>Feature sequence001 1421 42 gene locus_tag LOCUS_00010 1421 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1563 2855 gene locus_tag LOCUS_00020 1563 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3511 2852 gene locus_tag LOCUS_00030 3511 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3779 4504 gene locus_tag LOCUS_00040 gene pyrH 3779 4504 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_00040 4521 5087 gene locus_tag LOCUS_00050 gene frr 4521 5087 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531501.1 protein_id gnl|my_center|LOCUS_00050 5087 5980 gene locus_tag LOCUS_00060 5087 5980 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125263.1 protein_id gnl|my_center|LOCUS_00060 5980 6672 gene locus_tag LOCUS_00070 gene rncS 5980 6672 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_00070 6665 7315 gene locus_tag LOCUS_00080 gene rpe 6665 7315 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_00080 7318 8322 gene locus_tag LOCUS_00090 gene rsgA 7318 8322 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965036.1 protein_id gnl|my_center|LOCUS_00090 8324 9178 gene locus_tag LOCUS_00100 8324 9178 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_00100 9180 9650 gene locus_tag LOCUS_00110 9180 9650 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_00110 9660 10352 gene locus_tag LOCUS_00120 9660 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10577 11137 gene locus_tag LOCUS_00130 gene efp 10577 11137 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_00130 11171 11629 gene locus_tag LOCUS_00140 11171 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11655 13010 gene locus_tag LOCUS_00150 gene accC 11655 13010 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_00150 13062 14006 gene locus_tag LOCUS_00160 13062 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14220 15959 gene locus_tag LOCUS_00170 14220 15959 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_00170 15959 16288 gene locus_tag LOCUS_00180 15959 16288 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_00180 16330 17175 gene locus_tag LOCUS_00190 gene speE 16330 17175 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869811.1 protein_id gnl|my_center|LOCUS_00190 17184 18032 gene locus_tag LOCUS_00200 gene speE 17184 18032 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_00200 18386 19726 gene locus_tag LOCUS_00210 18386 19726 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_00210 19723 20703 gene locus_tag LOCUS_00220 gene mraY 19723 20703 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893058.1 protein_id gnl|my_center|LOCUS_00220 20706 22055 gene locus_tag LOCUS_00230 gene murD 20706 22055 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_00230 22036 23244 gene locus_tag LOCUS_00240 gene spoVE 22036 23244 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_00240 23228 24361 gene locus_tag LOCUS_00250 gene murG 23228 24361 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_00250 24354 25517 gene locus_tag LOCUS_00260 24354 25517 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_00260 25612 26406 gene locus_tag LOCUS_00270 gene pxpA 25612 26406 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_00270 26444 27757 gene locus_tag LOCUS_00280 26444 27757 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_00280 27787 28695 gene locus_tag LOCUS_00290 27787 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30440 28692 gene locus_tag LOCUS_00300 30440 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31464 30478 gene locus_tag LOCUS_00310 31464 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32683 31475 gene locus_tag LOCUS_00320 32683 31475 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_00320 33325 32684 gene locus_tag LOCUS_00330 33325 32684 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 protein_id gnl|my_center|LOCUS_00330 34753 33344 gene locus_tag LOCUS_00340 gene mnmE 34753 33344 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_00340 34801 36402 gene locus_tag LOCUS_00350 gene hcp 34801 36402 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545464.1 protein_id gnl|my_center|LOCUS_00350 36514 37890 gene locus_tag LOCUS_00360 gene cysS 36514 37890 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_00360 37872 39557 gene locus_tag LOCUS_00370 37872 39557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39535 41151 gene locus_tag LOCUS_00380 gene murJ 39535 41151 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_00380 41151 41729 gene locus_tag LOCUS_00390 41151 41729 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_00390 41918 42310 gene locus_tag LOCUS_00400 41918 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43804 42341 gene locus_tag LOCUS_00410 43804 42341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43957 44541 gene locus_tag LOCUS_00420 43957 44541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44637 45305 gene locus_tag LOCUS_00430 44637 45305 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288638.1 protein_id gnl|my_center|LOCUS_00430 46131 45307 gene locus_tag LOCUS_00440 gene whiG 46131 45307 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_00440 47210 46272 gene locus_tag LOCUS_00450 47210 46272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47534 47307 gene locus_tag LOCUS_00460 47534 47307 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780840.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence002 319 651 gene locus_tag LOCUS_00470 319 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 750 923 gene locus_tag LOCUS_00480 750 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 1078 2400 gene locus_tag LOCUS_00490 1078 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 2530 2922 gene locus_tag LOCUS_00500 2530 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 2924 3631 gene locus_tag LOCUS_00510 2924 3631 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_00510 3674 4135 gene locus_tag LOCUS_00520 gene ribE 3674 4135 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_00520 4143 5036 gene locus_tag LOCUS_00530 gene murQ 4143 5036 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477926.1 protein_id gnl|my_center|LOCUS_00530 5036 6034 gene locus_tag LOCUS_00540 5036 6034 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724031.1 protein_id gnl|my_center|LOCUS_00540 6034 6960 gene locus_tag LOCUS_00550 gene ricT 6034 6960 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903716.1 protein_id gnl|my_center|LOCUS_00550 7361 7017 gene locus_tag LOCUS_00560 7361 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9099 7513 gene locus_tag LOCUS_00570 9099 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9557 9099 gene locus_tag LOCUS_00580 9557 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 10333 9593 gene locus_tag LOCUS_00590 10333 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10481 11311 gene locus_tag LOCUS_00600 10481 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 11318 12259 gene locus_tag LOCUS_00610 gene thrB 11318 12259 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_00610 12632 12243 gene locus_tag LOCUS_00620 12632 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 13143 12625 gene locus_tag LOCUS_00630 gene ybeY 13143 12625 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 protein_id gnl|my_center|LOCUS_00630 15316 13124 gene locus_tag LOCUS_00640 15316 13124 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_00640 16655 15369 gene locus_tag LOCUS_00650 gene purB 16655 15369 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_00650 16876 17259 gene locus_tag LOCUS_00660 16876 17259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 17366 17635 gene locus_tag LOCUS_00670 gene rpsO 17366 17635 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_00670 19321 17738 gene locus_tag LOCUS_00680 19321 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 19520 21430 gene locus_tag LOCUS_00690 19520 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 24474 21682 gene locus_tag LOCUS_00700 gene secA 24474 21682 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_00700 26252 24657 gene locus_tag LOCUS_00710 26252 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 26885 26268 gene locus_tag LOCUS_00720 26885 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 27563 27030 gene locus_tag LOCUS_00730 27563 27030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 28972 27647 gene locus_tag LOCUS_00740 28972 27647 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392247.1 protein_id gnl|my_center|LOCUS_00740 29301 28972 gene locus_tag LOCUS_00750 29301 28972 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125933.1 protein_id gnl|my_center|LOCUS_00750 30013 29342 gene locus_tag LOCUS_00760 30013 29342 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_00760 30695 30039 gene locus_tag LOCUS_00770 30695 30039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 32293 30980 gene locus_tag LOCUS_00780 32293 30980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 32731 32342 gene locus_tag LOCUS_00790 32731 32342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 32802 34967 gene locus_tag LOCUS_00800 32802 34967 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_00800 35004 36512 gene locus_tag LOCUS_00810 gene lysS 35004 36512 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056067.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence003 3889 44 gene locus_tag LOCUS_00820 3889 44 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_00820 3933 3942 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5693 3984 gene locus_tag LOCUS_00830 gene rpoC1 5693 3984 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144261.1 protein_id gnl|my_center|LOCUS_00830 9060 5746 gene locus_tag LOCUS_00840 gene rpoB 9060 5746 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243626.1 protein_id gnl|my_center|LOCUS_00840 11644 9353 gene locus_tag LOCUS_00850 11644 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 13794 11650 gene locus_tag LOCUS_00860 13794 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 15996 13795 gene locus_tag LOCUS_00870 15996 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 16155 18032 gene locus_tag LOCUS_00880 gene ftsH 16155 18032 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141915.1 protein_id gnl|my_center|LOCUS_00880 18471 18283 gene locus_tag LOCUS_00890 18471 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 19557 18604 gene locus_tag LOCUS_00900 19557 18604 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_00900 19629 20489 gene locus_tag LOCUS_00910 gene hpnK 19629 20489 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_00910 20461 22293 gene locus_tag LOCUS_00920 20461 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 22829 22290 gene locus_tag LOCUS_00930 22829 22290 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_00930 23062 24729 gene locus_tag LOCUS_00940 23062 24729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 25328 27460 gene locus_tag LOCUS_00950 25328 27460 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_00950 27445 28137 gene locus_tag LOCUS_00960 27445 28137 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_00960 28338 28901 gene locus_tag LOCUS_00970 28338 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 31452 29053 gene locus_tag LOCUS_00980 31452 29053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 31687 33471 gene locus_tag LOCUS_00990 31687 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence004 104 490 gene locus_tag LOCUS_01000 104 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 709 1887 gene locus_tag LOCUS_01010 709 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1968 2540 gene locus_tag LOCUS_01020 1968 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 2646 3848 gene locus_tag LOCUS_01030 2646 3848 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_01030 3860 4489 gene locus_tag LOCUS_01040 3860 4489 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_01040 4983 6716 gene locus_tag LOCUS_01050 4983 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 6811 7059 gene locus_tag LOCUS_01060 6811 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7345 7668 gene locus_tag LOCUS_01070 7345 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 10793 8151 gene locus_tag LOCUS_01080 gene valS 10793 8151 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_01080 12185 11025 gene locus_tag LOCUS_01090 12185 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192726.1 protein_id gnl|my_center|LOCUS_01090 12317 13048 gene locus_tag LOCUS_01100 12317 13048 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_01100 13981 13106 gene locus_tag LOCUS_01110 gene rfbA 13981 13106 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_01110 14978 13995 gene locus_tag LOCUS_01120 gene rfbB 14978 13995 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989656.1 protein_id gnl|my_center|LOCUS_01120 15535 14978 gene locus_tag LOCUS_01130 gene rfbC 15535 14978 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_01130 16419 15616 gene locus_tag LOCUS_01140 16419 15616 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_01140 16496 16993 gene locus_tag LOCUS_01150 16496 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 17094 18779 gene locus_tag LOCUS_01160 17094 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 18793 20088 gene locus_tag LOCUS_01170 18793 20088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 20100 20756 gene locus_tag LOCUS_01180 20100 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 22168 20813 gene locus_tag LOCUS_01190 22168 20813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 22340 23689 gene locus_tag LOCUS_01200 22340 23689 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence005 80 946 gene locus_tag LOCUS_01210 80 946 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_01210 948 1427 gene locus_tag LOCUS_01220 948 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 1482 2750 gene locus_tag LOCUS_01230 1482 2750 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_01230 2762 4015 gene locus_tag LOCUS_01240 2762 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4022 4570 gene locus_tag LOCUS_01250 4022 4570 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016449.1 protein_id gnl|my_center|LOCUS_01250 4700 4900 gene locus_tag LOCUS_01260 4700 4900 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546887.1 protein_id gnl|my_center|LOCUS_01260 4893 5576 gene locus_tag LOCUS_01270 4893 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 5784 6095 gene locus_tag LOCUS_01280 gene rpsJ 5784 6095 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057588.1 protein_id gnl|my_center|LOCUS_01280 6254 6892 gene locus_tag LOCUS_01290 gene rplC 6254 6892 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140089.1 protein_id gnl|my_center|LOCUS_01290 6940 7584 gene locus_tag LOCUS_01300 gene rplD 6940 7584 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_01300 7616 7924 gene locus_tag LOCUS_01310 7616 7924 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262338.1 protein_id gnl|my_center|LOCUS_01310 7944 8771 gene locus_tag LOCUS_01320 gene rplB 7944 8771 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_01320 8818 9093 gene locus_tag LOCUS_01330 gene rpsS 8818 9093 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_01330 9134 9472 gene locus_tag LOCUS_01340 9134 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 9485 10210 gene locus_tag LOCUS_01350 gene rpsC 9485 10210 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_01350 10239 10658 gene locus_tag LOCUS_01360 gene rplP 10239 10658 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_01360 10671 10862 gene locus_tag LOCUS_01370 10671 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 10862 11107 gene locus_tag LOCUS_01380 gene rpsQ 10862 11107 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143906.1 protein_id gnl|my_center|LOCUS_01380 11145 11513 gene locus_tag LOCUS_01390 gene rplN 11145 11513 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_01390 11580 11918 gene locus_tag LOCUS_01400 gene rplX 11580 11918 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_01400 11968 12522 gene locus_tag LOCUS_01410 gene rplE 11968 12522 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_01410 12559 12765 gene locus_tag LOCUS_01420 12559 12765 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143902.1 protein_id gnl|my_center|LOCUS_01420 13010 13405 gene locus_tag LOCUS_01430 gene rpsH 13010 13405 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01430 13476 14015 gene locus_tag LOCUS_01440 gene rplF 13476 14015 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892857.1 protein_id gnl|my_center|LOCUS_01440 14221 14589 gene locus_tag LOCUS_01450 gene rplR 14221 14589 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_01450 15956 14709 gene locus_tag LOCUS_01460 gene gcvPA 15956 14709 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990102.1 protein_id gnl|my_center|LOCUS_01460 16339 15956 gene locus_tag LOCUS_01470 gene gcvH 16339 15956 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_01470 17457 16354 gene locus_tag LOCUS_01480 gene gcvT 17457 16354 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_01480 17589 18680 gene locus_tag LOCUS_01490 17589 18680 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_01490 18680 19435 gene locus_tag LOCUS_01500 18680 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 19964 21814 gene locus_tag LOCUS_01510 19964 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 22011 23828 gene locus_tag LOCUS_01520 22011 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 <24736 23840 gene locus_tag LOCUS_01530 <24736 23840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545319.1:3-dehydroquinate synthase >Feature sequence006 918 343 gene locus_tag LOCUS_01540 918 343 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 protein_id gnl|my_center|LOCUS_01540 1057 1311 gene locus_tag LOCUS_01550 1057 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2652 1297 gene locus_tag LOCUS_01560 2652 1297 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_01560 4404 2773 gene locus_tag LOCUS_01570 4404 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5954 4428 gene locus_tag LOCUS_01580 5954 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7053 6013 gene locus_tag LOCUS_01590 gene lptG 7053 6013 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_01590 7293 8309 gene locus_tag LOCUS_01600 7293 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 8322 8630 gene locus_tag LOCUS_01610 8322 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 10367 8664 gene locus_tag LOCUS_01620 10367 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 10468 13062 gene locus_tag LOCUS_01630 gene clpB 10468 13062 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_01630 13289 13098 gene locus_tag LOCUS_01640 13289 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13446 14021 gene locus_tag LOCUS_01650 13446 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14066 15796 gene locus_tag LOCUS_01660 gene ade 14066 15796 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_01660 16016 17911 gene locus_tag LOCUS_01670 16016 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 18039 19667 gene locus_tag LOCUS_01680 18039 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 19710 20252 gene locus_tag LOCUS_01690 19710 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence007 730 65 gene locus_tag LOCUS_01700 730 65 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_01700 2295 862 gene locus_tag LOCUS_01710 2295 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 2481 2651 gene locus_tag LOCUS_01720 2481 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2946 3200 gene locus_tag LOCUS_01730 2946 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 3294 3632 gene locus_tag LOCUS_01740 3294 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3647 4021 gene locus_tag LOCUS_01750 3647 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4036 5412 gene locus_tag LOCUS_01760 gene radA 4036 5412 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_01760 6465 6067 gene locus_tag LOCUS_01770 gene rpsI 6465 6067 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001966744.1 protein_id gnl|my_center|LOCUS_01770 6902 6465 gene locus_tag LOCUS_01780 gene rplM 6902 6465 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_01780 7703 6927 gene locus_tag LOCUS_01790 gene truA 7703 6927 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_01790 8134 7706 gene locus_tag LOCUS_01800 gene rplQ 8134 7706 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 protein_id gnl|my_center|LOCUS_01800 9164 8181 gene locus_tag LOCUS_01810 9164 8181 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_01810 9915 9238 gene locus_tag LOCUS_01820 gene rpsD 9915 9238 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 protein_id gnl|my_center|LOCUS_01820 10305 9919 gene locus_tag LOCUS_01830 gene rpsK 10305 9919 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_01830 10753 10382 gene locus_tag LOCUS_01840 gene rpsM 10753 10382 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_01840 11334 11119 gene locus_tag LOCUS_01850 gene infA 11334 11119 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_01850 12777 11569 gene locus_tag LOCUS_01860 12777 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 14489 12777 gene locus_tag LOCUS_01870 14489 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 14793 14584 gene locus_tag LOCUS_01880 gene yidD 14793 14584 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546583.1 protein_id gnl|my_center|LOCUS_01880 16906 14804 gene locus_tag LOCUS_01890 gene flhA 16906 14804 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_01890 17634 16906 gene locus_tag LOCUS_01900 17634 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 18656 17646 gene locus_tag LOCUS_01910 18656 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20383 18707 gene locus_tag LOCUS_01920 20383 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 20794 20459 gene locus_tag LOCUS_01930 gene fliE 20794 20459 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002660553.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence008 112 555 gene locus_tag LOCUS_01940 112 555 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_01940 1245 637 gene locus_tag LOCUS_01950 1245 637 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_01950 2325 1267 gene locus_tag LOCUS_01960 2325 1267 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143077.1 protein_id gnl|my_center|LOCUS_01960 2444 3145 gene locus_tag LOCUS_01970 2444 3145 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_01970 3337 4338 gene locus_tag LOCUS_01980 3337 4338 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_01980 5017 4682 gene locus_tag LOCUS_01990 5017 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5272 6429 gene locus_tag LOCUS_02000 5272 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6422 7480 gene locus_tag LOCUS_02010 gene ugpC 6422 7480 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_02010 7492 8301 gene locus_tag LOCUS_02020 7492 8301 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_02020 9206 8430 gene locus_tag LOCUS_02030 9206 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10278 9343 gene locus_tag LOCUS_02040 gene thiL 10278 9343 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 protein_id gnl|my_center|LOCUS_02040 11479 10721 gene locus_tag LOCUS_02050 11479 10721 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_02050 11571 12665 gene locus_tag LOCUS_02060 11571 12665 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084216.1 protein_id gnl|my_center|LOCUS_02060 12894 13727 gene locus_tag LOCUS_02070 12894 13727 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_02070 13989 14411 gene locus_tag LOCUS_02080 13989 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 15650 14478 gene locus_tag LOCUS_02090 gene dapL 15650 14478 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144094.1 protein_id gnl|my_center|LOCUS_02090 15958 17022 gene locus_tag LOCUS_02100 gene ruvB 15958 17022 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_02100 17027 18169 gene locus_tag LOCUS_02110 17027 18169 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965731.1 protein_id gnl|my_center|LOCUS_02110 18183 18692 gene locus_tag LOCUS_02120 18183 18692 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_02120 19053 19517 gene locus_tag LOCUS_02130 19053 19517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence009 2501 120 gene locus_tag LOCUS_02140 gene recG 2501 120 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_02140 5095 2501 gene locus_tag LOCUS_02150 5095 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5475 5227 gene locus_tag LOCUS_02160 5475 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 5671 6387 gene locus_tag LOCUS_02170 gene phoP 5671 6387 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_02170 6387 8102 gene locus_tag LOCUS_02180 6387 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 8114 8539 gene locus_tag LOCUS_02190 8114 8539 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359498.1 protein_id gnl|my_center|LOCUS_02190 8536 9279 gene locus_tag LOCUS_02200 8536 9279 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_02200 9608 10093 gene locus_tag LOCUS_02210 gene ruvC 9608 10093 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081287.1 protein_id gnl|my_center|LOCUS_02210 10106 10594 gene locus_tag LOCUS_02220 10106 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 10720 10902 gene locus_tag LOCUS_02230 10720 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11274 10891 gene locus_tag LOCUS_02240 11274 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13205 11274 gene locus_tag LOCUS_02250 13205 11274 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_02250 13275 13883 gene locus_tag LOCUS_02260 13275 13883 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_02260 13886 14827 gene locus_tag LOCUS_02270 gene rbsK 13886 14827 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 protein_id gnl|my_center|LOCUS_02270 14829 15845 gene locus_tag LOCUS_02280 gene csaB 14829 15845 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_02280 16109 15831 gene locus_tag LOCUS_02290 16109 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 17695 16187 gene locus_tag LOCUS_02300 17695 16187 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990850.1 protein_id gnl|my_center|LOCUS_02300 17956 18087 gene locus_tag LOCUS_02310 17956 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 18103 18621 gene locus_tag LOCUS_02320 18103 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence010 688 32 gene locus_tag LOCUS_02330 688 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 792 1784 gene locus_tag LOCUS_02340 792 1784 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143105.1 protein_id gnl|my_center|LOCUS_02340 1950 3638 gene locus_tag LOCUS_02350 gene glgP 1950 3638 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_02350 3950 5476 gene locus_tag LOCUS_02360 3950 5476 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_02360 5619 5482 gene locus_tag LOCUS_02370 5619 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5663 6988 gene locus_tag LOCUS_02380 gene miaB 5663 6988 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005381.1 protein_id gnl|my_center|LOCUS_02380 7278 7505 gene locus_tag LOCUS_02390 7278 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7607 8884 gene locus_tag LOCUS_02400 7607 8884 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_02400 8896 9951 gene locus_tag LOCUS_02410 gene thrC 8896 9951 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_02410 11000 9948 gene locus_tag LOCUS_02420 gene ribD 11000 9948 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987156.1 protein_id gnl|my_center|LOCUS_02420 11051 11725 gene locus_tag LOCUS_02430 11051 11725 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_02430 12710 11715 gene locus_tag LOCUS_02440 12710 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 13026 12847 gene locus_tag LOCUS_02450 13026 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 14069 13104 gene locus_tag LOCUS_02460 gene fmt 14069 13104 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365369.1 protein_id gnl|my_center|LOCUS_02460 14953 14057 gene locus_tag LOCUS_02470 14953 14057 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_02470 15036 17273 gene locus_tag LOCUS_02480 15036 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence011 345 986 gene locus_tag LOCUS_02490 gene fliP 345 986 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_02490 1001 1507 gene locus_tag LOCUS_02500 1001 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1510 2289 gene locus_tag LOCUS_02510 1510 2289 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733160.1 protein_id gnl|my_center|LOCUS_02510 2890 2375 gene locus_tag LOCUS_02520 2890 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3079 3285 gene locus_tag LOCUS_02530 3079 3285 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_02530 3286 3714 gene locus_tag LOCUS_02540 3286 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3724 4698 gene locus_tag LOCUS_02550 3724 4698 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263064.1 protein_id gnl|my_center|LOCUS_02550 5078 4773 gene locus_tag LOCUS_02560 5078 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 5176 5349 gene locus_tag LOCUS_02570 5176 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 5356 6276 gene locus_tag LOCUS_02580 5356 6276 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_02580 6284 6733 gene locus_tag LOCUS_02590 gene smpB 6284 6733 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_02590 6745 7317 gene locus_tag LOCUS_02600 6745 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7471 7827 gene locus_tag LOCUS_02610 gene rplU 7471 7827 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140827.1 protein_id gnl|my_center|LOCUS_02610 7873 8136 gene locus_tag LOCUS_02620 gene rpmA 7873 8136 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_02620 8293 9057 gene locus_tag LOCUS_02630 gene fliP 8293 9057 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359303.1 protein_id gnl|my_center|LOCUS_02630 9073 9342 gene locus_tag LOCUS_02640 gene fliQ 9073 9342 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_02640 9353 10135 gene locus_tag LOCUS_02650 gene fliR 9353 10135 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_02650 10160 11236 gene locus_tag LOCUS_02660 gene flhB 10160 11236 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_02660 11265 13361 gene locus_tag LOCUS_02670 gene flhA 11265 13361 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860707.1 protein_id gnl|my_center|LOCUS_02670 13380 13976 gene locus_tag LOCUS_02680 13380 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 13980 14324 gene locus_tag LOCUS_02690 13980 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 14324 15358 gene locus_tag LOCUS_02700 14324 15358 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963620.1 protein_id gnl|my_center|LOCUS_02700 15442 16677 gene locus_tag LOCUS_02710 15442 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 16689 17774 gene locus_tag LOCUS_02720 16689 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence012 413 183 gene locus_tag LOCUS_02730 413 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1736 432 gene locus_tag LOCUS_02740 1736 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 3413 1758 gene locus_tag LOCUS_02750 3413 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 3933 3400 gene locus_tag LOCUS_02760 3933 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3992 4447 gene locus_tag LOCUS_02770 3992 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4801 4436 gene locus_tag LOCUS_02780 4801 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5236 4811 gene locus_tag LOCUS_02790 5236 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6004 5366 gene locus_tag LOCUS_02800 6004 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6757 6089 gene locus_tag LOCUS_02810 6757 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7003 6761 gene locus_tag LOCUS_02820 7003 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 7983 7072 gene locus_tag LOCUS_02830 7983 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889358.1 protein_id gnl|my_center|LOCUS_02830 9801 8290 gene locus_tag LOCUS_02840 9801 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10302 9811 gene locus_tag LOCUS_02850 10302 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 10544 10314 gene locus_tag LOCUS_02860 10544 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 10946 10590 gene locus_tag LOCUS_02870 10946 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12216 11143 gene locus_tag LOCUS_02880 12216 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12280 12819 gene locus_tag LOCUS_02890 gene rimI 12280 12819 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_02890 12809 13498 gene locus_tag LOCUS_02900 12809 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13588 13740 gene locus_tag LOCUS_02910 13588 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 13854 14660 gene locus_tag LOCUS_02920 13854 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15590 14664 gene locus_tag LOCUS_02930 15590 14664 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_02930 15589 17574 gene locus_tag LOCUS_02940 15589 17574 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141608.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence013 1164 217 gene locus_tag LOCUS_02950 1164 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2624 1164 gene locus_tag LOCUS_02960 2624 1164 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_02960 4376 2643 gene locus_tag LOCUS_02970 4376 2643 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_02970 4901 4452 gene locus_tag LOCUS_02980 4901 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5894 4959 gene locus_tag LOCUS_02990 gene rsmH 5894 4959 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_02990 6104 6430 gene locus_tag LOCUS_03000 6104 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 7062 6427 gene locus_tag LOCUS_03010 7062 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 7129 8454 gene locus_tag LOCUS_03020 7129 8454 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_03020 8451 8990 gene locus_tag LOCUS_03030 8451 8990 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_03030 9057 10109 gene locus_tag LOCUS_03040 gene cbpA 9057 10109 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269037.1 protein_id gnl|my_center|LOCUS_03040 10757 10110 gene locus_tag LOCUS_03050 10757 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 11007 10759 gene locus_tag LOCUS_03060 11007 10759 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_03060 11098 12450 gene locus_tag LOCUS_03070 11098 12450 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_03070 12514 13617 gene locus_tag LOCUS_03080 gene ychF 12514 13617 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_03080 14294 13686 gene locus_tag LOCUS_03090 14294 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 15279 14362 gene locus_tag LOCUS_03100 15279 14362 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964409.1 protein_id gnl|my_center|LOCUS_03100 15654 15283 gene locus_tag LOCUS_03110 15654 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 16073 15657 gene locus_tag LOCUS_03120 gene fliS 16073 15657 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_03120 16603 16097 gene locus_tag LOCUS_03130 16603 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence014 178 4254 gene locus_tag LOCUS_03140 178 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4342 4917 gene locus_tag LOCUS_03150 4342 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5782 4874 gene locus_tag LOCUS_03160 5782 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5942 6760 gene locus_tag LOCUS_03170 5942 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7825 6815 gene locus_tag LOCUS_03180 7825 6815 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_03180 8476 7898 gene locus_tag LOCUS_03190 gene rdgB 8476 7898 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_03190 9213 8479 gene locus_tag LOCUS_03200 9213 8479 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125255.1 protein_id gnl|my_center|LOCUS_03200 9298 9822 gene locus_tag LOCUS_03210 9298 9822 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898339.1 protein_id gnl|my_center|LOCUS_03210 9806 11077 gene locus_tag LOCUS_03220 9806 11077 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_03220 11087 11596 gene locus_tag LOCUS_03230 11087 11596 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_03230 11668 12444 gene locus_tag LOCUS_03240 11668 12444 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545908.1 protein_id gnl|my_center|LOCUS_03240 12444 13718 gene locus_tag LOCUS_03250 12444 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 13728 14759 gene locus_tag LOCUS_03260 gene fliM 13728 14759 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_03260 14776 15390 gene locus_tag LOCUS_03270 14776 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 15543 15618 gene locus_tag LOCUS_t00010 15543 15618 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 306 1943 gene locus_tag LOCUS_03280 306 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1943 2350 gene locus_tag LOCUS_03290 gene ruvX 1943 2350 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_03290 2365 2622 gene locus_tag LOCUS_03300 2365 2622 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583235.1 protein_id gnl|my_center|LOCUS_03300 2622 3980 gene locus_tag LOCUS_03310 2622 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4066 5313 gene locus_tag LOCUS_03320 gene tilS 4066 5313 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_03320 5310 5849 gene locus_tag LOCUS_03330 gene hpt 5310 5849 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_03330 5852 7117 gene locus_tag LOCUS_03340 5852 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 8072 7077 gene locus_tag LOCUS_03350 gene dusB 8072 7077 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_03350 10185 8056 gene locus_tag LOCUS_03360 10185 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 10363 10731 gene locus_tag LOCUS_03370 10363 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 10808 11797 gene locus_tag LOCUS_03380 10808 11797 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140560.1 protein_id gnl|my_center|LOCUS_03380 11778 13157 gene locus_tag LOCUS_03390 11778 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15363 13162 gene locus_tag LOCUS_03400 gene priA 15363 13162 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_03400 15602 15363 gene locus_tag LOCUS_03410 15602 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence016 211 1251 gene locus_tag LOCUS_03420 gene queA 211 1251 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_03420 1408 2166 gene locus_tag LOCUS_03430 1408 2166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_03430 2154 2876 gene locus_tag LOCUS_03440 2154 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2910 3806 gene locus_tag LOCUS_03450 2910 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4008 4017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5008 4058 gene locus_tag LOCUS_03460 5008 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5668 5018 gene locus_tag LOCUS_03470 5668 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7347 5749 gene locus_tag LOCUS_03480 7347 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8025 7357 gene locus_tag LOCUS_03490 8025 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9069 8041 gene locus_tag LOCUS_03500 9069 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 9338 9069 gene locus_tag LOCUS_03510 9338 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9909 9421 gene locus_tag LOCUS_03520 9909 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 12607 9902 gene locus_tag LOCUS_03530 12607 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12689 13762 gene locus_tag LOCUS_03540 12689 13762 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_03540 13947 15779 gene locus_tag LOCUS_03550 13947 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence017 1221 40 gene locus_tag LOCUS_03560 1221 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1482 1225 gene locus_tag LOCUS_03570 1482 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1881 1495 gene locus_tag LOCUS_03580 gene cdd 1881 1495 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583680.1 protein_id gnl|my_center|LOCUS_03580 2020 3306 gene locus_tag LOCUS_03590 2020 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3670 3311 gene locus_tag LOCUS_03600 3670 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4911 3673 gene locus_tag LOCUS_03610 4911 3673 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_03610 5000 5710 gene locus_tag LOCUS_03620 5000 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6983 5697 gene locus_tag LOCUS_03630 gene mtaB 6983 5697 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_03630 7025 7216 gene locus_tag LOCUS_03640 7025 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7526 7197 gene locus_tag LOCUS_03650 7526 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 8764 7526 gene locus_tag LOCUS_03660 gene hisS 8764 7526 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_03660 8863 10281 gene locus_tag LOCUS_03670 gene hydG 8863 10281 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_03670 10812 10324 gene locus_tag LOCUS_03680 10812 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11712 10915 gene locus_tag LOCUS_03690 11712 10915 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125868.1 protein_id gnl|my_center|LOCUS_03690 12945 11713 gene locus_tag LOCUS_03700 12945 11713 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_03700 14095 12953 gene locus_tag LOCUS_03710 gene proB 14095 12953 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_03710 14556 14104 gene locus_tag LOCUS_03720 14556 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 14750 14905 gene locus_tag LOCUS_03730 14750 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 15034 15267 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttgatttactcttaatttaaagtatgttataat >Feature sequence018 1436 69 gene locus_tag LOCUS_03740 gene glnA 1436 69 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_03740 1703 2821 gene locus_tag LOCUS_03750 1703 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2909 3634 gene locus_tag LOCUS_03760 gene lptB 2909 3634 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143254.1 protein_id gnl|my_center|LOCUS_03760 3634 4758 gene locus_tag LOCUS_03770 gene lptG 3634 4758 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446409.1 protein_id gnl|my_center|LOCUS_03770 4770 5561 gene locus_tag LOCUS_03780 4770 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6673 5930 gene locus_tag LOCUS_03790 6673 5930 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_03790 7564 6737 gene locus_tag LOCUS_03800 7564 6737 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_03800 8508 7564 gene locus_tag LOCUS_03810 gene fmt 8508 7564 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_03810 8881 8495 gene locus_tag LOCUS_03820 gene crcB 8881 8495 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011704.1 protein_id gnl|my_center|LOCUS_03820 10219 8948 gene locus_tag LOCUS_03830 gene metK 10219 8948 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_03830 10396 11526 gene locus_tag LOCUS_03840 10396 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 12212 11523 gene locus_tag LOCUS_03850 gene trmD 12212 11523 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_03850 12727 12212 gene locus_tag LOCUS_03860 gene rimM 12727 12212 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_03860 14072 12717 gene locus_tag LOCUS_03870 14072 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 14651 14214 gene locus_tag LOCUS_03880 gene dtd 14651 14214 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence019 50 2527 gene locus_tag LOCUS_03890 gene leuS 50 2527 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_03890 4524 2635 gene locus_tag LOCUS_03900 4524 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 6353 4572 gene locus_tag LOCUS_03910 6353 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6574 7056 gene locus_tag LOCUS_03920 6574 7056 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 protein_id gnl|my_center|LOCUS_03920 7124 8362 gene locus_tag LOCUS_03930 7124 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8423 9328 gene locus_tag LOCUS_03940 8423 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9553 9392 gene locus_tag LOCUS_03950 9553 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 11629 9785 gene locus_tag LOCUS_03960 gene glmS 11629 9785 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_03960 11767 12471 gene locus_tag LOCUS_03970 11767 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12471 12917 gene locus_tag LOCUS_03980 12471 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12914 13372 gene locus_tag LOCUS_03990 12914 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 13393 14100 gene locus_tag LOCUS_04000 13393 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence020 <1 527 gene locus_tag LOCUS_04010 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000822542.1:HAMP domain-containing sensor histidine kinase 549 1253 gene locus_tag LOCUS_04020 549 1253 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_04020 1250 2062 gene locus_tag LOCUS_04030 1250 2062 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_04030 2056 3420 gene locus_tag LOCUS_04040 gene dacB 2056 3420 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957323.1 protein_id gnl|my_center|LOCUS_04040 4319 3456 gene locus_tag LOCUS_04050 4319 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4368 5753 gene locus_tag LOCUS_04060 4368 5753 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_04060 5737 8199 gene locus_tag LOCUS_04070 gene pheT 5737 8199 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_04070 8365 9009 gene locus_tag LOCUS_04080 8365 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9953 9243 gene locus_tag LOCUS_04090 9953 9243 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983637.1 protein_id gnl|my_center|LOCUS_04090 10288 9956 gene locus_tag LOCUS_04100 10288 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 10531 10304 gene locus_tag LOCUS_04110 gene secG 10531 10304 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_04110 11214 10534 gene locus_tag LOCUS_04120 11214 10534 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_04120 11934 11281 gene locus_tag LOCUS_04130 11934 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 12125 13300 gene locus_tag LOCUS_04140 12125 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 13478 13765 gene locus_tag LOCUS_04150 13478 13765 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence021 <1 670 gene locus_tag LOCUS_04160 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583464.1:S41 family peptidase 1988 672 gene locus_tag LOCUS_04170 gene fliI 1988 672 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_04170 2949 1969 gene locus_tag LOCUS_04180 2949 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4036 2933 gene locus_tag LOCUS_04190 gene fliG 4036 2933 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_04190 5607 4042 gene locus_tag LOCUS_04200 gene fliF 5607 4042 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_04200 6203 5763 gene locus_tag LOCUS_04210 6203 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6738 6232 gene locus_tag LOCUS_04220 gene flgC 6738 6232 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870081.1 protein_id gnl|my_center|LOCUS_04220 7285 6788 gene locus_tag LOCUS_04230 7285 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8536 7295 gene locus_tag LOCUS_04240 8536 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9359 8631 gene locus_tag LOCUS_04250 gene degU 9359 8631 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 protein_id gnl|my_center|LOCUS_04250 10343 9612 gene locus_tag LOCUS_04260 10343 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10539 11339 gene locus_tag LOCUS_04270 gene rfbF 10539 11339 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_04270 11332 12402 gene locus_tag LOCUS_04280 gene rfbG 11332 12402 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_04280 12390 13745 gene locus_tag LOCUS_04290 gene rfbH 12390 13745 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence022 48 1313 gene locus_tag LOCUS_04300 gene serS 48 1313 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963350.1 protein_id gnl|my_center|LOCUS_04300 1573 3870 gene locus_tag LOCUS_04310 1573 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3977 4579 gene locus_tag LOCUS_04320 3977 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4579 5151 gene locus_tag LOCUS_04330 4579 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9141 5407 gene locus_tag LOCUS_04340 9141 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 9748 9179 gene locus_tag LOCUS_04350 9748 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 13334 9801 gene locus_tag LOCUS_04360 13334 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence023 1552 920 gene locus_tag LOCUS_04370 1552 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2016 1543 gene locus_tag LOCUS_04380 gene tsaE 2016 1543 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_04380 3488 2019 gene locus_tag LOCUS_04390 3488 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4685 3504 gene locus_tag LOCUS_04400 4685 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 5765 4710 gene locus_tag LOCUS_04410 5765 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6408 5818 gene locus_tag LOCUS_04420 6408 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6670 7359 gene locus_tag LOCUS_04430 6670 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 7839 7938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8561 8073 gene locus_tag LOCUS_04440 8561 8073 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_04440 8955 8554 gene locus_tag LOCUS_04450 8955 8554 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876395.1 protein_id gnl|my_center|LOCUS_04450 9102 9656 gene locus_tag LOCUS_04460 9102 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9660 10862 gene locus_tag LOCUS_04470 gene trpB 9660 10862 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_04470 10866 11897 gene locus_tag LOCUS_04480 gene rlmN 10866 11897 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266908.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence024 210 728 gene locus_tag LOCUS_04490 210 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 682 1509 gene locus_tag LOCUS_04500 682 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1609 2103 gene locus_tag LOCUS_04510 1609 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2093 4012 gene locus_tag LOCUS_04520 2093 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4005 4841 gene locus_tag LOCUS_04530 4005 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5366 6319 gene locus_tag LOCUS_04540 gene glcK 5366 6319 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_04540 6322 7302 gene locus_tag LOCUS_04550 6322 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7286 8137 gene locus_tag LOCUS_04560 7286 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 8692 8114 gene locus_tag LOCUS_04570 gene yqeK 8692 8114 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_04570 9299 8682 gene locus_tag LOCUS_04580 gene nadD 9299 8682 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_04580 9902 9378 gene locus_tag LOCUS_04590 9902 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12183 9985 gene locus_tag LOCUS_04600 12183 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 <13664 12219 gene locus_tag LOCUS_04610 <13664 12219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206768427.1:flagellar biosynthesis protein FlhA >Feature sequence025 736 92 gene locus_tag LOCUS_04620 736 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 977 1546 gene locus_tag LOCUS_04630 977 1546 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_04630 2609 1536 gene locus_tag LOCUS_04640 2609 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5143 2717 gene locus_tag LOCUS_04650 5143 2717 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_04650 5228 5695 gene locus_tag LOCUS_04660 gene ndk 5228 5695 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875897.1 protein_id gnl|my_center|LOCUS_04660 5682 6806 gene locus_tag LOCUS_04670 gene tgt 5682 6806 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_04670 8500 6935 gene locus_tag LOCUS_04680 8500 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 9162 8809 gene locus_tag LOCUS_04690 9162 8809 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_04690 10471 9149 gene locus_tag LOCUS_04700 10471 9149 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_04700 11963 10566 gene locus_tag LOCUS_04710 11963 10566 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582596.1 protein_id gnl|my_center|LOCUS_04710 12857 11982 gene locus_tag LOCUS_04720 12857 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 <13535 12857 gene locus_tag LOCUS_04730 <13535 12857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865083.1:D-alanine--D-alanine ligase >Feature sequence026 1262 432 gene locus_tag LOCUS_04740 1262 432 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_04740 2007 1264 gene locus_tag LOCUS_04750 2007 1264 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_04750 2091 2417 gene locus_tag LOCUS_04760 2091 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4767 2662 gene locus_tag LOCUS_04770 gene fusA 4767 2662 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_04770 4951 6291 gene locus_tag LOCUS_04780 gene trkA 4951 6291 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_04780 6293 7762 gene locus_tag LOCUS_04790 6293 7762 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021495.1 protein_id gnl|my_center|LOCUS_04790 8606 7764 gene locus_tag LOCUS_04800 gene lipA 8606 7764 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_04800 9841 8603 gene locus_tag LOCUS_04810 gene lpdA 9841 8603 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545965.1 protein_id gnl|my_center|LOCUS_04810 10975 9851 gene locus_tag LOCUS_04820 gene alr 10975 9851 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182683.1 protein_id gnl|my_center|LOCUS_04820 12156 10990 gene locus_tag LOCUS_04830 12156 10990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095903.1 protein_id gnl|my_center|LOCUS_04830 <13161 12187 gene locus_tag LOCUS_04840 <13161 12187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083410.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence027 2947 470 gene locus_tag LOCUS_04850 gene pcrA 2947 470 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674369.1 protein_id gnl|my_center|LOCUS_04850 3027 3620 gene locus_tag LOCUS_04860 3027 3620 CDS product DNA recombination-mediator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929135.1 protein_id gnl|my_center|LOCUS_04860 3626 4795 gene locus_tag LOCUS_04870 3626 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4807 5337 gene locus_tag LOCUS_04880 4807 5337 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_04880 5348 6160 gene locus_tag LOCUS_04890 5348 6160 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 protein_id gnl|my_center|LOCUS_04890 6153 6632 gene locus_tag LOCUS_04900 gene ispF 6153 6632 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_04900 6634 7011 gene locus_tag LOCUS_04910 gene gloA 6634 7011 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_04910 7016 7591 gene locus_tag LOCUS_04920 7016 7591 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_04920 7710 7883 gene locus_tag LOCUS_04930 7710 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9261 7987 gene locus_tag LOCUS_04940 9261 7987 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_04940 9348 10538 gene locus_tag LOCUS_04950 9348 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11453 10671 gene locus_tag LOCUS_04960 gene glnH 11453 10671 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916480.1 protein_id gnl|my_center|LOCUS_04960 11549 12682 gene locus_tag LOCUS_04970 11549 12682 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence028 1180 962 gene locus_tag LOCUS_04980 1180 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2054 1182 gene locus_tag LOCUS_04990 2054 1182 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052404.1 protein_id gnl|my_center|LOCUS_04990 2740 2054 gene locus_tag LOCUS_05000 2740 2054 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_05000 3249 2749 gene locus_tag LOCUS_05010 3249 2749 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_05010 4600 3587 gene locus_tag LOCUS_05020 4600 3587 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427767.1 protein_id gnl|my_center|LOCUS_05020 5245 4649 gene locus_tag LOCUS_05030 gene recR 5245 4649 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_05030 5596 5261 gene locus_tag LOCUS_05040 5596 5261 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_05040 5675 6463 gene locus_tag LOCUS_05050 5675 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6538 7422 gene locus_tag LOCUS_05060 gene accD 6538 7422 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_05060 7439 8389 gene locus_tag LOCUS_05070 7439 8389 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124688.1 protein_id gnl|my_center|LOCUS_05070 8382 9278 gene locus_tag LOCUS_05080 gene prmA 8382 9278 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990133.1 protein_id gnl|my_center|LOCUS_05080 9290 9745 gene locus_tag LOCUS_05090 9290 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9750 10193 gene locus_tag LOCUS_05100 9750 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 10237 10980 gene locus_tag LOCUS_05110 gene kdsB 10237 10980 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_05110 11128 11877 gene locus_tag LOCUS_05120 11128 11877 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_05120 11911 11986 gene locus_tag LOCUS_t00020 11911 11986 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12396 12587 gene locus_tag LOCUS_05130 12396 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence029 791 48 gene locus_tag LOCUS_05140 791 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1195 920 gene locus_tag LOCUS_05150 1195 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3238 1244 gene locus_tag LOCUS_05160 gene ligA 3238 1244 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031442.1 protein_id gnl|my_center|LOCUS_05160 3841 4419 gene locus_tag LOCUS_05170 3841 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4419 5231 gene locus_tag LOCUS_05180 gene flgG 4419 5231 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_05180 5281 6066 gene locus_tag LOCUS_05190 gene flgG 5281 6066 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_05190 6077 6784 gene locus_tag LOCUS_05200 6077 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6813 7436 gene locus_tag LOCUS_05210 6813 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7456 8553 gene locus_tag LOCUS_05220 7456 8553 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073126.1 protein_id gnl|my_center|LOCUS_05220 8579 8926 gene locus_tag LOCUS_05230 8579 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 8951 9235 gene locus_tag LOCUS_05240 8951 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9257 9760 gene locus_tag LOCUS_05250 9257 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9775 11262 gene locus_tag LOCUS_05260 gene flgK 9775 11262 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_05260 11318 12322 gene locus_tag LOCUS_05270 gene flgL 11318 12322 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212790.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence030 75 989 gene locus_tag LOCUS_05280 75 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 1022 3124 gene locus_tag LOCUS_05290 1022 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3140 5155 gene locus_tag LOCUS_05300 gene pilB 3140 5155 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_05300 5167 6372 gene locus_tag LOCUS_05310 5167 6372 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_05310 6389 6709 gene locus_tag LOCUS_05320 6389 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6699 7532 gene locus_tag LOCUS_05330 6699 7532 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_05330 8332 7529 gene locus_tag LOCUS_05340 8332 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9076 8333 gene locus_tag LOCUS_05350 gene pgeF 9076 8333 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897820.1 protein_id gnl|my_center|LOCUS_05350 10377 9064 gene locus_tag LOCUS_05360 gene trmFO 10377 9064 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213003.1 protein_id gnl|my_center|LOCUS_05360 10446 11570 gene locus_tag LOCUS_05370 gene wecB 10446 11570 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211986.1 protein_id gnl|my_center|LOCUS_05370 <12324 11730 gene locus_tag LOCUS_05380 <12324 11730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867884.1:1,4-alpha-glucan branching protein >Feature sequence031 881 27 gene locus_tag LOCUS_05390 881 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2686 893 gene locus_tag LOCUS_05400 gene typA 2686 893 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141519.1 protein_id gnl|my_center|LOCUS_05400 3323 2745 gene locus_tag LOCUS_05410 gene canB 3323 2745 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_05410 3400 5004 gene locus_tag LOCUS_05420 3400 5004 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_05420 5461 5069 gene locus_tag LOCUS_05430 5461 5069 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141140.1 protein_id gnl|my_center|LOCUS_05430 6012 5464 gene locus_tag LOCUS_05440 6012 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 6673 6026 gene locus_tag LOCUS_05450 6673 6026 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141141.1 protein_id gnl|my_center|LOCUS_05450 7900 6719 gene locus_tag LOCUS_05460 7900 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8669 7965 gene locus_tag LOCUS_05470 8669 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 9300 8728 gene locus_tag LOCUS_05480 9300 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10188 9358 gene locus_tag LOCUS_05490 10188 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 10360 11574 gene locus_tag LOCUS_05500 10360 11574 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence032 150 1505 gene locus_tag LOCUS_05510 150 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1863 2510 gene locus_tag LOCUS_05520 1863 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2551 3354 gene locus_tag LOCUS_05530 2551 3354 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_05530 3373 3633 gene locus_tag LOCUS_05540 3373 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5152 3815 gene locus_tag LOCUS_05550 5152 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6326 5232 gene locus_tag LOCUS_05560 gene rpoD 6326 5232 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_05560 8200 6326 gene locus_tag LOCUS_05570 8200 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 8245 9015 gene locus_tag LOCUS_05580 8245 9015 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_05580 9012 9842 gene locus_tag LOCUS_05590 9012 9842 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_05590 <11259 9805 gene locus_tag LOCUS_05600 <11259 9805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545697.1:TolC family protein >Feature sequence033 317 1390 gene locus_tag LOCUS_05610 317 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1486 3024 gene locus_tag LOCUS_05620 1486 3024 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_05620 4891 3188 gene locus_tag LOCUS_05630 4891 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6144 5113 gene locus_tag LOCUS_05640 6144 5113 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_05640 6212 6490 gene locus_tag LOCUS_05650 6212 6490 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461681.1 protein_id gnl|my_center|LOCUS_05650 7759 6605 gene locus_tag LOCUS_05660 7759 6605 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147561507.1 protein_id gnl|my_center|LOCUS_05660 8056 9291 gene locus_tag LOCUS_05670 gene waaA 8056 9291 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369159.1 protein_id gnl|my_center|LOCUS_05670 9291 10400 gene locus_tag LOCUS_05680 9291 10400 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence034 769 1701 gene locus_tag LOCUS_05690 769 1701 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_05690 3504 1765 gene locus_tag LOCUS_05700 gene argS 3504 1765 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_05700 3581 4948 gene locus_tag LOCUS_05710 gene mgtE 3581 4948 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_05710 5609 5184 gene locus_tag LOCUS_05720 5609 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7302 5797 gene locus_tag LOCUS_05730 7302 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 8042 7434 gene locus_tag LOCUS_05740 gene ruvA 8042 7434 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689924.1 protein_id gnl|my_center|LOCUS_05740 8156 9055 gene locus_tag LOCUS_05750 8156 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9108 10769 gene locus_tag LOCUS_05760 9108 10769 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence035 1184 2536 gene locus_tag LOCUS_05770 gene fliI 1184 2536 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 protein_id gnl|my_center|LOCUS_05770 2551 3471 gene locus_tag LOCUS_05780 2551 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3491 3928 gene locus_tag LOCUS_05790 3491 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3934 4842 gene locus_tag LOCUS_05800 3934 4842 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_05800 4839 5129 gene locus_tag LOCUS_05810 4839 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6988 5210 gene locus_tag LOCUS_05820 6988 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 9364 7004 gene locus_tag LOCUS_05830 9364 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 10391 9366 gene locus_tag LOCUS_05840 10391 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence036 2750 90 gene locus_tag LOCUS_05850 gene ppdK 2750 90 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_05850 2889 4097 gene locus_tag LOCUS_05860 2889 4097 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_05860 4592 4191 gene locus_tag LOCUS_05870 4592 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5309 4806 gene locus_tag LOCUS_05880 5309 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6191 5388 gene locus_tag LOCUS_05890 6191 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6516 6199 gene locus_tag LOCUS_05900 6516 6199 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence037 <1 1484 gene locus_tag LOCUS_05910 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525345.1:ATP-binding protein 1996 1532 gene locus_tag LOCUS_05920 1996 1532 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_05920 2162 2638 gene locus_tag LOCUS_05930 2162 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3211 2645 gene locus_tag LOCUS_05940 3211 2645 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_05940 3362 3278 gene locus_tag LOCUS_t00030 3362 3278 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3443 3372 gene locus_tag LOCUS_t00040 3443 3372 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3536 3465 gene locus_tag LOCUS_t00050 3536 3465 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3726 4424 gene locus_tag LOCUS_05950 gene flgF 3726 4424 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_05950 4453 5175 gene locus_tag LOCUS_05960 gene flgG 4453 5175 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_05960 5221 5574 gene locus_tag LOCUS_05970 gene flgB 5221 5574 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_05970 5624 6067 gene locus_tag LOCUS_05980 gene flgC 5624 6067 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_05980 6194 7300 gene locus_tag LOCUS_05990 gene mnmA 6194 7300 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_05990 7300 8337 gene locus_tag LOCUS_06000 gene hydE 7300 8337 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_06000 8407 8889 gene locus_tag LOCUS_06010 8407 8889 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_06010 8886 10049 gene locus_tag LOCUS_06020 8886 10049 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence038 657 1310 gene locus_tag LOCUS_06030 657 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2831 1620 gene locus_tag LOCUS_06040 2831 1620 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949022.1 protein_id gnl|my_center|LOCUS_06040 2969 4711 gene locus_tag LOCUS_06050 2969 4711 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678848.1 protein_id gnl|my_center|LOCUS_06050 4754 5152 gene locus_tag LOCUS_06060 4754 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5152 5892 gene locus_tag LOCUS_06070 5152 5892 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_06070 5928 6632 gene locus_tag LOCUS_06080 5928 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6632 7498 gene locus_tag LOCUS_06090 6632 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7515 8120 gene locus_tag LOCUS_06100 7515 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8113 8355 gene locus_tag LOCUS_06110 8113 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 8345 9880 gene locus_tag LOCUS_06120 8345 9880 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence039 408 336 gene locus_tag LOCUS_t00060 408 336 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 721 473 gene locus_tag LOCUS_06130 721 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 1883 786 gene locus_tag LOCUS_06140 1883 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1936 5049 gene locus_tag LOCUS_06150 1936 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5194 7191 gene locus_tag LOCUS_06160 gene glyS 5194 7191 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_06160 7352 7648 gene locus_tag LOCUS_06170 7352 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7739 7978 gene locus_tag LOCUS_06180 7739 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8142 8219 gene locus_tag LOCUS_t00070 8142 8219 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8709 8951 gene locus_tag LOCUS_06190 8709 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence040 55 1260 gene locus_tag LOCUS_06200 55 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2184 1246 gene locus_tag LOCUS_06210 2184 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2290 2739 gene locus_tag LOCUS_06220 2290 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3166 2894 gene locus_tag LOCUS_06230 3166 2894 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_06230 4235 3408 gene locus_tag LOCUS_06240 4235 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4965 4369 gene locus_tag LOCUS_06250 4965 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5614 4982 gene locus_tag LOCUS_06260 5614 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6392 5754 gene locus_tag LOCUS_06270 6392 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 <9653 6389 gene locus_tag LOCUS_06280 <9653 6389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437942.1:ATP-dependent helicase >Feature sequence041 219 1301 gene locus_tag LOCUS_06290 219 1301 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928605.1 protein_id gnl|my_center|LOCUS_06290 1315 3516 gene locus_tag LOCUS_06300 1315 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3719 5719 gene locus_tag LOCUS_06310 3719 5719 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_06310 6858 5920 gene locus_tag LOCUS_06320 gene trxB 6858 5920 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_06320 7371 6871 gene locus_tag LOCUS_06330 7371 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8770 7379 gene locus_tag LOCUS_06340 8770 7379 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence042 19 1773 gene locus_tag LOCUS_06350 19 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1766 3319 gene locus_tag LOCUS_06360 1766 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3319 3966 gene locus_tag LOCUS_06370 3319 3966 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_06370 3977 4606 gene locus_tag LOCUS_06380 3977 4606 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_06380 4626 5156 gene locus_tag LOCUS_06390 4626 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5158 5898 gene locus_tag LOCUS_06400 5158 5898 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_06400 5876 7276 gene locus_tag LOCUS_06410 5876 7276 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583871.1 protein_id gnl|my_center|LOCUS_06410 <9535 7345 gene locus_tag LOCUS_06420 <9535 7345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680859.1:DEAD/DEAH box helicase >Feature sequence043 <1 1591 gene locus_tag LOCUS_06430 <1 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922364.1:restriction endonuclease subunit S 1601 3112 gene locus_tag LOCUS_06440 1601 3112 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_06440 3102 4583 gene locus_tag LOCUS_06450 3102 4583 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_06450 4584 5735 gene locus_tag LOCUS_06460 4584 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5725 8631 gene locus_tag LOCUS_06470 5725 8631 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_06470 8836 9099 gene locus_tag LOCUS_06480 8836 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331494.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence044 1654 3186 gene locus_tag LOCUS_06490 gene rny 1654 3186 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_06490 3208 4053 gene locus_tag LOCUS_06500 3208 4053 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_06500 4069 4926 gene locus_tag LOCUS_06510 4069 4926 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_06510 4937 5581 gene locus_tag LOCUS_06520 4937 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6202 5573 gene locus_tag LOCUS_06530 6202 5573 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_06530 7209 6199 gene locus_tag LOCUS_06540 gene lpxK 7209 6199 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_06540 8577 7213 gene locus_tag LOCUS_06550 8577 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 <9345 8621 gene locus_tag LOCUS_06560 <9345 8621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920674.1:ABC transporter ATP-binding protein >Feature sequence045 742 197 gene locus_tag LOCUS_06570 742 197 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_06570 2026 752 gene locus_tag LOCUS_06580 2026 752 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_06580 2448 2029 gene locus_tag LOCUS_06590 2448 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3538 2441 gene locus_tag LOCUS_06600 3538 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3994 3575 gene locus_tag LOCUS_06610 gene rsfS 3994 3575 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_06610 4434 3994 gene locus_tag LOCUS_06620 gene rpiB 4434 3994 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_06620 4574 5902 gene locus_tag LOCUS_06630 gene lysA 4574 5902 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125257.1 protein_id gnl|my_center|LOCUS_06630 5902 6810 gene locus_tag LOCUS_06640 gene cdaA 5902 6810 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_06640 6810 7694 gene locus_tag LOCUS_06650 6810 7694 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_06650 7754 8107 gene locus_tag LOCUS_06660 7754 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 8228 9175 gene locus_tag LOCUS_06670 8228 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence046 540 5576 gene locus_tag LOCUS_06680 540 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5589 5939 gene locus_tag LOCUS_06690 5589 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6133 6513 gene locus_tag LOCUS_06700 gene rpsL 6133 6513 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_06700 6513 6983 gene locus_tag LOCUS_06710 gene rpsG 6513 6983 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_06710 7318 7620 gene locus_tag LOCUS_06720 7318 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7906 7769 gene locus_tag LOCUS_06730 7906 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 9200 7920 gene locus_tag LOCUS_06740 9200 7920 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence047 1847 177 gene locus_tag LOCUS_06750 1847 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2033 2629 gene locus_tag LOCUS_06760 2033 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2755 3993 gene locus_tag LOCUS_06770 2755 3993 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120494.1 protein_id gnl|my_center|LOCUS_06770 4204 5118 gene locus_tag LOCUS_06780 4204 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6258 5227 gene locus_tag LOCUS_06790 6258 5227 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768231.1 protein_id gnl|my_center|LOCUS_06790 6473 8383 gene locus_tag LOCUS_06800 6473 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 <9279 8427 gene locus_tag LOCUS_06810 <9279 8427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528421.1:MATE family efflux transporter >Feature sequence048 927 685 gene locus_tag LOCUS_06820 927 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1837 920 gene locus_tag LOCUS_06830 1837 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1896 2540 gene locus_tag LOCUS_06840 1896 2540 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_06840 4116 2527 gene locus_tag LOCUS_06850 4116 2527 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863257.1 protein_id gnl|my_center|LOCUS_06850 4470 4120 gene locus_tag LOCUS_06860 gene aroH 4470 4120 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460212.1 protein_id gnl|my_center|LOCUS_06860 5390 4467 gene locus_tag LOCUS_06870 gene fmt 5390 4467 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965030.1 protein_id gnl|my_center|LOCUS_06870 5997 5380 gene locus_tag LOCUS_06880 5997 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6799 6428 gene locus_tag LOCUS_06890 6799 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 9109 6971 gene locus_tag LOCUS_06900 gene pnp 9109 6971 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence049 393 37 gene locus_tag LOCUS_06910 393 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 542 1759 gene locus_tag LOCUS_06920 gene tyrS 542 1759 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_06920 1764 2657 gene locus_tag LOCUS_06930 gene cysK 1764 2657 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_06930 2657 3328 gene locus_tag LOCUS_06940 gene cysE 2657 3328 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_06940 3364 4134 gene locus_tag LOCUS_06950 3364 4134 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836388.1 protein_id gnl|my_center|LOCUS_06950 4151 4435 gene locus_tag LOCUS_06960 4151 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4454 5125 gene locus_tag LOCUS_06970 gene sdaAB 4454 5125 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922792.1 protein_id gnl|my_center|LOCUS_06970 5128 6021 gene locus_tag LOCUS_06980 gene sdaAA 5128 6021 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671221.1 protein_id gnl|my_center|LOCUS_06980 6021 6887 gene locus_tag LOCUS_06990 6021 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7157 6843 gene locus_tag LOCUS_07000 7157 6843 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_07000 7726 7160 gene locus_tag LOCUS_07010 7726 7160 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_07010 7901 7710 gene locus_tag LOCUS_07020 7901 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7934 8788 gene locus_tag LOCUS_07030 7934 8788 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_07030 8881 9189 gene locus_tag LOCUS_07040 8881 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence050 645 268 gene locus_tag LOCUS_07050 645 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 988 671 gene locus_tag LOCUS_07060 988 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1417 1052 gene locus_tag LOCUS_07070 1417 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1546 2835 gene locus_tag LOCUS_07080 1546 2835 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_07080 2848 3561 gene locus_tag LOCUS_07090 2848 3561 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_07090 3551 3865 gene locus_tag LOCUS_07100 3551 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4338 3862 gene locus_tag LOCUS_07110 4338 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7133 4323 gene locus_tag LOCUS_07120 gene polA 7133 4323 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_07120 8456 7137 gene locus_tag LOCUS_07130 gene clpX 8456 7137 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_07130 9056 8466 gene locus_tag LOCUS_07140 gene clpP 9056 8466 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125965.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence051 1038 88 gene locus_tag LOCUS_07150 1038 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1945 1436 gene locus_tag LOCUS_07160 1945 1436 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_07160 2341 1961 gene locus_tag LOCUS_07170 2341 1961 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_07170 3030 2440 gene locus_tag LOCUS_07180 gene yihA 3030 2440 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984945.1 protein_id gnl|my_center|LOCUS_07180 4916 3000 gene locus_tag LOCUS_07190 4916 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5011 5925 gene locus_tag LOCUS_07200 gene xerD 5011 5925 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_07200 6282 8537 gene locus_tag LOCUS_07210 gene nrdD 6282 8537 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_07210 8671 9156 gene locus_tag LOCUS_07220 gene nrdG 8671 9156 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence052 1703 60 gene locus_tag LOCUS_07230 1703 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1862 2815 gene locus_tag LOCUS_07240 1862 2815 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_07240 2817 3491 gene locus_tag LOCUS_07250 gene ftsE 2817 3491 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_07250 3484 4395 gene locus_tag LOCUS_07260 3484 4395 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140650.1 protein_id gnl|my_center|LOCUS_07260 4398 5198 gene locus_tag LOCUS_07270 4398 5198 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_07270 5210 6463 gene locus_tag LOCUS_07280 5210 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7392 6487 gene locus_tag LOCUS_07290 7392 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8655 7516 gene locus_tag LOCUS_07300 8655 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence053 1463 51 gene locus_tag LOCUS_07310 1463 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2754 1603 gene locus_tag LOCUS_07320 2754 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2992 5415 gene locus_tag LOCUS_07330 2992 5415 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_07330 5758 6636 gene locus_tag LOCUS_07340 5758 6636 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_07340 7852 6983 gene locus_tag LOCUS_07350 7852 6983 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_07350 8940 8254 gene locus_tag LOCUS_07360 8940 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence054 39 332 gene locus_tag LOCUS_07370 39 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1206 409 gene locus_tag LOCUS_07380 gene proC 1206 409 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_07380 1300 1452 gene locus_tag LOCUS_07390 gene rpmH 1300 1452 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141474.1 protein_id gnl|my_center|LOCUS_07390 1445 1804 gene locus_tag LOCUS_07400 gene rnpA 1445 1804 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_07400 1797 2330 gene locus_tag LOCUS_07410 1797 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2398 2571 gene locus_tag LOCUS_07420 2398 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6584 2889 gene locus_tag LOCUS_07430 6584 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7633 6596 gene locus_tag LOCUS_07440 gene tsaD 7633 6596 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_07440 7654 8931 gene locus_tag LOCUS_07450 gene obgE 7654 8931 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724114.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence055 542 135 gene locus_tag LOCUS_07460 542 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1181 654 gene locus_tag LOCUS_07470 1181 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3102 1294 gene locus_tag LOCUS_07480 3102 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5058 3271 gene locus_tag LOCUS_07490 5058 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5591 5217 gene locus_tag LOCUS_07500 5591 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5704 7359 gene locus_tag LOCUS_07510 5704 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7481 7816 gene locus_tag LOCUS_07520 7481 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8705 8046 gene locus_tag LOCUS_07530 8705 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence056 150 2363 gene locus_tag LOCUS_07540 150 2363 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_07540 3277 2735 gene locus_tag LOCUS_07550 3277 2735 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_07550 4020 3379 gene locus_tag LOCUS_07560 4020 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4091 4837 gene locus_tag LOCUS_07570 gene dapB 4091 4837 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723017.1 protein_id gnl|my_center|LOCUS_07570 4859 5875 gene locus_tag LOCUS_07580 gene asd 4859 5875 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_07580 5875 6351 gene locus_tag LOCUS_07590 5875 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 6374 7468 gene locus_tag LOCUS_07600 gene lpxD 6374 7468 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387804.1 protein_id gnl|my_center|LOCUS_07600 7480 8295 gene locus_tag LOCUS_07610 gene lpxC 7480 8295 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_07610 8308 8757 gene locus_tag LOCUS_07620 gene fabZ 8308 8757 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence057 1240 2478 gene locus_tag LOCUS_07630 1240 2478 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_07630 2592 5057 gene locus_tag LOCUS_07640 gene gyrB 2592 5057 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_07640 5092 5748 gene locus_tag LOCUS_07650 5092 5748 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_07650 5741 6502 gene locus_tag LOCUS_07660 gene map 5741 6502 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_07660 6587 7357 gene locus_tag LOCUS_07670 6587 7357 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_07670 7360 8496 gene locus_tag LOCUS_07680 7360 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence058 2630 1290 gene locus_tag LOCUS_07690 gene secY 2630 1290 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_07690 3076 2633 gene locus_tag LOCUS_07700 gene rplO 3076 2633 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_07700 3291 3100 gene locus_tag LOCUS_07710 gene rpmD 3291 3100 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421137.1 protein_id gnl|my_center|LOCUS_07710 4001 3345 gene locus_tag LOCUS_07720 gene rpsE 4001 3345 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_07720 7756 4241 gene locus_tag LOCUS_07730 7756 4241 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_07730 8657 8088 gene locus_tag LOCUS_07740 8657 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence059 2194 26 gene locus_tag LOCUS_07750 2194 26 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_07750 2847 2224 gene locus_tag LOCUS_07760 2847 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4359 2941 gene locus_tag LOCUS_07770 gene dnaB 4359 2941 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_07770 4531 4605 gene locus_tag LOCUS_t00080 4531 4605 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4691 5725 gene locus_tag LOCUS_07780 4691 5725 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_07780 5868 5780 gene locus_tag LOCUS_t00090 5868 5780 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6180 8552 gene locus_tag LOCUS_07790 gene feoB 6180 8552 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence060 <1 603 gene locus_tag LOCUS_07800 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142403.1:uracil-DNA glycosylase 2343 592 gene locus_tag LOCUS_07810 2343 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5274 2437 gene locus_tag LOCUS_07820 5274 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 5402 6211 gene locus_tag LOCUS_07830 5402 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6306 7997 gene locus_tag LOCUS_07840 6306 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence061 129 204 gene locus_tag LOCUS_t00100 129 204 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 314 949 gene locus_tag LOCUS_07850 314 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1210 950 gene locus_tag LOCUS_07860 1210 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1929 1297 gene locus_tag LOCUS_07870 1929 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2025 2108 gene locus_tag LOCUS_t00110 2025 2108 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2710 2141 gene locus_tag LOCUS_07880 2710 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 5081 3198 gene locus_tag LOCUS_07890 5081 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3226 3235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5330 6145 gene locus_tag LOCUS_07900 gene lpxI 5330 6145 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_07900 6148 7275 gene locus_tag LOCUS_07910 gene lpxB 6148 7275 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957694.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence062 1332 136 gene locus_tag LOCUS_07920 1332 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1561 2520 gene locus_tag LOCUS_07930 gene fba 1561 2520 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_07930 2752 4071 gene locus_tag LOCUS_07940 gene gltP 2752 4071 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821127.1 protein_id gnl|my_center|LOCUS_07940 4079 6892 gene locus_tag LOCUS_07950 gene ileS 4079 6892 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_07950 7681 6971 gene locus_tag LOCUS_07960 7681 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7889 8185 gene locus_tag LOCUS_07970 7889 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence063 724 1422 gene locus_tag LOCUS_07980 724 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3415 1496 gene locus_tag LOCUS_07990 3415 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4680 3550 gene locus_tag LOCUS_08000 4680 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6053 4863 gene locus_tag LOCUS_08010 6053 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 6247 6322 gene locus_tag LOCUS_t00120 6247 6322 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6397 7215 gene locus_tag LOCUS_08020 6397 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7205 7675 gene locus_tag LOCUS_08030 gene rlmH 7205 7675 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence064 289 1509 gene locus_tag LOCUS_08040 289 1509 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929048.1 protein_id gnl|my_center|LOCUS_08040 1531 2055 gene locus_tag LOCUS_08050 1531 2055 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_08050 2844 2182 gene locus_tag LOCUS_08060 2844 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4237 2876 gene locus_tag LOCUS_08070 4237 2876 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 protein_id gnl|my_center|LOCUS_08070 4296 5561 gene locus_tag LOCUS_08080 gene pepT 4296 5561 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_08080 5564 6283 gene locus_tag LOCUS_08090 5564 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 8074 6470 gene locus_tag LOCUS_08100 8074 6470 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence065 1725 208 gene locus_tag LOCUS_08110 gene atpA 1725 208 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_08110 2293 1742 gene locus_tag LOCUS_08120 2293 1742 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_08120 2790 2293 gene locus_tag LOCUS_08130 2790 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3263 2793 gene locus_tag LOCUS_08140 3263 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3541 3299 gene locus_tag LOCUS_08150 3541 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4257 3574 gene locus_tag LOCUS_08160 gene atpB 4257 3574 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142904.1 protein_id gnl|my_center|LOCUS_08160 4357 5061 gene locus_tag LOCUS_08170 4357 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5743 5069 gene locus_tag LOCUS_08180 5743 5069 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404508.1 protein_id gnl|my_center|LOCUS_08180 6838 5777 gene locus_tag LOCUS_08190 gene flhB 6838 5777 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_08190 7599 6949 gene locus_tag LOCUS_08200 gene deoC 7599 6949 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence066 54 617 gene locus_tag LOCUS_08210 54 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 769 1200 gene locus_tag LOCUS_08220 769 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1213 1566 gene locus_tag LOCUS_08230 1213 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1733 1832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3848 2070 gene locus_tag LOCUS_08240 3848 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4805 3924 gene locus_tag LOCUS_08250 4805 3924 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_08250 6205 4877 gene locus_tag LOCUS_08260 6205 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6847 6212 gene locus_tag LOCUS_08270 6847 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 <7771 6852 gene locus_tag LOCUS_08280 <7771 6852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057610.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence067 199 423 gene locus_tag LOCUS_08290 199 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1939 410 gene locus_tag LOCUS_08300 1939 410 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126017.1 protein_id gnl|my_center|LOCUS_08300 2970 1939 gene locus_tag LOCUS_08310 2970 1939 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704251.1 protein_id gnl|my_center|LOCUS_08310 3214 2957 gene locus_tag LOCUS_08320 3214 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5901 3355 gene locus_tag LOCUS_08330 gene gyrA 5901 3355 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143075.1 protein_id gnl|my_center|LOCUS_08330 5992 7749 gene locus_tag LOCUS_08340 5992 7749 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880520.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence068 1513 59 gene locus_tag LOCUS_08350 1513 59 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_08350 2255 1635 gene locus_tag LOCUS_08360 2255 1635 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582936.1 protein_id gnl|my_center|LOCUS_08360 5031 2332 gene locus_tag LOCUS_08370 gene adhE 5031 2332 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_08370 5862 5194 gene locus_tag LOCUS_08380 5862 5194 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 protein_id gnl|my_center|LOCUS_08380 6563 5862 gene locus_tag LOCUS_08390 6563 5862 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545779.1 protein_id gnl|my_center|LOCUS_08390 <7747 6575 gene locus_tag LOCUS_08400 <7747 6575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809746.1:dihydropteroate synthase >Feature sequence069 1109 102 gene locus_tag LOCUS_08410 gene trpS 1109 102 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_08410 1900 1139 gene locus_tag LOCUS_08420 1900 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1242 1251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4877 2028 gene locus_tag LOCUS_08430 gene uvrA 4877 2028 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_08430 4990 5868 gene locus_tag LOCUS_08440 4990 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6043 6807 gene locus_tag LOCUS_08450 gene rpsB 6043 6807 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080936.1 protein_id gnl|my_center|LOCUS_08450 6807 7679 gene locus_tag LOCUS_08460 gene tsf 6807 7679 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018581.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence070 1059 202 gene locus_tag LOCUS_08470 1059 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1790 1359 gene locus_tag LOCUS_08480 gene aroQ 1790 1359 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_08480 1911 2255 gene locus_tag LOCUS_08490 1911 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2262 3056 gene locus_tag LOCUS_08500 gene folE2 2262 3056 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_08500 3154 4506 gene locus_tag LOCUS_08510 3154 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4510 5040 gene locus_tag LOCUS_08520 4510 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5141 6100 gene locus_tag LOCUS_08530 gene rpoD 5141 6100 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_08530 7588 6203 gene locus_tag LOCUS_08540 7588 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence071 1763 120 gene locus_tag LOCUS_08550 1763 120 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_08550 3000 1810 gene locus_tag LOCUS_08560 3000 1810 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_08560 4814 3015 gene locus_tag LOCUS_08570 4814 3015 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_08570 5070 4852 gene locus_tag LOCUS_08580 5070 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 5198 5890 gene locus_tag LOCUS_08590 5198 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6808 6086 gene locus_tag LOCUS_08600 6808 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence072 786 118 gene locus_tag LOCUS_08610 786 118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 protein_id gnl|my_center|LOCUS_08610 2076 1015 gene locus_tag LOCUS_08620 2076 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2611 2150 gene locus_tag LOCUS_08630 2611 2150 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_08630 2690 2974 gene locus_tag LOCUS_08640 2690 2974 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891710.1 protein_id gnl|my_center|LOCUS_08640 6832 3047 gene locus_tag LOCUS_08650 6832 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7530 6967 gene locus_tag LOCUS_08660 7530 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence073 2764 173 gene locus_tag LOCUS_08670 2764 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3033 3827 gene locus_tag LOCUS_08680 3033 3827 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_08680 3830 4810 gene locus_tag LOCUS_08690 3830 4810 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_08690 5355 4807 gene locus_tag LOCUS_08700 5355 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5980 5375 gene locus_tag LOCUS_08710 5980 5375 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_08710 7434 6067 gene locus_tag LOCUS_08720 gene ffh 7434 6067 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence074 1198 50 gene locus_tag LOCUS_08730 1198 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2174 1572 gene locus_tag LOCUS_08740 2174 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3224 2328 gene locus_tag LOCUS_08750 gene era 3224 2328 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_08750 3347 5410 gene locus_tag LOCUS_08760 3347 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5417 6553 gene locus_tag LOCUS_08770 5417 6553 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_08770 6702 7418 gene locus_tag LOCUS_08780 6702 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence075 1171 671 gene locus_tag LOCUS_08790 gene folK 1171 671 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_08790 1235 3304 gene locus_tag LOCUS_08800 gene mngB 1235 3304 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_08800 4046 3375 gene locus_tag LOCUS_08810 4046 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6632 4134 gene locus_tag LOCUS_08820 6632 4134 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942995.1 protein_id gnl|my_center|LOCUS_08820 7292 6702 gene locus_tag LOCUS_08830 7292 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence076 2153 1533 gene locus_tag LOCUS_08840 2153 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4343 2205 gene locus_tag LOCUS_08850 4343 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4497 6392 gene locus_tag LOCUS_08860 4497 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6446 7057 gene locus_tag LOCUS_08870 6446 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7249 7109 gene locus_tag LOCUS_08880 7249 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence077 2171 576 gene locus_tag LOCUS_08890 2171 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2865 2608 gene locus_tag LOCUS_08900 2865 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4591 2939 gene locus_tag LOCUS_08910 gene recN 4591 2939 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_08910 5406 4588 gene locus_tag LOCUS_08920 5406 4588 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_08920 6455 5505 gene locus_tag LOCUS_08930 6455 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence078 1045 773 gene locus_tag LOCUS_08940 1045 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1637 1038 gene locus_tag LOCUS_08950 1637 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2519 1647 gene locus_tag LOCUS_08960 2519 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3375 2512 gene locus_tag LOCUS_08970 gene truB 3375 2512 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022450.1 protein_id gnl|my_center|LOCUS_08970 3726 3376 gene locus_tag LOCUS_08980 gene rbfA 3726 3376 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_08980 6238 3749 gene locus_tag LOCUS_08990 gene infB 6238 3749 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 protein_id gnl|my_center|LOCUS_08990 6479 6231 gene locus_tag LOCUS_09000 6479 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 <7028 6482 gene locus_tag LOCUS_09010 <7028 6482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056003.1:peptide chain release factor 1 >Feature sequence079 1646 75 gene locus_tag LOCUS_09020 1646 75 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523062.1 protein_id gnl|my_center|LOCUS_09020 3246 1636 gene locus_tag LOCUS_09030 3246 1636 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242995.1 protein_id gnl|my_center|LOCUS_09030 4154 3282 gene locus_tag LOCUS_09040 gene glyQ 4154 3282 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583676.1 protein_id gnl|my_center|LOCUS_09040 4297 4809 gene locus_tag LOCUS_09050 4297 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4806 5849 gene locus_tag LOCUS_09060 4806 5849 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385426.1 protein_id gnl|my_center|LOCUS_09060 5843 6592 gene locus_tag LOCUS_09070 5843 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence080 945 691 gene locus_tag LOCUS_09080 945 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1040 1381 gene locus_tag LOCUS_09090 1040 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1383 3887 gene locus_tag LOCUS_09100 1383 3887 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_09100 3906 5657 gene locus_tag LOCUS_09110 3906 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 5644 6168 gene locus_tag LOCUS_09120 5644 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence081 17 262 gene locus_tag LOCUS_09130 17 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 246 743 gene locus_tag LOCUS_09140 246 743 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_09140 767 1090 gene locus_tag LOCUS_09150 767 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1113 2168 gene locus_tag LOCUS_09160 gene plsX 1113 2168 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_09160 2169 3089 gene locus_tag LOCUS_09170 gene fabD 2169 3089 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515899.1 protein_id gnl|my_center|LOCUS_09170 3093 3818 gene locus_tag LOCUS_09180 gene fabG 3093 3818 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_09180 3931 4161 gene locus_tag LOCUS_09190 gene acpP 3931 4161 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_09190 4260 5522 gene locus_tag LOCUS_09200 gene fabF 4260 5522 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_09200 6386 5595 gene locus_tag LOCUS_09210 gene surE 6386 5595 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_09210 6542 6618 gene locus_tag LOCUS_t00130 6542 6618 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence082 86 736 gene locus_tag LOCUS_09220 86 736 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 protein_id gnl|my_center|LOCUS_09220 739 1614 gene locus_tag LOCUS_09230 739 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1608 2267 gene locus_tag LOCUS_09240 gene lepB 1608 2267 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_09240 2287 3888 gene locus_tag LOCUS_09250 2287 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3888 4562 gene locus_tag LOCUS_09260 3888 4562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_09260 4564 5817 gene locus_tag LOCUS_09270 4564 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6134 5814 gene locus_tag LOCUS_09280 6134 5814 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379749.1 protein_id gnl|my_center|LOCUS_09280 6158 6616 gene locus_tag LOCUS_09290 6158 6616 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence083 85 1170 gene locus_tag LOCUS_09300 85 1170 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_09300 1172 2536 gene locus_tag LOCUS_09310 1172 2536 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964761.1 protein_id gnl|my_center|LOCUS_09310 3063 2539 gene locus_tag LOCUS_09320 3063 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5502 3163 gene locus_tag LOCUS_09330 gene recJ 5502 3163 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_09330 6719 5508 gene locus_tag LOCUS_09340 6719 5508 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence084 823 320 gene locus_tag LOCUS_09350 823 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1508 843 gene locus_tag LOCUS_09360 1508 843 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_09360 3164 1743 gene locus_tag LOCUS_09370 gene flgE 3164 1743 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034888230.1 protein_id gnl|my_center|LOCUS_09370 3830 3318 gene locus_tag LOCUS_09380 3830 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6128 3864 gene locus_tag LOCUS_09390 6128 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6590 6141 gene locus_tag LOCUS_09400 6590 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence085 920 78 gene locus_tag LOCUS_09410 gene aroE 920 78 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_09410 3210 913 gene locus_tag LOCUS_09420 gene topA 3210 913 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143190.1 protein_id gnl|my_center|LOCUS_09420 4298 3216 gene locus_tag LOCUS_09430 gene dprA 4298 3216 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_09430 5077 4304 gene locus_tag LOCUS_09440 5077 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6038 5079 gene locus_tag LOCUS_09450 6038 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6631 6035 gene locus_tag LOCUS_09460 6631 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence086 2308 824 gene locus_tag LOCUS_09470 2308 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2373 3404 gene locus_tag LOCUS_09480 2373 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3414 6605 gene locus_tag LOCUS_09490 3414 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence087 36 638 gene locus_tag LOCUS_09500 36 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 640 1107 gene locus_tag LOCUS_09510 640 1107 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_09510 1110 1937 gene locus_tag LOCUS_09520 1110 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2822 1950 gene locus_tag LOCUS_09530 2822 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3592 2822 gene locus_tag LOCUS_09540 3592 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3756 4544 gene locus_tag LOCUS_09550 3756 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence088 486 10 gene locus_tag LOCUS_09560 486 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 592 2016 gene locus_tag LOCUS_09570 592 2016 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765715.1 protein_id gnl|my_center|LOCUS_09570 2156 5332 gene locus_tag LOCUS_09580 2156 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6319 5336 gene locus_tag LOCUS_09590 6319 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence089 <1 2066 gene locus_tag LOCUS_09600 <1 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009894114.1:toxin production/motility transcriptional repressor RstA 2053 2652 gene locus_tag LOCUS_09610 gene rsmG 2053 2652 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722161.1 protein_id gnl|my_center|LOCUS_09610 2645 2992 gene locus_tag LOCUS_09620 2645 2992 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_09620 3016 3687 gene locus_tag LOCUS_09630 gene degU 3016 3687 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_09630 3802 5061 gene locus_tag LOCUS_09640 3802 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5022 5031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6091 5054 gene locus_tag LOCUS_09650 6091 5054 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence090 1364 834 gene locus_tag LOCUS_09660 1364 834 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_09660 2558 1497 gene locus_tag LOCUS_09670 gene rpsA 2558 1497 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132594.1 protein_id gnl|my_center|LOCUS_09670 3427 2555 gene locus_tag LOCUS_09680 gene ispH 3427 2555 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_09680 4900 3560 gene locus_tag LOCUS_09690 4900 3560 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183532.1 protein_id gnl|my_center|LOCUS_09690 <6430 5041 gene locus_tag LOCUS_09700 <6430 5041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080686.1:glycogen synthase >Feature sequence091 595 694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 702 2732 gene locus_tag LOCUS_09710 702 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2736 3743 gene locus_tag LOCUS_09720 2736 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5049 4612 gene locus_tag LOCUS_09730 5049 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 5524 6093 gene locus_tag LOCUS_09740 5524 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence092 447 522 gene locus_tag LOCUS_t00140 447 522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 777 1154 gene locus_tag LOCUS_09750 777 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1126 2334 gene locus_tag LOCUS_09760 gene trpB 1126 2334 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_09760 4001 2400 gene locus_tag LOCUS_09770 4001 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4186 4515 gene locus_tag LOCUS_09780 4186 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4584 5867 gene locus_tag LOCUS_09790 4584 5867 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928917.1 protein_id gnl|my_center|LOCUS_09790 6037 5962 gene locus_tag LOCUS_t00150 6037 5962 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 650 54 gene locus_tag LOCUS_09800 650 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 856 2502 gene locus_tag LOCUS_09810 856 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2814 3671 gene locus_tag LOCUS_09820 2814 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4168 3737 gene locus_tag LOCUS_09830 4168 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4254 5501 gene locus_tag LOCUS_09840 4254 5501 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_09840 5485 5964 gene locus_tag LOCUS_09850 5485 5964 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460298.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence094 1887 724 gene locus_tag LOCUS_09860 1887 724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202897.1 protein_id gnl|my_center|LOCUS_09860 2828 1887 gene locus_tag LOCUS_09870 2828 1887 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_09870 4246 2840 gene locus_tag LOCUS_09880 4246 2840 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107543.1 protein_id gnl|my_center|LOCUS_09880 4821 4246 gene locus_tag LOCUS_09890 4821 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5817 5011 gene locus_tag LOCUS_09900 5817 5011 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence095 916 987 gene locus_tag LOCUS_t00160 916 987 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1185 2393 gene locus_tag LOCUS_09910 gene tuf 1185 2393 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_09910 2506 3303 gene locus_tag LOCUS_09920 2506 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3604 3371 gene locus_tag LOCUS_09930 3604 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3769 5295 gene locus_tag LOCUS_09940 gene gpmI 3769 5295 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence096 651 1100 gene locus_tag LOCUS_09950 651 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1128 2168 gene locus_tag LOCUS_09960 1128 2168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_09960 2454 2750 gene locus_tag LOCUS_09970 2454 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2902 4215 gene locus_tag LOCUS_09980 2902 4215 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_09980 5965 4352 gene locus_tag LOCUS_09990 5965 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence097 115 804 gene locus_tag LOCUS_10000 115 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1178 2056 gene locus_tag LOCUS_10010 1178 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3063 2206 gene locus_tag LOCUS_10020 3063 2206 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 protein_id gnl|my_center|LOCUS_10020 3428 3063 gene locus_tag LOCUS_10030 gene queD 3428 3063 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_10030 3968 3441 gene locus_tag LOCUS_10040 3968 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4942 3971 gene locus_tag LOCUS_10050 4942 3971 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_10050 5068 5355 gene locus_tag LOCUS_10060 5068 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence098 1390 3516 gene locus_tag LOCUS_10070 1390 3516 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_10070 3524 4570 gene locus_tag LOCUS_10080 3524 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5482 4577 gene locus_tag LOCUS_10090 5482 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence099 160 540 gene locus_tag LOCUS_10100 160 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 553 1764 gene locus_tag LOCUS_10110 553 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1746 2183 gene locus_tag LOCUS_10120 1746 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2246 5740 gene locus_tag LOCUS_10130 gene smc 2246 5740 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence100 63 896 gene locus_tag LOCUS_10140 63 896 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_10140 904 1080 gene locus_tag LOCUS_10150 904 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1090 1869 gene locus_tag LOCUS_10160 gene etfB 1090 1869 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_10160 1862 2860 gene locus_tag LOCUS_10170 1862 2860 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_10170 2863 4137 gene locus_tag LOCUS_10180 2863 4137 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143270.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence101 2374 3285 gene locus_tag LOCUS_10190 2374 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3294 3983 gene locus_tag LOCUS_10200 3294 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3983 5350 gene locus_tag LOCUS_10210 3983 5350 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_10210 5371 5700 gene locus_tag LOCUS_10220 5371 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5549 5558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence102 278 1735 gene locus_tag LOCUS_10230 278 1735 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_10230 1722 3143 gene locus_tag LOCUS_10240 1722 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3240 5663 gene locus_tag LOCUS_10250 3240 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence103 284 1303 gene locus_tag LOCUS_10260 284 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1636 3006 gene locus_tag LOCUS_10270 gene gltA 1636 3006 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_10270 2990 3877 gene locus_tag LOCUS_10280 2990 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3889 5367 gene locus_tag LOCUS_10290 3889 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence104 1515 142 gene locus_tag LOCUS_10300 1515 142 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_10300 2348 1515 gene locus_tag LOCUS_10310 2348 1515 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_10310 2459 3943 gene locus_tag LOCUS_10320 2459 3943 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_10320 4134 5462 gene locus_tag LOCUS_10330 4134 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence105 1373 375 gene locus_tag LOCUS_10340 1373 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3578 1377 gene locus_tag LOCUS_10350 3578 1377 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929091.1 protein_id gnl|my_center|LOCUS_10350 3630 3902 gene locus_tag LOCUS_10360 3630 3902 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867625.1 protein_id gnl|my_center|LOCUS_10360 3937 4224 gene locus_tag LOCUS_10370 3937 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4997 4221 gene locus_tag LOCUS_10380 4997 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5297 5382 gene locus_tag LOCUS_t00170 5297 5382 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 1043 540 gene locus_tag LOCUS_10390 1043 540 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_10390 2706 1180 gene locus_tag LOCUS_10400 2706 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3298 2660 gene locus_tag LOCUS_10410 3298 2660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_10410 5466 3388 gene locus_tag LOCUS_10420 5466 3388 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938439.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence107 29 829 gene locus_tag LOCUS_10430 29 829 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_10430 886 2490 gene locus_tag LOCUS_10440 gene nadB 886 2490 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_10440 2480 3313 gene locus_tag LOCUS_10450 gene nadC 2480 3313 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_10450 3430 3828 gene locus_tag LOCUS_10460 3430 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4563 3919 gene locus_tag LOCUS_10470 4563 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4737 5564 gene locus_tag LOCUS_10480 4737 5564 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143994.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence108 1469 240 gene locus_tag LOCUS_10490 1469 240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_10490 2155 1466 gene locus_tag LOCUS_10500 2155 1466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_10500 3279 2155 gene locus_tag LOCUS_10510 3279 2155 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_10510 4827 3280 gene locus_tag LOCUS_10520 4827 3280 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_10520 5564 4914 gene locus_tag LOCUS_10530 gene upp 5564 4914 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence109 154 1503 gene locus_tag LOCUS_10540 154 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4070 1803 gene locus_tag LOCUS_10550 4070 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5390 4524 gene locus_tag LOCUS_10560 5390 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence110 322 2625 gene locus_tag LOCUS_10570 322 2625 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 protein_id gnl|my_center|LOCUS_10570 2934 4193 gene locus_tag LOCUS_10580 2934 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4377 5402 gene locus_tag LOCUS_10590 4377 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence111 336 764 gene locus_tag LOCUS_10600 336 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 815 1552 gene locus_tag LOCUS_10610 815 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2539 1637 gene locus_tag LOCUS_10620 2539 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2655 4061 gene locus_tag LOCUS_10630 gene atpD 2655 4061 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_10630 4086 4484 gene locus_tag LOCUS_10640 4086 4484 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_10640 4549 4639 gene locus_tag LOCUS_t00180 4549 4639 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 1038 475 gene locus_tag LOCUS_10650 1038 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1690 1010 gene locus_tag LOCUS_10660 1690 1010 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_10660 2231 1677 gene locus_tag LOCUS_10670 gene gmk 2231 1677 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_10670 3699 2245 gene locus_tag LOCUS_10680 3699 2245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871908.1 protein_id gnl|my_center|LOCUS_10680 4619 3702 gene locus_tag LOCUS_10690 4619 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence113 <1 705 gene locus_tag LOCUS_10700 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144299.1:F0F1 ATP synthase subunit gamma 4924 791 gene locus_tag LOCUS_10710 4924 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence114 559 1497 gene locus_tag LOCUS_10720 559 1497 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866389.1 protein_id gnl|my_center|LOCUS_10720 1509 2225 gene locus_tag LOCUS_10730 1509 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2238 3074 gene locus_tag LOCUS_10740 gene rfbD 2238 3074 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_10740 3077 3853 gene locus_tag LOCUS_10750 3077 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4957 3902 gene locus_tag LOCUS_10760 4957 3902 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544929.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence115 <1 1201 gene locus_tag LOCUS_10770 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262572.1:aerobic respiration two-component sensor histidine kinase ArcB 1251 2261 gene locus_tag LOCUS_10780 gene galE 1251 2261 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 protein_id gnl|my_center|LOCUS_10780 2193 2202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2261 2491 gene locus_tag LOCUS_10790 2261 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2593 3111 gene locus_tag LOCUS_10800 2593 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4195 3095 gene locus_tag LOCUS_10810 4195 3095 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_10810 <4955 4195 gene locus_tag LOCUS_10820 <4955 4195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000633861.1:ATP-binding cassette domain-containing protein >Feature sequence116 72 662 gene locus_tag LOCUS_10830 72 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 664 1218 gene locus_tag LOCUS_10840 664 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1317 1991 gene locus_tag LOCUS_10850 1317 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2422 3390 gene locus_tag LOCUS_10860 gene gshB 2422 3390 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_10860 3439 4911 gene locus_tag LOCUS_10870 3439 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence117 1234 443 gene locus_tag LOCUS_10880 1234 443 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_10880 1623 1240 gene locus_tag LOCUS_10890 1623 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1928 1710 gene locus_tag LOCUS_10900 1928 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2389 3252 gene locus_tag LOCUS_10910 2389 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3252 4070 gene locus_tag LOCUS_10920 gene minD 3252 4070 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_10920 4074 4799 gene locus_tag LOCUS_10930 4074 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence118 2546 1302 gene locus_tag LOCUS_10940 2546 1302 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_10940 2623 3654 gene locus_tag LOCUS_10950 2623 3654 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_10950 <4629 3737 gene locus_tag LOCUS_10960 <4629 3737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948117.1:diguanylate cyclase >Feature sequence119 1878 2780 gene locus_tag LOCUS_10970 gene nadA 1878 2780 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870480.1 protein_id gnl|my_center|LOCUS_10970 2780 3529 gene locus_tag LOCUS_10980 gene rlmB 2780 3529 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583826.1 protein_id gnl|my_center|LOCUS_10980 3565 4575 gene locus_tag LOCUS_10990 gene rpoD 3565 4575 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence120 198 1610 gene locus_tag LOCUS_11000 198 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1863 3401 gene locus_tag LOCUS_11010 gene hcp 1863 3401 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_11010 3852 3538 gene locus_tag LOCUS_11020 3852 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4090 4560 gene locus_tag LOCUS_11030 4090 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence121 195 398 gene locus_tag LOCUS_11040 gene rpmE 195 398 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_11040 487 1188 gene locus_tag LOCUS_11050 gene thyX 487 1188 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_11050 1855 1244 gene locus_tag LOCUS_11060 1855 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1908 4478 gene locus_tag LOCUS_11070 gene mutS 1908 4478 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence122 90 1763 gene locus_tag LOCUS_11080 90 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2638 1820 gene locus_tag LOCUS_11090 gene murI 2638 1820 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_11090 <4514 2601 gene locus_tag LOCUS_11100 <4514 2601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140967.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence123 108 1289 gene locus_tag LOCUS_11110 108 1289 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_11110 1304 4504 gene locus_tag LOCUS_11120 gene vmeQ 1304 4504 CDS product efflux RND transporter permease subunit VmeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479247.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence124 1088 1990 gene locus_tag LOCUS_11130 1088 1990 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_11130 3599 2265 gene locus_tag LOCUS_11140 3599 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence125 43 708 gene locus_tag LOCUS_11150 43 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 786 2540 gene locus_tag LOCUS_11160 786 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2524 2715 gene locus_tag LOCUS_11170 2524 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2718 3878 gene locus_tag LOCUS_11180 2718 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 <4487 3843 gene locus_tag LOCUS_11190 <4487 3843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080341.1:dTMP kinase >Feature sequence126 1393 512 gene locus_tag LOCUS_11200 1393 512 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122211.1 protein_id gnl|my_center|LOCUS_11200 1517 2407 gene locus_tag LOCUS_11210 1517 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2394 3251 gene locus_tag LOCUS_11220 2394 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3251 3856 gene locus_tag LOCUS_11230 3251 3856 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312481.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence127 209 682 gene locus_tag LOCUS_11240 209 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 657 935 gene locus_tag LOCUS_11250 657 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 986 1171 gene locus_tag LOCUS_11260 986 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1396 1632 gene locus_tag LOCUS_11270 1396 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1690 2085 gene locus_tag LOCUS_11280 1690 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2166 2363 gene locus_tag LOCUS_11290 2166 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2367 2567 gene locus_tag LOCUS_11300 2367 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2578 2919 gene locus_tag LOCUS_11310 2578 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2982 3209 gene locus_tag LOCUS_11320 2982 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3306 3974 gene locus_tag LOCUS_11330 3306 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4108 4227 gene locus_tag LOCUS_11340 4108 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence128 22 192 gene locus_tag LOCUS_11350 22 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 180 344 gene locus_tag LOCUS_11360 180 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 933 469 gene locus_tag LOCUS_11370 gene yfkJ 933 469 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 protein_id gnl|my_center|LOCUS_11370 1136 1969 gene locus_tag LOCUS_11380 gene kdsA 1136 1969 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_11380 1963 2589 gene locus_tag LOCUS_11390 1963 2589 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_11390 2691 3638 gene locus_tag LOCUS_11400 gene pheS 2691 3638 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_11400 3649 4350 gene locus_tag LOCUS_11410 3649 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence129 386 3436 gene locus_tag LOCUS_11420 386 3436 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_11420 4180 3500 gene locus_tag LOCUS_11430 4180 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence130 58 1086 gene locus_tag LOCUS_11440 58 1086 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_11440 1395 1138 gene locus_tag LOCUS_11450 1395 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1548 2813 gene locus_tag LOCUS_11460 gene purD 1548 2813 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence131 217 1494 gene locus_tag LOCUS_11470 gene aroA 217 1494 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_11470 1603 1528 gene locus_tag LOCUS_t00190 1603 1528 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1735 4236 gene locus_tag LOCUS_11480 1735 4236 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence132 1441 2001 gene locus_tag LOCUS_11490 1441 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2002 2646 gene locus_tag LOCUS_11500 2002 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2643 2960 gene locus_tag LOCUS_11510 2643 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3258 3267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3277 3732 gene locus_tag LOCUS_11520 gene rplJ 3277 3732 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_11520 3798 4175 gene locus_tag LOCUS_11530 gene rplL 3798 4175 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence133 52 1353 gene locus_tag LOCUS_11540 gene secD 52 1353 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_11540 1364 2329 gene locus_tag LOCUS_11550 gene secF 1364 2329 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144153.1 protein_id gnl|my_center|LOCUS_11550 2433 3965 gene locus_tag LOCUS_11560 2433 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4041 4232 gene locus_tag LOCUS_11570 gene rpmB 4041 4232 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence134 <1 547 gene locus_tag LOCUS_11580 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966178.1:D-alanine--D-alanine ligase family protein 1618 626 gene locus_tag LOCUS_11590 1618 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3465 1750 gene locus_tag LOCUS_11600 3465 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence135 1902 250 gene locus_tag LOCUS_11610 1902 250 CDS product R3H domain-containing nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244518.1 protein_id gnl|my_center|LOCUS_11610 2148 2378 gene locus_tag LOCUS_11620 2148 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2887 2441 gene locus_tag LOCUS_11630 2887 2441 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_11630 4182 2899 gene locus_tag LOCUS_11640 gene glmU 4182 2899 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458919.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence136 1613 18 gene locus_tag LOCUS_11650 1613 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3187 1637 gene locus_tag LOCUS_11660 3187 1637 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_11660 4185 3187 gene locus_tag LOCUS_11670 4185 3187 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence137 1298 2152 gene locus_tag LOCUS_11680 1298 2152 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_11680 3434 2142 gene locus_tag LOCUS_11690 3434 2142 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258935.1 protein_id gnl|my_center|LOCUS_11690 4144 3416 gene locus_tag LOCUS_11700 4144 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence138 1104 49 gene locus_tag LOCUS_11710 gene aroF 1104 49 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_11710 2293 1448 gene locus_tag LOCUS_11720 2293 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4155 2296 gene locus_tag LOCUS_11730 gene malQ 4155 2296 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence139 29 649 gene locus_tag LOCUS_11740 29 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 642 1106 gene locus_tag LOCUS_11750 642 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047947.1 protein_id gnl|my_center|LOCUS_11750 1109 1402 gene locus_tag LOCUS_11760 1109 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1518 1880 gene locus_tag LOCUS_11770 1518 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1877 2029 gene locus_tag LOCUS_11780 1877 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2029 2517 gene locus_tag LOCUS_11790 2029 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2517 3248 gene locus_tag LOCUS_11800 2517 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence140 786 133 gene locus_tag LOCUS_11810 786 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2408 1017 gene locus_tag LOCUS_11820 2408 1017 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582858.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence141 55 393 gene locus_tag LOCUS_11830 gene acpS 55 393 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_11830 1927 638 gene locus_tag LOCUS_11840 1927 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2072 3082 gene locus_tag LOCUS_11850 2072 3082 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392883.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence142 505 1410 gene locus_tag LOCUS_11860 505 1410 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101571.1 protein_id gnl|my_center|LOCUS_11860 1495 2958 gene locus_tag LOCUS_11870 1495 2958 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104936.1 protein_id gnl|my_center|LOCUS_11870 3048 3218 gene locus_tag LOCUS_11880 3048 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence143 128 628 gene locus_tag LOCUS_11890 gene rplI 128 628 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_11890 702 1454 gene locus_tag LOCUS_11900 702 1454 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_11900 1454 2290 gene locus_tag LOCUS_11910 gene folD 1454 2290 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475808.1 protein_id gnl|my_center|LOCUS_11910 2686 2351 gene locus_tag LOCUS_11920 2686 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3236 2922 gene locus_tag LOCUS_11930 3236 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3946 3401 gene locus_tag LOCUS_11940 3946 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence144 131 709 gene locus_tag LOCUS_11950 131 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 730 1905 gene locus_tag LOCUS_11960 gene dnaJ 730 1905 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_11960 1905 3338 gene locus_tag LOCUS_11970 1905 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3341 3901 gene locus_tag LOCUS_11980 3341 3901 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124554.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence145 167 523 gene locus_tag LOCUS_11990 gene rplS 167 523 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140830.1 protein_id gnl|my_center|LOCUS_11990 510 1352 gene locus_tag LOCUS_12000 gene ylqF 510 1352 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_12000 1339 2070 gene locus_tag LOCUS_12010 1339 2070 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963332.1 protein_id gnl|my_center|LOCUS_12010 3060 2305 gene locus_tag LOCUS_12020 3060 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3917 3114 gene locus_tag LOCUS_12030 gene rsmI 3917 3114 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence146 744 1301 gene locus_tag LOCUS_12040 gene pth 744 1301 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_12040 1371 2789 gene locus_tag LOCUS_12050 1371 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2912 3535 gene locus_tag LOCUS_12060 2912 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3565 3921 gene locus_tag LOCUS_12070 3565 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence147 851 633 gene locus_tag LOCUS_12080 851 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1247 1612 gene locus_tag LOCUS_12090 1247 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1930 2847 gene locus_tag LOCUS_12100 1930 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence148 1428 25 gene locus_tag LOCUS_12110 gene dnaA 1428 25 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_12110 2193 1438 gene locus_tag LOCUS_12120 2193 1438 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_12120 3767 2193 gene locus_tag LOCUS_12130 3767 2193 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003273.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence149 78 1373 gene locus_tag LOCUS_12140 gene eno 78 1373 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_12140 1426 2745 gene locus_tag LOCUS_12150 gene murA 1426 2745 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_12150 2729 3064 gene locus_tag LOCUS_12160 2729 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence150 713 198 gene locus_tag LOCUS_12170 gene aroK 713 198 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836631.1 protein_id gnl|my_center|LOCUS_12170 1866 703 gene locus_tag LOCUS_12180 gene aroC 1866 703 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583418.1 protein_id gnl|my_center|LOCUS_12180 2357 1887 gene locus_tag LOCUS_12190 2357 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3652 2471 gene locus_tag LOCUS_12200 gene ftsZ 3652 2471 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence151 168 401 gene locus_tag LOCUS_12210 168 401 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_12210 972 418 gene locus_tag LOCUS_12220 972 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1494 1054 gene locus_tag LOCUS_12230 1494 1054 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_12230 1666 3489 gene locus_tag LOCUS_12240 1666 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3660 3585 gene locus_tag LOCUS_t00200 3660 3585 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 1899 82 gene locus_tag LOCUS_12250 gene mutL 1899 82 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_12250 2207 3682 gene locus_tag LOCUS_12260 2207 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence153 282 764 gene locus_tag LOCUS_12270 gene ybaK 282 764 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_12270 1154 3148 gene locus_tag LOCUS_12280 gene uvrB 1154 3148 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 protein_id gnl|my_center|LOCUS_12280 3602 3240 gene locus_tag LOCUS_12290 3602 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence154 992 6 gene locus_tag LOCUS_12300 992 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2497 1193 gene locus_tag LOCUS_12310 gene rimO 2497 1193 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence155 1755 1 gene locus_tag LOCUS_12320 1755 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3207 2026 gene locus_tag LOCUS_12330 3207 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3409 3627 gene locus_tag LOCUS_12340 3409 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence156 533 207 gene locus_tag LOCUS_12350 533 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 821 546 gene locus_tag LOCUS_12360 821 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2018 1170 gene locus_tag LOCUS_12370 2018 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3446 2130 gene locus_tag LOCUS_12380 3446 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence157 531 974 gene locus_tag LOCUS_12390 531 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2935 1091 gene locus_tag LOCUS_12400 2935 1091 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_12400 3063 3479 gene locus_tag LOCUS_12410 3063 3479 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851141.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence158 217 759 gene locus_tag LOCUS_12420 217 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 778 1320 gene locus_tag LOCUS_12430 778 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1346 1810 gene locus_tag LOCUS_12440 1346 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3587 3234 gene locus_tag LOCUS_12450 3587 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence159 510 55 gene locus_tag LOCUS_12460 510 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2422 536 gene locus_tag LOCUS_12470 2422 536 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141861.1 protein_id gnl|my_center|LOCUS_12470 2746 3492 gene locus_tag LOCUS_12480 2746 3492 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence160 144 68 gene locus_tag LOCUS_t00210 144 68 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 283 1446 gene locus_tag LOCUS_12490 gene hydF 283 1446 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_12490 1479 1763 gene locus_tag LOCUS_12500 gene gatC 1479 1763 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_12500 1850 3457 gene locus_tag LOCUS_12510 gene pyrG 1850 3457 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence161 917 36 gene locus_tag LOCUS_12520 917 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1586 975 gene locus_tag LOCUS_12530 gene metW 1586 975 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_12530 2427 1576 gene locus_tag LOCUS_12540 2427 1576 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_12540 3392 2427 gene locus_tag LOCUS_12550 3392 2427 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546380.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence162 1733 51 gene locus_tag LOCUS_12560 1733 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2526 1819 gene locus_tag LOCUS_12570 2526 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence163 1921 1064 gene locus_tag LOCUS_12580 1921 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2781 1954 gene locus_tag LOCUS_12590 2781 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529553.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence164 1777 638 gene locus_tag LOCUS_12600 1777 638 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392884.1 protein_id gnl|my_center|LOCUS_12600 3206 1770 gene locus_tag LOCUS_12610 gene gcvPB 3206 1770 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722477.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence165 418 2682 gene locus_tag LOCUS_12620 418 2682 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence166 1849 8 gene locus_tag LOCUS_12630 gene dnaK 1849 8 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_12630 2005 2490 gene locus_tag LOCUS_12640 gene coaD 2005 2490 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence167 183 989 gene locus_tag LOCUS_12650 183 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1288 986 gene locus_tag LOCUS_12660 gene trxA 1288 986 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871903.1 protein_id gnl|my_center|LOCUS_12660 1802 1359 gene locus_tag LOCUS_12670 1802 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2677 1805 gene locus_tag LOCUS_12680 2677 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2987 3086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence168 1566 1966 gene locus_tag LOCUS_tm00010 1566 1966 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <3162 2129 gene locus_tag LOCUS_12690 <3162 2129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769896.1:Dot/Icm type IV secretion system effector CoxFIC1 >Feature sequence169 57 1781 gene locus_tag LOCUS_12700 57 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1815 2345 gene locus_tag LOCUS_12710 1815 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3028 2381 gene locus_tag LOCUS_12720 3028 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence170 90 773 gene locus_tag LOCUS_12730 90 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2493 841 gene locus_tag LOCUS_12740 gene groL 2493 841 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_12740 2993 2703 gene locus_tag LOCUS_12750 gene groES 2993 2703 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence171 546 455 gene locus_tag LOCUS_t00220 546 455 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 675 2171 gene locus_tag LOCUS_12760 675 2171 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_12760 2174 2767 gene locus_tag LOCUS_12770 gene tmung 2174 2767 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081422.1 protein_id gnl|my_center|LOCUS_12770 3001 2768 gene locus_tag LOCUS_12780 3001 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence172 636 13 gene locus_tag LOCUS_12790 636 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1168 653 gene locus_tag LOCUS_12800 1168 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1899 1171 gene locus_tag LOCUS_12810 1899 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence173 54 740 gene locus_tag LOCUS_12820 54 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 844 2484 gene locus_tag LOCUS_12830 844 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2605 2829 gene locus_tag LOCUS_12840 2605 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence174 <1 2573 gene locus_tag LOCUS_12850 <1 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048383.1:transcription-repair coupling factor >Feature sequence175 100 714 gene locus_tag LOCUS_12860 100 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 762 2204 gene locus_tag LOCUS_12870 gene gatB 762 2204 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence176 298 1347 gene locus_tag LOCUS_12880 298 1347 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_12880 1451 1912 gene locus_tag LOCUS_12890 1451 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1936 2871 gene locus_tag LOCUS_12900 1936 2871 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence177 938 126 gene locus_tag LOCUS_12910 938 126 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_12910 2390 951 gene locus_tag LOCUS_12920 gene pyk 2390 951 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence178 35 502 gene locus_tag LOCUS_12930 35 502 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_12930 492 1202 gene locus_tag LOCUS_12940 492 1202 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_12940 1224 2555 gene locus_tag LOCUS_12950 1224 2555 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence179 <1 1476 gene locus_tag LOCUS_12960 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530082.1:ATP-binding protein 2265 1480 gene locus_tag LOCUS_12970 gene lgt 2265 1480 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963653.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence180 47 445 gene locus_tag LOCUS_12980 47 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1019 798 gene locus_tag LOCUS_12990 1019 798 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_12990 1340 1215 gene locus_tag LOCUS_13000 1340 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1604 2761 gene locus_tag LOCUS_13010 1604 2761 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence181 261 1274 gene locus_tag LOCUS_13020 261 1274 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_13020 1271 1504 gene locus_tag LOCUS_13030 1271 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence182 133 1221 gene locus_tag LOCUS_13040 133 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1242 1694 gene locus_tag LOCUS_13050 gene fliW 1242 1694 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_13050 1698 1982 gene locus_tag LOCUS_13060 1698 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1984 2571 gene locus_tag LOCUS_13070 1984 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence183 852 22 gene locus_tag LOCUS_13080 gene prfB 852 22 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141233.1 protein_id gnl|my_center|LOCUS_13080 2653 1088 gene locus_tag LOCUS_13090 gene metG 2653 1088 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence184 59 820 gene locus_tag LOCUS_13100 59 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 807 1562 gene locus_tag LOCUS_13110 807 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence185 >Feature sequence186 186 887 gene locus_tag LOCUS_13120 186 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 901 1950 gene locus_tag LOCUS_13130 901 1950 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_13130 2522 2034 gene locus_tag LOCUS_13140 2522 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence187 1033 958 gene locus_tag LOCUS_t00230 1033 958 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1234 2472 gene locus_tag LOCUS_13150 1234 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence188 117 740 gene locus_tag LOCUS_13160 117 740 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707242.1 protein_id gnl|my_center|LOCUS_13160 2507 741 gene locus_tag LOCUS_13170 2507 741 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence189 1162 257 gene locus_tag LOCUS_13180 gene murB 1162 257 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057087.1 protein_id gnl|my_center|LOCUS_13180 2523 1165 gene locus_tag LOCUS_13190 gene murC 2523 1165 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence190 1719 520 gene locus_tag LOCUS_13200 gene nifS 1719 520 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_13200 2540 1722 gene locus_tag LOCUS_13210 gene nifU 2540 1722 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence191 160 2172 gene locus_tag LOCUS_13220 160 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2172 2549 gene locus_tag LOCUS_13230 2172 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence192 1245 202 gene locus_tag LOCUS_13240 gene mnmA 1245 202 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837714.1 protein_id gnl|my_center|LOCUS_13240 2148 1249 gene locus_tag LOCUS_13250 2148 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2330 2211 gene locus_tag LOCUS_13260 2330 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence193 1370 2248 gene locus_tag LOCUS_13270 1370 2248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence194 765 37 gene locus_tag LOCUS_13280 gene rplA 765 37 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810196.1 protein_id gnl|my_center|LOCUS_13280 1254 829 gene locus_tag LOCUS_13290 gene rplK 1254 829 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_13290 2100 1324 gene locus_tag LOCUS_13300 2100 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence195 1650 862 gene locus_tag LOCUS_13310 1650 862 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_13310 1879 1670 gene locus_tag LOCUS_13320 1879 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence196 317 144 gene locus_tag LOCUS_13330 317 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 277 954 gene locus_tag LOCUS_13340 277 954 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_13340 2083 1184 gene locus_tag LOCUS_13350 2083 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence197 20 1792 gene locus_tag LOCUS_13360 gene thrS 20 1792 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence198 548 15 gene locus_tag LOCUS_13370 548 15 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence199 707 1483 gene locus_tag LOCUS_13380 707 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2189 1536 gene locus_tag LOCUS_13390 2189 1536 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence200 356 283 gene locus_tag LOCUS_t00240 356 283 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1355 432 gene locus_tag LOCUS_13400 1355 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2290 1358 gene locus_tag LOCUS_13410 2290 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence201 2028 634 gene locus_tag LOCUS_13420 2028 634 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence202 717 10 gene locus_tag LOCUS_13430 717 10 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_13430 2227 911 gene locus_tag LOCUS_13440 2227 911 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence203 572 255 gene locus_tag LOCUS_13450 572 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1963 623 gene locus_tag LOCUS_13460 1963 623 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence204 1886 99 gene locus_tag LOCUS_13470 1886 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence205 1683 817 gene locus_tag LOCUS_13480 1683 817 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837305.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence206 >Feature sequence207 170 808 gene locus_tag LOCUS_13490 170 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1364 801 gene locus_tag LOCUS_13500 gene scpB 1364 801 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923281.1 protein_id gnl|my_center|LOCUS_13500 <2087 1364 gene locus_tag LOCUS_13510 <2087 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024213.1:ScpA family protein >Feature sequence208 554 2017 gene locus_tag LOCUS_13520 gene gltX 554 2017 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence209 1173 334 gene locus_tag LOCUS_13530 gene ispE 1173 334 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_13530 2000 1158 gene locus_tag LOCUS_13540 gene rsmA 2000 1158 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence210 893 162 gene locus_tag LOCUS_13550 893 162 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027615.1 protein_id gnl|my_center|LOCUS_13550 1300 893 gene locus_tag LOCUS_13560 1300 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1395 1535 gene locus_tag LOCUS_13570 1395 1535 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582562.1 protein_id gnl|my_center|LOCUS_13570 1607 2038 gene locus_tag LOCUS_13580 1607 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence211 1444 92 gene locus_tag LOCUS_13590 gene gdhA 1444 92 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_13590 1877 1512 gene locus_tag LOCUS_13600 1877 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence212 >Feature sequence213 352 1815 gene locus_tag LOCUS_13610 gene gatA 352 1815 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence214 1286 51 gene locus_tag LOCUS_13620 gene glgC 1286 51 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence215 203 706 gene locus_tag LOCUS_13630 gene infC 203 706 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_13630 780 855 gene locus_tag LOCUS_t00250 780 855 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1035 1134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence216 329 60 gene locus_tag LOCUS_13640 gene rpsT 329 60 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence217 1145 303 gene locus_tag LOCUS_13650 1145 303 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986912.1 protein_id gnl|my_center|LOCUS_13650 1378 1157 gene locus_tag LOCUS_13660 1378 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence218 1162 797 gene locus_tag LOCUS_13670 1162 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence219 501 7 gene locus_tag LOCUS_13680 501 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1322 549 gene locus_tag LOCUS_13690 1322 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1470 1772 gene locus_tag LOCUS_13700 1470 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence220 698 159 gene locus_tag LOCUS_13710 698 159 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13710 1597 932 gene locus_tag LOCUS_13720 1597 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence221 1366 668 gene locus_tag LOCUS_13730 1366 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1644 1372 gene locus_tag LOCUS_13740 1644 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence222 >Feature sequence223 1157 168 gene locus_tag LOCUS_13750 gene rlmN 1157 168 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_13750 1343 1158 gene locus_tag LOCUS_13760 1343 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence224 <1654 975 gene locus_tag LOCUS_13770 <1654 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208595.1:NAD-dependent epimerase/dehydratase >Feature sequence225 118 657 gene locus_tag LOCUS_13780 118 657 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_13780 657 1196 gene locus_tag LOCUS_13790 657 1196 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404491.1 protein_id gnl|my_center|LOCUS_13790 1536 1147 gene locus_tag LOCUS_13800 1536 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence226 943 32 gene locus_tag LOCUS_13810 gene ftsY 943 32 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 protein_id gnl|my_center|LOCUS_13810 1602 943 gene locus_tag LOCUS_13820 gene nusB 1602 943 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence227 281 105 gene locus_tag LOCUS_13830 281 105 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966884.1 protein_id gnl|my_center|LOCUS_13830 1516 341 gene locus_tag LOCUS_13840 1516 341 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence228 455 264 gene locus_tag LOCUS_13850 455 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 813 460 gene locus_tag LOCUS_13860 813 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1051 806 gene locus_tag LOCUS_13870 1051 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1195 1067 gene locus_tag LOCUS_13880 1195 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence229 <1 994 gene locus_tag LOCUS_13890 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence230 473 862 gene locus_tag LOCUS_13900 473 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1496 915 gene locus_tag LOCUS_13910 1496 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence231 1325 93 gene locus_tag LOCUS_13920 1325 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence232 39 422 gene locus_tag LOCUS_13930 39 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1349 504 gene locus_tag LOCUS_13940 gene miaA 1349 504 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence233 51 1379 gene locus_tag LOCUS_13950 gene tig 51 1379 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence234 1387 362 gene locus_tag LOCUS_13960 1387 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence235 577 50 gene locus_tag LOCUS_13970 577 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 663 1454 gene locus_tag LOCUS_13980 gene tpiA 663 1454 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence236 1349 69 gene locus_tag LOCUS_13990 1349 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence237 <1447 434 gene locus_tag LOCUS_14000 <1447 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120312.1:AAA family ATPase >Feature sequence238 1429 92 gene locus_tag LOCUS_14010 1429 92 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence239 33 123 gene locus_tag LOCUS_t00260 33 123 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 143 219 gene locus_tag LOCUS_t00270 143 219 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 224 299 gene locus_tag LOCUS_t00280 224 299 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 310 385 gene locus_tag LOCUS_t00290 310 385 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 412 488 gene locus_tag LOCUS_t00300 412 488 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 493 569 gene locus_tag LOCUS_t00310 493 569 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <1431 676 gene locus_tag LOCUS_14020 <1431 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001007697.1:site-specific integrase >Feature sequence240 <1 974 gene locus_tag LOCUS_14030 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869229.1:SLC13 family permease 1078 1293 gene locus_tag LOCUS_14040 1078 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence241 1324 461 gene locus_tag LOCUS_14050 gene xerD 1324 461 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence242 1235 84 gene locus_tag LOCUS_14060 gene rfbE 1235 84 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence243 <1293 365 gene locus_tag LOCUS_14070 <1293 365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948105.1:nucleobase:cation symporter-2 family protein >Feature sequence244 251 1147 gene locus_tag LOCUS_14080 251 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence245 >Feature sequence246 >Feature sequence247 201 1205 gene locus_tag LOCUS_14090 gene gap 201 1205 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360478.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence248 >Feature sequence249 1046 111 gene locus_tag LOCUS_14100 1046 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence250 63 1151 gene locus_tag LOCUS_14110 gene gmd 63 1151 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence251 1119 550 gene locus_tag LOCUS_14120 1119 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence252 >Feature sequence253 926 744 gene locus_tag LOCUS_14130 926 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence254 146 352 gene locus_tag LOCUS_14140 146 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence255 >Feature sequence256 >Feature sequence257 300 67 gene locus_tag LOCUS_14150 gene rpsR 300 67 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_14150 752 351 gene locus_tag LOCUS_14160 752 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1063 764 gene locus_tag LOCUS_14170 gene rpsF 1063 764 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256911.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence258 1071 655 gene locus_tag LOCUS_14180 1071 655 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence259 353 9 gene locus_tag LOCUS_14190 353 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 894 493 gene locus_tag LOCUS_14200 894 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence260 >Feature sequence261 411 1025 gene locus_tag LOCUS_14210 411 1025 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence262 896 108 gene locus_tag LOCUS_14220 896 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence263 >Feature sequence264 175 867 gene locus_tag LOCUS_14230 175 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230