 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_04400 81258 82214 gene locus_tag LOCUS_04410 gene rbsC 81258 82214 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_04410 82321 83325 gene locus_tag LOCUS_04420 82321 83325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242341.1 protein_id gnl|my_center|LOCUS_04420 83450 85024 gene locus_tag LOCUS_04430 83450 85024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 85039 86115 gene locus_tag LOCUS_04440 85039 86115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 86150 87652 gene locus_tag LOCUS_04450 86150 87652 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210222.1 protein_id gnl|my_center|LOCUS_04450 87664 88536 gene locus_tag LOCUS_04460 87664 88536 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 protein_id gnl|my_center|LOCUS_04460 88539 90395 gene locus_tag LOCUS_04470 88539 90395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 90417 91217 gene locus_tag LOCUS_04480 90417 91217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_04480 91704 91306 gene locus_tag LOCUS_04490 91704 91306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 93389 91749 gene locus_tag LOCUS_04500 93389 91749 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_04500 93942 93568 gene locus_tag LOCUS_04510 93942 93568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 94448 93942 gene locus_tag LOCUS_04520 94448 93942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 94699 94445 gene locus_tag LOCUS_04530 94699 94445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 95537 94968 gene locus_tag LOCUS_04540 95537 94968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 95773 95552 gene locus_tag LOCUS_04550 95773 95552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 96218 95838 gene locus_tag LOCUS_04560 96218 95838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 96355 96561 gene locus_tag LOCUS_04570 96355 96561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 96613 96777 gene locus_tag LOCUS_04580 96613 96777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 97282 96752 gene locus_tag LOCUS_04590 97282 96752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 97444 97644 gene locus_tag LOCUS_04600 97444 97644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 97637 97786 gene locus_tag LOCUS_04610 97637 97786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 97779 97907 gene locus_tag LOCUS_04620 97779 97907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 97910 98563 gene locus_tag LOCUS_04630 97910 98563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 98585 99478 gene locus_tag LOCUS_04640 98585 99478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 99495 99785 gene locus_tag LOCUS_04650 99495 99785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 99804 100088 gene locus_tag LOCUS_04660 99804 100088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 100098 101087 gene locus_tag LOCUS_04670 100098 101087 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_04670 101107 101544 gene locus_tag LOCUS_04680 101107 101544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 101563 102285 gene locus_tag LOCUS_04690 101563 102285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572217.1 protein_id gnl|my_center|LOCUS_04690 102461 103468 gene locus_tag LOCUS_04700 102461 103468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 103446 103922 gene locus_tag LOCUS_04710 103446 103922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 103897 104049 gene locus_tag LOCUS_04720 103897 104049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 104064 104261 gene locus_tag LOCUS_04730 104064 104261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 104251 104691 gene locus_tag LOCUS_04740 104251 104691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 104701 105189 gene locus_tag LOCUS_04750 104701 105189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 105208 105333 gene locus_tag LOCUS_04760 105208 105333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 105308 106468 gene locus_tag LOCUS_04770 105308 106468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 106579 106507 gene locus_tag LOCUS_t00050 106579 106507 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 107264 106872 gene locus_tag LOCUS_04780 107264 106872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence005 2136 1654 gene locus_tag LOCUS_04790 gene greA 2136 1654 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_04790 2978 2223 gene locus_tag LOCUS_04800 2978 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3942 2962 gene locus_tag LOCUS_04810 gene dusB 3942 2962 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_04810 4723 3944 gene locus_tag LOCUS_04820 4723 3944 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_04820 5137 4727 gene locus_tag LOCUS_04830 5137 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 6065 5073 gene locus_tag LOCUS_04840 6065 5073 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_04840 7076 6081 gene locus_tag LOCUS_04850 gene argF 7076 6081 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_04850 8031 7111 gene locus_tag LOCUS_04860 8031 7111 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_04860 8530 8075 gene locus_tag LOCUS_04870 8530 8075 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_04870 9628 8546 gene locus_tag LOCUS_04880 9628 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 10614 9820 gene locus_tag LOCUS_04890 gene proC 10614 9820 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_04890 11478 10639 gene locus_tag LOCUS_04900 11478 10639 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_04900 12529 11555 gene locus_tag LOCUS_04910 gene pfkA 12529 11555 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_04910 16092 12604 gene locus_tag LOCUS_04920 16092 12604 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_04920 16803 16204 gene locus_tag LOCUS_04930 16803 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 18052 16865 gene locus_tag LOCUS_04940 gene metK 18052 16865 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_04940 18587 18312 gene locus_tag LOCUS_04950 18587 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 19734 18721 gene locus_tag LOCUS_04960 19734 18721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216010.1 protein_id gnl|my_center|LOCUS_04960 20768 19737 gene locus_tag LOCUS_04970 20768 19737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974215.1 protein_id gnl|my_center|LOCUS_04970 22276 20765 gene locus_tag LOCUS_04980 22276 20765 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974214.1 protein_id gnl|my_center|LOCUS_04980 23428 22370 gene locus_tag LOCUS_04990 23428 22370 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339569.1 protein_id gnl|my_center|LOCUS_04990 25100 23448 gene locus_tag LOCUS_05000 gene araB 25100 23448 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_05000 25836 25111 gene locus_tag LOCUS_05010 gene nagB 25836 25111 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963511.1 protein_id gnl|my_center|LOCUS_05010 26447 25833 gene locus_tag LOCUS_05020 26447 25833 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733192.1 protein_id gnl|my_center|LOCUS_05020 27280 26474 gene locus_tag LOCUS_05030 gene sgcQ 27280 26474 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 protein_id gnl|my_center|LOCUS_05030 28072 27293 gene locus_tag LOCUS_05040 28072 27293 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_05040 28249 28908 gene locus_tag LOCUS_05050 28249 28908 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_05050 29709 28960 gene locus_tag LOCUS_05060 29709 28960 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_05060 31025 29733 gene locus_tag LOCUS_05070 31025 29733 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_05070 32772 31183 gene locus_tag LOCUS_05080 32772 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 33342 32779 gene locus_tag LOCUS_05090 33342 32779 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_05090 34017 33361 gene locus_tag LOCUS_05100 34017 33361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 35076 34417 gene locus_tag LOCUS_05110 35076 34417 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_05110 35544 35278 gene locus_tag LOCUS_05120 35544 35278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 35699 36349 gene locus_tag LOCUS_05130 35699 36349 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_05130 37422 36406 gene locus_tag LOCUS_05140 gene galE 37422 36406 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_05140 38799 37573 gene locus_tag LOCUS_05150 38799 37573 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_05150 39061 39204 gene locus_tag LOCUS_05160 39061 39204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 40284 39226 gene locus_tag LOCUS_05170 40284 39226 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_05170 41468 40470 gene locus_tag LOCUS_05180 gene pseB 41468 40470 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_05180 43203 41563 gene locus_tag LOCUS_05190 43203 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 44208 43216 gene locus_tag LOCUS_05200 44208 43216 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446968.1 protein_id gnl|my_center|LOCUS_05200 45395 44193 gene locus_tag LOCUS_05210 45395 44193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 46687 45392 gene locus_tag LOCUS_05220 46687 45392 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203010.1 protein_id gnl|my_center|LOCUS_05220 47505 46708 gene locus_tag LOCUS_05230 47505 46708 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257991.1 protein_id gnl|my_center|LOCUS_05230 48659 47553 gene locus_tag LOCUS_05240 48659 47553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 49441 48656 gene locus_tag LOCUS_05250 49441 48656 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_05250 50586 49459 gene locus_tag LOCUS_05260 50586 49459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 51982 50570 gene locus_tag LOCUS_05270 51982 50570 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_05270 52770 51982 gene locus_tag LOCUS_05280 52770 51982 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 protein_id gnl|my_center|LOCUS_05280 53703 52774 gene locus_tag LOCUS_05290 53703 52774 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_05290 54189 53803 gene locus_tag LOCUS_05300 54189 53803 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_05300 54950 54264 gene locus_tag LOCUS_05310 54950 54264 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_05310 55077 56528 gene locus_tag LOCUS_05320 55077 56528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 56525 57337 gene locus_tag LOCUS_05330 56525 57337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 57500 58792 gene locus_tag LOCUS_05340 gene licH 57500 58792 CDS product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 protein_id gnl|my_center|LOCUS_05340 58820 59758 gene locus_tag LOCUS_05350 58820 59758 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_05350 59764 60792 gene locus_tag LOCUS_05360 59764 60792 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861263.1 protein_id gnl|my_center|LOCUS_05360 61591 60857 gene locus_tag LOCUS_05370 61591 60857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 63313 61667 gene locus_tag LOCUS_05380 63313 61667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 64185 63310 gene locus_tag LOCUS_05390 64185 63310 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_05390 65088 64198 gene locus_tag LOCUS_05400 65088 64198 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_05400 66194 65088 gene locus_tag LOCUS_05410 66194 65088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_05410 67194 66157 gene locus_tag LOCUS_05420 67194 66157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 67422 67195 gene locus_tag LOCUS_05430 67422 67195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 68603 67479 gene locus_tag LOCUS_05440 68603 67479 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_05440 70320 68644 gene locus_tag LOCUS_05450 70320 68644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_05450 72053 70317 gene locus_tag LOCUS_05460 72053 70317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948104.1 protein_id gnl|my_center|LOCUS_05460 72540 72055 gene locus_tag LOCUS_05470 72540 72055 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861879.1 protein_id gnl|my_center|LOCUS_05470 73368 72637 gene locus_tag LOCUS_05480 73368 72637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 73692 75047 gene locus_tag LOCUS_05490 73692 75047 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_05490 75310 75409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76340 75765 gene locus_tag LOCUS_05500 76340 75765 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_05500 77332 76376 gene locus_tag LOCUS_05510 77332 76376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 78045 77329 gene locus_tag LOCUS_05520 gene cobI 78045 77329 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_05520 78472 78317 gene locus_tag LOCUS_05530 78472 78317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 79940 79281 gene locus_tag LOCUS_05540 gene eda 79940 79281 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_05540 80991 79942 gene locus_tag LOCUS_05550 80991 79942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 81637 80960 gene locus_tag LOCUS_05560 81637 80960 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970706.1 protein_id gnl|my_center|LOCUS_05560 82710 81643 gene locus_tag LOCUS_05570 82710 81643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 83800 82718 gene locus_tag LOCUS_05580 83800 82718 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_05580 84625 83819 gene locus_tag LOCUS_05590 gene fabG 84625 83819 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_05590 85634 84651 gene locus_tag LOCUS_05600 85634 84651 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_05600 87142 85631 gene locus_tag LOCUS_05610 87142 85631 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_05610 88225 87209 gene locus_tag LOCUS_05620 88225 87209 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728810.1 protein_id gnl|my_center|LOCUS_05620 88539 89255 gene locus_tag LOCUS_05630 88539 89255 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194205.1 protein_id gnl|my_center|LOCUS_05630 89357 89187 gene locus_tag LOCUS_05640 89357 89187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 89746 89357 gene locus_tag LOCUS_05650 89746 89357 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_05650 90725 89739 gene locus_tag LOCUS_05660 90725 89739 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_05660 91659 90835 gene locus_tag LOCUS_05670 gene fabG 91659 90835 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_05670 93290 91695 gene locus_tag LOCUS_05680 93290 91695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 94276 93302 gene locus_tag LOCUS_05690 94276 93302 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989516.1 protein_id gnl|my_center|LOCUS_05690 95115 94294 gene locus_tag LOCUS_05700 95115 94294 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114402.1 protein_id gnl|my_center|LOCUS_05700 96040 95129 gene locus_tag LOCUS_05710 96040 95129 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_05710 97820 96120 gene locus_tag LOCUS_05720 97820 96120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 97265 97274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 1653 1360 gene locus_tag LOCUS_05730 1653 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2085 1771 gene locus_tag LOCUS_05740 2085 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2733 2104 gene locus_tag LOCUS_05750 2733 2104 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_05750 3461 2751 gene locus_tag LOCUS_05760 3461 2751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 protein_id gnl|my_center|LOCUS_05760 4235 3474 gene locus_tag LOCUS_05770 4235 3474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_05770 5298 4237 gene locus_tag LOCUS_05780 5298 4237 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_05780 6196 5312 gene locus_tag LOCUS_05790 6196 5312 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_05790 7561 6386 gene locus_tag LOCUS_05800 7561 6386 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_05800 7787 7714 gene locus_tag LOCUS_t00060 7787 7714 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9845 7905 gene locus_tag LOCUS_05810 9845 7905 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_05810 10679 9846 gene locus_tag LOCUS_05820 10679 9846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970002.1 protein_id gnl|my_center|LOCUS_05820 12016 10808 gene locus_tag LOCUS_05830 12016 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 12971 12042 gene locus_tag LOCUS_05840 12971 12042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970565.1 protein_id gnl|my_center|LOCUS_05840 14488 12986 gene locus_tag LOCUS_05850 gene rbsA 14488 12986 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_05850 14660 16189 gene locus_tag LOCUS_05860 14660 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 16189 17955 gene locus_tag LOCUS_05870 16189 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 20048 17946 gene locus_tag LOCUS_05880 20048 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 20973 20035 gene locus_tag LOCUS_05890 20973 20035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_05890 21195 21956 gene locus_tag LOCUS_05900 21195 21956 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_05900 22125 21985 gene locus_tag LOCUS_05910 22125 21985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 23196 22174 gene locus_tag LOCUS_05920 23196 22174 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_05920 24657 23197 gene locus_tag LOCUS_05930 24657 23197 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_05930 25084 24728 gene locus_tag LOCUS_05940 gene rplT 25084 24728 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_05940 25325 25128 gene locus_tag LOCUS_05950 gene rpmI 25325 25128 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_05950 25860 25402 gene locus_tag LOCUS_05960 gene infC 25860 25402 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_05960 26779 26132 gene locus_tag LOCUS_05970 26779 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 27296 26982 gene locus_tag LOCUS_05980 27296 26982 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430798.1 protein_id gnl|my_center|LOCUS_05980 27925 27356 gene locus_tag LOCUS_05990 27925 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 28280 27906 gene locus_tag LOCUS_06000 28280 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 28845 28264 gene locus_tag LOCUS_06010 28845 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 29494 28862 gene locus_tag LOCUS_06020 29494 28862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 31166 29484 gene locus_tag LOCUS_06030 31166 29484 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_06030 31786 31187 gene locus_tag LOCUS_06040 31786 31187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 33231 31798 gene locus_tag LOCUS_06050 33231 31798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 34457 33252 gene locus_tag LOCUS_06060 34457 33252 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_06060 35017 34550 gene locus_tag LOCUS_06070 35017 34550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 36677 35043 gene locus_tag LOCUS_06080 36677 35043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 38661 36697 gene locus_tag LOCUS_06090 gene thrS 38661 36697 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_06090 38933 38682 gene locus_tag LOCUS_06100 38933 38682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 39843 39337 gene locus_tag LOCUS_06110 39843 39337 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_06110 40887 40078 gene locus_tag LOCUS_06120 40887 40078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 41630 40968 gene locus_tag LOCUS_06130 41630 40968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 42898 41606 gene locus_tag LOCUS_06140 42898 41606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 43837 43043 gene locus_tag LOCUS_06150 43837 43043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_06150 44759 43830 gene locus_tag LOCUS_06160 44759 43830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700784.1 protein_id gnl|my_center|LOCUS_06160 45895 44849 gene locus_tag LOCUS_06170 45895 44849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_06170 47286 45979 gene locus_tag LOCUS_06180 47286 45979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 47884 47366 gene locus_tag LOCUS_06190 gene cobO 47884 47366 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_06190 48519 47881 gene locus_tag LOCUS_06200 48519 47881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 50667 48526 gene locus_tag LOCUS_06210 50667 48526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 51761 50664 gene locus_tag LOCUS_06220 gene cobD 51761 50664 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_06220 52780 51758 gene locus_tag LOCUS_06230 gene cbiB 52780 51758 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 protein_id gnl|my_center|LOCUS_06230 53376 52777 gene locus_tag LOCUS_06240 53376 52777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 53699 53373 gene locus_tag LOCUS_06250 53699 53373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 54234 53722 gene locus_tag LOCUS_06260 54234 53722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 54235 54426 gene locus_tag LOCUS_06270 54235 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 55092 54544 gene locus_tag LOCUS_06280 gene cobU 55092 54544 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 protein_id gnl|my_center|LOCUS_06280 57534 55126 gene locus_tag LOCUS_06290 57534 55126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 59576 57531 gene locus_tag LOCUS_06300 59576 57531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 60325 59573 gene locus_tag LOCUS_06310 gene cobJ 60325 59573 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_06310 61398 60322 gene locus_tag LOCUS_06320 gene cbiG 61398 60322 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_06320 62179 61370 gene locus_tag LOCUS_06330 62179 61370 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924853.1 protein_id gnl|my_center|LOCUS_06330 63387 62176 gene locus_tag LOCUS_06340 gene cbiD 63387 62176 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_06340 64046 63501 gene locus_tag LOCUS_06350 64046 63501 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920199.1 protein_id gnl|my_center|LOCUS_06350 64362 64039 gene locus_tag LOCUS_06360 64362 64039 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612791.1 protein_id gnl|my_center|LOCUS_06360 65188 64586 gene locus_tag LOCUS_06370 65188 64586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 65356 65204 gene locus_tag LOCUS_06380 65356 65204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 66307 65474 gene locus_tag LOCUS_06390 66307 65474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 68282 66273 gene locus_tag LOCUS_06400 68282 66273 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964096.1 protein_id gnl|my_center|LOCUS_06400 69250 68465 gene locus_tag LOCUS_06410 69250 68465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 70326 69307 gene locus_tag LOCUS_06420 70326 69307 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_06420 71959 70373 gene locus_tag LOCUS_06430 71959 70373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 72421 72065 gene locus_tag LOCUS_06440 72421 72065 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_06440 74330 72462 gene locus_tag LOCUS_06450 74330 72462 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06450 74565 74347 gene locus_tag LOCUS_06460 74565 74347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 77254 74690 gene locus_tag LOCUS_06470 77254 74690 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06470 77603 77304 gene locus_tag LOCUS_06480 77603 77304 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_06480 79206 77761 gene locus_tag LOCUS_06490 79206 77761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 79394 79257 gene locus_tag LOCUS_06500 79394 79257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 79585 79944 gene locus_tag LOCUS_06510 79585 79944 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_06510 81625 79949 gene locus_tag LOCUS_06520 gene pdcB 81625 79949 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_06520 84215 81750 gene locus_tag LOCUS_06530 84215 81750 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_06530 84271 84280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84383 84670 gene locus_tag LOCUS_06540 84383 84670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 85545 84655 gene locus_tag LOCUS_06550 85545 84655 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_06550 88772 85557 gene locus_tag LOCUS_06560 gene carB 88772 85557 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_06560 89958 88765 gene locus_tag LOCUS_06570 gene carA 89958 88765 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 protein_id gnl|my_center|LOCUS_06570 93919 90119 gene locus_tag LOCUS_06580 93919 90119 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_06580 94974 94039 gene locus_tag LOCUS_06590 94974 94039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 95928 94987 gene locus_tag LOCUS_06600 95928 94987 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_06600 96573 95989 gene locus_tag LOCUS_06610 96573 95989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 97055 96588 gene locus_tag LOCUS_06620 97055 96588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence007 87 3050 gene locus_tag LOCUS_06630 87 3050 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922655.1 protein_id gnl|my_center|LOCUS_06630 3127 4053 gene locus_tag LOCUS_06640 3127 4053 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058548.1 protein_id gnl|my_center|LOCUS_06640 4326 4694 gene locus_tag LOCUS_06650 4326 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4801 5013 gene locus_tag LOCUS_06660 4801 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5169 5561 gene locus_tag LOCUS_06670 5169 5561 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_06670 5576 5977 gene locus_tag LOCUS_06680 5576 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6051 7289 gene locus_tag LOCUS_06690 6051 7289 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_06690 7291 8604 gene locus_tag LOCUS_06700 7291 8604 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_06700 8697 10007 gene locus_tag LOCUS_06710 8697 10007 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_06710 10019 10972 gene locus_tag LOCUS_06720 10019 10972 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_06720 11101 11565 gene locus_tag LOCUS_06730 11101 11565 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_06730 11584 12723 gene locus_tag LOCUS_06740 11584 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 12738 13007 gene locus_tag LOCUS_06750 12738 13007 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_06750 13000 13302 gene locus_tag LOCUS_06760 13000 13302 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_06760 13321 16164 gene locus_tag LOCUS_06770 13321 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 16161 16541 gene locus_tag LOCUS_06780 gene rbfA 16161 16541 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_06780 16528 17514 gene locus_tag LOCUS_06790 16528 17514 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_06790 17521 18450 gene locus_tag LOCUS_06800 gene truB 17521 18450 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_06800 18466 19401 gene locus_tag LOCUS_06810 18466 19401 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392568.1 protein_id gnl|my_center|LOCUS_06810 19482 20501 gene locus_tag LOCUS_06820 19482 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 20683 20949 gene locus_tag LOCUS_06830 gene rpsO 20683 20949 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721510.1 protein_id gnl|my_center|LOCUS_06830 21105 23195 gene locus_tag LOCUS_06840 gene pnp 21105 23195 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06840 23363 24298 gene locus_tag LOCUS_06850 gene spoIIIAA 23363 24298 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_06850 24402 24809 gene locus_tag LOCUS_06860 24402 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 24827 25021 gene locus_tag LOCUS_06870 24827 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 25035 25424 gene locus_tag LOCUS_06880 gene spoIIIAD 25035 25424 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_06880 25426 26481 gene locus_tag LOCUS_06890 25426 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 26489 26998 gene locus_tag LOCUS_06900 26489 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 26989 27609 gene locus_tag LOCUS_06910 26989 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 27622 28353 gene locus_tag LOCUS_06920 27622 28353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 28399 29550 gene locus_tag LOCUS_06930 28399 29550 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_06930 29580 31172 gene locus_tag LOCUS_06940 29580 31172 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_06940 31173 32354 gene locus_tag LOCUS_06950 31173 32354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 32442 32816 gene locus_tag LOCUS_06960 32442 32816 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_06960 32842 33252 gene locus_tag LOCUS_06970 gene nusB 32842 33252 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_06970 33252 34445 gene locus_tag LOCUS_06980 gene xseA 33252 34445 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_06980 34450 34662 gene locus_tag LOCUS_06990 34450 34662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 34634 35554 gene locus_tag LOCUS_07000 34634 35554 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_07000 35583 37448 gene locus_tag LOCUS_07010 gene dxs 35583 37448 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_07010 37469 38365 gene locus_tag LOCUS_07020 37469 38365 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_07020 38352 39227 gene locus_tag LOCUS_07030 38352 39227 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810952.1 protein_id gnl|my_center|LOCUS_07030 39232 39684 gene locus_tag LOCUS_07040 39232 39684 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_07040 39713 41392 gene locus_tag LOCUS_07050 gene recN 39713 41392 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_07050 41548 42849 gene locus_tag LOCUS_07060 gene spoIVB 41548 42849 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_07060 43548 42850 gene locus_tag LOCUS_07070 43548 42850 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_07070 44063 43584 gene locus_tag LOCUS_07080 44063 43584 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_07080 44358 45371 gene locus_tag LOCUS_07090 44358 45371 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_07090 45548 46726 gene locus_tag LOCUS_07100 45548 46726 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_07100 47944 46802 gene locus_tag LOCUS_07110 47944 46802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 52199 47958 gene locus_tag LOCUS_07120 52199 47958 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_07120 52421 53311 gene locus_tag LOCUS_07130 52421 53311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 53326 54075 gene locus_tag LOCUS_07140 53326 54075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 54100 54543 gene locus_tag LOCUS_07150 54100 54543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 54561 57488 gene locus_tag LOCUS_07160 54561 57488 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_07160 57535 58623 gene locus_tag LOCUS_07170 57535 58623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 58616 59518 gene locus_tag LOCUS_07180 gene era 58616 59518 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_07180 59569 59745 gene locus_tag LOCUS_07190 59569 59745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 59684 60334 gene locus_tag LOCUS_07200 gene recO 59684 60334 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_07200 60394 61011 gene locus_tag LOCUS_07210 60394 61011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 61039 62427 gene locus_tag LOCUS_07220 61039 62427 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_07220 62446 65100 gene locus_tag LOCUS_07230 gene alaS 62446 65100 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_07230 65244 65420 gene locus_tag LOCUS_07240 gene rpsU 65244 65420 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_07240 65597 66190 gene locus_tag LOCUS_07250 65597 66190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 66203 67432 gene locus_tag LOCUS_07260 gene dacF 66203 67432 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_07260 67479 68336 gene locus_tag LOCUS_07270 67479 68336 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_07270 68408 69328 gene locus_tag LOCUS_07280 68408 69328 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_07280 69443 70078 gene locus_tag LOCUS_07290 gene deoC 69443 70078 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017437.1 protein_id gnl|my_center|LOCUS_07290 70090 70836 gene locus_tag LOCUS_07300 70090 70836 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_07300 70849 71430 gene locus_tag LOCUS_07310 gene scpB 70849 71430 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_07310 71515 72753 gene locus_tag LOCUS_07320 71515 72753 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_07320 72808 73803 gene locus_tag LOCUS_07330 72808 73803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 73961 75388 gene locus_tag LOCUS_07340 73961 75388 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_07340 75407 76126 gene locus_tag LOCUS_07350 75407 76126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 76163 76534 gene locus_tag LOCUS_07360 76163 76534 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_07360 76592 77743 gene locus_tag LOCUS_07370 76592 77743 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_07370 77765 79198 gene locus_tag LOCUS_07380 77765 79198 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_07380 79418 80263 gene locus_tag LOCUS_07390 79418 80263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 80323 80868 gene locus_tag LOCUS_07400 80323 80868 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_07400 80883 81824 gene locus_tag LOCUS_07410 80883 81824 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_07410 81817 83064 gene locus_tag LOCUS_07420 81817 83064 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_07420 83079 83753 gene locus_tag LOCUS_07430 83079 83753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 83780 84721 gene locus_tag LOCUS_07440 gene mgfK 83780 84721 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_07440 84756 85826 gene locus_tag LOCUS_07450 84756 85826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence008 9 566 gene locus_tag LOCUS_07460 9 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 582 3860 gene locus_tag LOCUS_07470 582 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3889 4077 gene locus_tag LOCUS_07480 3889 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4173 4325 gene locus_tag LOCUS_07490 4173 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4810 5298 gene locus_tag LOCUS_07500 4810 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5629 6012 gene locus_tag LOCUS_07510 5629 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6806 6060 gene locus_tag LOCUS_07520 6806 6060 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_07520 8619 6784 gene locus_tag LOCUS_07530 8619 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8776 9654 gene locus_tag LOCUS_07540 8776 9654 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_07540 9654 10493 gene locus_tag LOCUS_07550 9654 10493 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_07550 10633 12000 gene locus_tag LOCUS_07560 10633 12000 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_07560 12080 13990 gene locus_tag LOCUS_07570 12080 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 14003 14710 gene locus_tag LOCUS_07580 14003 14710 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_07580 14790 15464 gene locus_tag LOCUS_07590 14790 15464 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_07590 15622 16752 gene locus_tag LOCUS_07600 15622 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17003 16749 gene locus_tag LOCUS_07610 17003 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 18304 17114 gene locus_tag LOCUS_07620 18304 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18805 18377 gene locus_tag LOCUS_07630 18805 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19305 19535 gene locus_tag LOCUS_07640 19305 19535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 20539 19607 gene locus_tag LOCUS_07650 20539 19607 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_07650 20737 22311 gene locus_tag LOCUS_07660 20737 22311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 22324 23316 gene locus_tag LOCUS_07670 22324 23316 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_07670 23497 24534 gene locus_tag LOCUS_07680 23497 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 24743 26209 gene locus_tag LOCUS_07690 24743 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 26224 27363 gene locus_tag LOCUS_07700 26224 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 27381 28343 gene locus_tag LOCUS_07710 27381 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 28354 29097 gene locus_tag LOCUS_07720 28354 29097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 29100 30200 gene locus_tag LOCUS_07730 29100 30200 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_07730 30215 31765 gene locus_tag LOCUS_07740 30215 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 31847 33433 gene locus_tag LOCUS_07750 31847 33433 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_07750 34501 33518 gene locus_tag LOCUS_07760 34501 33518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 34638 36209 gene locus_tag LOCUS_07770 34638 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 36213 37274 gene locus_tag LOCUS_07780 36213 37274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 37287 38099 gene locus_tag LOCUS_07790 37287 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 38099 39562 gene locus_tag LOCUS_07800 38099 39562 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_07800 39581 40657 gene locus_tag LOCUS_07810 39581 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007823.1 protein_id gnl|my_center|LOCUS_07810 41881 40658 gene locus_tag LOCUS_07820 41881 40658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 42055 42420 gene locus_tag LOCUS_07830 42055 42420 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_07830 42417 42752 gene locus_tag LOCUS_07840 42417 42752 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089868.1 protein_id gnl|my_center|LOCUS_07840 43057 42743 gene locus_tag LOCUS_07850 43057 42743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 43393 45849 gene locus_tag LOCUS_07860 43393 45849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 45926 47008 gene locus_tag LOCUS_07870 gene rfbB 45926 47008 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_07870 47115 47984 gene locus_tag LOCUS_07880 gene rfbA 47115 47984 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_07880 48003 48578 gene locus_tag LOCUS_07890 gene rfbC 48003 48578 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_07890 48568 49599 gene locus_tag LOCUS_07900 48568 49599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_07900 49645 50949 gene locus_tag LOCUS_07910 49645 50949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_07910 50954 53065 gene locus_tag LOCUS_07920 50954 53065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 53071 55341 gene locus_tag LOCUS_07930 53071 55341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 55353 57326 gene locus_tag LOCUS_07940 55353 57326 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_07940 57368 59089 gene locus_tag LOCUS_07950 57368 59089 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_07950 59166 60545 gene locus_tag LOCUS_07960 59166 60545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 60566 61546 gene locus_tag LOCUS_07970 60566 61546 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_07970 61622 63031 gene locus_tag LOCUS_07980 61622 63031 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_07980 63167 64456 gene locus_tag LOCUS_07990 63167 64456 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966327.1 protein_id gnl|my_center|LOCUS_07990 64578 65504 gene locus_tag LOCUS_08000 gene rfbN 64578 65504 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_08000 65590 66972 gene locus_tag LOCUS_08010 65590 66972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 67119 67553 gene locus_tag LOCUS_08020 67119 67553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 69810 67657 gene locus_tag LOCUS_08030 69810 67657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 70432 71154 gene locus_tag LOCUS_08040 70432 71154 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_08040 71151 72470 gene locus_tag LOCUS_08050 71151 72470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence009 89 268 gene locus_tag LOCUS_08060 89 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 402 1046 gene locus_tag LOCUS_08070 402 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1067 2056 gene locus_tag LOCUS_08080 1067 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2058 2444 gene locus_tag LOCUS_08090 2058 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2449 2787 gene locus_tag LOCUS_08100 2449 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2784 3167 gene locus_tag LOCUS_08110 2784 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3164 3565 gene locus_tag LOCUS_08120 3164 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3569 4006 gene locus_tag LOCUS_08130 3569 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4067 4381 gene locus_tag LOCUS_08140 4067 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4456 4701 gene locus_tag LOCUS_08150 4456 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4902 7685 gene locus_tag LOCUS_08160 4902 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 7689 8096 gene locus_tag LOCUS_08170 7689 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8099 9499 gene locus_tag LOCUS_08180 8099 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9496 10866 gene locus_tag LOCUS_08190 9496 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10871 11590 gene locus_tag LOCUS_08200 10871 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 11587 11853 gene locus_tag LOCUS_08210 11587 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 11850 12632 gene locus_tag LOCUS_08220 11850 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 12688 13131 gene locus_tag LOCUS_08230 12688 13131 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_08230 13196 14017 gene locus_tag LOCUS_08240 13196 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 14273 14064 gene locus_tag LOCUS_08250 14273 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 14551 14276 gene locus_tag LOCUS_08260 14551 14276 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_08260 14721 14548 gene locus_tag LOCUS_08270 14721 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 15663 14770 gene locus_tag LOCUS_08280 15663 14770 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425897.1 protein_id gnl|my_center|LOCUS_08280 15788 16939 gene locus_tag LOCUS_08290 15788 16939 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_08290 18560 16905 gene locus_tag LOCUS_08300 18560 16905 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_08300 18801 19811 gene locus_tag LOCUS_08310 18801 19811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_08310 19795 21903 gene locus_tag LOCUS_08320 19795 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 21918 22496 gene locus_tag LOCUS_08330 21918 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 22564 24057 gene locus_tag LOCUS_08340 22564 24057 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_08340 24084 25550 gene locus_tag LOCUS_08350 gene gltX 24084 25550 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_08350 25570 27354 gene locus_tag LOCUS_08360 25570 27354 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_08360 27673 27329 gene locus_tag LOCUS_08370 27673 27329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 27814 29739 gene locus_tag LOCUS_08380 27814 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 29736 30275 gene locus_tag LOCUS_08390 29736 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 30764 31189 gene locus_tag LOCUS_08400 30764 31189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 31243 32682 gene locus_tag LOCUS_08410 gene miaB 31243 32682 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_08410 32701 35352 gene locus_tag LOCUS_08420 gene mutS 32701 35352 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_08420 35368 37272 gene locus_tag LOCUS_08430 gene mutL 35368 37272 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_08430 37269 38222 gene locus_tag LOCUS_08440 gene miaA 37269 38222 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_08440 38219 39523 gene locus_tag LOCUS_08450 38219 39523 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_08450 39635 39871 gene locus_tag LOCUS_08460 39635 39871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 39948 40637 gene locus_tag LOCUS_08470 gene radC 39948 40637 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013390.1 protein_id gnl|my_center|LOCUS_08470 40653 41663 gene locus_tag LOCUS_08480 40653 41663 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_08480 41660 42535 gene locus_tag LOCUS_08490 gene mreC 41660 42535 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_08490 42539 43057 gene locus_tag LOCUS_08500 42539 43057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 43050 45914 gene locus_tag LOCUS_08510 43050 45914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 45937 46617 gene locus_tag LOCUS_08520 45937 46617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 46674 47465 gene locus_tag LOCUS_08530 gene minD 46674 47465 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_08530 47478 47747 gene locus_tag LOCUS_08540 gene minE 47478 47747 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_08540 47772 48887 gene locus_tag LOCUS_08550 gene rodA 47772 48887 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_08550 48935 49330 gene locus_tag LOCUS_08560 gene mgsA 48935 49330 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_08560 49419 50312 gene locus_tag LOCUS_08570 49419 50312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 50414 50833 gene locus_tag LOCUS_08580 50414 50833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_08580 50918 52309 gene locus_tag LOCUS_08590 50918 52309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 52322 53014 gene locus_tag LOCUS_08600 52322 53014 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_08600 53030 53542 gene locus_tag LOCUS_08610 53030 53542 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565171.1 protein_id gnl|my_center|LOCUS_08610 53604 54716 gene locus_tag LOCUS_08620 gene aroB 53604 54716 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_08620 54713 55252 gene locus_tag LOCUS_08630 gene lspA 54713 55252 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_08630 55257 56177 gene locus_tag LOCUS_08640 55257 56177 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_08640 56261 56887 gene locus_tag LOCUS_08650 56261 56887 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_08650 58002 57226 gene locus_tag LOCUS_08660 58002 57226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 58854 58222 gene locus_tag LOCUS_08670 58854 58222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 59108 58872 gene locus_tag LOCUS_08680 59108 58872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence010 <1 1241 gene locus_tag LOCUS_08690 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965839.1:methyl-accepting chemotaxis protein 1989 1324 gene locus_tag LOCUS_08700 1989 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2697 2116 gene locus_tag LOCUS_08710 2697 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2803 3030 gene locus_tag LOCUS_08720 2803 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5248 3014 gene locus_tag LOCUS_08730 5248 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6226 5390 gene locus_tag LOCUS_08740 gene rhaS 6226 5390 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209108.1 protein_id gnl|my_center|LOCUS_08740 6421 7767 gene locus_tag LOCUS_08750 6421 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 7901 8809 gene locus_tag LOCUS_08760 7901 8809 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_08760 8802 9641 gene locus_tag LOCUS_08770 8802 9641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_08770 9755 12004 gene locus_tag LOCUS_08780 9755 12004 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990068.1 protein_id gnl|my_center|LOCUS_08780 12035 13015 gene locus_tag LOCUS_08790 12035 13015 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_08790 13059 13961 gene locus_tag LOCUS_08800 13059 13961 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_08800 14052 15215 gene locus_tag LOCUS_08810 14052 15215 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 protein_id gnl|my_center|LOCUS_08810 15233 16744 gene locus_tag LOCUS_08820 gene galT 15233 16744 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_08820 16746 18470 gene locus_tag LOCUS_08830 16746 18470 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_08830 18520 19053 gene locus_tag LOCUS_08840 18520 19053 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_08840 19387 19728 gene locus_tag LOCUS_08850 19387 19728 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870108.1 protein_id gnl|my_center|LOCUS_08850 19715 20128 gene locus_tag LOCUS_08860 19715 20128 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393073.1 protein_id gnl|my_center|LOCUS_08860 21072 20125 gene locus_tag LOCUS_08870 21072 20125 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_08870 21169 21633 gene locus_tag LOCUS_08880 21169 21633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 23518 21695 gene locus_tag LOCUS_08890 23518 21695 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_08890 23695 24537 gene locus_tag LOCUS_08900 23695 24537 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_08900 24537 25478 gene locus_tag LOCUS_08910 24537 25478 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_08910 25509 26198 gene locus_tag LOCUS_08920 gene rpe 25509 26198 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_08920 26254 27102 gene locus_tag LOCUS_08930 26254 27102 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_08930 27347 28060 gene locus_tag LOCUS_08940 27347 28060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 28089 29267 gene locus_tag LOCUS_08950 28089 29267 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_08950 29300 30772 gene locus_tag LOCUS_08960 29300 30772 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_08960 30769 32181 gene locus_tag LOCUS_08970 30769 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 32192 33700 gene locus_tag LOCUS_08980 gene glpK 32192 33700 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_08980 33719 35101 gene locus_tag LOCUS_08990 33719 35101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 35140 35766 gene locus_tag LOCUS_09000 35140 35766 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_09000 35970 38159 gene locus_tag LOCUS_09010 35970 38159 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_09010 38192 40363 gene locus_tag LOCUS_09020 38192 40363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 40409 41431 gene locus_tag LOCUS_09030 40409 41431 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_09030 42273 41428 gene locus_tag LOCUS_09040 42273 41428 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289864.1 protein_id gnl|my_center|LOCUS_09040 42699 44147 gene locus_tag LOCUS_09050 42699 44147 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_09050 44254 45258 gene locus_tag LOCUS_09060 44254 45258 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_09060 45261 46106 gene locus_tag LOCUS_09070 45261 46106 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_09070 46152 47333 gene locus_tag LOCUS_09080 46152 47333 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_09080 47351 48523 gene locus_tag LOCUS_09090 47351 48523 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_09090 48557 49579 gene locus_tag LOCUS_09100 48557 49579 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_09100 49684 50808 gene locus_tag LOCUS_09110 49684 50808 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986990.1 protein_id gnl|my_center|LOCUS_09110 50841 53147 gene locus_tag LOCUS_09120 50841 53147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 53169 54353 gene locus_tag LOCUS_09130 53169 54353 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_09130 54404 55264 gene locus_tag LOCUS_09140 54404 55264 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 protein_id gnl|my_center|LOCUS_09140 55258 56169 gene locus_tag LOCUS_09150 55258 56169 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_09150 56319 56795 gene locus_tag LOCUS_09160 56319 56795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 57043 58083 gene locus_tag LOCUS_09170 gene hrcA 57043 58083 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_09170 58095 58730 gene locus_tag LOCUS_09180 58095 58730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence011 <1 1179 gene locus_tag LOCUS_09190 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966259.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB 1315 1752 gene locus_tag LOCUS_09200 1315 1752 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_09200 1806 3008 gene locus_tag LOCUS_09210 1806 3008 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_09210 3068 4387 gene locus_tag LOCUS_09220 3068 4387 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_09220 5319 4468 gene locus_tag LOCUS_09230 5319 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5560 6057 gene locus_tag LOCUS_09240 5560 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6097 7551 gene locus_tag LOCUS_09250 gene guaB 6097 7551 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_09250 7584 10298 gene locus_tag LOCUS_09260 7584 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 10295 11284 gene locus_tag LOCUS_09270 10295 11284 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680886.1 protein_id gnl|my_center|LOCUS_09270 11332 13092 gene locus_tag LOCUS_09280 11332 13092 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_09280 13102 13947 gene locus_tag LOCUS_09290 13102 13947 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_09290 14495 14031 gene locus_tag LOCUS_09300 14495 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 14571 15293 gene locus_tag LOCUS_09310 14571 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 15295 16056 gene locus_tag LOCUS_09320 15295 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 16502 16038 gene locus_tag LOCUS_09330 gene spoVAC 16502 16038 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_09330 16673 18049 gene locus_tag LOCUS_09340 16673 18049 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_09340 18061 19230 gene locus_tag LOCUS_09350 18061 19230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 19324 20361 gene locus_tag LOCUS_09360 gene spoVAD 19324 20361 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_09360 20508 21593 gene locus_tag LOCUS_09370 20508 21593 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_09370 21643 22272 gene locus_tag LOCUS_09380 gene spoVAA 21643 22272 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_09380 22262 22756 gene locus_tag LOCUS_09390 22262 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 22820 23050 gene locus_tag LOCUS_09400 22820 23050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 23067 23447 gene locus_tag LOCUS_09410 23067 23447 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_09410 23451 23969 gene locus_tag LOCUS_09420 23451 23969 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_09420 23966 24853 gene locus_tag LOCUS_09430 23966 24853 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_09430 24939 25295 gene locus_tag LOCUS_09440 gene spoVAE 24939 25295 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_09440 25315 27111 gene locus_tag LOCUS_09450 25315 27111 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_09450 27273 28616 gene locus_tag LOCUS_09460 27273 28616 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_09460 28882 28727 gene locus_tag LOCUS_09470 28882 28727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 29227 29643 gene locus_tag LOCUS_09480 29227 29643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 29797 30627 gene locus_tag LOCUS_09490 29797 30627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 30843 31658 gene locus_tag LOCUS_09500 30843 31658 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_09500 31674 35138 gene locus_tag LOCUS_09510 gene addB 31674 35138 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_09510 35129 38752 gene locus_tag LOCUS_09520 gene addA 35129 38752 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_09520 39876 38764 gene locus_tag LOCUS_09530 39876 38764 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_09530 40103 41203 gene locus_tag LOCUS_09540 40103 41203 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209403.1 protein_id gnl|my_center|LOCUS_09540 41205 42215 gene locus_tag LOCUS_09550 41205 42215 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228229.1 protein_id gnl|my_center|LOCUS_09550 42212 42853 gene locus_tag LOCUS_09560 gene dhaL 42212 42853 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_09560 42850 43323 gene locus_tag LOCUS_09570 gene rpiB 42850 43323 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_09570 43411 45609 gene locus_tag LOCUS_09580 43411 45609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 45660 47093 gene locus_tag LOCUS_09590 45660 47093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 47167 48090 gene locus_tag LOCUS_09600 47167 48090 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_09600 48103 48936 gene locus_tag LOCUS_09610 48103 48936 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 protein_id gnl|my_center|LOCUS_09610 48954 49934 gene locus_tag LOCUS_09620 gene ydjG 48954 49934 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723698.1 protein_id gnl|my_center|LOCUS_09620 49948 50736 gene locus_tag LOCUS_09630 49948 50736 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_09630 50751 51698 gene locus_tag LOCUS_09640 50751 51698 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_09640 52000 52698 gene locus_tag LOCUS_09650 gene thiT 52000 52698 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_09650 52951 53661 gene locus_tag LOCUS_09660 52951 53661 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_09660 53670 55211 gene locus_tag LOCUS_09670 53670 55211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 55402 56862 gene locus_tag LOCUS_09680 55402 56862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 56978 57241 gene locus_tag LOCUS_09690 56978 57241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 57248 58576 gene locus_tag LOCUS_09700 57248 58576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence012 906 226 gene locus_tag LOCUS_09710 906 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_09710 1290 1057 gene locus_tag LOCUS_09720 1290 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1238 1432 gene locus_tag LOCUS_09730 1238 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1483 2085 gene locus_tag LOCUS_09740 1483 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2181 2540 gene locus_tag LOCUS_09750 2181 2540 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_09750 2543 4876 gene locus_tag LOCUS_09760 2543 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5066 6046 gene locus_tag LOCUS_09770 5066 6046 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_09770 6046 6726 gene locus_tag LOCUS_09780 6046 6726 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_09780 6749 8884 gene locus_tag LOCUS_09790 6749 8884 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966624.1 protein_id gnl|my_center|LOCUS_09790 8830 9021 gene locus_tag LOCUS_09800 8830 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 9008 10276 gene locus_tag LOCUS_09810 9008 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 10541 11218 gene locus_tag LOCUS_09820 10541 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 11404 12351 gene locus_tag LOCUS_09830 11404 12351 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_09830 12383 13312 gene locus_tag LOCUS_09840 12383 13312 CDS product auxin efflux carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582699.1 protein_id gnl|my_center|LOCUS_09840 13352 13894 gene locus_tag LOCUS_09850 13352 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13952 14410 gene locus_tag LOCUS_09860 13952 14410 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965903.1 protein_id gnl|my_center|LOCUS_09860 16069 14519 gene locus_tag LOCUS_09870 16069 14519 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_09870 16301 17149 gene locus_tag LOCUS_09880 16301 17149 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_09880 17526 17200 gene locus_tag LOCUS_09890 17526 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 17769 17933 gene locus_tag LOCUS_09900 17769 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 17863 18936 gene locus_tag LOCUS_09910 17863 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 18959 19420 gene locus_tag LOCUS_09920 18959 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 19433 19903 gene locus_tag LOCUS_09930 19433 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 19924 21090 gene locus_tag LOCUS_09940 19924 21090 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_09940 21106 21810 gene locus_tag LOCUS_09950 21106 21810 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261248.1 protein_id gnl|my_center|LOCUS_09950 21797 23398 gene locus_tag LOCUS_09960 21797 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 24550 23462 gene locus_tag LOCUS_09970 gene trpS 24550 23462 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_09970 24712 25218 gene locus_tag LOCUS_09980 24712 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 26117 25254 gene locus_tag LOCUS_09990 26117 25254 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_09990 26231 26383 gene locus_tag LOCUS_10000 26231 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 26380 27699 gene locus_tag LOCUS_10010 26380 27699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 27815 28618 gene locus_tag LOCUS_10020 gene proB 27815 28618 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_10020 29842 28601 gene locus_tag LOCUS_10030 29842 28601 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_10030 30015 31568 gene locus_tag LOCUS_10040 gene putP 30015 31568 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_10040 31959 32276 gene locus_tag LOCUS_10050 gene rpsJ 31959 32276 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_10050 32351 33034 gene locus_tag LOCUS_10060 gene rplC 32351 33034 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_10060 33069 33689 gene locus_tag LOCUS_10070 gene rplD 33069 33689 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_10070 33689 33988 gene locus_tag LOCUS_10080 gene rplW 33689 33988 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_10080 34070 34912 gene locus_tag LOCUS_10090 gene rplB 34070 34912 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_10090 34932 35213 gene locus_tag LOCUS_10100 gene rpsS 34932 35213 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_10100 35228 35614 gene locus_tag LOCUS_10110 35228 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 35627 36298 gene locus_tag LOCUS_10120 gene rpsC 35627 36298 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_10120 36298 36735 gene locus_tag LOCUS_10130 gene rplP 36298 36735 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_10130 36725 36931 gene locus_tag LOCUS_10140 gene rpmC 36725 36931 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_10140 36974 37228 gene locus_tag LOCUS_10150 gene rpsQ 36974 37228 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_10150 37267 37635 gene locus_tag LOCUS_10160 gene rplN 37267 37635 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_10160 37648 37959 gene locus_tag LOCUS_10170 gene rplX 37648 37959 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_10170 37984 38523 gene locus_tag LOCUS_10180 gene rplE 37984 38523 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_10180 38544 38729 gene locus_tag LOCUS_10190 38544 38729 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_10190 38755 39156 gene locus_tag LOCUS_10200 gene rpsH 38755 39156 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_10200 39203 39745 gene locus_tag LOCUS_10210 gene rplF 39203 39745 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_10210 39766 40134 gene locus_tag LOCUS_10220 gene rplR 39766 40134 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_10220 40154 40660 gene locus_tag LOCUS_10230 gene rpsE 40154 40660 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_10230 40674 40862 gene locus_tag LOCUS_10240 gene rpmD 40674 40862 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933824.1 protein_id gnl|my_center|LOCUS_10240 40886 41332 gene locus_tag LOCUS_10250 gene rplO 40886 41332 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_10250 41332 42645 gene locus_tag LOCUS_10260 gene secY 41332 42645 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_10260 42717 43358 gene locus_tag LOCUS_10270 42717 43358 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_10270 43403 44170 gene locus_tag LOCUS_10280 gene map 43403 44170 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_10280 44186 44458 gene locus_tag LOCUS_10290 44186 44458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 44451 44669 gene locus_tag LOCUS_10300 gene infA 44451 44669 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_10300 44629 44853 gene locus_tag LOCUS_10310 44629 44853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 45147 45515 gene locus_tag LOCUS_10320 gene rpsM 45147 45515 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_10320 45546 45947 gene locus_tag LOCUS_10330 gene rpsK 45546 45947 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_10330 46037 46630 gene locus_tag LOCUS_10340 gene rpsD 46037 46630 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_10340 46709 47665 gene locus_tag LOCUS_10350 46709 47665 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_10350 47861 48397 gene locus_tag LOCUS_10360 47861 48397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 48674 49516 gene locus_tag LOCUS_10370 48674 49516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 49578 49808 gene locus_tag LOCUS_10380 49578 49808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 50335 51054 gene locus_tag LOCUS_10390 50335 51054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 51992 51063 gene locus_tag LOCUS_10400 51992 51063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 52161 53006 gene locus_tag LOCUS_10410 52161 53006 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_10410 53065 53916 gene locus_tag LOCUS_10420 53065 53916 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_10420 53919 54722 gene locus_tag LOCUS_10430 53919 54722 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_10430 54794 55558 gene locus_tag LOCUS_10440 gene truA 54794 55558 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_10440 55796 56224 gene locus_tag LOCUS_10450 gene rplM 55796 56224 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_10450 56252 56650 gene locus_tag LOCUS_10460 gene rpsI 56252 56650 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence013 <1 560 gene locus_tag LOCUS_10470 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002610375.1:site-specific integrase 746 1225 gene locus_tag LOCUS_10480 746 1225 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_10480 1442 2695 gene locus_tag LOCUS_10490 1442 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2698 3336 gene locus_tag LOCUS_10500 2698 3336 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_10500 4661 3309 gene locus_tag LOCUS_10510 4661 3309 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_10510 4793 5998 gene locus_tag LOCUS_10520 gene nifS 4793 5998 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_10520 5988 6431 gene locus_tag LOCUS_10530 gene nifU 5988 6431 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_10530 6439 7518 gene locus_tag LOCUS_10540 gene mnmA 6439 7518 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_10540 8348 7530 gene locus_tag LOCUS_10550 8348 7530 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_10550 8618 9646 gene locus_tag LOCUS_10560 gene gap 8618 9646 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_10560 9752 10975 gene locus_tag LOCUS_10570 9752 10975 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_10570 11027 11773 gene locus_tag LOCUS_10580 gene tpiA 11027 11773 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700616.1 protein_id gnl|my_center|LOCUS_10580 11917 12111 gene locus_tag LOCUS_10590 11917 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 12101 13087 gene locus_tag LOCUS_10600 12101 13087 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_10600 13286 14875 gene locus_tag LOCUS_10610 13286 14875 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_10610 14951 16288 gene locus_tag LOCUS_10620 14951 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 18117 16339 gene locus_tag LOCUS_10630 18117 16339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_10630 19861 18107 gene locus_tag LOCUS_10640 19861 18107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582943.1 protein_id gnl|my_center|LOCUS_10640 20251 21423 gene locus_tag LOCUS_10650 20251 21423 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_10650 21500 22906 gene locus_tag LOCUS_10660 21500 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 22942 24105 gene locus_tag LOCUS_10670 22942 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 24236 25777 gene locus_tag LOCUS_10680 gene gpmI 24236 25777 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_10680 25875 27092 gene locus_tag LOCUS_10690 25875 27092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 29209 27074 gene locus_tag LOCUS_10700 29209 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 29476 29841 gene locus_tag LOCUS_10710 29476 29841 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733123.1 protein_id gnl|my_center|LOCUS_10710 29843 30748 gene locus_tag LOCUS_10720 29843 30748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657068.1 protein_id gnl|my_center|LOCUS_10720 30720 32987 gene locus_tag LOCUS_10730 30720 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 33014 35086 gene locus_tag LOCUS_10740 33014 35086 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_10740 35263 35362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35812 38562 gene locus_tag LOCUS_10750 35812 38562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 38087 38186 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38663 39301 gene locus_tag LOCUS_10760 38663 39301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 39314 39952 gene locus_tag LOCUS_10770 39314 39952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 39983 41263 gene locus_tag LOCUS_10780 39983 41263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 42941 41229 gene locus_tag LOCUS_10790 42941 41229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 43112 44428 gene locus_tag LOCUS_10800 gene eno 43112 44428 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_10800 44531 45985 gene locus_tag LOCUS_10810 44531 45985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 46064 46303 gene locus_tag LOCUS_10820 gene secG 46064 46303 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 protein_id gnl|my_center|LOCUS_10820 46381 48552 gene locus_tag LOCUS_10830 gene rnr 46381 48552 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_10830 48552 49019 gene locus_tag LOCUS_10840 gene smpB 48552 49019 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_10840 49071 49418 gene locus_tag LOCUS_tm00010 49071 49418 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 49487 50104 gene locus_tag LOCUS_10850 49487 50104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 50076 50750 gene locus_tag LOCUS_10860 50076 50750 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_10860 50752 52308 gene locus_tag LOCUS_10870 50752 52308 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_10870 52301 54520 gene locus_tag LOCUS_10880 52301 54520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 54513 55253 gene locus_tag LOCUS_10890 54513 55253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence014 154 79 gene locus_tag LOCUS_t00070 154 79 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 247 177 gene locus_tag LOCUS_t00080 247 177 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 344 270 gene locus_tag LOCUS_t00090 344 270 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 512 1912 gene locus_tag LOCUS_10900 512 1912 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_10900 1905 2846 gene locus_tag LOCUS_10910 1905 2846 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_10910 2945 3026 gene locus_tag LOCUS_t00100 2945 3026 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3367 3074 gene locus_tag LOCUS_10920 3367 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3422 3673 gene locus_tag LOCUS_10930 3422 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4038 5465 gene locus_tag LOCUS_10940 4038 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 5602 6645 gene locus_tag LOCUS_10950 5602 6645 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_10950 6632 7474 gene locus_tag LOCUS_10960 6632 7474 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_10960 8443 7502 gene locus_tag LOCUS_10970 8443 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8739 10847 gene locus_tag LOCUS_10980 8739 10847 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_10980 11023 11907 gene locus_tag LOCUS_10990 11023 11907 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_10990 11921 12286 gene locus_tag LOCUS_11000 11921 12286 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_11000 12370 13359 gene locus_tag LOCUS_11010 12370 13359 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_11010 13506 15824 gene locus_tag LOCUS_11020 gene glgP 13506 15824 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_11020 15948 16406 gene locus_tag LOCUS_11030 15948 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 16411 17259 gene locus_tag LOCUS_11040 16411 17259 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_11040 18831 17275 gene locus_tag LOCUS_11050 18831 17275 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_11050 19007 19477 gene locus_tag LOCUS_11060 19007 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 19493 20029 gene locus_tag LOCUS_11070 19493 20029 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_11070 20029 20934 gene locus_tag LOCUS_11080 20029 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 20951 21631 gene locus_tag LOCUS_11090 20951 21631 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_11090 21628 22503 gene locus_tag LOCUS_11100 21628 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 22701 27251 gene locus_tag LOCUS_11110 gene gltB 22701 27251 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_11110 27264 28757 gene locus_tag LOCUS_11120 27264 28757 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_11120 29198 30301 gene locus_tag LOCUS_11130 29198 30301 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_11130 30718 30500 gene locus_tag LOCUS_11140 30718 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 30835 31215 gene locus_tag LOCUS_11150 30835 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 31201 31210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31305 32342 gene locus_tag LOCUS_11160 31305 32342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 33119 32409 gene locus_tag LOCUS_11170 33119 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 33641 33252 gene locus_tag LOCUS_11180 33641 33252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 33889 34575 gene locus_tag LOCUS_11190 33889 34575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 34665 35810 gene locus_tag LOCUS_11200 gene fucO 34665 35810 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_11200 35941 36040 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36314 37921 gene locus_tag LOCUS_11210 36314 37921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 38039 38818 gene locus_tag LOCUS_11220 38039 38818 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 protein_id gnl|my_center|LOCUS_11220 38931 40349 gene locus_tag LOCUS_11230 38931 40349 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_11230 40331 41125 gene locus_tag LOCUS_11240 40331 41125 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_11240 41271 41498 gene locus_tag LOCUS_11250 41271 41498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 41623 44088 gene locus_tag LOCUS_11260 41623 44088 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964979.1 protein_id gnl|my_center|LOCUS_11260 44487 45773 gene locus_tag LOCUS_11270 gene tig 44487 45773 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_11270 45813 46403 gene locus_tag LOCUS_11280 gene clpP 45813 46403 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_11280 46459 47718 gene locus_tag LOCUS_11290 gene clpX 46459 47718 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_11290 47780 50158 gene locus_tag LOCUS_11300 gene lon 47780 50158 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_11300 50159 50758 gene locus_tag LOCUS_11310 gene yihA 50159 50758 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_11310 50764 51987 gene locus_tag LOCUS_11320 gene ytvI 50764 51987 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_11320 52034 53020 gene locus_tag LOCUS_11330 52034 53020 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_11330 53022 53810 gene locus_tag LOCUS_11340 gene truA 53022 53810 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_11340 53789 54271 gene locus_tag LOCUS_11350 53789 54271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 54264 54857 gene locus_tag LOCUS_11360 54264 54857 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763102.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence015 1252 335 gene locus_tag LOCUS_11370 gene metA 1252 335 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_11370 1908 1312 gene locus_tag LOCUS_11380 1908 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3969 1963 gene locus_tag LOCUS_11390 gene ligA 3969 1963 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_11390 4853 4119 gene locus_tag LOCUS_11400 4853 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6177 4831 gene locus_tag LOCUS_11410 gene hflX 6177 4831 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721879.1 protein_id gnl|my_center|LOCUS_11410 8191 6155 gene locus_tag LOCUS_11420 8191 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 8270 8797 gene locus_tag LOCUS_11430 8270 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10549 8834 gene locus_tag LOCUS_11440 10549 8834 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903384.1 protein_id gnl|my_center|LOCUS_11440 12237 10564 gene locus_tag LOCUS_11450 12237 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 13469 12348 gene locus_tag LOCUS_11460 gene glf 13469 12348 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_11460 13644 13462 gene locus_tag LOCUS_11470 13644 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 13864 13610 gene locus_tag LOCUS_11480 13864 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14075 13932 gene locus_tag LOCUS_11490 14075 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 15411 14152 gene locus_tag LOCUS_11500 15411 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 15551 16579 gene locus_tag LOCUS_11510 15551 16579 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_11510 16745 16551 gene locus_tag LOCUS_11520 16745 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 17860 17324 gene locus_tag LOCUS_11530 17860 17324 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194850.1 protein_id gnl|my_center|LOCUS_11530 19157 17871 gene locus_tag LOCUS_11540 19157 17871 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_11540 20908 19361 gene locus_tag LOCUS_11550 gene rny 20908 19361 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_11550 21634 21011 gene locus_tag LOCUS_11560 21634 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 22666 21638 gene locus_tag LOCUS_11570 gene recA 22666 21638 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_11570 23887 23027 gene locus_tag LOCUS_11580 23887 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 24387 23884 gene locus_tag LOCUS_11590 24387 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 24920 24387 gene locus_tag LOCUS_11600 gene pgsA 24920 24387 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_11600 26264 24936 gene locus_tag LOCUS_11610 gene rimO 26264 24936 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_11610 26563 26330 gene locus_tag LOCUS_11620 gene rpoZ 26563 26330 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965026.1 protein_id gnl|my_center|LOCUS_11620 27221 26586 gene locus_tag LOCUS_11630 gene gmk 27221 26586 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_11630 27465 27202 gene locus_tag LOCUS_11640 gene remA 27465 27202 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_11640 28355 27477 gene locus_tag LOCUS_11650 28355 27477 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_11650 28494 30248 gene locus_tag LOCUS_11660 28494 30248 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_11660 31945 30305 gene locus_tag LOCUS_11670 31945 30305 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_11670 33444 31999 gene locus_tag LOCUS_11680 gene glgA 33444 31999 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_11680 34068 33544 gene locus_tag LOCUS_11690 34068 33544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 35206 34160 gene locus_tag LOCUS_11700 35206 34160 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_11700 35341 37173 gene locus_tag LOCUS_11710 35341 37173 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_11710 37352 38698 gene locus_tag LOCUS_11720 37352 38698 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_11720 41087 38664 gene locus_tag LOCUS_11730 41087 38664 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679111.1 protein_id gnl|my_center|LOCUS_11730 42493 41084 gene locus_tag LOCUS_11740 gene melB 42493 41084 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032709637.1 protein_id gnl|my_center|LOCUS_11740 44964 42493 gene locus_tag LOCUS_11750 44964 42493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 45539 44961 gene locus_tag LOCUS_11760 45539 44961 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243160.1 protein_id gnl|my_center|LOCUS_11760 46990 45767 gene locus_tag LOCUS_11770 46990 45767 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_11770 48421 47069 gene locus_tag LOCUS_11780 48421 47069 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_11780 49854 48427 gene locus_tag LOCUS_11790 49854 48427 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence016 184 1236 gene locus_tag LOCUS_11800 184 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1220 2737 gene locus_tag LOCUS_11810 1220 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2715 4319 gene locus_tag LOCUS_11820 2715 4319 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_11820 4316 5365 gene locus_tag LOCUS_11830 gene xylF 4316 5365 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_11830 5573 6733 gene locus_tag LOCUS_11840 gene chvE 5573 6733 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_11840 6896 8440 gene locus_tag LOCUS_11850 gene gguA 6896 8440 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535529.1 protein_id gnl|my_center|LOCUS_11850 8437 9627 gene locus_tag LOCUS_11860 gene gguB 8437 9627 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_11860 9734 11503 gene locus_tag LOCUS_11870 9734 11503 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963863.1 protein_id gnl|my_center|LOCUS_11870 12188 11496 gene locus_tag LOCUS_11880 12188 11496 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_11880 12562 12185 gene locus_tag LOCUS_11890 12562 12185 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_11890 12704 13258 gene locus_tag LOCUS_11900 12704 13258 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_11900 13380 13895 gene locus_tag LOCUS_11910 13380 13895 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_11910 14026 13898 gene locus_tag LOCUS_11920 14026 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 15199 14063 gene locus_tag LOCUS_11930 15199 14063 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_11930 15913 17664 gene locus_tag LOCUS_11940 gene aspS 15913 17664 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_11940 17687 19069 gene locus_tag LOCUS_11950 gene trkA 17687 19069 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_11950 19080 20519 gene locus_tag LOCUS_11960 19080 20519 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_11960 20631 21551 gene locus_tag LOCUS_11970 gene ptb 20631 21551 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_11970 21561 22628 gene locus_tag LOCUS_11980 gene buk 21561 22628 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_11980 22731 23786 gene locus_tag LOCUS_11990 22731 23786 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_11990 23892 25280 gene locus_tag LOCUS_12000 23892 25280 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_12000 26532 25411 gene locus_tag LOCUS_12010 26532 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 27001 29568 gene locus_tag LOCUS_12020 gene secA 27001 29568 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_12020 29737 30879 gene locus_tag LOCUS_12030 gene prfB 29737 30879 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_12030 30723 30822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32084 31545 gene locus_tag LOCUS_12040 32084 31545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 32626 32177 gene locus_tag LOCUS_12050 32626 32177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 32697 32885 gene locus_tag LOCUS_12060 32697 32885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 32809 35223 gene locus_tag LOCUS_12070 32809 35223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 35239 36306 gene locus_tag LOCUS_12080 gene rsmH 35239 36306 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_12080 37064 36309 gene locus_tag LOCUS_12090 37064 36309 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_12090 37277 37486 gene locus_tag LOCUS_12100 37277 37486 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 protein_id gnl|my_center|LOCUS_12100 37492 38004 gene locus_tag LOCUS_12110 37492 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 37997 38995 gene locus_tag LOCUS_12120 37997 38995 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_12120 40332 39004 gene locus_tag LOCUS_12130 40332 39004 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_12130 40741 41733 gene locus_tag LOCUS_12140 40741 41733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 41811 42002 gene locus_tag LOCUS_12150 41811 42002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 42106 42879 gene locus_tag LOCUS_12160 42106 42879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 43264 43962 gene locus_tag LOCUS_12170 43264 43962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_12170 43979 45430 gene locus_tag LOCUS_12180 43979 45430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 45443 46663 gene locus_tag LOCUS_12190 45443 46663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence017 1620 19 gene locus_tag LOCUS_12200 1620 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1930 1766 gene locus_tag LOCUS_12210 1930 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2617 1967 gene locus_tag LOCUS_12220 2617 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2932 2633 gene locus_tag LOCUS_12230 2932 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12230 3281 3003 gene locus_tag LOCUS_12240 3281 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3814 3617 gene locus_tag LOCUS_12250 3814 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4268 4846 gene locus_tag LOCUS_12260 4268 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4843 5697 gene locus_tag LOCUS_12270 4843 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 6789 5872 gene locus_tag LOCUS_12280 6789 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6906 7367 gene locus_tag LOCUS_12290 6906 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 9405 7438 gene locus_tag LOCUS_12300 9405 7438 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_12300 10239 9478 gene locus_tag LOCUS_12310 gene dapB 10239 9478 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_12310 11159 10275 gene locus_tag LOCUS_12320 gene dapA 11159 10275 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_12320 12046 11549 gene locus_tag LOCUS_12330 gene cobO 12046 11549 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_12330 12805 12152 gene locus_tag LOCUS_12340 12805 12152 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_12340 12978 14837 gene locus_tag LOCUS_12350 gene typA 12978 14837 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_12350 16315 14960 gene locus_tag LOCUS_12360 gene mgtE 16315 14960 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_12360 17175 16528 gene locus_tag LOCUS_12370 17175 16528 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_12370 17353 20079 gene locus_tag LOCUS_12380 17353 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 20989 20234 gene locus_tag LOCUS_12390 20989 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 22331 20961 gene locus_tag LOCUS_12400 22331 20961 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_12400 22973 22344 gene locus_tag LOCUS_12410 22973 22344 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583945.1 protein_id gnl|my_center|LOCUS_12410 23104 23030 gene locus_tag LOCUS_t00110 23104 23030 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24059 23235 gene locus_tag LOCUS_12420 24059 23235 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986912.1 protein_id gnl|my_center|LOCUS_12420 25428 24046 gene locus_tag LOCUS_12430 25428 24046 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 protein_id gnl|my_center|LOCUS_12430 25538 26449 gene locus_tag LOCUS_12440 25538 26449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 27421 26654 gene locus_tag LOCUS_12450 27421 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 27771 28526 gene locus_tag LOCUS_12460 27771 28526 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_12460 28542 29255 gene locus_tag LOCUS_12470 28542 29255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_12470 29252 30697 gene locus_tag LOCUS_12480 29252 30697 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_12480 31847 30657 gene locus_tag LOCUS_12490 31847 30657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 32604 31831 gene locus_tag LOCUS_12500 32604 31831 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_12500 33684 32749 gene locus_tag LOCUS_12510 gene cysK 33684 32749 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_12510 34969 33785 gene locus_tag LOCUS_12520 34969 33785 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_12520 36140 34986 gene locus_tag LOCUS_12530 36140 34986 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_12530 36758 36168 gene locus_tag LOCUS_12540 36758 36168 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_12540 38499 36922 gene locus_tag LOCUS_12550 38499 36922 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_12550 40615 38618 gene locus_tag LOCUS_12560 40615 38618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_12560 42345 40612 gene locus_tag LOCUS_12570 42345 40612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_12570 42827 42342 gene locus_tag LOCUS_12580 42827 42342 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015980.1 protein_id gnl|my_center|LOCUS_12580 43699 42977 gene locus_tag LOCUS_12590 43699 42977 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_12590 43836 44432 gene locus_tag LOCUS_12600 43836 44432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 45371 44454 gene locus_tag LOCUS_12610 45371 44454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 46156 45368 gene locus_tag LOCUS_12620 46156 45368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 46476 46156 gene locus_tag LOCUS_12630 46476 46156 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence018 1395 76 gene locus_tag LOCUS_12640 1395 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2212 1418 gene locus_tag LOCUS_12650 gene suhB 2212 1418 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 protein_id gnl|my_center|LOCUS_12650 3589 2279 gene locus_tag LOCUS_12660 3589 2279 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_12660 5172 3622 gene locus_tag LOCUS_12670 5172 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5901 7031 gene locus_tag LOCUS_12680 5901 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7016 7552 gene locus_tag LOCUS_12690 7016 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7691 9124 gene locus_tag LOCUS_12700 7691 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9126 10232 gene locus_tag LOCUS_12710 9126 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 10455 10336 gene locus_tag LOCUS_12720 10455 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 10466 10999 gene locus_tag LOCUS_12730 10466 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 11034 11354 gene locus_tag LOCUS_12740 11034 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 11507 11436 gene locus_tag LOCUS_t00120 11507 11436 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13562 11763 gene locus_tag LOCUS_12750 gene argS 13562 11763 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_12750 14290 13604 gene locus_tag LOCUS_12760 14290 13604 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_12760 15630 14338 gene locus_tag LOCUS_12770 15630 14338 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_12770 17768 15765 gene locus_tag LOCUS_12780 17768 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 18984 17968 gene locus_tag LOCUS_12790 18984 17968 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_12790 19567 19076 gene locus_tag LOCUS_12800 19567 19076 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_12800 20443 19595 gene locus_tag LOCUS_12810 20443 19595 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_12810 22059 20461 gene locus_tag LOCUS_12820 22059 20461 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12820 22653 22339 gene locus_tag LOCUS_12830 22653 22339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 25443 22708 gene locus_tag LOCUS_12840 25443 22708 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_12840 26656 25499 gene locus_tag LOCUS_12850 26656 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 27541 26708 gene locus_tag LOCUS_12860 27541 26708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 27622 28569 gene locus_tag LOCUS_12870 27622 28569 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_12870 29902 28538 gene locus_tag LOCUS_12880 29902 28538 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_12880 30310 29927 gene locus_tag LOCUS_12890 30310 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 30823 30452 gene locus_tag LOCUS_12900 30823 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 32061 30967 gene locus_tag LOCUS_12910 32061 30967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 32131 32349 gene locus_tag LOCUS_12920 32131 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 32491 32418 gene locus_tag LOCUS_t00130 32491 32418 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34011 32677 gene locus_tag LOCUS_12930 34011 32677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 36124 34886 gene locus_tag LOCUS_12940 36124 34886 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861660.1 protein_id gnl|my_center|LOCUS_12940 36297 37271 gene locus_tag LOCUS_12950 36297 37271 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294549.1 protein_id gnl|my_center|LOCUS_12950 37300 37980 gene locus_tag LOCUS_12960 37300 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 39093 38068 gene locus_tag LOCUS_12970 39093 38068 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475456.1 protein_id gnl|my_center|LOCUS_12970 40956 39211 gene locus_tag LOCUS_12980 40956 39211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 41488 40967 gene locus_tag LOCUS_12990 41488 40967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 41944 41567 gene locus_tag LOCUS_13000 41944 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 42099 42974 gene locus_tag LOCUS_13010 42099 42974 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_13010 44151 43102 gene locus_tag LOCUS_13020 44151 43102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 <45991 44361 gene locus_tag LOCUS_13030 <45991 44361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083240.1:ammonium transporter >Feature sequence019 80 220 gene locus_tag LOCUS_13040 80 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3078 406 gene locus_tag LOCUS_13050 3078 406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_13050 3762 3091 gene locus_tag LOCUS_13060 3762 3091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_13060 4787 3864 gene locus_tag LOCUS_13070 4787 3864 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_13070 5457 4780 gene locus_tag LOCUS_13080 5457 4780 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_13080 5794 5522 gene locus_tag LOCUS_13090 5794 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6020 6598 gene locus_tag LOCUS_13100 6020 6598 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_13100 6647 6814 gene locus_tag LOCUS_13110 6647 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6944 7567 gene locus_tag LOCUS_13120 6944 7567 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_13120 7564 7797 gene locus_tag LOCUS_13130 7564 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7797 8264 gene locus_tag LOCUS_13140 7797 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8265 9200 gene locus_tag LOCUS_13150 8265 9200 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_13150 9430 9529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10064 10225 gene locus_tag LOCUS_13160 10064 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10210 10512 gene locus_tag LOCUS_13170 10210 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 10516 12276 gene locus_tag LOCUS_13180 10516 12276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680646.1 protein_id gnl|my_center|LOCUS_13180 12276 14009 gene locus_tag LOCUS_13190 12276 14009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680643.1 protein_id gnl|my_center|LOCUS_13190 14218 14421 gene locus_tag LOCUS_13200 14218 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 14673 16139 gene locus_tag LOCUS_13210 14673 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 16333 17730 gene locus_tag LOCUS_13220 16333 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 17753 19351 gene locus_tag LOCUS_13230 17753 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 19553 20530 gene locus_tag LOCUS_13240 19553 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 20562 21896 gene locus_tag LOCUS_13250 20562 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 21909 22406 gene locus_tag LOCUS_13260 21909 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 22432 24054 gene locus_tag LOCUS_13270 22432 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 24105 24935 gene locus_tag LOCUS_13280 24105 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 24932 25510 gene locus_tag LOCUS_13290 24932 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 25649 26287 gene locus_tag LOCUS_13300 25649 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 26335 26604 gene locus_tag LOCUS_13310 26335 26604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 27080 28006 gene locus_tag LOCUS_13320 27080 28006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 28003 29373 gene locus_tag LOCUS_13330 28003 29373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 29370 30080 gene locus_tag LOCUS_13340 gene rgbR 29370 30080 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_13340 30267 32006 gene locus_tag LOCUS_13350 30267 32006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 32037 32531 gene locus_tag LOCUS_13360 32037 32531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 32535 32750 gene locus_tag LOCUS_13370 32535 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 32763 32891 gene locus_tag LOCUS_13380 32763 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 32912 34216 gene locus_tag LOCUS_13390 32912 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 34248 34376 gene locus_tag LOCUS_13400 34248 34376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 34397 35770 gene locus_tag LOCUS_13410 34397 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 35824 36117 gene locus_tag LOCUS_13420 35824 36117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 37505 36315 gene locus_tag LOCUS_13430 37505 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 38579 39169 gene locus_tag LOCUS_13440 38579 39169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_13440 39162 40028 gene locus_tag LOCUS_13450 39162 40028 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_13450 40443 40036 gene locus_tag LOCUS_13460 40443 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 41033 40440 gene locus_tag LOCUS_13470 41033 40440 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963355.1 protein_id gnl|my_center|LOCUS_13470 41191 41964 gene locus_tag LOCUS_13480 41191 41964 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_13480 42021 43361 gene locus_tag LOCUS_13490 42021 43361 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966105.1 protein_id gnl|my_center|LOCUS_13490 43382 44560 gene locus_tag LOCUS_13500 43382 44560 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_13500 44664 45227 gene locus_tag LOCUS_13510 44664 45227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence020 95 958 gene locus_tag LOCUS_13520 gene ispE 95 958 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_13520 1006 1689 gene locus_tag LOCUS_13530 1006 1689 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_13530 1768 2028 gene locus_tag LOCUS_13540 1768 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2033 2854 gene locus_tag LOCUS_13550 gene murI 2033 2854 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_13550 2880 3323 gene locus_tag LOCUS_13560 2880 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3893 3417 gene locus_tag LOCUS_13570 3893 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4107 5267 gene locus_tag LOCUS_13580 gene tig 4107 5267 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_13580 5274 6593 gene locus_tag LOCUS_13590 5274 6593 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_13590 6627 8105 gene locus_tag LOCUS_13600 gene clpX 6627 8105 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965927.1 protein_id gnl|my_center|LOCUS_13600 8199 9920 gene locus_tag LOCUS_13610 8199 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 9939 10391 gene locus_tag LOCUS_13620 9939 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 10552 10929 gene locus_tag LOCUS_13630 10552 10929 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_13630 10926 11627 gene locus_tag LOCUS_13640 10926 11627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_13640 11621 12433 gene locus_tag LOCUS_13650 11621 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922087.1 protein_id gnl|my_center|LOCUS_13650 13463 12531 gene locus_tag LOCUS_13660 gene arcC 13463 12531 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_13660 13738 14751 gene locus_tag LOCUS_13670 13738 14751 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_13670 14741 15406 gene locus_tag LOCUS_13680 14741 15406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356305.1 protein_id gnl|my_center|LOCUS_13680 15473 16384 gene locus_tag LOCUS_13690 15473 16384 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_13690 16560 16351 gene locus_tag LOCUS_13700 16560 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 16562 17614 gene locus_tag LOCUS_13710 16562 17614 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017178.1 protein_id gnl|my_center|LOCUS_13710 17671 19140 gene locus_tag LOCUS_13720 gene xylB 17671 19140 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_13720 19168 19788 gene locus_tag LOCUS_13730 19168 19788 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_13730 19819 21300 gene locus_tag LOCUS_13740 19819 21300 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_13740 21518 22870 gene locus_tag LOCUS_13750 21518 22870 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_13750 22927 23688 gene locus_tag LOCUS_13760 22927 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 23706 24623 gene locus_tag LOCUS_13770 23706 24623 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_13770 24699 25919 gene locus_tag LOCUS_13780 gene pepT 24699 25919 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_13780 25925 26584 gene locus_tag LOCUS_13790 gene sdaAB 25925 26584 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_13790 26615 27496 gene locus_tag LOCUS_13800 gene sdaAA 26615 27496 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_13800 27647 28273 gene locus_tag LOCUS_13810 27647 28273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 28424 29632 gene locus_tag LOCUS_13820 28424 29632 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 protein_id gnl|my_center|LOCUS_13820 29707 30633 gene locus_tag LOCUS_13830 29707 30633 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 protein_id gnl|my_center|LOCUS_13830 30673 31683 gene locus_tag LOCUS_13840 30673 31683 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053882.1 protein_id gnl|my_center|LOCUS_13840 31685 32470 gene locus_tag LOCUS_13850 31685 32470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 protein_id gnl|my_center|LOCUS_13850 32472 33176 gene locus_tag LOCUS_13860 32472 33176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_13860 33198 34385 gene locus_tag LOCUS_13870 33198 34385 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_13870 34420 35412 gene locus_tag LOCUS_13880 34420 35412 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 protein_id gnl|my_center|LOCUS_13880 35525 36688 gene locus_tag LOCUS_13890 35525 36688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 36942 42155 gene locus_tag LOCUS_13900 36942 42155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 39632 39731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence021 1334 42 gene locus_tag LOCUS_13910 1334 42 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_13910 2286 1894 gene locus_tag LOCUS_13920 2286 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3147 2296 gene locus_tag LOCUS_13930 3147 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4099 3095 gene locus_tag LOCUS_13940 4099 3095 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_13940 5900 4119 gene locus_tag LOCUS_13950 5900 4119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975031.1 protein_id gnl|my_center|LOCUS_13950 6793 5912 gene locus_tag LOCUS_13960 6793 5912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_13960 7819 6809 gene locus_tag LOCUS_13970 7819 6809 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 protein_id gnl|my_center|LOCUS_13970 9473 7887 gene locus_tag LOCUS_13980 9473 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 10133 9525 gene locus_tag LOCUS_13990 10133 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13990 11573 10215 gene locus_tag LOCUS_14000 gene gabT 11573 10215 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_14000 11749 12894 gene locus_tag LOCUS_14010 11749 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13084 12884 gene locus_tag LOCUS_14020 13084 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 13880 13137 gene locus_tag LOCUS_14030 13880 13137 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_14030 14536 14105 gene locus_tag LOCUS_14040 14536 14105 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_14040 15206 14559 gene locus_tag LOCUS_14050 15206 14559 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_14050 16259 15384 gene locus_tag LOCUS_14060 gene rsgA 16259 15384 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_14060 18518 16263 gene locus_tag LOCUS_14070 18518 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 19289 18546 gene locus_tag LOCUS_14080 19289 18546 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_14080 20368 19286 gene locus_tag LOCUS_14090 gene rlmN 20368 19286 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_14090 21726 20365 gene locus_tag LOCUS_14100 gene rsmB 21726 20365 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830124.1 protein_id gnl|my_center|LOCUS_14100 22466 21741 gene locus_tag LOCUS_14110 22466 21741 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642482.1 protein_id gnl|my_center|LOCUS_14110 23439 22501 gene locus_tag LOCUS_14120 gene fmt 23439 22501 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_14120 23930 23457 gene locus_tag LOCUS_14130 gene def 23930 23457 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_14130 26198 23952 gene locus_tag LOCUS_14140 gene priA 26198 23952 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965028.1 protein_id gnl|my_center|LOCUS_14140 27707 26217 gene locus_tag LOCUS_14150 27707 26217 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_14150 28900 27962 gene locus_tag LOCUS_14160 28900 27962 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966234.1 protein_id gnl|my_center|LOCUS_14160 30691 28913 gene locus_tag LOCUS_14170 gene recJ 30691 28913 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_14170 33029 30780 gene locus_tag LOCUS_14180 gene secDF 33029 30780 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_14180 34423 33032 gene locus_tag LOCUS_14190 gene scfB 34423 33032 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_14190 34698 34555 gene locus_tag LOCUS_14200 gene scfA 34698 34555 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_14200 36067 34778 gene locus_tag LOCUS_14210 36067 34778 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14210 36506 36150 gene locus_tag LOCUS_14220 36506 36150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 37904 36558 gene locus_tag LOCUS_14230 37904 36558 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 protein_id gnl|my_center|LOCUS_14230 38432 37917 gene locus_tag LOCUS_14240 38432 37917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 38688 39716 gene locus_tag LOCUS_14250 38688 39716 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_14250 39581 39680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39771 41432 gene locus_tag LOCUS_14260 39771 41432 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence022 621 4 gene locus_tag LOCUS_14270 621 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 975 685 gene locus_tag LOCUS_14280 975 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1955 1149 gene locus_tag LOCUS_14290 1955 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4673 2760 gene locus_tag LOCUS_14300 4673 2760 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_14300 4892 5884 gene locus_tag LOCUS_14310 gene rbsR 4892 5884 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296587.1 protein_id gnl|my_center|LOCUS_14310 5895 7067 gene locus_tag LOCUS_14320 5895 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7774 7106 gene locus_tag LOCUS_14330 7774 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 8001 10388 gene locus_tag LOCUS_14340 8001 10388 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_14340 10410 11834 gene locus_tag LOCUS_14350 10410 11834 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_14350 12046 12594 gene locus_tag LOCUS_14360 12046 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 12608 13417 gene locus_tag LOCUS_14370 12608 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 13980 13456 gene locus_tag LOCUS_14380 13980 13456 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_14380 14193 14492 gene locus_tag LOCUS_14390 14193 14492 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906388.1 protein_id gnl|my_center|LOCUS_14390 14684 14505 gene locus_tag LOCUS_14400 14684 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 15072 16442 gene locus_tag LOCUS_14410 15072 16442 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_14410 17238 16489 gene locus_tag LOCUS_14420 17238 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 17433 19709 gene locus_tag LOCUS_14430 17433 19709 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_14430 19690 20397 gene locus_tag LOCUS_14440 19690 20397 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_14440 21389 20454 gene locus_tag LOCUS_14450 21389 20454 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_14450 21595 23937 gene locus_tag LOCUS_14460 gene yicI 21595 23937 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 protein_id gnl|my_center|LOCUS_14460 24115 24924 gene locus_tag LOCUS_14470 24115 24924 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_14470 25585 24956 gene locus_tag LOCUS_14480 25585 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 26993 25626 gene locus_tag LOCUS_14490 26993 25626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 27675 27001 gene locus_tag LOCUS_14500 27675 27001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_14500 27884 30253 gene locus_tag LOCUS_14510 27884 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 30366 31043 gene locus_tag LOCUS_14520 30366 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 31047 31895 gene locus_tag LOCUS_14530 31047 31895 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_14530 31900 33204 gene locus_tag LOCUS_14540 31900 33204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 33282 34244 gene locus_tag LOCUS_14550 33282 34244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 35722 34235 gene locus_tag LOCUS_14560 35722 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 35888 36544 gene locus_tag LOCUS_14570 gene trmB 35888 36544 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_14570 36581 36898 gene locus_tag LOCUS_14580 gene trxA 36581 36898 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_14580 37004 38350 gene locus_tag LOCUS_14590 37004 38350 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_14590 38366 38965 gene locus_tag LOCUS_14600 38366 38965 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_14600 39138 39212 gene locus_tag LOCUS_t00140 39138 39212 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39380 39811 gene locus_tag LOCUS_14610 39380 39811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 39824 41140 gene locus_tag LOCUS_14620 39824 41140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence023 424 891 gene locus_tag LOCUS_14630 424 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1210 2559 gene locus_tag LOCUS_14640 1210 2559 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_14640 2672 4042 gene locus_tag LOCUS_14650 2672 4042 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_14650 4126 4377 gene locus_tag LOCUS_14660 4126 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_14660 4388 4621 gene locus_tag LOCUS_14670 4388 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4618 5901 gene locus_tag LOCUS_14680 4618 5901 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_14680 6076 7059 gene locus_tag LOCUS_14690 6076 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7074 7730 gene locus_tag LOCUS_14700 7074 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7845 8678 gene locus_tag LOCUS_14710 7845 8678 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_14710 8703 9569 gene locus_tag LOCUS_14720 8703 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 9601 10482 gene locus_tag LOCUS_14730 gene gmuE 9601 10482 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_14730 10495 13197 gene locus_tag LOCUS_14740 10495 13197 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_14740 14767 13169 gene locus_tag LOCUS_14750 14767 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 15842 14784 gene locus_tag LOCUS_14760 15842 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 15927 17012 gene locus_tag LOCUS_14770 15927 17012 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_14770 17243 19045 gene locus_tag LOCUS_14780 17243 19045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 19185 20075 gene locus_tag LOCUS_14790 19185 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 20127 20873 gene locus_tag LOCUS_14800 20127 20873 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_14800 20860 21582 gene locus_tag LOCUS_14810 20860 21582 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_14810 23428 21605 gene locus_tag LOCUS_14820 23428 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 23537 24544 gene locus_tag LOCUS_14830 23537 24544 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 protein_id gnl|my_center|LOCUS_14830 24546 25601 gene locus_tag LOCUS_14840 gene hisC 24546 25601 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_14840 25616 26461 gene locus_tag LOCUS_14850 25616 26461 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455196.1 protein_id gnl|my_center|LOCUS_14850 26477 27391 gene locus_tag LOCUS_14860 26477 27391 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_14860 27388 28266 gene locus_tag LOCUS_14870 gene hslO 27388 28266 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_14870 28277 30223 gene locus_tag LOCUS_14880 28277 30223 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_14880 30302 31045 gene locus_tag LOCUS_14890 30302 31045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 31601 31119 gene locus_tag LOCUS_14900 31601 31119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 31759 33093 gene locus_tag LOCUS_14910 gene glnA 31759 33093 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_14910 33123 33674 gene locus_tag LOCUS_14920 33123 33674 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384488.1 protein_id gnl|my_center|LOCUS_14920 33745 34893 gene locus_tag LOCUS_14930 33745 34893 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_14930 35020 36732 gene locus_tag LOCUS_14940 35020 36732 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458957.1 protein_id gnl|my_center|LOCUS_14940 36830 37678 gene locus_tag LOCUS_14950 gene dapF 36830 37678 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_14950 37702 38916 gene locus_tag LOCUS_14960 37702 38916 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_14960 39461 39069 gene locus_tag LOCUS_14970 39461 39069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence024 1635 136 gene locus_tag LOCUS_14980 1635 136 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_14980 3468 1645 gene locus_tag LOCUS_14990 gene glmS 3468 1645 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_14990 5055 3874 gene locus_tag LOCUS_15000 5055 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5705 5076 gene locus_tag LOCUS_15010 5705 5076 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_15010 8026 5729 gene locus_tag LOCUS_15020 8026 5729 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_15020 9822 8197 gene locus_tag LOCUS_15030 gene groL 9822 8197 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_15030 10149 9865 gene locus_tag LOCUS_15040 10149 9865 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_15040 10845 10375 gene locus_tag LOCUS_15050 10845 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 11138 10833 gene locus_tag LOCUS_15060 11138 10833 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_15060 12189 11254 gene locus_tag LOCUS_15070 12189 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 12922 12224 gene locus_tag LOCUS_15080 12922 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 13587 12925 gene locus_tag LOCUS_15090 13587 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 13764 14858 gene locus_tag LOCUS_15100 13764 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 14887 15591 gene locus_tag LOCUS_15110 14887 15591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_15110 15682 16086 gene locus_tag LOCUS_15120 15682 16086 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_15120 16792 16190 gene locus_tag LOCUS_15130 16792 16190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_15130 17716 17815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18661 18023 gene locus_tag LOCUS_15140 18661 18023 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459001.1 protein_id gnl|my_center|LOCUS_15140 18915 18703 gene locus_tag LOCUS_15150 18915 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 19101 19661 gene locus_tag LOCUS_15160 gene nagB 19101 19661 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_15160 19819 20007 gene locus_tag LOCUS_15170 19819 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 20962 19997 gene locus_tag LOCUS_15180 20962 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 21187 22791 gene locus_tag LOCUS_15190 gene pckA 21187 22791 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_15190 22973 22815 gene locus_tag LOCUS_15200 22973 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 24121 23153 gene locus_tag LOCUS_15210 24121 23153 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_15210 25049 24270 gene locus_tag LOCUS_15220 25049 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 25672 25085 gene locus_tag LOCUS_15230 25672 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 26261 25650 gene locus_tag LOCUS_15240 26261 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 26979 26371 gene locus_tag LOCUS_15250 26979 26371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 27420 26998 gene locus_tag LOCUS_15260 27420 26998 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_15260 28227 27424 gene locus_tag LOCUS_15270 28227 27424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 29402 28338 gene locus_tag LOCUS_15280 29402 28338 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_15280 29624 29484 gene locus_tag LOCUS_15290 29624 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 29782 31122 gene locus_tag LOCUS_15300 29782 31122 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_15300 31141 31788 gene locus_tag LOCUS_15310 31141 31788 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_15310 31974 33860 gene locus_tag LOCUS_15320 31974 33860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 33853 34554 gene locus_tag LOCUS_15330 33853 34554 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_15330 34727 34867 gene locus_tag LOCUS_15340 34727 34867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 35727 36641 gene locus_tag LOCUS_15350 35727 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 37714 36638 gene locus_tag LOCUS_15360 37714 36638 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_15360 37978 38148 gene locus_tag LOCUS_15370 37978 38148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 38498 38337 gene locus_tag LOCUS_15380 38498 38337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 38684 38947 gene locus_tag LOCUS_15390 38684 38947 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_15390 38944 39276 gene locus_tag LOCUS_15400 38944 39276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence025 398 63 gene locus_tag LOCUS_15410 398 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2157 544 gene locus_tag LOCUS_15420 2157 544 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_15420 2517 3989 gene locus_tag LOCUS_15430 2517 3989 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_15430 3993 6137 gene locus_tag LOCUS_15440 gene ftsH 3993 6137 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_15440 6189 8054 gene locus_tag LOCUS_15450 gene uvrC 6189 8054 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_15450 8185 9132 gene locus_tag LOCUS_15460 gene hprK 8185 9132 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_15460 9173 10114 gene locus_tag LOCUS_15470 9173 10114 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_15470 10141 11061 gene locus_tag LOCUS_15480 gene murB 10141 11061 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_15480 11145 12011 gene locus_tag LOCUS_15490 gene rapZ 11145 12011 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_15490 12029 12247 gene locus_tag LOCUS_15500 12029 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 12146 12155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12396 12914 gene locus_tag LOCUS_15510 12396 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12930 13190 gene locus_tag LOCUS_15520 12930 13190 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_15520 13301 14200 gene locus_tag LOCUS_15530 13301 14200 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_15530 14915 14394 gene locus_tag LOCUS_15540 14915 14394 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_15540 15036 15878 gene locus_tag LOCUS_15550 15036 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 15909 17879 gene locus_tag LOCUS_15560 gene metG 15909 17879 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_15560 17925 18869 gene locus_tag LOCUS_15570 17925 18869 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_15570 18885 19460 gene locus_tag LOCUS_15580 18885 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 19472 19957 gene locus_tag LOCUS_15590 19472 19957 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766887.1 protein_id gnl|my_center|LOCUS_15590 19968 20669 gene locus_tag LOCUS_15600 19968 20669 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710135.1 protein_id gnl|my_center|LOCUS_15600 20672 22159 gene locus_tag LOCUS_15610 20672 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 22358 23467 gene locus_tag LOCUS_15620 gene ugpC 22358 23467 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_15620 23548 24747 gene locus_tag LOCUS_15630 23548 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 24633 24732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24872 25699 gene locus_tag LOCUS_15640 24872 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 25769 27685 gene locus_tag LOCUS_15650 25769 27685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 28010 28564 gene locus_tag LOCUS_15660 gene tadA 28010 28564 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_15660 28542 29936 gene locus_tag LOCUS_15670 28542 29936 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_15670 30055 32211 gene locus_tag LOCUS_15680 gene nrdD 30055 32211 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_15680 32211 32696 gene locus_tag LOCUS_15690 gene nrdG 32211 32696 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_15690 32714 33067 gene locus_tag LOCUS_15700 32714 33067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15700 33040 33315 gene locus_tag LOCUS_15710 33040 33315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15710 33457 34035 gene locus_tag LOCUS_15720 33457 34035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15720 34064 34525 gene locus_tag LOCUS_15730 34064 34525 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_15730 34522 35061 gene locus_tag LOCUS_15740 34522 35061 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 protein_id gnl|my_center|LOCUS_15740 35214 36113 gene locus_tag LOCUS_15750 35214 36113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 36256 37758 gene locus_tag LOCUS_15760 36256 37758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 38860 37853 gene locus_tag LOCUS_15770 38860 37853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence026 1368 3365 gene locus_tag LOCUS_15780 1368 3365 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_15780 3472 3600 gene locus_tag LOCUS_15790 3472 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3766 4158 gene locus_tag LOCUS_15800 3766 4158 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_15800 4173 5012 gene locus_tag LOCUS_15810 4173 5012 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_15810 5009 5755 gene locus_tag LOCUS_15820 5009 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5970 6668 gene locus_tag LOCUS_15830 5970 6668 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_15830 6757 7635 gene locus_tag LOCUS_15840 6757 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15840 7716 8339 gene locus_tag LOCUS_15850 7716 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15850 8323 9069 gene locus_tag LOCUS_15860 8323 9069 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_15860 9087 9698 gene locus_tag LOCUS_15870 9087 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 9811 9886 gene locus_tag LOCUS_t00150 9811 9886 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10177 11502 gene locus_tag LOCUS_15880 10177 11502 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_15880 11585 13093 gene locus_tag LOCUS_15890 11585 13093 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_15890 13111 14763 gene locus_tag LOCUS_15900 13111 14763 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_15900 14934 16538 gene locus_tag LOCUS_15910 14934 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 16541 18364 gene locus_tag LOCUS_15920 16541 18364 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_15920 18361 19338 gene locus_tag LOCUS_15930 18361 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 19373 20434 gene locus_tag LOCUS_15940 gene mglB 19373 20434 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365711.1 protein_id gnl|my_center|LOCUS_15940 20492 21061 gene locus_tag LOCUS_15950 20492 21061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 21145 21903 gene locus_tag LOCUS_15960 21145 21903 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_15960 22746 21958 gene locus_tag LOCUS_15970 22746 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 22895 23026 gene locus_tag LOCUS_15980 22895 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 23092 26046 gene locus_tag LOCUS_15990 23092 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 26262 27812 gene locus_tag LOCUS_16000 gene cls 26262 27812 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775565.1 protein_id gnl|my_center|LOCUS_16000 30370 27935 gene locus_tag LOCUS_16010 30370 27935 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_16010 30753 31763 gene locus_tag LOCUS_16020 30753 31763 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_16020 31844 33292 gene locus_tag LOCUS_16030 31844 33292 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 protein_id gnl|my_center|LOCUS_16030 33413 34306 gene locus_tag LOCUS_16040 33413 34306 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_16040 34309 35178 gene locus_tag LOCUS_16050 34309 35178 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_16050 35325 35483 gene locus_tag LOCUS_16060 35325 35483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 35638 36801 gene locus_tag LOCUS_16070 35638 36801 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_16070 36813 37862 gene locus_tag LOCUS_16080 36813 37862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 37859 38494 gene locus_tag LOCUS_16090 37859 38494 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_16090 38491 38976 gene locus_tag LOCUS_16100 38491 38976 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989714.1 protein_id gnl|my_center|LOCUS_16100 39145 39071 gene locus_tag LOCUS_t00160 39145 39071 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39232 39160 gene locus_tag LOCUS_t00170 39232 39160 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 39346 39272 gene locus_tag LOCUS_t00180 39346 39272 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 126 1502 gene locus_tag LOCUS_16110 126 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1514 2812 gene locus_tag LOCUS_16120 1514 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2809 4572 gene locus_tag LOCUS_16130 2809 4572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_16130 4587 5633 gene locus_tag LOCUS_16140 4587 5633 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013281911.1 protein_id gnl|my_center|LOCUS_16140 5614 6384 gene locus_tag LOCUS_16150 5614 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6403 7344 gene locus_tag LOCUS_16160 6403 7344 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144136388.1 protein_id gnl|my_center|LOCUS_16160 7331 8479 gene locus_tag LOCUS_16170 7331 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 8479 9630 gene locus_tag LOCUS_16180 8479 9630 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650924.1 protein_id gnl|my_center|LOCUS_16180 9632 10186 gene locus_tag LOCUS_16190 9632 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10197 11225 gene locus_tag LOCUS_16200 10197 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11247 12257 gene locus_tag LOCUS_16210 11247 12257 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_16210 12262 13506 gene locus_tag LOCUS_16220 12262 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13473 15002 gene locus_tag LOCUS_16230 13473 15002 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_16230 15009 16064 gene locus_tag LOCUS_16240 15009 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 16069 16998 gene locus_tag LOCUS_16250 16069 16998 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056838.1 protein_id gnl|my_center|LOCUS_16250 17021 18196 gene locus_tag LOCUS_16260 17021 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 18193 19293 gene locus_tag LOCUS_16270 18193 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 19290 20342 gene locus_tag LOCUS_16280 19290 20342 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061516.1 protein_id gnl|my_center|LOCUS_16280 20339 22246 gene locus_tag LOCUS_16290 20339 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 22224 23429 gene locus_tag LOCUS_16300 22224 23429 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_16300 23371 24996 gene locus_tag LOCUS_16310 23371 24996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 24981 26720 gene locus_tag LOCUS_16320 24981 26720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_16320 26717 27595 gene locus_tag LOCUS_16330 26717 27595 CDS product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794519.1 protein_id gnl|my_center|LOCUS_16330 27619 29199 gene locus_tag LOCUS_16340 27619 29199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476406.1 protein_id gnl|my_center|LOCUS_16340 29201 30358 gene locus_tag LOCUS_16350 29201 30358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 30336 31805 gene locus_tag LOCUS_16360 30336 31805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 31793 33010 gene locus_tag LOCUS_16370 31793 33010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 33007 33903 gene locus_tag LOCUS_16380 33007 33903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 33848 35011 gene locus_tag LOCUS_16390 33848 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 35011 35730 gene locus_tag LOCUS_16400 35011 35730 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_16400 35727 36116 gene locus_tag LOCUS_16410 35727 36116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 36097 37212 gene locus_tag LOCUS_16420 36097 37212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 37197 38105 gene locus_tag LOCUS_16430 37197 38105 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence028 174 1865 gene locus_tag LOCUS_16440 174 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2368 4506 gene locus_tag LOCUS_16450 2368 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 4528 5376 gene locus_tag LOCUS_16460 4528 5376 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_16460 5724 6767 gene locus_tag LOCUS_16470 gene pheS 5724 6767 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 protein_id gnl|my_center|LOCUS_16470 6787 9231 gene locus_tag LOCUS_16480 gene pheT 6787 9231 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_16480 9248 10660 gene locus_tag LOCUS_16490 9248 10660 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_16490 10660 11721 gene locus_tag LOCUS_16500 gene queA 10660 11721 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_16500 11762 12106 gene locus_tag LOCUS_16510 11762 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 12139 12612 gene locus_tag LOCUS_16520 12139 12612 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966355.1 protein_id gnl|my_center|LOCUS_16520 13549 12602 gene locus_tag LOCUS_16530 13549 12602 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_16530 13702 14379 gene locus_tag LOCUS_16540 13702 14379 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_16540 14414 14641 gene locus_tag LOCUS_16550 14414 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 14668 15156 gene locus_tag LOCUS_16560 14668 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 15143 17161 gene locus_tag LOCUS_16570 15143 17161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 17163 18098 gene locus_tag LOCUS_16580 gene atpG 17163 18098 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_16580 18098 19495 gene locus_tag LOCUS_16590 gene atpD 18098 19495 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_16590 19532 19948 gene locus_tag LOCUS_16600 19532 19948 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_16600 21101 20001 gene locus_tag LOCUS_16610 gene tyrA 21101 20001 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_16610 21353 23443 gene locus_tag LOCUS_16620 gene fusA 21353 23443 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_16620 23614 26025 gene locus_tag LOCUS_16630 gene leuS 23614 26025 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 protein_id gnl|my_center|LOCUS_16630 26358 26089 gene locus_tag LOCUS_16640 26358 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 26857 26348 gene locus_tag LOCUS_16650 26857 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 27047 27280 gene locus_tag LOCUS_16660 27047 27280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 27425 27970 gene locus_tag LOCUS_16670 27425 27970 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_16670 27960 28331 gene locus_tag LOCUS_16680 27960 28331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 28315 28941 gene locus_tag LOCUS_16690 28315 28941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 28938 29555 gene locus_tag LOCUS_16700 28938 29555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 29635 29928 gene locus_tag LOCUS_16710 29635 29928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 30033 30647 gene locus_tag LOCUS_16720 30033 30647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 30769 31950 gene locus_tag LOCUS_16730 30769 31950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence029 820 92 gene locus_tag LOCUS_16740 gene rsmG 820 92 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_16740 2750 822 gene locus_tag LOCUS_16750 gene mnmG 2750 822 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_16750 3498 2794 gene locus_tag LOCUS_16760 3498 2794 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_16760 4356 3535 gene locus_tag LOCUS_16770 4356 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5760 4375 gene locus_tag LOCUS_16780 gene mnmE 5760 4375 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_16780 6451 5828 gene locus_tag LOCUS_16790 6451 5828 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_16790 7808 6465 gene locus_tag LOCUS_16800 7808 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 8445 8068 gene locus_tag LOCUS_16810 gene rnpA 8445 8068 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_16810 8625 8491 gene locus_tag LOCUS_16820 gene rpmH 8625 8491 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_16820 8923 10281 gene locus_tag LOCUS_16830 gene dnaA 8923 10281 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_16830 10486 11595 gene locus_tag LOCUS_16840 gene dnaN 10486 11595 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_16840 11622 11831 gene locus_tag LOCUS_16850 11622 11831 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_16850 11840 12925 gene locus_tag LOCUS_16860 gene recF 11840 12925 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_16860 12955 14883 gene locus_tag LOCUS_16870 gene gyrB 12955 14883 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435993.1 protein_id gnl|my_center|LOCUS_16870 14919 17462 gene locus_tag LOCUS_16880 gene gyrA 14919 17462 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_16880 17477 18670 gene locus_tag LOCUS_16890 17477 18670 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_16890 18719 20248 gene locus_tag LOCUS_16900 18719 20248 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_16900 21341 20289 gene locus_tag LOCUS_16910 21341 20289 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_16910 21988 21422 gene locus_tag LOCUS_16920 21988 21422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 23262 22339 gene locus_tag LOCUS_16930 23262 22339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 23611 23252 gene locus_tag LOCUS_16940 23611 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 26292 23665 gene locus_tag LOCUS_16950 26292 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 26908 28359 gene locus_tag LOCUS_16960 26908 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 28320 28943 gene locus_tag LOCUS_16970 28320 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 28940 29713 gene locus_tag LOCUS_16980 28940 29713 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_16980 29664 30581 gene locus_tag LOCUS_16990 29664 30581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_16990 31205 30636 gene locus_tag LOCUS_17000 31205 30636 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_17000 31687 31202 gene locus_tag LOCUS_17010 31687 31202 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_17010 32025 32642 gene locus_tag LOCUS_17020 32025 32642 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_17020 32687 33232 gene locus_tag LOCUS_17030 32687 33232 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_17030 33165 34094 gene locus_tag LOCUS_17040 33165 34094 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_17040 34261 35010 gene locus_tag LOCUS_17050 34261 35010 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964759.1 protein_id gnl|my_center|LOCUS_17050 35151 35528 gene locus_tag LOCUS_17060 35151 35528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 35512 35688 gene locus_tag LOCUS_17070 35512 35688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence030 <1 2634 gene locus_tag LOCUS_17080 <1 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861890.1:valine--tRNA ligase 2662 3972 gene locus_tag LOCUS_17090 2662 3972 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_17090 3959 4117 gene locus_tag LOCUS_17100 3959 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4122 5543 gene locus_tag LOCUS_17110 4122 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5700 6008 gene locus_tag LOCUS_17120 gene spoIIAA 5700 6008 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_17120 6050 6553 gene locus_tag LOCUS_17130 gene spoIIAB 6050 6553 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_17130 6560 7276 gene locus_tag LOCUS_17140 gene sigF 6560 7276 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_17140 7336 8496 gene locus_tag LOCUS_17150 7336 8496 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_17150 8493 11117 gene locus_tag LOCUS_17160 8493 11117 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_17160 11190 12593 gene locus_tag LOCUS_17170 11190 12593 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_17170 12611 13654 gene locus_tag LOCUS_17180 12611 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 13839 15896 gene locus_tag LOCUS_17190 gene htpG 13839 15896 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_17190 15959 17209 gene locus_tag LOCUS_17200 15959 17209 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966518.1 protein_id gnl|my_center|LOCUS_17200 17365 20913 gene locus_tag LOCUS_17210 17365 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 20926 22251 gene locus_tag LOCUS_17220 20926 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 22270 23103 gene locus_tag LOCUS_17230 22270 23103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 23117 24301 gene locus_tag LOCUS_17240 23117 24301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 24392 25285 gene locus_tag LOCUS_17250 24392 25285 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182488.1 protein_id gnl|my_center|LOCUS_17250 25413 26015 gene locus_tag LOCUS_17260 25413 26015 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_17260 26032 26802 gene locus_tag LOCUS_17270 26032 26802 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_17270 26888 27595 gene locus_tag LOCUS_17280 26888 27595 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_17280 27616 29025 gene locus_tag LOCUS_17290 gene purF 27616 29025 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_17290 29038 30489 gene locus_tag LOCUS_17300 gene purB 29038 30489 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_17300 30773 32179 gene locus_tag LOCUS_17310 gene rho 30773 32179 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_17310 32289 32495 gene locus_tag LOCUS_17320 gene rpmE 32289 32495 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_17320 32562 33560 gene locus_tag LOCUS_17330 32562 33560 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_17330 33564 34403 gene locus_tag LOCUS_17340 gene prmC 33564 34403 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970073.1 protein_id gnl|my_center|LOCUS_17340 34406 35485 gene locus_tag LOCUS_17350 gene prfA 34406 35485 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence031 1516 170 gene locus_tag LOCUS_17360 gene gdhA 1516 170 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_17360 2104 1673 gene locus_tag LOCUS_17370 2104 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3339 2251 gene locus_tag LOCUS_17380 3339 2251 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_17380 4652 3351 gene locus_tag LOCUS_17390 4652 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4758 4685 gene locus_tag LOCUS_t00190 4758 4685 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5796 4867 gene locus_tag LOCUS_17400 5796 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6475 5918 gene locus_tag LOCUS_17410 gene efp 6475 5918 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_17410 7011 6574 gene locus_tag LOCUS_17420 gene aroQ 7011 6574 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_17420 7553 7008 gene locus_tag LOCUS_17430 7553 7008 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_17430 8426 7560 gene locus_tag LOCUS_17440 8426 7560 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_17440 8966 8430 gene locus_tag LOCUS_17450 8966 8430 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_17450 9486 9076 gene locus_tag LOCUS_17460 9486 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10343 9600 gene locus_tag LOCUS_17470 10343 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 11155 10343 gene locus_tag LOCUS_17480 11155 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 11951 11148 gene locus_tag LOCUS_17490 11951 11148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810093.1 protein_id gnl|my_center|LOCUS_17490 12908 11967 gene locus_tag LOCUS_17500 12908 11967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_17500 14446 12932 gene locus_tag LOCUS_17510 14446 12932 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_17510 15053 14604 gene locus_tag LOCUS_17520 gene nrdR 15053 14604 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_17520 15343 15110 gene locus_tag LOCUS_17530 15343 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 15473 16252 gene locus_tag LOCUS_17540 gene sigG 15473 16252 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_17540 16980 16237 gene locus_tag LOCUS_17550 gene sigE 16980 16237 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_17550 17786 16992 gene locus_tag LOCUS_17560 17786 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 19268 17952 gene locus_tag LOCUS_17570 19268 17952 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_17570 20535 19342 gene locus_tag LOCUS_17580 gene ftsZ 20535 19342 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_17580 21471 20653 gene locus_tag LOCUS_17590 21471 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 22780 21530 gene locus_tag LOCUS_17600 gene murA 22780 21530 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_17600 24016 22853 gene locus_tag LOCUS_17610 gene spoVE 24016 22853 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_17610 25383 24022 gene locus_tag LOCUS_17620 gene murD 25383 24022 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_17620 27142 25415 gene locus_tag LOCUS_17630 27142 25415 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_17630 29460 27220 gene locus_tag LOCUS_17640 29460 27220 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_17640 30002 29472 gene locus_tag LOCUS_17650 30002 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 30952 30017 gene locus_tag LOCUS_17660 gene rsmH 30952 30017 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_17660 31401 30964 gene locus_tag LOCUS_17670 gene mraZ 31401 30964 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_17670 32802 31705 gene locus_tag LOCUS_17680 gene ychF 32802 31705 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_17680 33724 32918 gene locus_tag LOCUS_17690 33724 32918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 34011 33805 gene locus_tag LOCUS_17700 34011 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 34433 34245 gene locus_tag LOCUS_17710 34433 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 34719 35042 gene locus_tag LOCUS_17720 34719 35042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence032 292 1482 gene locus_tag LOCUS_17730 292 1482 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_17730 1508 1978 gene locus_tag LOCUS_17740 1508 1978 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240524.1 protein_id gnl|my_center|LOCUS_17740 3215 2061 gene locus_tag LOCUS_17750 3215 2061 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_17750 3378 3722 gene locus_tag LOCUS_17760 3378 3722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_17760 3736 5040 gene locus_tag LOCUS_17770 3736 5040 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_17770 5069 5476 gene locus_tag LOCUS_17780 gene mscL 5069 5476 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_17780 5469 6368 gene locus_tag LOCUS_17790 5469 6368 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_17790 6389 7189 gene locus_tag LOCUS_17800 6389 7189 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_17800 7295 9061 gene locus_tag LOCUS_17810 gene aspS 7295 9061 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_17810 9065 10441 gene locus_tag LOCUS_17820 9065 10441 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_17820 10465 11514 gene locus_tag LOCUS_17830 10465 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 11679 11942 gene locus_tag LOCUS_17840 11679 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 11945 12880 gene locus_tag LOCUS_17850 gene pyrF 11945 12880 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_17850 12939 13505 gene locus_tag LOCUS_17860 12939 13505 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_17860 13506 13913 gene locus_tag LOCUS_17870 13506 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 13913 14401 gene locus_tag LOCUS_17880 13913 14401 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_17880 14500 15240 gene locus_tag LOCUS_17890 14500 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 15362 16039 gene locus_tag LOCUS_17900 gene pyrE 15362 16039 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_17900 16067 16219 gene locus_tag LOCUS_17910 16067 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 16281 16622 gene locus_tag LOCUS_17920 16281 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 16622 18700 gene locus_tag LOCUS_17930 16622 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 18785 19294 gene locus_tag LOCUS_17940 gene purE 18785 19294 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_17940 19328 20353 gene locus_tag LOCUS_17950 gene purM 19328 20353 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_17950 20347 20973 gene locus_tag LOCUS_17960 gene purN 20347 20973 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_17960 21006 22277 gene locus_tag LOCUS_17970 gene purD 21006 22277 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_17970 22307 22768 gene locus_tag LOCUS_17980 22307 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 22780 24114 gene locus_tag LOCUS_17990 22780 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 24265 24639 gene locus_tag LOCUS_18000 24265 24639 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_18000 24641 27079 gene locus_tag LOCUS_18010 24641 27079 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723897.1 protein_id gnl|my_center|LOCUS_18010 27142 27555 gene locus_tag LOCUS_18020 27142 27555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 27614 28984 gene locus_tag LOCUS_18030 gene radA 27614 28984 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_18030 29113 30225 gene locus_tag LOCUS_18040 29113 30225 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_18040 30245 31243 gene locus_tag LOCUS_18050 gene cytR 30245 31243 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 protein_id gnl|my_center|LOCUS_18050 31293 31364 gene locus_tag LOCUS_t00200 31293 31364 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 31517 33070 gene locus_tag LOCUS_18060 gene malQ 31517 33070 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_18060 33067 34761 gene locus_tag LOCUS_18070 33067 34761 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence033 2430 154 gene locus_tag LOCUS_18080 2430 154 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546735.1 protein_id gnl|my_center|LOCUS_18080 3420 2464 gene locus_tag LOCUS_18090 3420 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4913 3432 gene locus_tag LOCUS_18100 4913 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5603 4923 gene locus_tag LOCUS_18110 5603 4923 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_18110 6303 5653 gene locus_tag LOCUS_18120 6303 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 6848 6417 gene locus_tag LOCUS_18130 6848 6417 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395139.1 protein_id gnl|my_center|LOCUS_18130 8450 6927 gene locus_tag LOCUS_18140 8450 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 9655 8465 gene locus_tag LOCUS_18150 9655 8465 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_18150 10583 9681 gene locus_tag LOCUS_18160 gene argB 10583 9681 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_18160 11834 10611 gene locus_tag LOCUS_18170 gene argJ 11834 10611 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_18170 12305 11859 gene locus_tag LOCUS_18180 12305 11859 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_18180 12873 12310 gene locus_tag LOCUS_18190 12873 12310 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_18190 13856 12903 gene locus_tag LOCUS_18200 gene argC 13856 12903 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_18200 14077 15339 gene locus_tag LOCUS_18210 14077 15339 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_18210 15359 15652 gene locus_tag LOCUS_18220 15359 15652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 15679 16398 gene locus_tag LOCUS_18230 15679 16398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 17229 16393 gene locus_tag LOCUS_18240 17229 16393 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_18240 17443 18597 gene locus_tag LOCUS_18250 17443 18597 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_18250 18600 19616 gene locus_tag LOCUS_18260 18600 19616 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_18260 19642 20154 gene locus_tag LOCUS_18270 19642 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 22112 20208 gene locus_tag LOCUS_18280 22112 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 23470 22109 gene locus_tag LOCUS_18290 23470 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 24319 23474 gene locus_tag LOCUS_18300 24319 23474 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_18300 26384 24408 gene locus_tag LOCUS_18310 26384 24408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 26656 26808 gene locus_tag LOCUS_18320 26656 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 26792 27469 gene locus_tag LOCUS_18330 26792 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 28277 27537 gene locus_tag LOCUS_18340 28277 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 28636 28448 gene locus_tag LOCUS_18350 28636 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 29876 28737 gene locus_tag LOCUS_18360 29876 28737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 30140 29961 gene locus_tag LOCUS_18370 30140 29961 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_18370 32762 30171 gene locus_tag LOCUS_18380 gene clpB 32762 30171 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_18380 33835 32924 gene locus_tag LOCUS_18390 33835 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 <34617 34101 gene locus_tag LOCUS_18400 <34617 34101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015782.1:ATP-binding protein >Feature sequence034 498 2246 gene locus_tag LOCUS_18410 498 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2259 11243 gene locus_tag LOCUS_18420 2259 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 11268 11567 gene locus_tag LOCUS_18430 11268 11567 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_18430 11606 12943 gene locus_tag LOCUS_18440 11606 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 12957 13805 gene locus_tag LOCUS_18450 gene ispH 12957 13805 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_18450 13786 14922 gene locus_tag LOCUS_18460 gene rpsA 13786 14922 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_18460 15030 15812 gene locus_tag LOCUS_18470 15030 15812 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460804.1 protein_id gnl|my_center|LOCUS_18470 16973 15870 gene locus_tag LOCUS_18480 16973 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 17127 18446 gene locus_tag LOCUS_18490 gene rsxC 17127 18446 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_18490 18459 19391 gene locus_tag LOCUS_18500 18459 19391 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_18500 19388 19999 gene locus_tag LOCUS_18510 19388 19999 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_18510 19999 20691 gene locus_tag LOCUS_18520 19999 20691 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_18520 20678 21262 gene locus_tag LOCUS_18530 gene rsxA 20678 21262 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_18530 21275 22075 gene locus_tag LOCUS_18540 21275 22075 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_18540 22089 23117 gene locus_tag LOCUS_18550 22089 23117 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_18550 24104 23130 gene locus_tag LOCUS_18560 24104 23130 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_18560 24264 25415 gene locus_tag LOCUS_18570 24264 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 26220 25426 gene locus_tag LOCUS_18580 26220 25426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 26343 26966 gene locus_tag LOCUS_18590 26343 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 27063 28550 gene locus_tag LOCUS_18600 gene thrC 27063 28550 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_18600 29994 28627 gene locus_tag LOCUS_18610 29994 28627 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_18610 30502 30720 gene locus_tag LOCUS_18620 30502 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 30795 32270 gene locus_tag LOCUS_18630 30795 32270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 32267 32734 gene locus_tag LOCUS_18640 32267 32734 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_18640 33213 33398 gene locus_tag LOCUS_18650 33213 33398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence035 2789 987 gene locus_tag LOCUS_18660 2789 987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 protein_id gnl|my_center|LOCUS_18660 3732 2791 gene locus_tag LOCUS_18670 3732 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3858 4769 gene locus_tag LOCUS_18680 3858 4769 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246321.1 protein_id gnl|my_center|LOCUS_18680 5764 4733 gene locus_tag LOCUS_18690 gene hydE 5764 4733 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_18690 6640 5771 gene locus_tag LOCUS_18700 gene rsmA 6640 5771 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_18700 7451 6654 gene locus_tag LOCUS_18710 7451 6654 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_18710 7572 7645 gene locus_tag LOCUS_t00210 7572 7645 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7791 10523 gene locus_tag LOCUS_18720 7791 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 10545 12461 gene locus_tag LOCUS_18730 gene glgB 10545 12461 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_18730 12557 15667 gene locus_tag LOCUS_18740 12557 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 15669 16799 gene locus_tag LOCUS_18750 15669 16799 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080946.1 protein_id gnl|my_center|LOCUS_18750 16832 17308 gene locus_tag LOCUS_18760 16832 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 17572 17270 gene locus_tag LOCUS_18770 17572 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 17736 17939 gene locus_tag LOCUS_18780 17736 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 19239 17947 gene locus_tag LOCUS_18790 19239 17947 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_18790 21038 19269 gene locus_tag LOCUS_18800 21038 19269 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582799.1 protein_id gnl|my_center|LOCUS_18800 21964 21065 gene locus_tag LOCUS_18810 21964 21065 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_18810 23129 21969 gene locus_tag LOCUS_18820 23129 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 23565 23664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23683 24342 gene locus_tag LOCUS_18830 23683 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 24401 25747 gene locus_tag LOCUS_18840 24401 25747 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227575.1 protein_id gnl|my_center|LOCUS_18840 25831 26703 gene locus_tag LOCUS_18850 25831 26703 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_18850 26700 27533 gene locus_tag LOCUS_18860 26700 27533 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_18860 29800 28307 gene locus_tag LOCUS_18870 29800 28307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 31556 29817 gene locus_tag LOCUS_18880 31556 29817 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_18880 32420 31593 gene locus_tag LOCUS_18890 32420 31593 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_18890 33304 32417 gene locus_tag LOCUS_18900 33304 32417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence036 249 1736 gene locus_tag LOCUS_18910 249 1736 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_18910 2071 1829 gene locus_tag LOCUS_18920 2071 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2141 2359 gene locus_tag LOCUS_18930 2141 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2290 2457 gene locus_tag LOCUS_18940 2290 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2610 2795 gene locus_tag LOCUS_18950 2610 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3228 3016 gene locus_tag LOCUS_18960 3228 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3370 3909 gene locus_tag LOCUS_18970 3370 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 3909 4610 gene locus_tag LOCUS_18980 3909 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 5626 4652 gene locus_tag LOCUS_18990 5626 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6245 8356 gene locus_tag LOCUS_19000 6245 8356 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_19000 8438 8962 gene locus_tag LOCUS_19010 8438 8962 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_19010 9044 11086 gene locus_tag LOCUS_19020 9044 11086 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812357.1 protein_id gnl|my_center|LOCUS_19020 11237 11512 gene locus_tag LOCUS_19030 11237 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 11518 12036 gene locus_tag LOCUS_19040 11518 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12069 13679 gene locus_tag LOCUS_19050 gene flgK 12069 13679 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 protein_id gnl|my_center|LOCUS_19050 13708 15537 gene locus_tag LOCUS_19060 13708 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 15567 17129 gene locus_tag LOCUS_19070 15567 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 17161 17619 gene locus_tag LOCUS_19080 17161 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 17620 17838 gene locus_tag LOCUS_19090 gene csrA 17620 17838 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_19090 17936 18367 gene locus_tag LOCUS_19100 17936 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 18379 19923 gene locus_tag LOCUS_19110 gene fliD 18379 19923 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037105.1 protein_id gnl|my_center|LOCUS_19110 19925 20311 gene locus_tag LOCUS_19120 gene fliS 19925 20311 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_19120 20308 20784 gene locus_tag LOCUS_19130 20308 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 21002 21337 gene locus_tag LOCUS_19140 21002 21337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 22686 21385 gene locus_tag LOCUS_19150 22686 21385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 22961 23110 gene locus_tag LOCUS_19160 gene rpmG 22961 23110 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_19160 23155 23364 gene locus_tag LOCUS_19170 23155 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 23382 23900 gene locus_tag LOCUS_19180 gene nusG 23382 23900 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_19180 24078 24503 gene locus_tag LOCUS_19190 gene rplK 24078 24503 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_19190 24564 25253 gene locus_tag LOCUS_19200 gene rplA 24564 25253 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_19200 25432 26682 gene locus_tag LOCUS_19210 25432 26682 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854536.1 protein_id gnl|my_center|LOCUS_19210 26918 27493 gene locus_tag LOCUS_19220 gene rplJ 26918 27493 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_19220 27558 27935 gene locus_tag LOCUS_19230 gene rplL 27558 27935 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_19230 28260 32054 gene locus_tag LOCUS_19240 gene rpoB 28260 32054 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence037 766 329 gene locus_tag LOCUS_19250 766 329 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523668.1 protein_id gnl|my_center|LOCUS_19250 1478 780 gene locus_tag LOCUS_19260 1478 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1989 1510 gene locus_tag LOCUS_19270 1989 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4750 2012 gene locus_tag LOCUS_19280 4750 2012 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_19280 6908 5367 gene locus_tag LOCUS_19290 gene guaA 6908 5367 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_19290 7309 7040 gene locus_tag LOCUS_19300 gene spoIIID 7309 7040 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_19300 10387 7376 gene locus_tag LOCUS_19310 10387 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 10571 10368 gene locus_tag LOCUS_19320 10571 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 10548 11042 gene locus_tag LOCUS_19330 10548 11042 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869013.1 protein_id gnl|my_center|LOCUS_19330 13632 11098 gene locus_tag LOCUS_19340 13632 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 14790 13633 gene locus_tag LOCUS_19350 14790 13633 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_19350 15192 14803 gene locus_tag LOCUS_19360 15192 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 15752 15348 gene locus_tag LOCUS_19370 15752 15348 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_19370 17155 15764 gene locus_tag LOCUS_19380 gene atpD 17155 15764 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_19380 18078 17197 gene locus_tag LOCUS_19390 gene atpG 18078 17197 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_19390 19610 18105 gene locus_tag LOCUS_19400 gene atpA 19610 18105 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_19400 20191 19637 gene locus_tag LOCUS_19410 20191 19637 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_19410 20697 20179 gene locus_tag LOCUS_19420 gene atpF 20697 20179 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_19420 20988 20734 gene locus_tag LOCUS_19430 20988 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 21760 21035 gene locus_tag LOCUS_19440 gene atpB 21760 21035 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_19440 22220 21765 gene locus_tag LOCUS_19450 22220 21765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 22512 22222 gene locus_tag LOCUS_19460 22512 22222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 22728 23204 gene locus_tag LOCUS_19470 22728 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 24458 23286 gene locus_tag LOCUS_19480 24458 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 25106 24477 gene locus_tag LOCUS_19490 gene upp 25106 24477 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_19490 25607 25155 gene locus_tag LOCUS_19500 gene rpiB 25607 25155 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_19500 26679 25630 gene locus_tag LOCUS_19510 26679 25630 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_19510 27332 26721 gene locus_tag LOCUS_19520 gene cwlD 27332 26721 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_19520 27534 27340 gene locus_tag LOCUS_19530 27534 27340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 29384 27687 gene locus_tag LOCUS_19540 29384 27687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 29829 29611 gene locus_tag LOCUS_19550 29829 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 30474 31274 gene locus_tag LOCUS_19560 30474 31274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 31602 31411 gene locus_tag LOCUS_19570 31602 31411 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence038 1042 62 gene locus_tag LOCUS_19580 1042 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2266 1064 gene locus_tag LOCUS_19590 2266 1064 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_19590 3894 2278 gene locus_tag LOCUS_19600 3894 2278 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_19600 4697 3930 gene locus_tag LOCUS_19610 4697 3930 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_19610 6879 4876 gene locus_tag LOCUS_19620 6879 4876 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_19620 7009 7809 gene locus_tag LOCUS_19630 7009 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 9977 7878 gene locus_tag LOCUS_19640 9977 7878 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_19640 10330 10022 gene locus_tag LOCUS_19650 10330 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 10884 10459 gene locus_tag LOCUS_19660 10884 10459 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_19660 12088 10874 gene locus_tag LOCUS_19670 12088 10874 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_19670 13028 12078 gene locus_tag LOCUS_19680 13028 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 14447 13041 gene locus_tag LOCUS_19690 gene sufB 14447 13041 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_19690 15190 14444 gene locus_tag LOCUS_19700 gene sufC 15190 14444 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_19700 15645 15193 gene locus_tag LOCUS_19710 15645 15193 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_19710 16358 15756 gene locus_tag LOCUS_19720 gene thrH 16358 15756 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_19720 17450 16473 gene locus_tag LOCUS_19730 gene bsh 17450 16473 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_19730 18578 17469 gene locus_tag LOCUS_19740 18578 17469 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_19740 19464 18604 gene locus_tag LOCUS_19750 19464 18604 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 protein_id gnl|my_center|LOCUS_19750 19820 19467 gene locus_tag LOCUS_19760 19820 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 20119 19937 gene locus_tag LOCUS_19770 20119 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 20643 20122 gene locus_tag LOCUS_19780 20643 20122 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_19780 21050 20673 gene locus_tag LOCUS_19790 21050 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 22369 21050 gene locus_tag LOCUS_19800 22369 21050 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_19800 22854 22387 gene locus_tag LOCUS_19810 22854 22387 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_19810 24342 22978 gene locus_tag LOCUS_19820 24342 22978 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_19820 25633 24356 gene locus_tag LOCUS_19830 25633 24356 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_19830 26275 26374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26974 26849 gene locus_tag LOCUS_19840 26974 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 27723 26977 gene locus_tag LOCUS_19850 27723 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 28387 27743 gene locus_tag LOCUS_19860 28387 27743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 28785 28528 gene locus_tag LOCUS_19870 28785 28528 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_19870 28904 29164 gene locus_tag LOCUS_19880 28904 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 <30937 29176 gene locus_tag LOCUS_19890 <30937 29176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011167180.1:S8 family peptidase >Feature sequence039 119 358 gene locus_tag LOCUS_19900 119 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 398 1399 gene locus_tag LOCUS_19910 398 1399 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_19910 1456 2505 gene locus_tag LOCUS_19920 1456 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837545.1 protein_id gnl|my_center|LOCUS_19920 2580 3563 gene locus_tag LOCUS_19930 2580 3563 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_19930 3589 4053 gene locus_tag LOCUS_19940 3589 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4118 5626 gene locus_tag LOCUS_19950 4118 5626 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_19950 5630 6562 gene locus_tag LOCUS_19960 5630 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 6582 7028 gene locus_tag LOCUS_19970 6582 7028 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638661.1 protein_id gnl|my_center|LOCUS_19970 7043 8158 gene locus_tag LOCUS_19980 7043 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 8176 9072 gene locus_tag LOCUS_19990 gene dapA 8176 9072 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_19990 9240 11735 gene locus_tag LOCUS_20000 9240 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 11823 12374 gene locus_tag LOCUS_20010 11823 12374 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_20010 12371 13936 gene locus_tag LOCUS_20020 gene speA 12371 13936 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_20020 13938 15350 gene locus_tag LOCUS_20030 gene pyk 13938 15350 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_20030 15356 15937 gene locus_tag LOCUS_20040 15356 15937 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_20040 15990 16430 gene locus_tag LOCUS_20050 15990 16430 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_20050 16444 17436 gene locus_tag LOCUS_20060 16444 17436 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_20060 17453 18361 gene locus_tag LOCUS_20070 17453 18361 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_20070 18348 19094 gene locus_tag LOCUS_20080 18348 19094 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_20080 19106 19951 gene locus_tag LOCUS_20090 gene rsmI 19106 19951 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_20090 19988 20407 gene locus_tag LOCUS_20100 19988 20407 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027036.1 protein_id gnl|my_center|LOCUS_20100 20480 21364 gene locus_tag LOCUS_20110 20480 21364 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538273.1 protein_id gnl|my_center|LOCUS_20110 21380 23140 gene locus_tag LOCUS_20120 21380 23140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_20120 23142 24920 gene locus_tag LOCUS_20130 23142 24920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837093.1 protein_id gnl|my_center|LOCUS_20130 24967 26253 gene locus_tag LOCUS_20140 24967 26253 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224723.1 protein_id gnl|my_center|LOCUS_20140 26255 27124 gene locus_tag LOCUS_20150 26255 27124 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_20150 28319 27192 gene locus_tag LOCUS_20160 28319 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 29219 28350 gene locus_tag LOCUS_20170 29219 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 29399 29328 gene locus_tag LOCUS_t00220 29399 29328 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29584 29739 gene locus_tag LOCUS_20180 29584 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence040 1500 214 gene locus_tag LOCUS_20190 1500 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2475 1531 gene locus_tag LOCUS_20200 2475 1531 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_20200 4203 2530 gene locus_tag LOCUS_20210 4203 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5311 4235 gene locus_tag LOCUS_20220 gene gmd 5311 4235 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_20220 5798 5343 gene locus_tag LOCUS_20230 5798 5343 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_20230 6659 5817 gene locus_tag LOCUS_20240 gene rfbD 6659 5817 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_20240 6882 8039 gene locus_tag LOCUS_20250 6882 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 8346 8083 gene locus_tag LOCUS_20260 8346 8083 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_20260 9737 8388 gene locus_tag LOCUS_20270 gene glmM 9737 8388 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_20270 11017 9740 gene locus_tag LOCUS_20280 11017 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 11876 11007 gene locus_tag LOCUS_20290 gene cdaA 11876 11007 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_20290 12866 11907 gene locus_tag LOCUS_20300 12866 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 13270 12884 gene locus_tag LOCUS_20310 13270 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 13703 13293 gene locus_tag LOCUS_20320 13703 13293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_20320 14524 13718 gene locus_tag LOCUS_20330 14524 13718 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970080.1 protein_id gnl|my_center|LOCUS_20330 16724 14478 gene locus_tag LOCUS_20340 16724 14478 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_20340 17214 16864 gene locus_tag LOCUS_20350 17214 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 18053 17235 gene locus_tag LOCUS_20360 gene flgG 18053 17235 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_20360 18845 18069 gene locus_tag LOCUS_20370 gene flgF 18845 18069 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557363.1 protein_id gnl|my_center|LOCUS_20370 19854 18859 gene locus_tag LOCUS_20380 19854 18859 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_20380 22915 20018 gene locus_tag LOCUS_20390 gene uvrA 22915 20018 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963825.1 protein_id gnl|my_center|LOCUS_20390 24931 22940 gene locus_tag LOCUS_20400 gene uvrB 24931 22940 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_20400 25151 24942 gene locus_tag LOCUS_20410 25151 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 25341 25102 gene locus_tag LOCUS_20420 25341 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 26701 25703 gene locus_tag LOCUS_20430 26701 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 27362 26856 gene locus_tag LOCUS_20440 27362 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 27875 27483 gene locus_tag LOCUS_20450 27875 27483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 28044 27868 gene locus_tag LOCUS_20460 28044 27868 CDS product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272462.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence041 1154 561 gene locus_tag LOCUS_20470 1154 561 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136374.1 protein_id gnl|my_center|LOCUS_20470 1997 1170 gene locus_tag LOCUS_20480 1997 1170 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568028.1 protein_id gnl|my_center|LOCUS_20480 2760 2107 gene locus_tag LOCUS_20490 2760 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2915 3163 gene locus_tag LOCUS_20500 2915 3163 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_20500 3177 4259 gene locus_tag LOCUS_20510 3177 4259 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_20510 4881 4267 gene locus_tag LOCUS_20520 4881 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4989 6485 gene locus_tag LOCUS_20530 4989 6485 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_20530 6496 7572 gene locus_tag LOCUS_20540 6496 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 8262 7585 gene locus_tag LOCUS_20550 8262 7585 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_20550 9791 8259 gene locus_tag LOCUS_20560 9791 8259 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_20560 11039 9942 gene locus_tag LOCUS_20570 11039 9942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_20570 12184 11159 gene locus_tag LOCUS_20580 gene yjfF 12184 11159 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_20580 13287 12184 gene locus_tag LOCUS_20590 13287 12184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_20590 14843 13284 gene locus_tag LOCUS_20600 14843 13284 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_20600 16006 14948 gene locus_tag LOCUS_20610 16006 14948 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_20610 17607 16162 gene locus_tag LOCUS_20620 17607 16162 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_20620 19229 17604 gene locus_tag LOCUS_20630 19229 17604 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_20630 19953 19258 gene locus_tag LOCUS_20640 19953 19258 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129982.1 protein_id gnl|my_center|LOCUS_20640 21605 20010 gene locus_tag LOCUS_20650 21605 20010 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_20650 23149 21653 gene locus_tag LOCUS_20660 gene araA 23149 21653 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_20660 24409 23255 gene locus_tag LOCUS_20670 gene araR 24409 23255 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_20670 25872 24406 gene locus_tag LOCUS_20680 25872 24406 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608887.1 protein_id gnl|my_center|LOCUS_20680 26730 25897 gene locus_tag LOCUS_20690 26730 25897 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_20690 27650 26745 gene locus_tag LOCUS_20700 27650 26745 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence042 373 5 gene locus_tag LOCUS_20710 373 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1691 582 gene locus_tag LOCUS_20720 1691 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2700 2557 gene locus_tag LOCUS_20730 2700 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20730 2851 2702 gene locus_tag LOCUS_20740 2851 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20740 4899 3601 gene locus_tag LOCUS_20750 4899 3601 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_20750 6153 4921 gene locus_tag LOCUS_20760 6153 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 7046 6150 gene locus_tag LOCUS_20770 gene ftsX 7046 6150 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_20770 7806 7036 gene locus_tag LOCUS_20780 gene ftsE 7806 7036 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_20780 8881 7796 gene locus_tag LOCUS_20790 8881 7796 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_20790 9178 9366 gene locus_tag LOCUS_20800 9178 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 10325 9408 gene locus_tag LOCUS_20810 10325 9408 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963805.1 protein_id gnl|my_center|LOCUS_20810 11169 10315 gene locus_tag LOCUS_20820 11169 10315 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_20820 11978 11166 gene locus_tag LOCUS_20830 11978 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 12137 12065 gene locus_tag LOCUS_t00230 12137 12065 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12394 13065 gene locus_tag LOCUS_20840 12394 13065 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814547.1 protein_id gnl|my_center|LOCUS_20840 13147 14454 gene locus_tag LOCUS_20850 13147 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 16658 14547 gene locus_tag LOCUS_20860 16658 14547 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_20860 18118 16880 gene locus_tag LOCUS_20870 18118 16880 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_20870 18787 18146 gene locus_tag LOCUS_20880 18787 18146 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_20880 19291 18803 gene locus_tag LOCUS_20890 19291 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 19528 19310 gene locus_tag LOCUS_20900 19528 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 21344 19671 gene locus_tag LOCUS_20910 21344 19671 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_20910 21774 21517 gene locus_tag LOCUS_20920 21774 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 22208 21777 gene locus_tag LOCUS_20930 gene ruvX 22208 21777 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_20930 22483 22223 gene locus_tag LOCUS_20940 22483 22223 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385813.1 protein_id gnl|my_center|LOCUS_20940 23933 22560 gene locus_tag LOCUS_20950 gene mtaB 23933 22560 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_20950 24036 24266 gene locus_tag LOCUS_20960 24036 24266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 25541 24357 gene locus_tag LOCUS_20970 gene thiI 25541 24357 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_20970 26743 25589 gene locus_tag LOCUS_20980 26743 25589 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_20980 <27478 26823 gene locus_tag LOCUS_20990 <27478 26823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964597.1:16S rRNA (uracil(1498)-N(3))-methyltransferase >Feature sequence043 67 234 gene locus_tag LOCUS_21000 67 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 453 2255 gene locus_tag LOCUS_21010 453 2255 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_21010 2236 3768 gene locus_tag LOCUS_21020 2236 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3915 5225 gene locus_tag LOCUS_21030 3915 5225 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973776.1 protein_id gnl|my_center|LOCUS_21030 5310 6209 gene locus_tag LOCUS_21040 5310 6209 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270459.1 protein_id gnl|my_center|LOCUS_21040 6209 7057 gene locus_tag LOCUS_21050 6209 7057 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532212.1 protein_id gnl|my_center|LOCUS_21050 7079 9145 gene locus_tag LOCUS_21060 7079 9145 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_21060 9388 10641 gene locus_tag LOCUS_21070 9388 10641 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_21070 11146 10712 gene locus_tag LOCUS_21080 11146 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 11202 11981 gene locus_tag LOCUS_21090 11202 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 12071 12559 gene locus_tag LOCUS_21100 12071 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 12606 12950 gene locus_tag LOCUS_21110 12606 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 13539 13778 gene locus_tag LOCUS_21120 13539 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 13833 14048 gene locus_tag LOCUS_21130 13833 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 14797 15672 gene locus_tag LOCUS_21140 14797 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 15811 17478 gene locus_tag LOCUS_21150 15811 17478 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987082.1 protein_id gnl|my_center|LOCUS_21150 17587 19053 gene locus_tag LOCUS_21160 17587 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 20880 19594 gene locus_tag LOCUS_21170 20880 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 22197 20905 gene locus_tag LOCUS_21180 22197 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 22933 22187 gene locus_tag LOCUS_21190 22933 22187 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence044 <1 1460 gene locus_tag LOCUS_21200 <1 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000079784.1:FliC/FljB family flagellin 2029 1943 gene locus_tag LOCUS_t00240 2029 1943 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2283 3026 gene locus_tag LOCUS_21210 gene fabG 2283 3026 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_21210 3248 3051 gene locus_tag LOCUS_21220 3248 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4961 3369 gene locus_tag LOCUS_21230 4961 3369 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_21230 5845 4958 gene locus_tag LOCUS_21240 5845 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6220 8511 gene locus_tag LOCUS_21250 6220 8511 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_21250 8660 9526 gene locus_tag LOCUS_21260 8660 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 9738 11132 gene locus_tag LOCUS_21270 9738 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11161 11913 gene locus_tag LOCUS_21280 11161 11913 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_21280 11906 12850 gene locus_tag LOCUS_21290 11906 12850 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_21290 12854 16270 gene locus_tag LOCUS_21300 12854 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 17542 16355 gene locus_tag LOCUS_21310 17542 16355 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_21310 18522 17551 gene locus_tag LOCUS_21320 18522 17551 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_21320 19621 18536 gene locus_tag LOCUS_21330 19621 18536 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_21330 21274 19898 gene locus_tag LOCUS_21340 gene murC 21274 19898 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_21340 21601 22878 gene locus_tag LOCUS_21350 21601 22878 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_21350 22875 23996 gene locus_tag LOCUS_21360 gene glgD 22875 23996 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_21360 24050 24325 gene locus_tag LOCUS_21370 gene spoVG 24050 24325 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_21370 24597 25178 gene locus_tag LOCUS_21380 gene pth 24597 25178 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence045 <1 814 gene locus_tag LOCUS_21390 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403988.1:threonine/serine exporter family protein 835 1281 gene locus_tag LOCUS_21400 835 1281 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948564.1 protein_id gnl|my_center|LOCUS_21400 1774 1343 gene locus_tag LOCUS_21410 1774 1343 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_21410 2715 1792 gene locus_tag LOCUS_21420 gene pyrB 2715 1792 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_21420 3368 2829 gene locus_tag LOCUS_21430 3368 2829 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_21430 3498 3884 gene locus_tag LOCUS_21440 3498 3884 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813451.1 protein_id gnl|my_center|LOCUS_21440 4305 3904 gene locus_tag LOCUS_21450 4305 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4337 5668 gene locus_tag LOCUS_21460 4337 5668 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_21460 5661 6218 gene locus_tag LOCUS_21470 gene folE 5661 6218 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_21470 6269 7078 gene locus_tag LOCUS_21480 gene folP 6269 7078 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_21480 7071 7904 gene locus_tag LOCUS_21490 gene folK 7071 7904 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_21490 7891 8088 gene locus_tag LOCUS_21500 7891 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 9106 8072 gene locus_tag LOCUS_21510 9106 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 9306 10430 gene locus_tag LOCUS_21520 gene pheA 9306 10430 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_21520 10477 12024 gene locus_tag LOCUS_21530 10477 12024 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_21530 12021 14195 gene locus_tag LOCUS_21540 12021 14195 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_21540 14188 14793 gene locus_tag LOCUS_21550 14188 14793 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_21550 16796 14781 gene locus_tag LOCUS_21560 16796 14781 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_21560 17266 18600 gene locus_tag LOCUS_21570 17266 18600 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382263.1 protein_id gnl|my_center|LOCUS_21570 18721 20130 gene locus_tag LOCUS_21580 18721 20130 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262977.1 protein_id gnl|my_center|LOCUS_21580 20130 20972 gene locus_tag LOCUS_21590 20130 20972 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837036.1 protein_id gnl|my_center|LOCUS_21590 20977 21978 gene locus_tag LOCUS_21600 20977 21978 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_21600 22015 23865 gene locus_tag LOCUS_21610 22015 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 23838 24056 gene locus_tag LOCUS_21620 23838 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 24176 25318 gene locus_tag LOCUS_21630 24176 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 25340 25603 gene locus_tag LOCUS_21640 25340 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence046 659 81 gene locus_tag LOCUS_21650 659 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3000 850 gene locus_tag LOCUS_21660 3000 850 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897348.1 protein_id gnl|my_center|LOCUS_21660 5095 3233 gene locus_tag LOCUS_21670 gene ftsH 5095 3233 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_21670 5678 5154 gene locus_tag LOCUS_21680 gene hpt 5678 5154 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582585.1 protein_id gnl|my_center|LOCUS_21680 7142 5694 gene locus_tag LOCUS_21690 gene tilS 7142 5694 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_21690 8380 7181 gene locus_tag LOCUS_21700 8380 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 8827 8519 gene locus_tag LOCUS_21710 8827 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 9306 8842 gene locus_tag LOCUS_21720 9306 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 9626 9336 gene locus_tag LOCUS_21730 9626 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 9931 9692 gene locus_tag LOCUS_21740 9931 9692 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 protein_id gnl|my_center|LOCUS_21740 10284 10009 gene locus_tag LOCUS_21750 10284 10009 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_21750 11854 10436 gene locus_tag LOCUS_21760 11854 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 12877 11891 gene locus_tag LOCUS_21770 12877 11891 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947965.1 protein_id gnl|my_center|LOCUS_21770 14284 12935 gene locus_tag LOCUS_21780 14284 12935 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_21780 15730 14300 gene locus_tag LOCUS_21790 gene proS 15730 14300 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_21790 17664 16063 gene locus_tag LOCUS_21800 17664 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 18625 17636 gene locus_tag LOCUS_21810 18625 17636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19417 18695 gene locus_tag LOCUS_21820 19417 18695 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_21820 20139 19450 gene locus_tag LOCUS_21830 20139 19450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_21830 21663 20182 gene locus_tag LOCUS_21840 21663 20182 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_21840 21830 22225 gene locus_tag LOCUS_21850 21830 22225 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_21850 22267 22809 gene locus_tag LOCUS_21860 22267 22809 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_21860 23298 24692 gene locus_tag LOCUS_21870 23298 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 25615 24764 gene locus_tag LOCUS_21880 25615 24764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence047 180 638 gene locus_tag LOCUS_21890 180 638 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_21890 635 1354 gene locus_tag LOCUS_21900 635 1354 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_21900 1507 5727 gene locus_tag LOCUS_21910 1507 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 5720 6394 gene locus_tag LOCUS_21920 5720 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 6508 6720 gene locus_tag LOCUS_21930 6508 6720 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_21930 6734 6955 gene locus_tag LOCUS_21940 6734 6955 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_21940 7076 9247 gene locus_tag LOCUS_21950 gene feoB 7076 9247 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_21950 9262 9594 gene locus_tag LOCUS_21960 9262 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 10391 9609 gene locus_tag LOCUS_21970 10391 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 11043 12212 gene locus_tag LOCUS_21980 11043 12212 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109125.1 protein_id gnl|my_center|LOCUS_21980 12252 13169 gene locus_tag LOCUS_21990 12252 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 13205 14122 gene locus_tag LOCUS_22000 13205 14122 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894436.1 protein_id gnl|my_center|LOCUS_22000 14155 15042 gene locus_tag LOCUS_22010 14155 15042 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_22010 15039 15890 gene locus_tag LOCUS_22020 15039 15890 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880516.1 protein_id gnl|my_center|LOCUS_22020 15936 17360 gene locus_tag LOCUS_22030 15936 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 17476 18285 gene locus_tag LOCUS_22040 17476 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 18298 18756 gene locus_tag LOCUS_22050 18298 18756 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_22050 18762 19742 gene locus_tag LOCUS_22060 18762 19742 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573446.1 protein_id gnl|my_center|LOCUS_22060 19730 20686 gene locus_tag LOCUS_22070 19730 20686 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573446.1 protein_id gnl|my_center|LOCUS_22070 20729 21574 gene locus_tag LOCUS_22080 20729 21574 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_22080 21949 21602 gene locus_tag LOCUS_22090 21949 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 22992 22102 gene locus_tag LOCUS_22100 22992 22102 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_22100 23717 23016 gene locus_tag LOCUS_22110 23717 23016 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017182.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence048 1131 88 gene locus_tag LOCUS_22120 1131 88 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_22120 1940 1158 gene locus_tag LOCUS_22130 1940 1158 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_22130 3123 1969 gene locus_tag LOCUS_22140 3123 1969 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_22140 4049 3177 gene locus_tag LOCUS_22150 4049 3177 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_22150 4937 4152 gene locus_tag LOCUS_22160 4937 4152 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_22160 6206 5022 gene locus_tag LOCUS_22170 6206 5022 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_22170 7443 6448 gene locus_tag LOCUS_22180 7443 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 9384 7510 gene locus_tag LOCUS_22190 9384 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 10089 9562 gene locus_tag LOCUS_22200 gene raiA 10089 9562 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_22200 11868 10537 gene locus_tag LOCUS_22210 11868 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 13104 12187 gene locus_tag LOCUS_22220 gene trxB 13104 12187 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_22220 13924 13178 gene locus_tag LOCUS_22230 13924 13178 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965914.1 protein_id gnl|my_center|LOCUS_22230 14774 13902 gene locus_tag LOCUS_22240 gene metF 14774 13902 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_22240 15804 14806 gene locus_tag LOCUS_22250 15804 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 16481 15804 gene locus_tag LOCUS_22260 16481 15804 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_22260 17392 16532 gene locus_tag LOCUS_22270 17392 16532 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293644.1 protein_id gnl|my_center|LOCUS_22270 17580 19007 gene locus_tag LOCUS_22280 17580 19007 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_22280 19048 20076 gene locus_tag LOCUS_22290 19048 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 21889 20102 gene locus_tag LOCUS_22300 21889 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 22305 22063 gene locus_tag LOCUS_22310 22305 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 22723 22496 gene locus_tag LOCUS_22320 22723 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 23865 22747 gene locus_tag LOCUS_22330 gene msrB 23865 22747 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108316.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence049 <1 2635 gene locus_tag LOCUS_22340 <1 2635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048383.1:transcription-repair coupling factor 2843 3775 gene locus_tag LOCUS_22350 2843 3775 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754393.1 protein_id gnl|my_center|LOCUS_22350 3791 4729 gene locus_tag LOCUS_22360 gene pstC 3791 4729 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_22360 4722 5594 gene locus_tag LOCUS_22370 gene pstA 4722 5594 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_22370 5625 6389 gene locus_tag LOCUS_22380 gene pstB 5625 6389 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_22380 6419 7081 gene locus_tag LOCUS_22390 gene phoU 6419 7081 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_22390 7195 8970 gene locus_tag LOCUS_22400 7195 8970 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_22400 8986 9660 gene locus_tag LOCUS_22410 8986 9660 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_22410 9673 11040 gene locus_tag LOCUS_22420 9673 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 11061 12254 gene locus_tag LOCUS_22430 gene pseC 11061 12254 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_22430 12309 13331 gene locus_tag LOCUS_22440 12309 13331 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_22440 13393 14466 gene locus_tag LOCUS_22450 13393 14466 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_22450 14499 16106 gene locus_tag LOCUS_22460 14499 16106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 16143 16496 gene locus_tag LOCUS_22470 16143 16496 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_22470 16496 17092 gene locus_tag LOCUS_22480 gene recR 16496 17092 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_22480 17114 18154 gene locus_tag LOCUS_22490 17114 18154 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_22490 18249 18884 gene locus_tag LOCUS_22500 18249 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 18905 20116 gene locus_tag LOCUS_22510 18905 20116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 20135 20527 gene locus_tag LOCUS_22520 20135 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 20654 20827 gene locus_tag LOCUS_22530 20654 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 21018 22706 gene locus_tag LOCUS_22540 21018 22706 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_22540 22740 23576 gene locus_tag LOCUS_22550 22740 23576 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615599.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence050 423 1445 gene locus_tag LOCUS_22560 423 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1435 2646 gene locus_tag LOCUS_22570 1435 2646 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_22570 2804 3376 gene locus_tag LOCUS_22580 2804 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3377 4675 gene locus_tag LOCUS_22590 3377 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4705 4950 gene locus_tag LOCUS_22600 4705 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4947 6335 gene locus_tag LOCUS_22610 4947 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6470 7213 gene locus_tag LOCUS_22620 6470 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 7192 7644 gene locus_tag LOCUS_22630 7192 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7634 8065 gene locus_tag LOCUS_22640 7634 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 8062 9351 gene locus_tag LOCUS_22650 8062 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 9429 10436 gene locus_tag LOCUS_22660 9429 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 10502 10912 gene locus_tag LOCUS_22670 10502 10912 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_22670 10967 11809 gene locus_tag LOCUS_22680 10967 11809 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_22680 11830 12381 gene locus_tag LOCUS_22690 11830 12381 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_22690 12384 14153 gene locus_tag LOCUS_22700 12384 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 14146 14898 gene locus_tag LOCUS_22710 14146 14898 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922507.1 protein_id gnl|my_center|LOCUS_22710 15053 16258 gene locus_tag LOCUS_22720 15053 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 16325 18037 gene locus_tag LOCUS_22730 16325 18037 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_22730 18039 19115 gene locus_tag LOCUS_22740 18039 19115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974670.1 protein_id gnl|my_center|LOCUS_22740 19155 19838 gene locus_tag LOCUS_22750 19155 19838 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 protein_id gnl|my_center|LOCUS_22750 20025 20114 gene locus_tag LOCUS_t00250 20025 20114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 813 43 gene locus_tag LOCUS_22760 813 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1713 832 gene locus_tag LOCUS_22770 1713 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2222 1809 gene locus_tag LOCUS_22780 2222 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3679 2231 gene locus_tag LOCUS_22790 gene mobV 3679 2231 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119405.1 protein_id gnl|my_center|LOCUS_22790 4278 3946 gene locus_tag LOCUS_22800 4278 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5274 4294 gene locus_tag LOCUS_22810 5274 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6456 5374 gene locus_tag LOCUS_22820 6456 5374 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_22820 6668 6474 gene locus_tag LOCUS_22830 6668 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6916 7398 gene locus_tag LOCUS_22840 6916 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 8733 7546 gene locus_tag LOCUS_22850 gene tuf 8733 7546 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_22850 11006 8844 gene locus_tag LOCUS_22860 gene fusA 11006 8844 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_22860 11518 11048 gene locus_tag LOCUS_22870 gene rpsG 11518 11048 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_22870 12097 11678 gene locus_tag LOCUS_22880 gene rpsL 12097 11678 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_22880 15741 12328 gene locus_tag LOCUS_22890 15741 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 15968 16663 gene locus_tag LOCUS_22900 15968 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 16686 17249 gene locus_tag LOCUS_22910 16686 17249 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_22910 17254 17481 gene locus_tag LOCUS_22920 17254 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 <20269 17526 gene locus_tag LOCUS_22930 <20269 17526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' >Feature sequence052 665 9 gene locus_tag LOCUS_22940 665 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2054 852 gene locus_tag LOCUS_22950 2054 852 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_22950 4099 2105 gene locus_tag LOCUS_22960 4099 2105 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_22960 4950 4114 gene locus_tag LOCUS_22970 4950 4114 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_22970 5845 4940 gene locus_tag LOCUS_22980 5845 4940 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_22980 7265 5925 gene locus_tag LOCUS_22990 7265 5925 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_22990 9156 7327 gene locus_tag LOCUS_23000 9156 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 10184 9153 gene locus_tag LOCUS_23010 10184 9153 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_23010 11168 10392 gene locus_tag LOCUS_23020 gene trpA 11168 10392 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_23020 12351 11161 gene locus_tag LOCUS_23030 gene trpB 12351 11161 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_23030 12951 12355 gene locus_tag LOCUS_23040 12951 12355 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_23040 13739 12948 gene locus_tag LOCUS_23050 gene trpC 13739 12948 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_23050 14755 13736 gene locus_tag LOCUS_23060 gene trpD 14755 13736 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_23060 15357 14785 gene locus_tag LOCUS_23070 15357 14785 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_23070 16817 15354 gene locus_tag LOCUS_23080 gene trpE 16817 15354 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_23080 18137 17178 gene locus_tag LOCUS_23090 18137 17178 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_23090 19509 18163 gene locus_tag LOCUS_23100 19509 18163 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence053 2513 1437 gene locus_tag LOCUS_23110 2513 1437 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_23110 2803 3834 gene locus_tag LOCUS_23120 gene rbsR 2803 3834 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104055.1 protein_id gnl|my_center|LOCUS_23120 4765 3893 gene locus_tag LOCUS_23130 4765 3893 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 protein_id gnl|my_center|LOCUS_23130 6908 4905 gene locus_tag LOCUS_23140 6908 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 8626 6992 gene locus_tag LOCUS_23150 8626 6992 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_23150 9420 8629 gene locus_tag LOCUS_23160 9420 8629 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_23160 10276 9422 gene locus_tag LOCUS_23170 gene accD 10276 9422 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002280638.1 protein_id gnl|my_center|LOCUS_23170 11588 10281 gene locus_tag LOCUS_23180 11588 10281 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_23180 12008 11592 gene locus_tag LOCUS_23190 12008 11592 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_23190 12435 12013 gene locus_tag LOCUS_23200 gene accB 12435 12013 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_23200 13678 12440 gene locus_tag LOCUS_23210 gene fabF 13678 12440 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_23210 14418 13690 gene locus_tag LOCUS_23220 gene fabG 14418 13690 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_23220 15311 14412 gene locus_tag LOCUS_23230 gene fabD 15311 14412 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_23230 16243 15299 gene locus_tag LOCUS_23240 gene fabK 16243 15299 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_23240 16469 16248 gene locus_tag LOCUS_23250 gene acpP 16469 16248 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753030.1 protein_id gnl|my_center|LOCUS_23250 17662 16700 gene locus_tag LOCUS_23260 17662 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 18340 17783 gene locus_tag LOCUS_23270 18340 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence054 1184 1038 gene locus_tag LOCUS_23280 1184 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2859 1468 gene locus_tag LOCUS_23290 gene rlmD 2859 1468 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_23290 3082 2921 gene locus_tag LOCUS_23300 3082 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3341 3015 gene locus_tag LOCUS_23310 3341 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 5709 3439 gene locus_tag LOCUS_23320 gene pcrA 5709 3439 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 protein_id gnl|my_center|LOCUS_23320 6489 5725 gene locus_tag LOCUS_23330 6489 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7621 6515 gene locus_tag LOCUS_23340 7621 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_23340 8998 7643 gene locus_tag LOCUS_23350 8998 7643 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_23350 10234 9206 gene locus_tag LOCUS_23360 10234 9206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_23360 10673 10344 gene locus_tag LOCUS_23370 10673 10344 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986763.1 protein_id gnl|my_center|LOCUS_23370 11279 10674 gene locus_tag LOCUS_23380 11279 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986764.1 protein_id gnl|my_center|LOCUS_23380 11708 11307 gene locus_tag LOCUS_23390 11708 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 12232 11705 gene locus_tag LOCUS_23400 12232 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 13019 12405 gene locus_tag LOCUS_23410 13019 12405 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427879.1 protein_id gnl|my_center|LOCUS_23410 13190 13483 gene locus_tag LOCUS_23420 13190 13483 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_23420 14258 13545 gene locus_tag LOCUS_23430 14258 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 15420 14353 gene locus_tag LOCUS_23440 15420 14353 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_23440 15641 15841 gene locus_tag LOCUS_23450 gene cspA 15641 15841 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831260.1 protein_id gnl|my_center|LOCUS_23450 16149 17504 gene locus_tag LOCUS_23460 16149 17504 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence055 304 376 gene locus_tag LOCUS_t00260 304 376 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 396 470 gene locus_tag LOCUS_t00270 396 470 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 643 882 gene locus_tag LOCUS_23470 643 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 866 1093 gene locus_tag LOCUS_23480 866 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2400 1168 gene locus_tag LOCUS_23490 2400 1168 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_23490 2906 4264 gene locus_tag LOCUS_23500 2906 4264 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_23500 4456 4977 gene locus_tag LOCUS_23510 4456 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4981 6819 gene locus_tag LOCUS_23520 4981 6819 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_23520 6949 7506 gene locus_tag LOCUS_23530 6949 7506 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_23530 7512 7916 gene locus_tag LOCUS_23540 7512 7916 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_23540 8147 7926 gene locus_tag LOCUS_23550 8147 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 8049 8465 gene locus_tag LOCUS_23560 8049 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 8643 9191 gene locus_tag LOCUS_23570 gene ispF 8643 9191 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_23570 9211 10626 gene locus_tag LOCUS_23580 gene hydG 9211 10626 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_23580 10660 11874 gene locus_tag LOCUS_23590 gene hydF 10660 11874 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_23590 11999 12691 gene locus_tag LOCUS_23600 gene cysE 11999 12691 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_23600 12712 14118 gene locus_tag LOCUS_23610 gene cysS 12712 14118 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_23610 14103 14531 gene locus_tag LOCUS_23620 14103 14531 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_23620 14626 15393 gene locus_tag LOCUS_23630 gene rlmB 14626 15393 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_23630 15413 16681 gene locus_tag LOCUS_23640 15413 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 16671 17297 gene locus_tag LOCUS_23650 gene sigH 16671 17297 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence056 <1 1088 gene locus_tag LOCUS_23660 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195472.1:formate C-acetyltransferase 1211 1942 gene locus_tag LOCUS_23670 gene pflA 1211 1942 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_23670 2068 2238 gene locus_tag LOCUS_23680 2068 2238 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_23680 3015 2281 gene locus_tag LOCUS_23690 3015 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3136 2900 gene locus_tag LOCUS_23700 3136 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 4454 3117 gene locus_tag LOCUS_23710 gene dnaB 4454 3117 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_23710 4922 4473 gene locus_tag LOCUS_23720 gene rplI 4922 4473 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_23720 7003 4943 gene locus_tag LOCUS_23730 7003 4943 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_23730 7509 7246 gene locus_tag LOCUS_23740 gene rpsR 7509 7246 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_23740 8001 7555 gene locus_tag LOCUS_23750 gene ssb 8001 7555 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_23750 8327 8037 gene locus_tag LOCUS_23760 gene rpsF 8327 8037 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_23760 8654 8478 gene locus_tag LOCUS_23770 8654 8478 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815177.1 protein_id gnl|my_center|LOCUS_23770 9381 8665 gene locus_tag LOCUS_23780 9381 8665 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_23780 10134 9394 gene locus_tag LOCUS_23790 10134 9394 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_23790 11156 10125 gene locus_tag LOCUS_23800 11156 10125 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_23800 12641 11160 gene locus_tag LOCUS_23810 gene malQ 12641 11160 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_23810 13499 12657 gene locus_tag LOCUS_23820 13499 12657 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_23820 14341 13499 gene locus_tag LOCUS_23830 14341 13499 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_23830 15853 14435 gene locus_tag LOCUS_23840 15853 14435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_23840 16056 15850 gene locus_tag LOCUS_23850 16056 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 16265 16194 gene locus_tag LOCUS_t00280 16265 16194 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 134 721 gene locus_tag LOCUS_23860 134 721 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 protein_id gnl|my_center|LOCUS_23860 745 963 gene locus_tag LOCUS_23870 745 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 969 2147 gene locus_tag LOCUS_23880 969 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3518 2220 gene locus_tag LOCUS_23890 gene vmrA 3518 2220 CDS product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 protein_id gnl|my_center|LOCUS_23890 3642 4076 gene locus_tag LOCUS_23900 3642 4076 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_23900 5233 4064 gene locus_tag LOCUS_23910 5233 4064 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_23910 5521 7173 gene locus_tag LOCUS_23920 gene pdcA 5521 7173 CDS product c-di-GMP phosphodiesterase PdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902545.1 protein_id gnl|my_center|LOCUS_23920 7226 8329 gene locus_tag LOCUS_23930 7226 8329 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_23930 8419 8503 gene locus_tag LOCUS_t00290 8419 8503 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8663 9433 gene locus_tag LOCUS_23940 8663 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9675 10262 gene locus_tag LOCUS_23950 9675 10262 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_23950 10310 11278 gene locus_tag LOCUS_23960 10310 11278 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_23960 11312 11803 gene locus_tag LOCUS_23970 11312 11803 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_23970 11819 12664 gene locus_tag LOCUS_23980 11819 12664 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_23980 12734 13525 gene locus_tag LOCUS_23990 gene lgt 12734 13525 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence058 139 1128 gene locus_tag LOCUS_24000 139 1128 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_24000 2040 1189 gene locus_tag LOCUS_24010 2040 1189 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682345.1 protein_id gnl|my_center|LOCUS_24010 3865 2042 gene locus_tag LOCUS_24020 gene ftsH 3865 2042 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_24020 4894 3893 gene locus_tag LOCUS_24030 4894 3893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_24030 6000 4897 gene locus_tag LOCUS_24040 6000 4897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_24040 7525 5993 gene locus_tag LOCUS_24050 7525 5993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_24050 8975 7668 gene locus_tag LOCUS_24060 8975 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 9711 9136 gene locus_tag LOCUS_24070 9711 9136 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_24070 11637 9907 gene locus_tag LOCUS_24080 11637 9907 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_24080 12166 11639 gene locus_tag LOCUS_24090 12166 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 13228 12317 gene locus_tag LOCUS_24100 13228 12317 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892281.1 protein_id gnl|my_center|LOCUS_24100 13396 14538 gene locus_tag LOCUS_24110 13396 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence059 76 942 gene locus_tag LOCUS_24120 76 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 957 1742 gene locus_tag LOCUS_24130 957 1742 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110864.1 protein_id gnl|my_center|LOCUS_24130 1745 2674 gene locus_tag LOCUS_24140 1745 2674 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899523.1 protein_id gnl|my_center|LOCUS_24140 2738 3700 gene locus_tag LOCUS_24150 2738 3700 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_24150 3776 4054 gene locus_tag LOCUS_24160 3776 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 4054 4347 gene locus_tag LOCUS_24170 4054 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4741 6495 gene locus_tag LOCUS_24180 4741 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6559 6768 gene locus_tag LOCUS_24190 6559 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 6758 7615 gene locus_tag LOCUS_24200 6758 7615 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_24200 7632 8048 gene locus_tag LOCUS_24210 7632 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 8059 8406 gene locus_tag LOCUS_24220 8059 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 8450 8983 gene locus_tag LOCUS_24230 8450 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 8980 10740 gene locus_tag LOCUS_24240 8980 10740 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_24240 10954 11166 gene locus_tag LOCUS_24250 10954 11166 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_24250 11333 11545 gene locus_tag LOCUS_24260 11333 11545 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_24260 11604 12470 gene locus_tag LOCUS_24270 11604 12470 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_24270 12482 12958 gene locus_tag LOCUS_24280 12482 12958 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_24280 12840 13847 gene locus_tag LOCUS_24290 12840 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence060 1253 522 gene locus_tag LOCUS_24300 1253 522 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_24300 2077 1250 gene locus_tag LOCUS_24310 2077 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2183 3301 gene locus_tag LOCUS_24320 2183 3301 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_24320 3298 3957 gene locus_tag LOCUS_24330 3298 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 4966 3926 gene locus_tag LOCUS_24340 4966 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 5411 4956 gene locus_tag LOCUS_24350 5411 4956 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582556.1 protein_id gnl|my_center|LOCUS_24350 6406 5432 gene locus_tag LOCUS_24360 gene holA 6406 5432 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_24360 7365 6502 gene locus_tag LOCUS_24370 7365 6502 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_24370 8305 7493 gene locus_tag LOCUS_24380 8305 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 9600 8302 gene locus_tag LOCUS_24390 9600 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 11005 9674 gene locus_tag LOCUS_24400 gene csm6 11005 9674 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_24400 11351 11034 gene locus_tag LOCUS_24410 gene cas2 11351 11034 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414276.1 protein_id gnl|my_center|LOCUS_24410 12385 11381 gene locus_tag LOCUS_24420 gene cas1 12385 11381 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414279.1 protein_id gnl|my_center|LOCUS_24420 12411 >12865 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttctcgtcccccttaggggatttctttttat >Feature sequence061 316 226 gene locus_tag LOCUS_t00300 316 226 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 455 369 gene locus_tag LOCUS_t00310 455 369 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1468 683 gene locus_tag LOCUS_24430 1468 683 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978750.1 protein_id gnl|my_center|LOCUS_24430 2794 2078 gene locus_tag LOCUS_24440 gene ispD 2794 2078 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_24440 3890 2868 gene locus_tag LOCUS_24450 gene tsaD 3890 2868 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_24450 4497 3901 gene locus_tag LOCUS_24460 4497 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5408 4494 gene locus_tag LOCUS_24470 5408 4494 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_24470 5689 5441 gene locus_tag LOCUS_24480 5689 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 6207 5761 gene locus_tag LOCUS_24490 gene rimI 6207 5761 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_24490 6940 6197 gene locus_tag LOCUS_24500 gene tsaB 6940 6197 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_24500 7380 6949 gene locus_tag LOCUS_24510 gene tsaE 7380 6949 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 protein_id gnl|my_center|LOCUS_24510 7853 7374 gene locus_tag LOCUS_24520 7853 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 9641 7947 gene locus_tag LOCUS_24530 gene pdcB 9641 7947 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_24530 11362 9689 gene locus_tag LOCUS_24540 11362 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 10582 10681 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <12645 11548 gene locus_tag LOCUS_24550 <12645 11548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004598537.1:PleD family two-component system response regulator >Feature sequence062 169 1320 gene locus_tag LOCUS_24560 169 1320 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_24560 1462 2184 gene locus_tag LOCUS_24570 1462 2184 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_24570 2212 2967 gene locus_tag LOCUS_24580 2212 2967 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476103.1 protein_id gnl|my_center|LOCUS_24580 3021 3815 gene locus_tag LOCUS_24590 3021 3815 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_24590 3827 4699 gene locus_tag LOCUS_24600 3827 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4743 5882 gene locus_tag LOCUS_24610 4743 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 5911 6699 gene locus_tag LOCUS_24620 5911 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 6826 7377 gene locus_tag LOCUS_24630 6826 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 7784 8647 gene locus_tag LOCUS_24640 7784 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 8924 9757 gene locus_tag LOCUS_24650 8924 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 9816 10601 gene locus_tag LOCUS_24660 9816 10601 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476440.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence063 <1 1529 gene locus_tag LOCUS_24670 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398654.1:alpha-L-arabinofuranosidase AbfB 1426 1525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1568 2350 gene locus_tag LOCUS_24680 1568 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2779 2327 gene locus_tag LOCUS_24690 2779 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3252 2776 gene locus_tag LOCUS_24700 3252 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3772 3242 gene locus_tag LOCUS_24710 3772 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4107 3769 gene locus_tag LOCUS_24720 4107 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5176 4130 gene locus_tag LOCUS_24730 5176 4130 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_24730 5915 5208 gene locus_tag LOCUS_24740 5915 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 6843 6364 gene locus_tag LOCUS_24750 6843 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 6993 7616 gene locus_tag LOCUS_24760 6993 7616 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_24760 8167 7577 gene locus_tag LOCUS_24770 8167 7577 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_24770 8994 8170 gene locus_tag LOCUS_24780 gene nudC 8994 8170 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_24780 9092 10078 gene locus_tag LOCUS_24790 gene prmA 9092 10078 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence064 1861 101 gene locus_tag LOCUS_24800 1861 101 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 protein_id gnl|my_center|LOCUS_24800 2299 2784 gene locus_tag LOCUS_24810 2299 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3276 2779 gene locus_tag LOCUS_24820 3276 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675099.1 protein_id gnl|my_center|LOCUS_24820 3310 5145 gene locus_tag LOCUS_24830 3310 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5439 5224 gene locus_tag LOCUS_24840 5439 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 7009 5423 gene locus_tag LOCUS_24850 7009 5423 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_24850 8494 7148 gene locus_tag LOCUS_24860 8494 7148 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_24860 9455 8487 gene locus_tag LOCUS_24870 9455 8487 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143619.1 protein_id gnl|my_center|LOCUS_24870 9670 9876 gene locus_tag LOCUS_24880 9670 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence065 34 2034 gene locus_tag LOCUS_24890 34 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2181 3047 gene locus_tag LOCUS_24900 2181 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24900 3150 3929 gene locus_tag LOCUS_24910 3150 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3942 4721 gene locus_tag LOCUS_24920 3942 4721 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_24920 4821 6863 gene locus_tag LOCUS_24930 gene glgX 4821 6863 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_24930 6905 7393 gene locus_tag LOCUS_24940 gene ybaK 6905 7393 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_24940 7368 7619 gene locus_tag LOCUS_24950 7368 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 7664 8782 gene locus_tag LOCUS_24960 gene mtnA 7664 8782 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_24960 8779 9462 gene locus_tag LOCUS_24970 8779 9462 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence066 1570 674 gene locus_tag LOCUS_24980 1570 674 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948132.1 protein_id gnl|my_center|LOCUS_24980 2914 2408 gene locus_tag LOCUS_24990 2914 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 4044 3139 gene locus_tag LOCUS_25000 4044 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4673 4041 gene locus_tag LOCUS_25010 4673 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4933 5006 gene locus_tag LOCUS_t00320 4933 5006 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5298 5065 gene locus_tag LOCUS_25020 5298 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 7153 5447 gene locus_tag LOCUS_25030 7153 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8412 7456 gene locus_tag LOCUS_25040 8412 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence067 209 1108 gene locus_tag LOCUS_25050 209 1108 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_25050 1132 2355 gene locus_tag LOCUS_25060 1132 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4778 2430 gene locus_tag LOCUS_25070 gene feoB 4778 2430 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_25070 4916 6400 gene locus_tag LOCUS_25080 4916 6400 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_25080 6729 7916 gene locus_tag LOCUS_25090 6729 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence068 1203 3068 gene locus_tag LOCUS_25100 1203 3068 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_25100 3206 3589 gene locus_tag LOCUS_25110 3206 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3691 4398 gene locus_tag LOCUS_25120 3691 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 5229 4528 gene locus_tag LOCUS_25130 5229 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 7595 5385 gene locus_tag LOCUS_25140 7595 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 7804 7622 gene locus_tag LOCUS_25150 7804 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 8384 7785 gene locus_tag LOCUS_25160 8384 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence069 421 1344 gene locus_tag LOCUS_25170 421 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1345 2187 gene locus_tag LOCUS_25180 1345 2187 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259004.1 protein_id gnl|my_center|LOCUS_25180 2205 3935 gene locus_tag LOCUS_25190 2205 3935 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994174.1 protein_id gnl|my_center|LOCUS_25190 3941 4960 gene locus_tag LOCUS_25200 gene malR 3941 4960 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_25200 6084 5059 gene locus_tag LOCUS_25210 6084 5059 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_25210 7063 6107 gene locus_tag LOCUS_25220 7063 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 <8331 7191 gene locus_tag LOCUS_25230 <8331 7191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963715.1:LacI family DNA-binding transcriptional regulator >Feature sequence070 341 1126 gene locus_tag LOCUS_25240 341 1126 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933511.1 protein_id gnl|my_center|LOCUS_25240 1116 2021 gene locus_tag LOCUS_25250 1116 2021 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185518.1 protein_id gnl|my_center|LOCUS_25250 2018 2152 gene locus_tag LOCUS_25260 2018 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2157 2324 gene locus_tag LOCUS_25270 2157 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 2314 2625 gene locus_tag LOCUS_25280 2314 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2755 3153 gene locus_tag LOCUS_25290 2755 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3167 3565 gene locus_tag LOCUS_25300 3167 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3579 3971 gene locus_tag LOCUS_25310 3579 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4329 4428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4430 5248 gene locus_tag LOCUS_25320 4430 5248 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860781.1 protein_id gnl|my_center|LOCUS_25320 5248 6042 gene locus_tag LOCUS_25330 5248 6042 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_25330 6125 6616 gene locus_tag LOCUS_25340 6125 6616 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence071 474 70 gene locus_tag LOCUS_25350 gene dut 474 70 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_25350 1243 455 gene locus_tag LOCUS_25360 1243 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1565 1230 gene locus_tag LOCUS_25370 1565 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3715 1562 gene locus_tag LOCUS_25380 3715 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3872 3705 gene locus_tag LOCUS_25390 3872 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 4380 3874 gene locus_tag LOCUS_25400 4380 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 5300 4434 gene locus_tag LOCUS_25410 5300 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 5619 5284 gene locus_tag LOCUS_25420 5619 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 7483 5687 gene locus_tag LOCUS_25430 7483 5687 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861362.1 protein_id gnl|my_center|LOCUS_25430 7774 7511 gene locus_tag LOCUS_25440 7774 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence072 143 1552 gene locus_tag LOCUS_25450 143 1552 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_25450 1677 2441 gene locus_tag LOCUS_25460 1677 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2559 2768 gene locus_tag LOCUS_25470 2559 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 3220 2810 gene locus_tag LOCUS_25480 3220 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3416 4000 gene locus_tag LOCUS_25490 3416 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4200 5381 gene locus_tag LOCUS_25500 4200 5381 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_25500 5413 5706 gene locus_tag LOCUS_25510 gene gatC 5413 5706 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 protein_id gnl|my_center|LOCUS_25510 5721 7181 gene locus_tag LOCUS_25520 gene gatA 5721 7181 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence073 316 104 gene locus_tag LOCUS_25530 316 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 846 475 gene locus_tag LOCUS_25540 846 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1035 963 gene locus_tag LOCUS_t00330 1035 963 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1990 1082 gene locus_tag LOCUS_25550 1990 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3401 2115 gene locus_tag LOCUS_25560 gene serS 3401 2115 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_25560 4490 3438 gene locus_tag LOCUS_25570 4490 3438 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_25570 5027 4506 gene locus_tag LOCUS_25580 5027 4506 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815159.1 protein_id gnl|my_center|LOCUS_25580 5963 5067 gene locus_tag LOCUS_25590 5963 5067 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_25590 6746 5985 gene locus_tag LOCUS_25600 6746 5985 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_25600 7027 6776 gene locus_tag LOCUS_25610 7027 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence074 159 1514 gene locus_tag LOCUS_25620 159 1514 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_25620 1594 2430 gene locus_tag LOCUS_25630 1594 2430 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363043.1 protein_id gnl|my_center|LOCUS_25630 2613 5234 gene locus_tag LOCUS_25640 gene ppdK 2613 5234 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_25640 5558 5710 gene locus_tag LOCUS_25650 5558 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5671 6249 gene locus_tag LOCUS_25660 5671 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 6219 6515 gene locus_tag LOCUS_25670 6219 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence075 550 248 gene locus_tag LOCUS_25680 550 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 809 543 gene locus_tag LOCUS_25690 809 543 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_25690 1484 1930 gene locus_tag LOCUS_25700 1484 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1927 2169 gene locus_tag LOCUS_25710 1927 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3924 2329 gene locus_tag LOCUS_25720 gene hcp 3924 2329 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_25720 4660 3941 gene locus_tag LOCUS_25730 4660 3941 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_25730 4757 5422 gene locus_tag LOCUS_25740 4757 5422 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_25740 5580 5398 gene locus_tag LOCUS_25750 5580 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 5651 6598 gene locus_tag LOCUS_25760 5651 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6708 6623 gene locus_tag LOCUS_t00340 6708 6623 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6803 6730 gene locus_tag LOCUS_t00350 6803 6730 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 24 167 gene locus_tag LOCUS_25770 24 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 614 1741 gene locus_tag LOCUS_25780 gene ribD 614 1741 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_25780 1723 2376 gene locus_tag LOCUS_25790 1723 2376 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_25790 2395 3612 gene locus_tag LOCUS_25800 2395 3612 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_25800 3642 4115 gene locus_tag LOCUS_25810 gene ribE 3642 4115 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_25810 4131 4781 gene locus_tag LOCUS_25820 4131 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4786 4885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5561 6607 gene locus_tag LOCUS_25830 5561 6607 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence077 3541 1244 gene locus_tag LOCUS_25840 3541 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 6448 4727 gene locus_tag LOCUS_25850 6448 4727 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence078 86 385 gene locus_tag LOCUS_25860 86 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 288 1070 gene locus_tag LOCUS_25870 288 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1234 1794 gene locus_tag LOCUS_25880 1234 1794 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_25880 1802 2128 gene locus_tag LOCUS_25890 1802 2128 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_25890 2311 2826 gene locus_tag LOCUS_25900 2311 2826 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709451.1 protein_id gnl|my_center|LOCUS_25900 3083 3736 gene locus_tag LOCUS_25910 3083 3736 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_25910 3927 4610 gene locus_tag LOCUS_25920 3927 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4580 4732 gene locus_tag LOCUS_25930 4580 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4719 5042 gene locus_tag LOCUS_25940 4719 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence079 1126 218 gene locus_tag LOCUS_25950 1126 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1387 1187 gene locus_tag LOCUS_25960 1387 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1953 1387 gene locus_tag LOCUS_25970 1953 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2413 2087 gene locus_tag LOCUS_25980 2413 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3319 2966 gene locus_tag LOCUS_25990 3319 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3773 3528 gene locus_tag LOCUS_26000 3773 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4190 3948 gene locus_tag LOCUS_26010 4190 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 5500 4211 gene locus_tag LOCUS_26020 5500 4211 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence080 1307 651 gene locus_tag LOCUS_26030 1307 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1693 1391 gene locus_tag LOCUS_26040 1693 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3421 1769 gene locus_tag LOCUS_26050 3421 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 4019 3435 gene locus_tag LOCUS_26060 4019 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4707 4090 gene locus_tag LOCUS_26070 4707 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 5916 5182 gene locus_tag LOCUS_26080 5916 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence081 976 182 gene locus_tag LOCUS_26090 976 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2534 1155 gene locus_tag LOCUS_26100 2534 1155 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_26100 3738 2491 gene locus_tag LOCUS_26110 3738 2491 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_26110 3932 4726 gene locus_tag LOCUS_26120 3932 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 6079 4736 gene locus_tag LOCUS_26130 6079 4736 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence082 118 423 gene locus_tag LOCUS_26140 118 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1542 610 gene locus_tag LOCUS_26150 1542 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3219 1795 gene locus_tag LOCUS_26160 3219 1795 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_26160 3565 3233 gene locus_tag LOCUS_26170 3565 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3927 3559 gene locus_tag LOCUS_26180 3927 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 6052 3899 gene locus_tag LOCUS_26190 6052 3899 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence083 1425 832 gene locus_tag LOCUS_26200 1425 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3268 1634 gene locus_tag LOCUS_26210 3268 1634 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272719.1 protein_id gnl|my_center|LOCUS_26210 4180 3281 gene locus_tag LOCUS_26220 4180 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 5768 4152 gene locus_tag LOCUS_26230 5768 4152 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_26230 6014 5859 gene locus_tag LOCUS_26240 6014 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence084 91 960 gene locus_tag LOCUS_26250 91 960 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_26250 984 1448 gene locus_tag LOCUS_26260 984 1448 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_26260 1330 3393 gene locus_tag LOCUS_26270 1330 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2907 3006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3524 5002 gene locus_tag LOCUS_26280 3524 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4867 4966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5095 5763 gene locus_tag LOCUS_26290 5095 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence085 3513 2425 gene locus_tag LOCUS_26300 3513 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3733 3572 gene locus_tag LOCUS_26310 3733 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 <5853 3748 gene locus_tag LOCUS_26320 <5853 3748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001178115.1:SpaA isopeptide-forming pilin-related protein >Feature sequence086 155 1630 gene locus_tag LOCUS_26330 155 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1620 2327 gene locus_tag LOCUS_26340 1620 2327 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 protein_id gnl|my_center|LOCUS_26340 2563 3912 gene locus_tag LOCUS_26350 2563 3912 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_26350 3932 4837 gene locus_tag LOCUS_26360 3932 4837 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_26360 4853 5671 gene locus_tag LOCUS_26370 4853 5671 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303949.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence087 <1 2068 gene locus_tag LOCUS_26380 <1 2068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861108.1:DNA topoisomerase 3 >Feature sequence088 1520 936 gene locus_tag LOCUS_26390 1520 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3381 1747 gene locus_tag LOCUS_26400 3381 1747 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272719.1 protein_id gnl|my_center|LOCUS_26400 4293 3394 gene locus_tag LOCUS_26410 4293 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 <5319 4265 gene locus_tag LOCUS_26420 <5319 4265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461951.1:recombinase family protein >Feature sequence089 165 1541 gene locus_tag LOCUS_26430 165 1541 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_26430 1617 2495 gene locus_tag LOCUS_26440 1617 2495 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_26440 2488 3294 gene locus_tag LOCUS_26450 2488 3294 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_26450 3294 3755 gene locus_tag LOCUS_26460 3294 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3706 5004 gene locus_tag LOCUS_26470 3706 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence090 1547 63 gene locus_tag LOCUS_26480 1547 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1747 1950 gene locus_tag LOCUS_26490 1747 1950 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890274.1 protein_id gnl|my_center|LOCUS_26490 2260 2359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3963 2950 gene locus_tag LOCUS_26500 3963 2950 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_26500 4467 4027 gene locus_tag LOCUS_26510 4467 4027 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence091 <1 749 gene locus_tag LOCUS_26520 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679655.1:Rpn family recombination-promoting nuclease/putative transposase 980 1531 gene locus_tag LOCUS_26530 980 1531 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_26530 1566 2039 gene locus_tag LOCUS_26540 1566 2039 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_26540 2046 2549 gene locus_tag LOCUS_26550 gene greA 2046 2549 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564597.1 protein_id gnl|my_center|LOCUS_26550 2696 2911 gene locus_tag LOCUS_26560 2696 2911 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_26560 3495 2974 gene locus_tag LOCUS_26570 3495 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3677 3895 gene locus_tag LOCUS_26580 3677 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence092 109 1161 gene locus_tag LOCUS_26590 109 1161 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_26590 1539 1165 gene locus_tag LOCUS_26600 1539 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1792 2406 gene locus_tag LOCUS_26610 gene lexA 1792 2406 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_26610 <4632 2492 gene locus_tag LOCUS_26620 <4632 2492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389475.1:1,3-beta-galactosyl-N-acetylhexosamine phosphorylase >Feature sequence093 2015 720 gene locus_tag LOCUS_26630 gene dcm 2015 720 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837382.1 protein_id gnl|my_center|LOCUS_26630 2838 1999 gene locus_tag LOCUS_26640 2838 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3979 2759 gene locus_tag LOCUS_26650 3979 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2885 2984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence094 <1 1190 gene locus_tag LOCUS_26660 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein 1183 1896 gene locus_tag LOCUS_26670 1183 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2409 1942 gene locus_tag LOCUS_26680 2409 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2846 2406 gene locus_tag LOCUS_26690 2846 2406 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977032.1 protein_id gnl|my_center|LOCUS_26690 3545 2847 gene locus_tag LOCUS_26700 3545 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 4429 3563 gene locus_tag LOCUS_26710 4429 3563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262479.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence095 247 681 gene locus_tag LOCUS_26720 247 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 848 1858 gene locus_tag LOCUS_26730 848 1858 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_26730 1858 3189 gene locus_tag LOCUS_26740 1858 3189 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_26740 4029 3184 gene locus_tag LOCUS_26750 4029 3184 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700996.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence096 2161 470 gene locus_tag LOCUS_26760 gene pdcB 2161 470 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_26760 <3903 2227 gene locus_tag LOCUS_26770 <3903 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425090.1:methyl-accepting chemotaxis protein >Feature sequence097 220 1005 gene locus_tag LOCUS_26780 220 1005 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 protein_id gnl|my_center|LOCUS_26780 1005 1910 gene locus_tag LOCUS_26790 1005 1910 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_26790 1977 3536 gene locus_tag LOCUS_26800 1977 3536 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966186.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence098 >Feature sequence099 97 615 gene locus_tag LOCUS_26810 97 615 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_26810 612 1346 gene locus_tag LOCUS_26820 612 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1337 2224 gene locus_tag LOCUS_26830 1337 2224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_26830 2211 3452 gene locus_tag LOCUS_26840 2211 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence100 1811 420 gene locus_tag LOCUS_26850 1811 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2449 2087 gene locus_tag LOCUS_26860 gene tnpB 2449 2087 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748777.1 protein_id gnl|my_center|LOCUS_26860 3399 2995 gene locus_tag LOCUS_26870 3399 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence101 >Feature sequence102 >Feature sequence103 <1 2574 gene locus_tag LOCUS_26880 <1 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109466.1:beta-galactosidase >Feature sequence104 >Feature sequence105 <1 2556 gene locus_tag LOCUS_26890 <1 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196793289.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence106 2232 895 gene locus_tag LOCUS_26900 2232 895 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence107 <1 1399 gene locus_tag LOCUS_26910 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947070.1:flagellin 1959 1705 gene locus_tag LOCUS_26920 1959 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence108 280 603 gene locus_tag LOCUS_26930 gene mobC 280 603 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_26930 570 1949 gene locus_tag LOCUS_26940 570 1949 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence109 419 60 gene locus_tag LOCUS_26950 419 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2049 625 gene locus_tag LOCUS_26960 2049 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence110 1557 121 gene locus_tag LOCUS_26970 gene rlmD 1557 121 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence111 276 1766 gene locus_tag LOCUS_26980 276 1766 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203395.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence112 <1941 680 gene locus_tag LOCUS_26990 <1941 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458828.1:MobP3 family relaxase >Feature sequence113 109 285 gene locus_tag LOCUS_27000 109 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 533 282 gene locus_tag LOCUS_27010 533 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1846 530 gene locus_tag LOCUS_27020 1846 530 CDS product IS30-like element ISSmi1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163006.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence114 1041 709 gene locus_tag LOCUS_27030 1041 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 1570 1046 gene locus_tag LOCUS_27040 1570 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence115 >Feature sequence116 255 710 gene locus_tag LOCUS_27050 255 710 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_27050 714 1229 gene locus_tag LOCUS_27060 714 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1319 1630 gene locus_tag LOCUS_27070 1319 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence117 6 1007 gene locus_tag LOCUS_27080 6 1007 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461933.1 protein_id gnl|my_center|LOCUS_27080 970 1452 gene locus_tag LOCUS_27090 970 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014315028.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence118 <1601 194 gene locus_tag LOCUS_27100 <1601 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947070.1:flagellin >Feature sequence119 1511 156 gene locus_tag LOCUS_27110 1511 156 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence120 137 598 gene locus_tag LOCUS_27120 137 598 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008026391.1 protein_id gnl|my_center|LOCUS_27120 251 260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 604 1254 gene locus_tag LOCUS_27130 604 1254 CDS product DUF4122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108387.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence121 1491 61 gene locus_tag LOCUS_27140 1491 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence122 <1 611 gene locus_tag LOCUS_27150 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966854.1:acyl-[acyl-carrier-protein] thioesterase 667 1500 gene locus_tag LOCUS_27160 667 1500 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence123 1237 437 gene locus_tag LOCUS_27170 1237 437 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence124 >Feature sequence125 53 802 gene locus_tag LOCUS_27180 53 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence126 >Feature sequence127 114 725 gene locus_tag LOCUS_27190 114 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 741 1109 gene locus_tag LOCUS_27200 741 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence128 1081 149 gene locus_tag LOCUS_27210 1081 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence129 134 292 gene locus_tag LOCUS_27220 134 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1154 324 gene locus_tag LOCUS_27230 1154 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence130 1321 77 gene locus_tag LOCUS_27240 1321 77 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140337.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence131 3 1223 gene locus_tag LOCUS_27250 3 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence132 >Feature sequence133 681 448 gene locus_tag LOCUS_27260 681 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence134 <1 682 gene locus_tag LOCUS_27270 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680891.1:LytTR family DNA-binding domain-containing protein >Feature sequence135 984 187 gene locus_tag LOCUS_27280 984 187 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence136 1034 45 gene locus_tag LOCUS_27290 gene bsh 1034 45 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence137 >Feature sequence138 >Feature sequence139 >Feature sequence140 <1 596 gene locus_tag LOCUS_27300 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775403.1:glycoside hydrolase family 3 C-terminal domain-containing protein 520 529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence141 >Feature sequence142 >Feature sequence143 >Feature sequence144 304 504 gene locus_tag LOCUS_27310 304 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence145 >Feature sequence146