>Feature sequence001 <1 723 gene locus_tag LOCUS_00010 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193606.1:UMP kinase 944 798 gene locus_tag LOCUS_00020 944 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1191 1751 gene locus_tag LOCUS_00030 gene frr 1191 1751 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_00030 1818 2513 gene locus_tag LOCUS_00040 gene uppS 1818 2513 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180544.1 protein_id gnl|my_center|LOCUS_00040 2517 3371 gene locus_tag LOCUS_00050 2517 3371 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063744.1 protein_id gnl|my_center|LOCUS_00050 3381 3902 gene locus_tag LOCUS_00060 3381 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 3834 3843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3986 4555 gene locus_tag LOCUS_00070 3986 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 4558 5919 gene locus_tag LOCUS_00080 gene rseP 4558 5919 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 protein_id gnl|my_center|LOCUS_00080 5957 8290 gene locus_tag LOCUS_00090 gene bamA 5957 8290 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039863.1 protein_id gnl|my_center|LOCUS_00090 8334 8831 gene locus_tag LOCUS_00100 8334 8831 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_00100 9006 10073 gene locus_tag LOCUS_00110 gene lpxD 9006 10073 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243946.1 protein_id gnl|my_center|LOCUS_00110 10076 10516 gene locus_tag LOCUS_00120 gene fabZ 10076 10516 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_00120 10527 11321 gene locus_tag LOCUS_00130 gene lpxA 10527 11321 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581103.1 protein_id gnl|my_center|LOCUS_00130 11321 12472 gene locus_tag LOCUS_00140 gene lpxB 11321 12472 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_00140 12472 13113 gene locus_tag LOCUS_00150 gene rnhB 12472 13113 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_00150 13114 13920 gene locus_tag LOCUS_00160 13114 13920 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697046.1 protein_id gnl|my_center|LOCUS_00160 14837 13971 gene locus_tag LOCUS_00170 14837 13971 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_00170 14929 17310 gene locus_tag LOCUS_00180 gene ppsA 14929 17310 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063754.1 protein_id gnl|my_center|LOCUS_00180 17429 17851 gene locus_tag LOCUS_00190 17429 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17812 18333 gene locus_tag LOCUS_00200 17812 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18326 18859 gene locus_tag LOCUS_00210 18326 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18881 20050 gene locus_tag LOCUS_00220 18881 20050 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_00220 20619 20047 gene locus_tag LOCUS_00230 20619 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21122 20664 gene locus_tag LOCUS_00240 gene smpB 21122 20664 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_00240 21239 21526 gene locus_tag LOCUS_00250 21239 21526 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811750.1 protein_id gnl|my_center|LOCUS_00250 21619 23085 gene locus_tag LOCUS_00260 gene guaB 21619 23085 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_00260 23189 24754 gene locus_tag LOCUS_00270 gene guaA 23189 24754 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193192.1 protein_id gnl|my_center|LOCUS_00270 25585 26157 gene locus_tag LOCUS_00280 25585 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26173 27021 gene locus_tag LOCUS_00290 26173 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27002 27922 gene locus_tag LOCUS_00300 27002 27922 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810987.1 protein_id gnl|my_center|LOCUS_00300 27919 29805 gene locus_tag LOCUS_00310 27919 29805 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_00310 30001 31743 gene locus_tag LOCUS_00320 30001 31743 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_00320 31743 32237 gene locus_tag LOCUS_00330 gene ilvN 31743 32237 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_00330 32276 33292 gene locus_tag LOCUS_00340 gene ilvC 32276 33292 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_00340 33998 33363 gene locus_tag LOCUS_00350 33998 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 34264 33974 gene locus_tag LOCUS_00360 34264 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00360 34010 34019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34439 35782 gene locus_tag LOCUS_00370 gene rph 34439 35782 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369622.1 protein_id gnl|my_center|LOCUS_00370 35784 36923 gene locus_tag LOCUS_00380 gene hemW 35784 36923 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 protein_id gnl|my_center|LOCUS_00380 37225 38646 gene locus_tag LOCUS_00390 gene glnA 37225 38646 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_00390 38704 39771 gene locus_tag LOCUS_00400 gene glnL 38704 39771 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_00400 39768 41192 gene locus_tag LOCUS_00410 gene ntrC 39768 41192 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_00410 41216 42241 gene locus_tag LOCUS_00420 41216 42241 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_00420 43021 42224 gene locus_tag LOCUS_00430 gene xth 43021 42224 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_00430 45114 43018 gene locus_tag LOCUS_00440 45114 43018 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_00440 45946 45083 gene locus_tag LOCUS_00450 gene folD 45946 45083 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_00450 46788 46108 gene locus_tag LOCUS_00460 46788 46108 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_00460 49362 46951 gene locus_tag LOCUS_00470 gene fixL 49362 46951 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence002 367 376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 382 1440 gene locus_tag LOCUS_00480 382 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 1581 2429 gene locus_tag LOCUS_00490 1581 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 2662 4179 gene locus_tag LOCUS_00500 2662 4179 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460454.1 protein_id gnl|my_center|LOCUS_00500 4233 4589 gene locus_tag LOCUS_00510 4233 4589 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073178.1 protein_id gnl|my_center|LOCUS_00510 4622 5767 gene locus_tag LOCUS_00520 gene omp38 4622 5767 CDS product porin Omp38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184655.1 protein_id gnl|my_center|LOCUS_00520 7489 5864 gene locus_tag LOCUS_00530 7489 5864 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_00530 8958 7624 gene locus_tag LOCUS_00540 gene clcA 8958 7624 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 protein_id gnl|my_center|LOCUS_00540 9802 9110 gene locus_tag LOCUS_00550 gene ybgF 9802 9110 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_00550 10300 9809 gene locus_tag LOCUS_00560 gene pal 10300 9809 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_00560 11609 10314 gene locus_tag LOCUS_00570 gene tolB 11609 10314 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_00570 13339 11771 gene locus_tag LOCUS_00580 gene purH 13339 11771 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527723.1 protein_id gnl|my_center|LOCUS_00580 14427 13447 gene locus_tag LOCUS_00590 gene dusB 14427 13447 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_00590 15134 14424 gene locus_tag LOCUS_00600 15134 14424 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_00600 16153 15146 gene locus_tag LOCUS_00610 16153 15146 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_00610 16275 18602 gene locus_tag LOCUS_00620 16275 18602 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189876.1 protein_id gnl|my_center|LOCUS_00620 18606 19967 gene locus_tag LOCUS_00630 18606 19967 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_00630 20024 20848 gene locus_tag LOCUS_00640 gene rsmA 20024 20848 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064975.1 protein_id gnl|my_center|LOCUS_00640 21234 20845 gene locus_tag LOCUS_00650 21234 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 22129 21245 gene locus_tag LOCUS_00660 22129 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 21262 21271 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22875 22138 gene locus_tag LOCUS_00670 22875 22138 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_00670 25015 22925 gene locus_tag LOCUS_00680 gene glyS 25015 22925 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_00680 25931 25029 gene locus_tag LOCUS_00690 gene glyQ 25931 25029 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_00690 27503 25980 gene locus_tag LOCUS_00700 gene lnt 27503 25980 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_00700 28391 27519 gene locus_tag LOCUS_00710 28391 27519 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_00710 28894 28424 gene locus_tag LOCUS_00720 28894 28424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 29882 28887 gene locus_tag LOCUS_00730 29882 28887 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064328.1 protein_id gnl|my_center|LOCUS_00730 31208 29883 gene locus_tag LOCUS_00740 gene miaB 31208 29883 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_00740 32128 31304 gene locus_tag LOCUS_00750 32128 31304 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_00750 32261 32185 gene locus_tag LOCUS_t00010 32261 32185 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33176 32358 gene locus_tag LOCUS_00760 gene thiD 33176 32358 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815096.1 protein_id gnl|my_center|LOCUS_00760 34482 33157 gene locus_tag LOCUS_00770 gene waaA 34482 33157 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_00770 35426 34479 gene locus_tag LOCUS_00780 gene waaC 35426 34479 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905414.1 protein_id gnl|my_center|LOCUS_00780 36822 35437 gene locus_tag LOCUS_00790 36822 35437 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_00790 36936 37880 gene locus_tag LOCUS_00800 gene rfaE1 36936 37880 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_00800 37896 38891 gene locus_tag LOCUS_00810 gene rfaD 37896 38891 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687838.1 protein_id gnl|my_center|LOCUS_00810 38969 39469 gene locus_tag LOCUS_00820 38969 39469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 39466 39960 gene locus_tag LOCUS_00830 gene rfaE2 39466 39960 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189202.1 protein_id gnl|my_center|LOCUS_00830 40813 39953 gene locus_tag LOCUS_00840 gene galU 40813 39953 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039181.1 protein_id gnl|my_center|LOCUS_00840 41696 40860 gene locus_tag LOCUS_00850 41696 40860 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927117.1 protein_id gnl|my_center|LOCUS_00850 42135 41683 gene locus_tag LOCUS_00860 gene ruvX 42135 41683 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_00860 42301 42741 gene locus_tag LOCUS_00870 42301 42741 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_00870 42752 43189 gene locus_tag LOCUS_00880 42752 43189 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_00880 43257 43847 gene locus_tag LOCUS_00890 43257 43847 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_00890 45099 43960 gene locus_tag LOCUS_00900 45099 43960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 46066 45242 gene locus_tag LOCUS_00910 46066 45242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence003 145 71 gene locus_tag LOCUS_t00020 145 71 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 632 177 gene locus_tag LOCUS_00920 gene rnhA 632 177 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_00920 1163 666 gene locus_tag LOCUS_00930 1163 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 1523 3286 gene locus_tag LOCUS_00940 1523 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3511 4299 gene locus_tag LOCUS_00950 gene fabI 3511 4299 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_00950 4309 4701 gene locus_tag LOCUS_00960 4309 4701 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_00960 4724 5419 gene locus_tag LOCUS_00970 4724 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 5430 6302 gene locus_tag LOCUS_00980 5430 6302 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_00980 6309 7964 gene locus_tag LOCUS_00990 gene recN 6309 7964 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_00990 8493 8035 gene locus_tag LOCUS_01000 gene fur 8493 8035 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 protein_id gnl|my_center|LOCUS_01000 8596 9114 gene locus_tag LOCUS_01010 8596 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 9277 9286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9340 10143 gene locus_tag LOCUS_01020 gene dapB 9340 10143 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065058.1 protein_id gnl|my_center|LOCUS_01020 10147 10368 gene locus_tag LOCUS_01030 10147 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 10374 10721 gene locus_tag LOCUS_01040 10374 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 11166 12170 gene locus_tag LOCUS_01050 11166 12170 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040092.1 protein_id gnl|my_center|LOCUS_01050 12955 12167 gene locus_tag LOCUS_01060 gene lgt 12955 12167 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_01060 14443 12959 gene locus_tag LOCUS_01070 gene sbcB 14443 12959 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656746.1 protein_id gnl|my_center|LOCUS_01070 15390 14575 gene locus_tag LOCUS_01080 15390 14575 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_01080 15975 15493 gene locus_tag LOCUS_01090 15975 15493 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_01090 16063 16815 gene locus_tag LOCUS_01100 gene thiM 16063 16815 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097913.1 protein_id gnl|my_center|LOCUS_01100 16812 17459 gene locus_tag LOCUS_01110 gene thiE 16812 17459 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_01110 17910 17437 gene locus_tag LOCUS_01120 17910 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 18016 18972 gene locus_tag LOCUS_01130 18016 18972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 19160 20053 gene locus_tag LOCUS_01140 19160 20053 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_01140 20129 20623 gene locus_tag LOCUS_01150 gene purE 20129 20623 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_01150 20634 21800 gene locus_tag LOCUS_01160 20634 21800 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_01160 21805 22062 gene locus_tag LOCUS_01170 21805 22062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01170 22046 22055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22101 22808 gene locus_tag LOCUS_01180 22101 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01180 22805 23683 gene locus_tag LOCUS_01190 22805 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 23680 24585 gene locus_tag LOCUS_01200 23680 24585 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104575.1 protein_id gnl|my_center|LOCUS_01200 24578 25396 gene locus_tag LOCUS_01210 gene murI 24578 25396 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 protein_id gnl|my_center|LOCUS_01210 25489 26064 gene locus_tag LOCUS_01220 25489 26064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 26088 26711 gene locus_tag LOCUS_01230 26088 26711 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_01230 26803 27678 gene locus_tag LOCUS_01240 26803 27678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 27682 28176 gene locus_tag LOCUS_01250 27682 28176 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204255.1 protein_id gnl|my_center|LOCUS_01250 28328 29731 gene locus_tag LOCUS_01260 gene purB 28328 29731 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522085.1 protein_id gnl|my_center|LOCUS_01260 30216 29815 gene locus_tag LOCUS_01270 30216 29815 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095052.1 protein_id gnl|my_center|LOCUS_01270 31378 30311 gene locus_tag LOCUS_01280 gene fba 31378 30311 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809510.1 protein_id gnl|my_center|LOCUS_01280 32141 31509 gene locus_tag LOCUS_01290 gene fixJ 32141 31509 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_01290 33772 32138 gene locus_tag LOCUS_01300 33772 32138 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263003.1 protein_id gnl|my_center|LOCUS_01300 34273 33902 gene locus_tag LOCUS_01310 34273 33902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 35890 34319 gene locus_tag LOCUS_01320 35890 34319 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812060.1 protein_id gnl|my_center|LOCUS_01320 37431 36001 gene locus_tag LOCUS_01330 37431 36001 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_01330 37928 37431 gene locus_tag LOCUS_01340 37928 37431 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_01340 38136 38678 gene locus_tag LOCUS_01350 38136 38678 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_01350 38849 38924 gene locus_tag LOCUS_t00030 38849 38924 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38935 39019 gene locus_tag LOCUS_t00040 38935 39019 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39259 40404 gene locus_tag LOCUS_01360 39259 40404 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_01360 40401 40763 gene locus_tag LOCUS_01370 40401 40763 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038817.1 protein_id gnl|my_center|LOCUS_01370 40877 42028 gene locus_tag LOCUS_01380 gene araJ 40877 42028 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705512.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence004 1264 167 gene locus_tag LOCUS_01390 gene bcsZ 1264 167 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052370.1 protein_id gnl|my_center|LOCUS_01390 3547 1283 gene locus_tag LOCUS_01400 gene bcsB 3547 1283 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005021118.1 protein_id gnl|my_center|LOCUS_01400 6233 3576 gene locus_tag LOCUS_01410 gene bcsA 6233 3576 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369239.1 protein_id gnl|my_center|LOCUS_01410 6609 7121 gene locus_tag LOCUS_01420 6609 7121 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602838.1 protein_id gnl|my_center|LOCUS_01420 7157 7672 gene locus_tag LOCUS_01430 7157 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7988 7734 gene locus_tag LOCUS_01440 7988 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8617 7991 gene locus_tag LOCUS_01450 8617 7991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040736.1 protein_id gnl|my_center|LOCUS_01450 9390 8614 gene locus_tag LOCUS_01460 9390 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 9877 9395 gene locus_tag LOCUS_01470 gene mlaD 9877 9395 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_01470 10684 9893 gene locus_tag LOCUS_01480 gene mlaE 10684 9893 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_01480 11496 10681 gene locus_tag LOCUS_01490 11496 10681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_01490 12147 11689 gene locus_tag LOCUS_01500 12147 11689 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_01500 13647 12169 gene locus_tag LOCUS_01510 13647 12169 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_01510 18341 13656 gene locus_tag LOCUS_01520 18341 13656 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_01520 19183 18452 gene locus_tag LOCUS_01530 19183 18452 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_01530 20404 19235 gene locus_tag LOCUS_01540 20404 19235 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_01540 20607 20756 gene locus_tag LOCUS_01550 20607 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 20859 21563 gene locus_tag LOCUS_01560 20859 21563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 21585 23705 gene locus_tag LOCUS_01570 21585 23705 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 protein_id gnl|my_center|LOCUS_01570 23717 24514 gene locus_tag LOCUS_01580 23717 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 24572 25618 gene locus_tag LOCUS_01590 24572 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 25696 26436 gene locus_tag LOCUS_01600 25696 26436 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070833.1 protein_id gnl|my_center|LOCUS_01600 26437 27384 gene locus_tag LOCUS_01610 gene nrfD 26437 27384 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070834.1 protein_id gnl|my_center|LOCUS_01610 28601 27456 gene locus_tag LOCUS_01620 28601 27456 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_01620 29680 28598 gene locus_tag LOCUS_01630 gene aroB 29680 28598 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221481.1 protein_id gnl|my_center|LOCUS_01630 30225 29677 gene locus_tag LOCUS_01640 30225 29677 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_01640 30732 30304 gene locus_tag LOCUS_01650 30732 30304 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_01650 30907 31623 gene locus_tag LOCUS_01660 30907 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 31616 31945 gene locus_tag LOCUS_01670 31616 31945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 32079 34490 gene locus_tag LOCUS_01680 32079 34490 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_01680 35868 34606 gene locus_tag LOCUS_01690 35868 34606 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198019.1 protein_id gnl|my_center|LOCUS_01690 36203 35865 gene locus_tag LOCUS_01700 36203 35865 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812839.1 protein_id gnl|my_center|LOCUS_01700 36520 37227 gene locus_tag LOCUS_01710 36520 37227 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530572.1 protein_id gnl|my_center|LOCUS_01710 38278 37313 gene locus_tag LOCUS_01720 38278 37313 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_01720 >Feature sequence005 1843 98 gene locus_tag LOCUS_01730 1843 98 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_01730 2469 1924 gene locus_tag LOCUS_01740 gene hemG 2469 1924 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070443.1 protein_id gnl|my_center|LOCUS_01740 2662 2922 gene locus_tag LOCUS_01750 gene infA 2662 2922 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388420.1 protein_id gnl|my_center|LOCUS_01750 3174 2959 gene locus_tag LOCUS_01760 3174 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 4432 3317 gene locus_tag LOCUS_01770 4432 3317 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 protein_id gnl|my_center|LOCUS_01770 4661 5035 gene locus_tag LOCUS_01780 4661 5035 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_01780 5028 5771 gene locus_tag LOCUS_01790 5028 5771 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_01790 6388 5768 gene locus_tag LOCUS_01800 gene pncA 6388 5768 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083504.1 protein_id gnl|my_center|LOCUS_01800 7456 6389 gene locus_tag LOCUS_01810 7456 6389 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025518.1 protein_id gnl|my_center|LOCUS_01810 7615 8700 gene locus_tag LOCUS_01820 gene mnmA 7615 8700 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_01820 9502 8798 gene locus_tag LOCUS_01830 9502 8798 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190187.1 protein_id gnl|my_center|LOCUS_01830 9778 10095 gene locus_tag LOCUS_01840 gene sugE 9778 10095 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 protein_id gnl|my_center|LOCUS_01840 10239 11912 gene locus_tag LOCUS_01850 10239 11912 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941025.1 protein_id gnl|my_center|LOCUS_01850 11968 13446 gene locus_tag LOCUS_01860 11968 13446 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535882.1 protein_id gnl|my_center|LOCUS_01860 13457 13951 gene locus_tag LOCUS_01870 13457 13951 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948926.1 protein_id gnl|my_center|LOCUS_01870 14731 14021 gene locus_tag LOCUS_01880 14731 14021 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190187.1 protein_id gnl|my_center|LOCUS_01880 15634 14738 gene locus_tag LOCUS_01890 gene sucD 15634 14738 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_01890 16802 15636 gene locus_tag LOCUS_01900 gene sucC 16802 15636 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_01900 17339 16863 gene locus_tag LOCUS_01910 gene recX 17339 16863 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 protein_id gnl|my_center|LOCUS_01910 18442 17339 gene locus_tag LOCUS_01920 gene recA 18442 17339 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_01920 18703 18778 gene locus_tag LOCUS_t00050 18703 18778 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18784 18859 gene locus_tag LOCUS_t00060 18784 18859 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19848 18901 gene locus_tag LOCUS_01930 19848 18901 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704467.1 protein_id gnl|my_center|LOCUS_01930 19946 21307 gene locus_tag LOCUS_01940 19946 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 21717 22775 gene locus_tag LOCUS_01950 21717 22775 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190044.1 protein_id gnl|my_center|LOCUS_01950 22765 23418 gene locus_tag LOCUS_01960 22765 23418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522364.1 protein_id gnl|my_center|LOCUS_01960 24280 23531 gene locus_tag LOCUS_01970 24280 23531 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_01970 24419 24492 gene locus_tag LOCUS_t00070 24419 24492 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25533 25207 gene locus_tag LOCUS_01980 25533 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 26994 25549 gene locus_tag LOCUS_01990 26994 25549 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_01990 27344 28003 gene locus_tag LOCUS_02000 27344 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 27974 27983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28071 29060 gene locus_tag LOCUS_02010 28071 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 29720 29052 gene locus_tag LOCUS_02020 gene fixJ 29720 29052 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_02020 29990 30712 gene locus_tag LOCUS_02030 gene trmB 29990 30712 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 protein_id gnl|my_center|LOCUS_02030 31602 30775 gene locus_tag LOCUS_02040 31602 30775 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_02040 31970 31614 gene locus_tag LOCUS_02050 31970 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 33028 32117 gene locus_tag LOCUS_02060 gene rarD 33028 32117 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734267.1 protein_id gnl|my_center|LOCUS_02060 34949 33099 gene locus_tag LOCUS_02070 gene mnmC 34949 33099 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204185.1 protein_id gnl|my_center|LOCUS_02070 36076 34958 gene locus_tag LOCUS_02080 36076 34958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02080 36636 35977 gene locus_tag LOCUS_02090 36636 35977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02090 36152 36161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37355 36666 gene locus_tag LOCUS_02100 37355 36666 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053924.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence006 472 1665 gene locus_tag LOCUS_02110 472 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1879 2040 gene locus_tag LOCUS_02120 1879 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2512 3804 gene locus_tag LOCUS_02130 gene hemL 2512 3804 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_02130 3831 5909 gene locus_tag LOCUS_02140 3831 5909 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_02140 6012 6677 gene locus_tag LOCUS_02150 6012 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6741 7052 gene locus_tag LOCUS_02160 6741 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7907 7098 gene locus_tag LOCUS_02170 7907 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9323 7953 gene locus_tag LOCUS_02180 gene dcuC 9323 7953 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 protein_id gnl|my_center|LOCUS_02180 10756 9326 gene locus_tag LOCUS_02190 gene argH 10756 9326 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110925521.1 protein_id gnl|my_center|LOCUS_02190 10970 11890 gene locus_tag LOCUS_02200 10970 11890 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481663.1 protein_id gnl|my_center|LOCUS_02200 12702 11887 gene locus_tag LOCUS_02210 gene pyrF 12702 11887 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_02210 14039 12837 gene locus_tag LOCUS_02220 gene lde 14039 12837 CDS product multidrug efflux MFS transporter Lde inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 protein_id gnl|my_center|LOCUS_02220 15890 14247 gene locus_tag LOCUS_02230 gene groL 15890 14247 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_02230 16218 15931 gene locus_tag LOCUS_02240 gene groES 16218 15931 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_02240 16434 17861 gene locus_tag LOCUS_02250 gene dacB 16434 17861 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_02250 17909 18211 gene locus_tag LOCUS_02260 17909 18211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 18239 18688 gene locus_tag LOCUS_02270 18239 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 18675 19055 gene locus_tag LOCUS_02280 18675 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 20468 19146 gene locus_tag LOCUS_02290 20468 19146 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_02290 20977 20465 gene locus_tag LOCUS_02300 20977 20465 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_02300 21495 20962 gene locus_tag LOCUS_02310 21495 20962 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694464.1 protein_id gnl|my_center|LOCUS_02310 22526 21492 gene locus_tag LOCUS_02320 gene thiL 22526 21492 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_02320 22998 22519 gene locus_tag LOCUS_02330 gene nusB 22998 22519 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_02330 23488 22988 gene locus_tag LOCUS_02340 gene ribH 23488 22988 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_02340 24198 23590 gene locus_tag LOCUS_02350 24198 23590 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_02350 25307 24216 gene locus_tag LOCUS_02360 gene ribD 25307 24216 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931219.1 protein_id gnl|my_center|LOCUS_02360 25777 25304 gene locus_tag LOCUS_02370 gene nrdR 25777 25304 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_02370 27091 25799 gene locus_tag LOCUS_02380 27091 25799 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_02380 27300 27671 gene locus_tag LOCUS_02390 gene erpA 27300 27671 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_02390 28826 27720 gene locus_tag LOCUS_02400 28826 27720 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533564.1 protein_id gnl|my_center|LOCUS_02400 30203 28875 gene locus_tag LOCUS_02410 30203 28875 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_02410 30387 31631 gene locus_tag LOCUS_02420 gene tyrS 30387 31631 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 protein_id gnl|my_center|LOCUS_02420 31641 32093 gene locus_tag LOCUS_02430 gene dtd 31641 32093 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 protein_id gnl|my_center|LOCUS_02430 32102 32755 gene locus_tag LOCUS_02440 32102 32755 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_02440 33871 32813 gene locus_tag LOCUS_02450 gene argC 33871 32813 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_02450 34435 34043 gene locus_tag LOCUS_02460 gene rpsI 34435 34043 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_02460 34867 34439 gene locus_tag LOCUS_02470 gene rplM 34867 34439 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215010.1 protein_id gnl|my_center|LOCUS_02470 36565 35102 gene locus_tag LOCUS_02480 36565 35102 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_02480 <37300 36568 gene locus_tag LOCUS_02490 <37300 36568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940392.1:glycerol kinase GlpK >Feature sequence007 2699 2154 gene locus_tag LOCUS_02500 2699 2154 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931244.1 protein_id gnl|my_center|LOCUS_02500 2201 2210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4062 2704 gene locus_tag LOCUS_02510 gene mpl 4062 2704 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_02510 4139 4780 gene locus_tag LOCUS_02520 4139 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4962 5396 gene locus_tag LOCUS_02530 gene aroQ 4962 5396 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_02530 5430 5882 gene locus_tag LOCUS_02540 gene accB 5430 5882 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 protein_id gnl|my_center|LOCUS_02540 5896 7254 gene locus_tag LOCUS_02550 gene accC 5896 7254 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_02550 7266 8165 gene locus_tag LOCUS_02560 gene prmA 7266 8165 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931932.1 protein_id gnl|my_center|LOCUS_02560 8183 9040 gene locus_tag LOCUS_02570 8183 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 10125 9037 gene locus_tag LOCUS_02580 gene modC 10125 9037 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_02580 10827 10147 gene locus_tag LOCUS_02590 gene modB 10827 10147 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_02590 11595 10846 gene locus_tag LOCUS_02600 gene modA 11595 10846 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_02600 11701 12453 gene locus_tag LOCUS_02610 11701 12453 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269173.1 protein_id gnl|my_center|LOCUS_02610 12700 13335 gene locus_tag LOCUS_02620 12700 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 14861 13431 gene locus_tag LOCUS_02630 14861 13431 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 protein_id gnl|my_center|LOCUS_02630 15048 17726 gene locus_tag LOCUS_02640 gene pepN 15048 17726 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 protein_id gnl|my_center|LOCUS_02640 17779 18765 gene locus_tag LOCUS_02650 17779 18765 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341445.1 protein_id gnl|my_center|LOCUS_02650 19352 18825 gene locus_tag LOCUS_02660 19352 18825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 20061 20711 gene locus_tag LOCUS_02670 gene upp 20061 20711 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186446.1 protein_id gnl|my_center|LOCUS_02670 20882 21724 gene locus_tag LOCUS_02680 20882 21724 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183634.1 protein_id gnl|my_center|LOCUS_02680 23273 22005 gene locus_tag LOCUS_02690 23273 22005 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 protein_id gnl|my_center|LOCUS_02690 24740 23469 gene locus_tag LOCUS_02700 gene dcuC 24740 23469 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454288.1 protein_id gnl|my_center|LOCUS_02700 25027 26307 gene locus_tag LOCUS_02710 25027 26307 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815570.1 protein_id gnl|my_center|LOCUS_02710 26451 28313 gene locus_tag LOCUS_02720 gene narX 26451 28313 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_02720 28313 28957 gene locus_tag LOCUS_02730 gene narL 28313 28957 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_02730 29337 29026 gene locus_tag LOCUS_02740 29337 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 30233 29346 gene locus_tag LOCUS_02750 gene napH 30233 29346 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891886.1 protein_id gnl|my_center|LOCUS_02750 30961 30230 gene locus_tag LOCUS_02760 gene napG 30961 30230 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462912.1 protein_id gnl|my_center|LOCUS_02760 33794 31029 gene locus_tag LOCUS_02770 gene napA 33794 31029 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_02770 34091 33831 gene locus_tag LOCUS_02780 34091 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 35615 34254 gene locus_tag LOCUS_02790 gene dcuB 35615 34254 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence008 523 179 gene locus_tag LOCUS_02800 523 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 775 1284 gene locus_tag LOCUS_02810 775 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1324 2982 gene locus_tag LOCUS_02820 1324 2982 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_02820 3955 3425 gene locus_tag LOCUS_02830 3955 3425 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814933.1 protein_id gnl|my_center|LOCUS_02830 4621 4055 gene locus_tag LOCUS_02840 gene ampD 4621 4055 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_02840 4887 4621 gene locus_tag LOCUS_02850 4887 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5724 4891 gene locus_tag LOCUS_02860 gene ccsA 5724 4891 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448047.1 protein_id gnl|my_center|LOCUS_02860 5792 7186 gene locus_tag LOCUS_02870 gene ffh 5792 7186 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807808.1 protein_id gnl|my_center|LOCUS_02870 7186 7791 gene locus_tag LOCUS_02880 gene ruvC 7186 7791 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_02880 7795 8364 gene locus_tag LOCUS_02890 gene ruvA 7795 8364 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_02890 8368 9408 gene locus_tag LOCUS_02900 gene ruvB 8368 9408 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 protein_id gnl|my_center|LOCUS_02900 9392 10114 gene locus_tag LOCUS_02910 9392 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10171 13737 gene locus_tag LOCUS_02920 10171 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 13749 17174 gene locus_tag LOCUS_02930 13749 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 17176 18426 gene locus_tag LOCUS_02940 17176 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 18354 18363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18372 19130 gene locus_tag LOCUS_02950 18372 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 19324 19668 gene locus_tag LOCUS_02960 19324 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 21950 20139 gene locus_tag LOCUS_02970 21950 20139 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_02970 22993 21950 gene locus_tag LOCUS_02980 22993 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02980 23330 23007 gene locus_tag LOCUS_02990 23330 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 23025 23034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24304 23327 gene locus_tag LOCUS_03000 24304 23327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_03000 26568 24301 gene locus_tag LOCUS_03010 26568 24301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_03010 26843 27259 gene locus_tag LOCUS_03020 gene ybgC 26843 27259 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_03020 27285 27968 gene locus_tag LOCUS_03030 gene tolQ 27285 27968 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_03030 27978 28400 gene locus_tag LOCUS_03040 gene tolR 27978 28400 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_03040 28400 29611 gene locus_tag LOCUS_03050 28400 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 28781 28790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29629 31140 gene locus_tag LOCUS_03060 29629 31140 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186398.1 protein_id gnl|my_center|LOCUS_03060 31246 31896 gene locus_tag LOCUS_03070 31246 31896 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107754.1 protein_id gnl|my_center|LOCUS_03070 32236 31940 gene locus_tag LOCUS_03080 32236 31940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence009 124 552 gene locus_tag LOCUS_03090 gene mraZ 124 552 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_03090 570 1538 gene locus_tag LOCUS_03100 gene rsmH 570 1538 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_03100 1535 1837 gene locus_tag LOCUS_03110 1535 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1834 3741 gene locus_tag LOCUS_03120 1834 3741 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_03120 3734 5200 gene locus_tag LOCUS_03130 3734 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5193 6581 gene locus_tag LOCUS_03140 5193 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6582 7745 gene locus_tag LOCUS_03150 gene mraY 6582 7745 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_03150 7752 9185 gene locus_tag LOCUS_03160 gene murD 7752 9185 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_03160 9179 10414 gene locus_tag LOCUS_03170 gene ftsW 9179 10414 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_03170 10411 11493 gene locus_tag LOCUS_03180 gene murG 10411 11493 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689443.1 protein_id gnl|my_center|LOCUS_03180 11496 12884 gene locus_tag LOCUS_03190 gene murC 11496 12884 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194319.1 protein_id gnl|my_center|LOCUS_03190 12888 13829 gene locus_tag LOCUS_03200 12888 13829 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_03200 13833 14642 gene locus_tag LOCUS_03210 13833 14642 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_03210 14695 15954 gene locus_tag LOCUS_03220 gene ftsA 14695 15954 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545961.1 protein_id gnl|my_center|LOCUS_03220 16151 17803 gene locus_tag LOCUS_03230 16151 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 17807 18736 gene locus_tag LOCUS_03240 gene lpxC 17807 18736 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_03240 19344 18784 gene locus_tag LOCUS_03250 19344 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 19572 22238 gene locus_tag LOCUS_03260 gene secA 19572 22238 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_03260 22361 23590 gene locus_tag LOCUS_03270 gene argJ 22361 23590 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_03270 23598 24482 gene locus_tag LOCUS_03280 23598 24482 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_03280 24472 24867 gene locus_tag LOCUS_03290 24472 24867 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194234.1 protein_id gnl|my_center|LOCUS_03290 25121 24870 gene locus_tag LOCUS_03300 25121 24870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 25879 25109 gene locus_tag LOCUS_03310 gene zapD 25879 25109 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420900.1 protein_id gnl|my_center|LOCUS_03310 26716 26114 gene locus_tag LOCUS_03320 gene coaE 26716 26114 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 protein_id gnl|my_center|LOCUS_03320 27793 26795 gene locus_tag LOCUS_03330 27793 26795 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 protein_id gnl|my_center|LOCUS_03330 27949 29112 gene locus_tag LOCUS_03340 gene mdtG 27949 29112 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027946.1 protein_id gnl|my_center|LOCUS_03340 29225 29149 gene locus_tag LOCUS_t00080 29225 29149 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30226 29246 gene locus_tag LOCUS_03350 gene ispB 30226 29246 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038769.1 protein_id gnl|my_center|LOCUS_03350 30497 30808 gene locus_tag LOCUS_03360 gene rplU 30497 30808 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194344.1 protein_id gnl|my_center|LOCUS_03360 30837 31097 gene locus_tag LOCUS_03370 gene rpmA 30837 31097 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551972.1 protein_id gnl|my_center|LOCUS_03370 31217 32329 gene locus_tag LOCUS_03380 gene obgE 31217 32329 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence010 392 26 gene locus_tag LOCUS_tm00010 392 26 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3370 437 gene locus_tag LOCUS_03390 3370 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4084 3425 gene locus_tag LOCUS_03400 4084 3425 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039473.1 protein_id gnl|my_center|LOCUS_03400 4774 4139 gene locus_tag LOCUS_03410 4774 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6207 4867 gene locus_tag LOCUS_03420 6207 4867 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_03420 6526 6227 gene locus_tag LOCUS_03430 6526 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6674 9535 gene locus_tag LOCUS_03440 gene gyrA 6674 9535 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_03440 9519 10586 gene locus_tag LOCUS_03450 gene serC 9519 10586 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_03450 10597 11718 gene locus_tag LOCUS_03460 gene pheA 10597 11718 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_03460 11715 12842 gene locus_tag LOCUS_03470 gene hisC 11715 12842 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_03470 12839 13699 gene locus_tag LOCUS_03480 12839 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 13711 15006 gene locus_tag LOCUS_03490 13711 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 15006 15668 gene locus_tag LOCUS_03500 gene cmk 15006 15668 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_03500 15762 17456 gene locus_tag LOCUS_03510 gene rpsA 15762 17456 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930101.1 protein_id gnl|my_center|LOCUS_03510 17474 17776 gene locus_tag LOCUS_03520 17474 17776 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_03520 17925 19124 gene locus_tag LOCUS_03530 gene lapB 17925 19124 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_03530 19055 19064 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19226 20122 gene locus_tag LOCUS_03540 gene htpX 19226 20122 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_03540 20415 20209 gene locus_tag LOCUS_03550 20415 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 22032 20641 gene locus_tag LOCUS_03560 22032 20641 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930260.1 protein_id gnl|my_center|LOCUS_03560 23773 22049 gene locus_tag LOCUS_03570 23773 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_03570 24165 23869 gene locus_tag LOCUS_03580 24165 23869 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818624.1 protein_id gnl|my_center|LOCUS_03580 25572 24316 gene locus_tag LOCUS_03590 gene rho 25572 24316 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_03590 26030 25710 gene locus_tag LOCUS_03600 gene trxA 26030 25710 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_03600 26622 26377 gene locus_tag LOCUS_03610 26622 26377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 26860 27369 gene locus_tag LOCUS_03620 26860 27369 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence011 97 1368 gene locus_tag LOCUS_03630 97 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1522 2637 gene locus_tag LOCUS_03640 1522 2637 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206644.1 protein_id gnl|my_center|LOCUS_03640 2627 2983 gene locus_tag LOCUS_03650 2627 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 3005 4819 gene locus_tag LOCUS_03660 3005 4819 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527809.1 protein_id gnl|my_center|LOCUS_03660 4823 5845 gene locus_tag LOCUS_03670 4823 5845 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986861.1 protein_id gnl|my_center|LOCUS_03670 5953 6726 gene locus_tag LOCUS_03680 gene truC 5953 6726 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890132.1 protein_id gnl|my_center|LOCUS_03680 6982 6764 gene locus_tag LOCUS_03690 6982 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6909 7697 gene locus_tag LOCUS_03700 6909 7697 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 protein_id gnl|my_center|LOCUS_03700 8094 9524 gene locus_tag LOCUS_03710 8094 9524 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356617.1 protein_id gnl|my_center|LOCUS_03710 9521 10663 gene locus_tag LOCUS_03720 9521 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03720 10557 11288 gene locus_tag LOCUS_03730 10557 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 10586 10595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11291 11908 gene locus_tag LOCUS_03740 11291 11908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_03740 13435 11963 gene locus_tag LOCUS_03750 gene urdA 13435 11963 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_03750 16818 13729 gene locus_tag LOCUS_03760 16818 13729 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_03760 17954 16839 gene locus_tag LOCUS_03770 17954 16839 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844987.1 protein_id gnl|my_center|LOCUS_03770 19430 18270 gene locus_tag LOCUS_03780 gene dnaJ 19430 18270 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_03780 21457 19553 gene locus_tag LOCUS_03790 gene dnaK 21457 19553 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_03790 22084 21539 gene locus_tag LOCUS_03800 gene grpE 22084 21539 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_03800 23366 22359 gene locus_tag LOCUS_03810 gene hemH 23366 22359 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059263.1 protein_id gnl|my_center|LOCUS_03810 23948 23373 gene locus_tag LOCUS_03820 23948 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 24973 23996 gene locus_tag LOCUS_03830 24973 23996 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_03830 27762 25015 gene locus_tag LOCUS_03840 gene glnE 27762 25015 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522142.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence012 71 637 gene locus_tag LOCUS_03850 71 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1268 2842 gene locus_tag LOCUS_03860 1268 2842 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179238099.1 protein_id gnl|my_center|LOCUS_03860 3203 4675 gene locus_tag LOCUS_03870 3203 4675 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 protein_id gnl|my_center|LOCUS_03870 4679 5323 gene locus_tag LOCUS_03880 4679 5323 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_03880 5510 6697 gene locus_tag LOCUS_03890 5510 6697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_03890 6862 7563 gene locus_tag LOCUS_03900 6862 7563 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327147.1 protein_id gnl|my_center|LOCUS_03900 7565 8521 gene locus_tag LOCUS_03910 7565 8521 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 protein_id gnl|my_center|LOCUS_03910 8774 9841 gene locus_tag LOCUS_03920 gene aroG 8774 9841 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_03920 11205 9934 gene locus_tag LOCUS_03930 11205 9934 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 protein_id gnl|my_center|LOCUS_03930 11760 11966 gene locus_tag LOCUS_03940 11760 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 13447 12038 gene locus_tag LOCUS_03950 gene fccA 13447 12038 CDS product fumarate reductase flavoprotein subunit FccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071245.1 protein_id gnl|my_center|LOCUS_03950 14147 13524 gene locus_tag LOCUS_03960 14147 13524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_03960 15913 14144 gene locus_tag LOCUS_03970 15913 14144 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 protein_id gnl|my_center|LOCUS_03970 16720 16112 gene locus_tag LOCUS_03980 16720 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 18212 16713 gene locus_tag LOCUS_03990 18212 16713 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918691.1 protein_id gnl|my_center|LOCUS_03990 21350 18213 gene locus_tag LOCUS_04000 21350 18213 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 protein_id gnl|my_center|LOCUS_04000 22528 21365 gene locus_tag LOCUS_04010 22528 21365 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_04010 24446 22731 gene locus_tag LOCUS_04020 24446 22731 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480694.1 protein_id gnl|my_center|LOCUS_04020 25921 24674 gene locus_tag LOCUS_04030 25921 24674 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_04030 27202 25937 gene locus_tag LOCUS_04040 gene dcuC 27202 25937 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence013 2781 1435 gene locus_tag LOCUS_04050 2781 1435 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_04050 4674 2836 gene locus_tag LOCUS_04060 4674 2836 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_04060 5403 4816 gene locus_tag LOCUS_04070 5403 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 7316 5487 gene locus_tag LOCUS_04080 7316 5487 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_04080 8485 7313 gene locus_tag LOCUS_04090 8485 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 8487 9407 gene locus_tag LOCUS_04100 gene rsmI 8487 9407 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770442.1 protein_id gnl|my_center|LOCUS_04100 9422 10642 gene locus_tag LOCUS_04110 gene ppk2 9422 10642 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809186.1 protein_id gnl|my_center|LOCUS_04110 11200 10721 gene locus_tag LOCUS_04120 11200 10721 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_04120 11670 11215 gene locus_tag LOCUS_04130 11670 11215 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_04130 12721 11816 gene locus_tag LOCUS_04140 gene ttcA 12721 11816 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_04140 13125 12721 gene locus_tag LOCUS_04150 13125 12721 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_04150 13169 13360 gene locus_tag LOCUS_04160 13169 13360 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189988.1 protein_id gnl|my_center|LOCUS_04160 14446 13334 gene locus_tag LOCUS_04170 14446 13334 CDS product CCA-adding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958469.1 protein_id gnl|my_center|LOCUS_04170 14483 15034 gene locus_tag LOCUS_04180 14483 15034 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197233.1 protein_id gnl|my_center|LOCUS_04180 16333 15038 gene locus_tag LOCUS_04190 16333 15038 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040180.1 protein_id gnl|my_center|LOCUS_04190 17615 16425 gene locus_tag LOCUS_04200 gene metK 17615 16425 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 protein_id gnl|my_center|LOCUS_04200 17838 18734 gene locus_tag LOCUS_04210 17838 18734 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523078.1 protein_id gnl|my_center|LOCUS_04210 18966 19820 gene locus_tag LOCUS_04220 gene dapF 18966 19820 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199067.1 protein_id gnl|my_center|LOCUS_04220 19817 20494 gene locus_tag LOCUS_04230 19817 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 20503 21738 gene locus_tag LOCUS_04240 20503 21738 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_04240 21492 21501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21889 23001 gene locus_tag LOCUS_04250 21889 23001 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931290.1 protein_id gnl|my_center|LOCUS_04250 23034 23747 gene locus_tag LOCUS_04260 23034 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24020 23814 gene locus_tag LOCUS_04270 24020 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 24115 25008 gene locus_tag LOCUS_04280 gene argB 24115 25008 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_04280 25023 25622 gene locus_tag LOCUS_04290 gene slmA 25023 25622 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927138.1 protein_id gnl|my_center|LOCUS_04290 <27200 25687 gene locus_tag LOCUS_04300 <27200 25687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446625.1:protease CptA >Feature sequence014 <1 646 gene locus_tag LOCUS_04310 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937488.1:molybdate ABC transporter substrate-binding protein 650 1318 gene locus_tag LOCUS_04320 gene modB 650 1318 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021257.1 protein_id gnl|my_center|LOCUS_04320 1322 2158 gene locus_tag LOCUS_04330 gene modD 1322 2158 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 protein_id gnl|my_center|LOCUS_04330 2820 2284 gene locus_tag LOCUS_04340 2820 2284 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647970.1 protein_id gnl|my_center|LOCUS_04340 2979 2886 gene locus_tag LOCUS_t00090 2979 2886 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3400 3101 gene locus_tag LOCUS_04350 3400 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3549 4088 gene locus_tag LOCUS_04360 3549 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5038 4085 gene locus_tag LOCUS_04370 5038 4085 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032713612.1 protein_id gnl|my_center|LOCUS_04370 5140 5910 gene locus_tag LOCUS_04380 5140 5910 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_04380 5995 6666 gene locus_tag LOCUS_04390 5995 6666 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462201.1 protein_id gnl|my_center|LOCUS_04390 6669 7364 gene locus_tag LOCUS_04400 6669 7364 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 7261 7270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7566 8564 gene locus_tag LOCUS_04410 7566 8564 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_04410 8580 9476 gene locus_tag LOCUS_04420 8580 9476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_04420 9469 10269 gene locus_tag LOCUS_04430 9469 10269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_04430 11740 10304 gene locus_tag LOCUS_04440 gene tilS 11740 10304 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176529.1 protein_id gnl|my_center|LOCUS_04440 12692 11721 gene locus_tag LOCUS_04450 12692 11721 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_04450 13355 12702 gene locus_tag LOCUS_04460 13355 12702 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_04460 14755 13361 gene locus_tag LOCUS_04470 gene cysS 14755 13361 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_04470 14987 15193 gene locus_tag LOCUS_04480 14987 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 17029 15335 gene locus_tag LOCUS_04490 17029 15335 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 protein_id gnl|my_center|LOCUS_04490 17407 17060 gene locus_tag LOCUS_04500 17407 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 18257 17514 gene locus_tag LOCUS_04510 18257 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 18454 19014 gene locus_tag LOCUS_04520 18454 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19069 19626 gene locus_tag LOCUS_04530 19069 19626 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_04530 19644 20135 gene locus_tag LOCUS_04540 19644 20135 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_04540 20136 20924 gene locus_tag LOCUS_04550 20136 20924 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039346.1 protein_id gnl|my_center|LOCUS_04550 20926 21702 gene locus_tag LOCUS_04560 20926 21702 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694907.1 protein_id gnl|my_center|LOCUS_04560 21699 22346 gene locus_tag LOCUS_04570 21699 22346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 22410 24278 gene locus_tag LOCUS_04580 22410 24278 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_04580 25132 24275 gene locus_tag LOCUS_04590 25132 24275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 <26988 25203 gene locus_tag LOCUS_04600 <26988 25203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941025.1:ammonia-forming cytochrome c nitrite reductase subunit c552 >Feature sequence015 132 57 gene locus_tag LOCUS_t00100 132 57 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 444 172 gene locus_tag LOCUS_04610 444 172 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 protein_id gnl|my_center|LOCUS_04610 3222 793 gene locus_tag LOCUS_04620 gene lon 3222 793 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_04620 2544 2553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4786 3461 gene locus_tag LOCUS_04630 gene clpX 4786 3461 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_04630 5448 4819 gene locus_tag LOCUS_04640 gene clpP 5448 4819 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_04640 6951 5566 gene locus_tag LOCUS_04650 gene tig 6951 5566 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930555.1 protein_id gnl|my_center|LOCUS_04650 7467 7601 gene locus_tag LOCUS_04660 7467 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7721 7797 gene locus_tag LOCUS_t00110 7721 7797 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8804 8118 gene locus_tag LOCUS_04670 8804 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9386 8823 gene locus_tag LOCUS_04680 9386 8823 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_04680 9716 10795 gene locus_tag LOCUS_04690 9716 10795 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_04690 10876 11346 gene locus_tag LOCUS_04700 10876 11346 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938007.1 protein_id gnl|my_center|LOCUS_04700 11356 12651 gene locus_tag LOCUS_04710 11356 12651 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938006.1 protein_id gnl|my_center|LOCUS_04710 13129 12701 gene locus_tag LOCUS_04720 13129 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 13420 15033 gene locus_tag LOCUS_04730 gene pckA 13420 15033 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_04730 15989 15078 gene locus_tag LOCUS_04740 15989 15078 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535950.1 protein_id gnl|my_center|LOCUS_04740 17303 16110 gene locus_tag LOCUS_04750 gene dpaL 17303 16110 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_04750 18468 17305 gene locus_tag LOCUS_04760 18468 17305 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047945.1 protein_id gnl|my_center|LOCUS_04760 19500 18568 gene locus_tag LOCUS_04770 19500 18568 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_04770 19897 19682 gene locus_tag LOCUS_04780 19897 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 20117 20692 gene locus_tag LOCUS_04790 20117 20692 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063992.1 protein_id gnl|my_center|LOCUS_04790 20810 21592 gene locus_tag LOCUS_04800 20810 21592 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108359.1 protein_id gnl|my_center|LOCUS_04800 21693 22100 gene locus_tag LOCUS_04810 21693 22100 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_04810 23072 22155 gene locus_tag LOCUS_04820 23072 22155 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476460.1 protein_id gnl|my_center|LOCUS_04820 23442 23525 gene locus_tag LOCUS_t00120 23442 23525 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23759 24922 gene locus_tag LOCUS_04830 gene hmpA 23759 24922 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930799.1 protein_id gnl|my_center|LOCUS_04830 25412 25696 gene locus_tag LOCUS_04840 25412 25696 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence016 1458 97 gene locus_tag LOCUS_04850 1458 97 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_04850 1874 3433 gene locus_tag LOCUS_04860 1874 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4464 3487 gene locus_tag LOCUS_04870 4464 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6854 4533 gene locus_tag LOCUS_04880 gene ppk1 6854 4533 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870306.1 protein_id gnl|my_center|LOCUS_04880 7832 6939 gene locus_tag LOCUS_04890 7832 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8292 8035 gene locus_tag LOCUS_04900 gene moaD 8292 8035 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_04900 9036 8296 gene locus_tag LOCUS_04910 gene moeB 9036 8296 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_04910 9181 10077 gene locus_tag LOCUS_04920 9181 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 10148 10525 gene locus_tag LOCUS_04930 10148 10525 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071582.1 protein_id gnl|my_center|LOCUS_04930 11505 10522 gene locus_tag LOCUS_04940 11505 10522 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707317.1 protein_id gnl|my_center|LOCUS_04940 11589 12485 gene locus_tag LOCUS_04950 11589 12485 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700189.1 protein_id gnl|my_center|LOCUS_04950 13311 12538 gene locus_tag LOCUS_04960 13311 12538 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_04960 14060 13308 gene locus_tag LOCUS_04970 14060 13308 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_04970 14917 14150 gene locus_tag LOCUS_04980 14917 14150 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 protein_id gnl|my_center|LOCUS_04980 15568 15107 gene locus_tag LOCUS_04990 15568 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 16364 15939 gene locus_tag LOCUS_05000 16364 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 16589 16374 gene locus_tag LOCUS_05010 16589 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 18144 17296 gene locus_tag LOCUS_05020 gene panC 18144 17296 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064922.1 protein_id gnl|my_center|LOCUS_05020 18972 18160 gene locus_tag LOCUS_05030 gene panB 18972 18160 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_05030 19492 18941 gene locus_tag LOCUS_05040 gene folK 19492 18941 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194373.1 protein_id gnl|my_center|LOCUS_05040 20935 19496 gene locus_tag LOCUS_05050 gene pcnB 20935 19496 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_05050 21656 20964 gene locus_tag LOCUS_05060 21656 20964 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688561.1 protein_id gnl|my_center|LOCUS_05060 22363 21653 gene locus_tag LOCUS_05070 gene hda 22363 21653 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065012.1 protein_id gnl|my_center|LOCUS_05070 22507 22959 gene locus_tag LOCUS_05080 22507 22959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 23144 24178 gene locus_tag LOCUS_05090 gene purM 23144 24178 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence017 294 599 gene locus_tag LOCUS_05100 294 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 672 2048 gene locus_tag LOCUS_05110 672 2048 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 protein_id gnl|my_center|LOCUS_05110 4632 2107 gene locus_tag LOCUS_05120 4632 2107 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_05120 4821 5348 gene locus_tag LOCUS_05130 gene def 4821 5348 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_05130 6117 5350 gene locus_tag LOCUS_05140 6117 5350 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_05140 6337 7311 gene locus_tag LOCUS_05150 gene fmt 6337 7311 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_05150 7308 8612 gene locus_tag LOCUS_05160 gene rsmB 7308 8612 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 protein_id gnl|my_center|LOCUS_05160 8612 9181 gene locus_tag LOCUS_05170 8612 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9182 9718 gene locus_tag LOCUS_05180 9182 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 9578 9587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9660 11447 gene locus_tag LOCUS_05190 9660 11447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 11496 12209 gene locus_tag LOCUS_05200 gene esaR 11496 12209 CDS product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189647.1 protein_id gnl|my_center|LOCUS_05200 12240 13652 gene locus_tag LOCUS_05210 gene trkA 12240 13652 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818498.1 protein_id gnl|my_center|LOCUS_05210 13654 15135 gene locus_tag LOCUS_05220 13654 15135 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807338.1 protein_id gnl|my_center|LOCUS_05220 15569 15216 gene locus_tag LOCUS_05230 15569 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 15702 16109 gene locus_tag LOCUS_05240 15702 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 16096 16365 gene locus_tag LOCUS_05250 16096 16365 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_05250 16368 18176 gene locus_tag LOCUS_05260 gene ptsP 16368 18176 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_05260 18166 18825 gene locus_tag LOCUS_05270 18166 18825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 20153 18822 gene locus_tag LOCUS_05280 20153 18822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_05280 20917 20222 gene locus_tag LOCUS_05290 20917 20222 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_05290 21690 20914 gene locus_tag LOCUS_05300 21690 20914 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_05300 21628 21837 gene locus_tag LOCUS_05310 21628 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 21856 22530 gene locus_tag LOCUS_05320 gene pyrE 21856 22530 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_05320 24031 22583 gene locus_tag LOCUS_05330 gene gatB 24031 22583 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_05330 <25120 24046 gene locus_tag LOCUS_05340 <25120 24046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189326.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence018 1389 511 gene locus_tag LOCUS_05350 1389 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098034.1 protein_id gnl|my_center|LOCUS_05350 2202 1678 gene locus_tag LOCUS_05360 2202 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3927 2203 gene locus_tag LOCUS_05370 3927 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4099 3932 gene locus_tag LOCUS_05380 4099 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4521 4123 gene locus_tag LOCUS_05390 4521 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4959 4522 gene locus_tag LOCUS_05400 4959 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 6520 5024 gene locus_tag LOCUS_05410 6520 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6752 6603 gene locus_tag LOCUS_05420 6752 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 7770 7000 gene locus_tag LOCUS_05430 7770 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 8339 7767 gene locus_tag LOCUS_05440 8339 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8763 8284 gene locus_tag LOCUS_05450 8763 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 9358 8765 gene locus_tag LOCUS_05460 9358 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9790 9362 gene locus_tag LOCUS_05470 9790 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 10278 9799 gene locus_tag LOCUS_05480 10278 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 11406 10345 gene locus_tag LOCUS_05490 11406 10345 CDS product DUF2184 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098046.1 protein_id gnl|my_center|LOCUS_05490 11937 11422 gene locus_tag LOCUS_05500 11937 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 13402 11951 gene locus_tag LOCUS_05510 13402 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 14566 13670 gene locus_tag LOCUS_05520 14566 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 16164 14563 gene locus_tag LOCUS_05530 16164 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 17704 16235 gene locus_tag LOCUS_05540 gene terL 17704 16235 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_05540 18089 17649 gene locus_tag LOCUS_05550 18089 17649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 20066 19242 gene locus_tag LOCUS_05560 20066 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 20837 20412 gene locus_tag LOCUS_05570 20837 20412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 21318 20827 gene locus_tag LOCUS_05580 21318 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21524 21315 gene locus_tag LOCUS_05590 21524 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21864 21508 gene locus_tag LOCUS_05600 21864 21508 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744232.1 protein_id gnl|my_center|LOCUS_05600 22145 21861 gene locus_tag LOCUS_05610 22145 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 22662 22534 gene locus_tag LOCUS_05620 22662 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 23735 22671 gene locus_tag LOCUS_05630 23735 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 24144 23704 gene locus_tag LOCUS_05640 24144 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence019 1998 826 gene locus_tag LOCUS_05650 1998 826 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211257.1 protein_id gnl|my_center|LOCUS_05650 2146 2155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2214 2858 gene locus_tag LOCUS_05660 2214 2858 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862987.1 protein_id gnl|my_center|LOCUS_05660 4342 2882 gene locus_tag LOCUS_05670 4342 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4989 4363 gene locus_tag LOCUS_05680 gene fixJ 4989 4363 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_05680 6727 4973 gene locus_tag LOCUS_05690 6727 4973 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 protein_id gnl|my_center|LOCUS_05690 8348 6831 gene locus_tag LOCUS_05700 8348 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 9014 8523 gene locus_tag LOCUS_05710 9014 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9960 11264 gene locus_tag LOCUS_05720 gene lplT 9960 11264 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_05720 11337 12746 gene locus_tag LOCUS_05730 gene pgi 11337 12746 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100194.1 protein_id gnl|my_center|LOCUS_05730 13941 12832 gene locus_tag LOCUS_05740 13941 12832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_05740 15056 13938 gene locus_tag LOCUS_05750 15056 13938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_05750 16812 15049 gene locus_tag LOCUS_05760 16812 15049 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_05760 17807 16821 gene locus_tag LOCUS_05770 17807 16821 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_05770 18523 17933 gene locus_tag LOCUS_05780 18523 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19346 18621 gene locus_tag LOCUS_05790 19346 18621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_05790 19909 19918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20586 20044 gene locus_tag LOCUS_05800 20586 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 21259 20657 gene locus_tag LOCUS_05810 gene cbiM 21259 20657 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_05810 22023 21259 gene locus_tag LOCUS_05820 22023 21259 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_05820 23018 22116 gene locus_tag LOCUS_05830 gene yddG 23018 22116 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 protein_id gnl|my_center|LOCUS_05830 <24206 23116 gene locus_tag LOCUS_05840 <24206 23116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816917.1:AAA family ATPase >Feature sequence020 4210 2618 gene locus_tag LOCUS_05850 4210 2618 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_05850 5543 4233 gene locus_tag LOCUS_05860 5543 4233 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_05860 6002 5927 gene locus_tag LOCUS_t00130 6002 5927 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6081 6008 gene locus_tag LOCUS_t00140 6081 6008 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6177 6102 gene locus_tag LOCUS_t00150 6177 6102 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6409 6831 gene locus_tag LOCUS_05870 6409 6831 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 protein_id gnl|my_center|LOCUS_05870 8728 6806 gene locus_tag LOCUS_05880 8728 6806 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_05880 9626 8721 gene locus_tag LOCUS_05890 gene prmB 9626 8721 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926401.1 protein_id gnl|my_center|LOCUS_05890 10752 9607 gene locus_tag LOCUS_05900 gene dapE 10752 9607 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 protein_id gnl|my_center|LOCUS_05900 11661 10855 gene locus_tag LOCUS_05910 gene dapD 11661 10855 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186643.1 protein_id gnl|my_center|LOCUS_05910 12854 11664 gene locus_tag LOCUS_05920 gene dapC 12854 11664 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_05920 13411 12992 gene locus_tag LOCUS_05930 13411 12992 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_05930 13631 14794 gene locus_tag LOCUS_05940 13631 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 14886 16940 gene locus_tag LOCUS_05950 gene ligA 14886 16940 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_05950 16933 17685 gene locus_tag LOCUS_05960 16933 17685 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_05960 20303 17751 gene locus_tag LOCUS_05970 20303 17751 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 protein_id gnl|my_center|LOCUS_05970 21145 20330 gene locus_tag LOCUS_05980 gene map 21145 20330 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811806.1 protein_id gnl|my_center|LOCUS_05980 21489 22247 gene locus_tag LOCUS_05990 gene rpsB 21489 22247 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811803.1 protein_id gnl|my_center|LOCUS_05990 22333 23220 gene locus_tag LOCUS_06000 gene tsf 22333 23220 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence021 120 896 gene locus_tag LOCUS_06010 120 896 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_06010 999 1151 gene locus_tag LOCUS_06020 999 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1362 2114 gene locus_tag LOCUS_06030 gene surE 1362 2114 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 protein_id gnl|my_center|LOCUS_06030 2201 2965 gene locus_tag LOCUS_06040 2201 2965 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 protein_id gnl|my_center|LOCUS_06040 2986 4437 gene locus_tag LOCUS_06050 gene rlmD 2986 4437 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_06050 4443 4985 gene locus_tag LOCUS_06060 4443 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5012 5632 gene locus_tag LOCUS_06070 5012 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5643 6167 gene locus_tag LOCUS_06080 5643 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6345 6773 gene locus_tag LOCUS_06090 gene ndk 6345 6773 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_06090 6843 8012 gene locus_tag LOCUS_06100 gene rlmN 6843 8012 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_06100 8005 9099 gene locus_tag LOCUS_06110 8005 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 9127 10335 gene locus_tag LOCUS_06120 gene ispG 9127 10335 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_06120 10335 11612 gene locus_tag LOCUS_06130 gene hisS 10335 11612 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521334.1 protein_id gnl|my_center|LOCUS_06130 11702 12337 gene locus_tag LOCUS_06140 11702 12337 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810700.1 protein_id gnl|my_center|LOCUS_06140 12341 13456 gene locus_tag LOCUS_06150 gene bamB 12341 13456 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_06150 13462 14793 gene locus_tag LOCUS_06160 gene der 13462 14793 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_06160 15113 15364 gene locus_tag LOCUS_06170 gene hfq 15113 15364 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_06170 15364 16527 gene locus_tag LOCUS_06180 gene hflX 15364 16527 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447752.1 protein_id gnl|my_center|LOCUS_06180 16703 18202 gene locus_tag LOCUS_06190 gene hflK 16703 18202 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_06190 18213 19106 gene locus_tag LOCUS_06200 gene hflC 18213 19106 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_06200 19329 20495 gene locus_tag LOCUS_06210 19329 20495 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063927.1 protein_id gnl|my_center|LOCUS_06210 20513 21805 gene locus_tag LOCUS_06220 20513 21805 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_06220 21818 22345 gene locus_tag LOCUS_06230 21818 22345 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527158.1 protein_id gnl|my_center|LOCUS_06230 22648 22734 gene locus_tag LOCUS_t00160 22648 22734 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 <1 828 gene locus_tag LOCUS_06240 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532924.1:S-methyl-5-thioribose-1-phosphate isomerase 821 1513 gene locus_tag LOCUS_06250 821 1513 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337432.1 protein_id gnl|my_center|LOCUS_06250 1500 1760 gene locus_tag LOCUS_06260 1500 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1744 2250 gene locus_tag LOCUS_06270 1744 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2265 3458 gene locus_tag LOCUS_06280 2265 3458 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 protein_id gnl|my_center|LOCUS_06280 5324 3531 gene locus_tag LOCUS_06290 gene aspS 5324 3531 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_06290 5755 5447 gene locus_tag LOCUS_06300 5755 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7956 5905 gene locus_tag LOCUS_06310 gene fusA 7956 5905 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_06310 8097 8939 gene locus_tag LOCUS_06320 8097 8939 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_06320 9077 10480 gene locus_tag LOCUS_06330 9077 10480 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_06330 10470 11771 gene locus_tag LOCUS_06340 10470 11771 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_06340 11771 12478 gene locus_tag LOCUS_06350 11771 12478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_06350 12472 13677 gene locus_tag LOCUS_06360 12472 13677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_06360 14262 13735 gene locus_tag LOCUS_06370 gene ssb 14262 13735 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_06370 14851 14366 gene locus_tag LOCUS_06380 14851 14366 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426596.1 protein_id gnl|my_center|LOCUS_06380 15116 17977 gene locus_tag LOCUS_06390 gene uvrA 15116 17977 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_06390 18000 19289 gene locus_tag LOCUS_06400 18000 19289 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence023 182 2236 gene locus_tag LOCUS_06410 gene uvrB 182 2236 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_06410 2452 2877 gene locus_tag LOCUS_06420 2452 2877 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_06420 2992 3447 gene locus_tag LOCUS_06430 gene iscR 2992 3447 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_06430 3483 4691 gene locus_tag LOCUS_06440 3483 4691 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 protein_id gnl|my_center|LOCUS_06440 4707 5102 gene locus_tag LOCUS_06450 gene iscU 4707 5102 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092829.1 protein_id gnl|my_center|LOCUS_06450 5102 5425 gene locus_tag LOCUS_06460 gene iscA 5102 5425 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_06460 5442 5942 gene locus_tag LOCUS_06470 gene hscB 5442 5942 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_06470 5942 7801 gene locus_tag LOCUS_06480 gene hscA 5942 7801 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951132.1 protein_id gnl|my_center|LOCUS_06480 7804 8142 gene locus_tag LOCUS_06490 gene fdx 7804 8142 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 protein_id gnl|my_center|LOCUS_06490 8142 8342 gene locus_tag LOCUS_06500 gene iscX 8142 8342 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 protein_id gnl|my_center|LOCUS_06500 9185 8346 gene locus_tag LOCUS_06510 9185 8346 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064810.1 protein_id gnl|my_center|LOCUS_06510 10714 9191 gene locus_tag LOCUS_06520 gene lysS 10714 9191 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205152.1 protein_id gnl|my_center|LOCUS_06520 11483 10716 gene locus_tag LOCUS_06530 11483 10716 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_06530 12328 11486 gene locus_tag LOCUS_06540 gene prfB 12328 11486 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 14440 12722 gene locus_tag LOCUS_06550 gene recJ 14440 12722 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_06550 15500 14457 gene locus_tag LOCUS_06560 15500 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 15721 15512 gene locus_tag LOCUS_06570 15721 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 15684 16841 gene locus_tag LOCUS_06580 15684 16841 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930193.1 protein_id gnl|my_center|LOCUS_06580 16834 17523 gene locus_tag LOCUS_06590 gene lolD 16834 17523 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_06590 17524 18336 gene locus_tag LOCUS_06600 17524 18336 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_06600 18504 19085 gene locus_tag LOCUS_06610 18504 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 19106 20479 gene locus_tag LOCUS_06620 19106 20479 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815306.1 protein_id gnl|my_center|LOCUS_06620 20495 20851 gene locus_tag LOCUS_06630 20495 20851 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310481.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence024 125 1207 gene locus_tag LOCUS_06640 125 1207 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972885.1 protein_id gnl|my_center|LOCUS_06640 3045 1288 gene locus_tag LOCUS_06650 3045 1288 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 protein_id gnl|my_center|LOCUS_06650 4984 3326 gene locus_tag LOCUS_06660 4984 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4153 4162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5946 5152 gene locus_tag LOCUS_06670 5946 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 5181 5190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8023 6611 gene locus_tag LOCUS_06680 8023 6611 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_06680 9447 8098 gene locus_tag LOCUS_06690 gene pcaB 9447 8098 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_06690 9775 10452 gene locus_tag LOCUS_06700 9775 10452 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_06700 10571 11533 gene locus_tag LOCUS_06710 10571 11533 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460935.1 protein_id gnl|my_center|LOCUS_06710 11546 12175 gene locus_tag LOCUS_06720 11546 12175 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460936.1 protein_id gnl|my_center|LOCUS_06720 12240 14015 gene locus_tag LOCUS_06730 12240 14015 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 protein_id gnl|my_center|LOCUS_06730 14012 14635 gene locus_tag LOCUS_06740 14012 14635 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_06740 14763 16352 gene locus_tag LOCUS_06750 14763 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16414 16746 gene locus_tag LOCUS_06760 16414 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 17006 16866 gene locus_tag LOCUS_06770 17006 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17142 17801 gene locus_tag LOCUS_06780 17142 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 17814 18284 gene locus_tag LOCUS_06790 17814 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 18407 19675 gene locus_tag LOCUS_06800 18407 19675 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930633.1 protein_id gnl|my_center|LOCUS_06800 20339 19755 gene locus_tag LOCUS_06810 20339 19755 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693637.1 protein_id gnl|my_center|LOCUS_06810 21351 20419 gene locus_tag LOCUS_06820 21351 20419 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_06820 21973 21398 gene locus_tag LOCUS_06830 21973 21398 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence025 120 1253 gene locus_tag LOCUS_06840 gene tgt 120 1253 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_06840 1529 1879 gene locus_tag LOCUS_06850 gene yajC 1529 1879 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_06850 1984 3882 gene locus_tag LOCUS_06860 gene secD 1984 3882 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_06860 3885 4820 gene locus_tag LOCUS_06870 gene secF 3885 4820 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_06870 5240 5509 gene locus_tag LOCUS_06880 5240 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5472 5804 gene locus_tag LOCUS_06890 5472 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6545 5883 gene locus_tag LOCUS_06900 6545 5883 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_06900 7677 6628 gene locus_tag LOCUS_06910 gene hypE 7677 6628 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_06910 8803 7697 gene locus_tag LOCUS_06920 gene hypD 8803 7697 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_06920 9033 8800 gene locus_tag LOCUS_06930 9033 8800 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_06930 11369 9039 gene locus_tag LOCUS_06940 gene hypF 11369 9039 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948176.1 protein_id gnl|my_center|LOCUS_06940 11301 11310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12007 11333 gene locus_tag LOCUS_06950 12007 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12260 12078 gene locus_tag LOCUS_06960 12260 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 12629 12282 gene locus_tag LOCUS_06970 gene hypA 12629 12282 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_06970 13716 12622 gene locus_tag LOCUS_06980 13716 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 14312 13713 gene locus_tag LOCUS_06990 14312 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06990 14529 14269 gene locus_tag LOCUS_07000 14529 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07000 15434 14529 gene locus_tag LOCUS_07010 15434 14529 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_07010 15904 15458 gene locus_tag LOCUS_07020 15904 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 16230 15904 gene locus_tag LOCUS_07030 gene hypC 16230 15904 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334908.1 protein_id gnl|my_center|LOCUS_07030 16886 16230 gene locus_tag LOCUS_07040 16886 16230 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_07040 17366 17019 gene locus_tag LOCUS_07050 17366 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 18145 17375 gene locus_tag LOCUS_07060 gene cybH 18145 17375 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965636.1 protein_id gnl|my_center|LOCUS_07060 19927 18158 gene locus_tag LOCUS_07070 19927 18158 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089679.1 protein_id gnl|my_center|LOCUS_07070 21027 19927 gene locus_tag LOCUS_07080 21027 19927 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194451.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence026 <1 1344 gene locus_tag LOCUS_07090 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005418812.1:C4-dicarboxylate transporter DcuC 1692 1456 gene locus_tag LOCUS_07100 1692 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3144 1891 gene locus_tag LOCUS_07110 gene pepT 3144 1891 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_07110 3405 4682 gene locus_tag LOCUS_07120 gene dcuC 3405 4682 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891426.1 protein_id gnl|my_center|LOCUS_07120 4701 5831 gene locus_tag LOCUS_07130 4701 5831 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_07130 7584 5851 gene locus_tag LOCUS_07140 gene pepF 7584 5851 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_07140 8694 7735 gene locus_tag LOCUS_07150 8694 7735 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 protein_id gnl|my_center|LOCUS_07150 8899 8687 gene locus_tag LOCUS_07160 8899 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 9130 9840 gene locus_tag LOCUS_07170 9130 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07170 9817 9826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9849 10442 gene locus_tag LOCUS_07180 9849 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 10445 11497 gene locus_tag LOCUS_07190 10445 11497 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464702.1 protein_id gnl|my_center|LOCUS_07190 11507 12715 gene locus_tag LOCUS_07200 11507 12715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_07200 12705 13976 gene locus_tag LOCUS_07210 12705 13976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707255.1 protein_id gnl|my_center|LOCUS_07210 15569 14007 gene locus_tag LOCUS_07220 15569 14007 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_07220 15733 17256 gene locus_tag LOCUS_07230 15733 17256 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_07230 17281 17637 gene locus_tag LOCUS_07240 17281 17637 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072954.1 protein_id gnl|my_center|LOCUS_07240 17680 19329 gene locus_tag LOCUS_07250 17680 19329 CDS product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602238.1 protein_id gnl|my_center|LOCUS_07250 19348 20406 gene locus_tag LOCUS_07260 19348 20406 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence027 84 661 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagttccccgcgtaagcggggatgaaccg 1548 2672 gene locus_tag LOCUS_07270 1548 2672 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931454.1 protein_id gnl|my_center|LOCUS_07270 3535 2669 gene locus_tag LOCUS_07280 gene gluQRS 3535 2669 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 protein_id gnl|my_center|LOCUS_07280 4694 3594 gene locus_tag LOCUS_07290 4694 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6056 4788 gene locus_tag LOCUS_07300 6056 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 6642 6046 gene locus_tag LOCUS_07310 gene yjgA 6642 6046 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_07310 6719 8029 gene locus_tag LOCUS_07320 gene pmbA 6719 8029 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567741.1 protein_id gnl|my_center|LOCUS_07320 8137 9165 gene locus_tag LOCUS_07330 8137 9165 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_07330 10695 9259 gene locus_tag LOCUS_07340 gene argH 10695 9259 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_07340 10894 11826 gene locus_tag LOCUS_07350 gene hemC 10894 11826 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687436.1 protein_id gnl|my_center|LOCUS_07350 11826 12575 gene locus_tag LOCUS_07360 11826 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12635 13168 gene locus_tag LOCUS_07370 gene ppa 12635 13168 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_07370 13317 14939 gene locus_tag LOCUS_07380 13317 14939 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931082.1 protein_id gnl|my_center|LOCUS_07380 14974 15312 gene locus_tag LOCUS_07390 14974 15312 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_07390 16012 15365 gene locus_tag LOCUS_07400 16012 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 16983 16018 gene locus_tag LOCUS_07410 gene trxB 16983 16018 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409663.1 protein_id gnl|my_center|LOCUS_07410 17073 19622 gene locus_tag LOCUS_07420 gene ftsK 17073 19622 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence028 363 3044 gene locus_tag LOCUS_07430 363 3044 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_07430 3108 3863 gene locus_tag LOCUS_07440 3108 3863 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_07440 4293 3868 gene locus_tag LOCUS_07450 4293 3868 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_07450 4489 5277 gene locus_tag LOCUS_07460 4489 5277 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 protein_id gnl|my_center|LOCUS_07460 5397 5406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5466 6449 gene locus_tag LOCUS_07470 5466 6449 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815171.1 protein_id gnl|my_center|LOCUS_07470 6449 6979 gene locus_tag LOCUS_07480 gene kdsC 6449 6979 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099768.1 protein_id gnl|my_center|LOCUS_07480 6983 7576 gene locus_tag LOCUS_07490 6983 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7711 8304 gene locus_tag LOCUS_07500 gene lptA 7711 8304 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_07500 8301 9074 gene locus_tag LOCUS_07510 gene lptB 8301 9074 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_07510 9085 10443 gene locus_tag LOCUS_07520 gene rpoN 9085 10443 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809012.1 protein_id gnl|my_center|LOCUS_07520 10492 10968 gene locus_tag LOCUS_07530 gene ptsN 10492 10968 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_07530 10988 11926 gene locus_tag LOCUS_07540 gene hprK 10988 11926 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 protein_id gnl|my_center|LOCUS_07540 11940 12809 gene locus_tag LOCUS_07550 gene rapZ 11940 12809 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195227.1 protein_id gnl|my_center|LOCUS_07550 13792 12806 gene locus_tag LOCUS_07560 gene mutY 13792 12806 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064920.1 protein_id gnl|my_center|LOCUS_07560 15220 13931 gene locus_tag LOCUS_07570 15220 13931 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197818.1 protein_id gnl|my_center|LOCUS_07570 15504 17003 gene locus_tag LOCUS_07580 15504 17003 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_07580 18253 17039 gene locus_tag LOCUS_07590 gene hydF 18253 17039 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_07590 19033 18341 gene locus_tag LOCUS_07600 19033 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 19373 19026 gene locus_tag LOCUS_07610 19373 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence029 161 1321 gene locus_tag LOCUS_07620 gene pncB 161 1321 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 protein_id gnl|my_center|LOCUS_07620 1563 2984 gene locus_tag LOCUS_07630 1563 2984 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527476.1 protein_id gnl|my_center|LOCUS_07630 3175 3888 gene locus_tag LOCUS_07640 3175 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3864 4838 gene locus_tag LOCUS_07650 3864 4838 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_07650 4984 6627 gene locus_tag LOCUS_07660 4984 6627 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_07660 6633 7487 gene locus_tag LOCUS_07670 gene kdsA 6633 7487 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_07670 7505 8791 gene locus_tag LOCUS_07680 gene eno 7505 8791 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_07680 8795 9100 gene locus_tag LOCUS_07690 8795 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 9273 10175 gene locus_tag LOCUS_07700 9273 10175 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_07700 10256 11338 gene locus_tag LOCUS_07710 gene alr 10256 11338 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191260.1 protein_id gnl|my_center|LOCUS_07710 12092 11331 gene locus_tag LOCUS_07720 12092 11331 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_07720 12303 14327 gene locus_tag LOCUS_07730 12303 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 14324 15037 gene locus_tag LOCUS_07740 gene walR 14324 15037 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 protein_id gnl|my_center|LOCUS_07740 15138 16667 gene locus_tag LOCUS_07750 15138 16667 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_07750 16677 17084 gene locus_tag LOCUS_07760 16677 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 18124 17174 gene locus_tag LOCUS_07770 gene hslO 18124 17174 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence030 137 1624 gene locus_tag LOCUS_07780 137 1624 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073179.1 protein_id gnl|my_center|LOCUS_07780 1692 1701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1754 1996 gene locus_tag LOCUS_07790 1754 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2026 2325 gene locus_tag LOCUS_07800 2026 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07800 2342 3673 gene locus_tag LOCUS_07810 2342 3673 CDS product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073177.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07810 3824 4879 gene locus_tag LOCUS_07820 3824 4879 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_07820 5073 5393 gene locus_tag LOCUS_07830 5073 5393 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_07830 5397 6650 gene locus_tag LOCUS_07840 5397 6650 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_07840 6663 7427 gene locus_tag LOCUS_07850 6663 7427 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_07850 7516 8457 gene locus_tag LOCUS_07860 7516 8457 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 protein_id gnl|my_center|LOCUS_07860 8640 9629 gene locus_tag LOCUS_07870 8640 9629 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_07870 9675 10100 gene locus_tag LOCUS_07880 9675 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 11215 10142 gene locus_tag LOCUS_07890 gene nagZ 11215 10142 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_07890 11608 11219 gene locus_tag LOCUS_07900 gene acpS 11608 11219 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581197.1 protein_id gnl|my_center|LOCUS_07900 12057 11611 gene locus_tag LOCUS_07910 12057 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 12026 12035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12743 12129 gene locus_tag LOCUS_07920 gene recO 12743 12129 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524618.1 protein_id gnl|my_center|LOCUS_07920 13093 14877 gene locus_tag LOCUS_07930 13093 14877 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 protein_id gnl|my_center|LOCUS_07930 14858 15469 gene locus_tag LOCUS_07940 14858 15469 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973728.1 protein_id gnl|my_center|LOCUS_07940 15593 17371 gene locus_tag LOCUS_07950 15593 17371 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_07950 18649 17600 gene locus_tag LOCUS_07960 18649 17600 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence031 528 2891 gene locus_tag LOCUS_07970 gene torA 528 2891 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338998.1 protein_id gnl|my_center|LOCUS_07970 3027 4400 gene locus_tag LOCUS_07980 3027 4400 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_07980 4437 5207 gene locus_tag LOCUS_07990 4437 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_07990 5381 6307 gene locus_tag LOCUS_08000 gene aroD 5381 6307 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_08000 6340 8142 gene locus_tag LOCUS_08010 6340 8142 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703251.1 protein_id gnl|my_center|LOCUS_08010 8213 10009 gene locus_tag LOCUS_08020 8213 10009 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925920.1 protein_id gnl|my_center|LOCUS_08020 10019 10666 gene locus_tag LOCUS_08030 gene fixJ 10019 10666 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_08030 10666 12066 gene locus_tag LOCUS_08040 10666 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 12445 13761 gene locus_tag LOCUS_08050 12445 13761 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762009.1 protein_id gnl|my_center|LOCUS_08050 14538 13888 gene locus_tag LOCUS_08060 14538 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 15022 16011 gene locus_tag LOCUS_08070 15022 16011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918733.1 protein_id gnl|my_center|LOCUS_08070 16286 17290 gene locus_tag LOCUS_08080 16286 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 17310 18200 gene locus_tag LOCUS_08090 gene ftcD 17310 18200 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence032 309 770 gene locus_tag LOCUS_08100 gene mscL 309 770 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815814.1 protein_id gnl|my_center|LOCUS_08100 4305 811 gene locus_tag LOCUS_08110 4305 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5094 4342 gene locus_tag LOCUS_08120 5094 4342 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261499.1 protein_id gnl|my_center|LOCUS_08120 5559 5155 gene locus_tag LOCUS_08130 5559 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 6089 5655 gene locus_tag LOCUS_08140 6089 5655 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_08140 6944 6159 gene locus_tag LOCUS_08150 6944 6159 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696991.1 protein_id gnl|my_center|LOCUS_08150 7101 8000 gene locus_tag LOCUS_08160 7101 8000 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_08160 8073 9311 gene locus_tag LOCUS_08170 8073 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 9499 10185 gene locus_tag LOCUS_08180 9499 10185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 protein_id gnl|my_center|LOCUS_08180 10714 10235 gene locus_tag LOCUS_08190 gene moaC 10714 10235 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_08190 10818 12296 gene locus_tag LOCUS_08200 10818 12296 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_08200 12455 13498 gene locus_tag LOCUS_08210 12455 13498 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_08210 14653 13580 gene locus_tag LOCUS_08220 gene apbC 14653 13580 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_08220 14797 16899 gene locus_tag LOCUS_08230 gene metG 14797 16899 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064494.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence033 1724 336 gene locus_tag LOCUS_08240 1724 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2573 1908 gene locus_tag LOCUS_08250 2573 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3041 3307 gene locus_tag LOCUS_08260 3041 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3702 4847 gene locus_tag LOCUS_08270 3702 4847 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_08270 6216 4975 gene locus_tag LOCUS_08280 6216 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 8682 8491 gene locus_tag LOCUS_08290 8682 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9141 9344 gene locus_tag LOCUS_08300 9141 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9488 10966 gene locus_tag LOCUS_08310 9488 10966 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272522.1 protein_id gnl|my_center|LOCUS_08310 11717 11499 gene locus_tag LOCUS_08320 11717 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12099 11863 gene locus_tag LOCUS_08330 12099 11863 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_08330 13901 12264 gene locus_tag LOCUS_08340 13901 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 14928 13975 gene locus_tag LOCUS_08350 14928 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 16086 15064 gene locus_tag LOCUS_08360 16086 15064 CDS product CbbQ/NirQ/NorQ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939317.1 protein_id gnl|my_center|LOCUS_08360 17195 16170 gene locus_tag LOCUS_08370 17195 16170 CDS product primase-helicase zinc-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260358.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence034 345 55 gene locus_tag LOCUS_08380 345 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 628 1725 gene locus_tag LOCUS_08390 628 1725 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262044.1 protein_id gnl|my_center|LOCUS_08390 1832 2281 gene locus_tag LOCUS_08400 1832 2281 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975474.1 protein_id gnl|my_center|LOCUS_08400 2385 2978 gene locus_tag LOCUS_08410 2385 2978 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791444.1 protein_id gnl|my_center|LOCUS_08410 3187 4626 gene locus_tag LOCUS_08420 3187 4626 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_08420 4785 5891 gene locus_tag LOCUS_08430 4785 5891 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704276.1 protein_id gnl|my_center|LOCUS_08430 6596 7306 gene locus_tag LOCUS_08440 6596 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 7328 9421 gene locus_tag LOCUS_08450 7328 9421 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273547.1 protein_id gnl|my_center|LOCUS_08450 9437 10291 gene locus_tag LOCUS_08460 9437 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10185 10194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10317 11393 gene locus_tag LOCUS_08470 10317 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11434 12102 gene locus_tag LOCUS_08480 11434 12102 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070833.1 protein_id gnl|my_center|LOCUS_08480 12104 13030 gene locus_tag LOCUS_08490 gene nrfD 12104 13030 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070834.1 protein_id gnl|my_center|LOCUS_08490 16770 15178 gene locus_tag LOCUS_08500 16770 15178 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179238099.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence035 1910 852 gene locus_tag LOCUS_08510 1910 852 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869708.1 protein_id gnl|my_center|LOCUS_08510 2487 2215 gene locus_tag LOCUS_08520 2487 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2774 2484 gene locus_tag LOCUS_08530 2774 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4145 2859 gene locus_tag LOCUS_08540 4145 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4589 4218 gene locus_tag LOCUS_08550 4589 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5267 4662 gene locus_tag LOCUS_08560 5267 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5671 5348 gene locus_tag LOCUS_08570 5671 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6165 5743 gene locus_tag LOCUS_08580 6165 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6563 6261 gene locus_tag LOCUS_08590 6563 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7110 6580 gene locus_tag LOCUS_08600 7110 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7903 7682 gene locus_tag LOCUS_08610 7903 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8355 8014 gene locus_tag LOCUS_08620 8355 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9082 8786 gene locus_tag LOCUS_08630 9082 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11211 9355 gene locus_tag LOCUS_08640 11211 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12336 11284 gene locus_tag LOCUS_08650 12336 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 13406 12411 gene locus_tag LOCUS_08660 13406 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14403 13420 gene locus_tag LOCUS_08670 14403 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 15037 14564 gene locus_tag LOCUS_08680 gene ssb 15037 14564 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013740.1 protein_id gnl|my_center|LOCUS_08680 16175 15147 gene locus_tag LOCUS_08690 16175 15147 CDS product CbbQ/NirQ/NorQ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939317.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence036 166 1248 gene locus_tag LOCUS_08700 166 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 1211 1220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1353 1772 gene locus_tag LOCUS_08710 1353 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 1834 2814 gene locus_tag LOCUS_08720 1834 2814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814271.1 protein_id gnl|my_center|LOCUS_08720 2820 4037 gene locus_tag LOCUS_08730 2820 4037 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_08730 4087 4962 gene locus_tag LOCUS_08740 4087 4962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039165.1 protein_id gnl|my_center|LOCUS_08740 4968 6002 gene locus_tag LOCUS_08750 4968 6002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_08750 5999 7027 gene locus_tag LOCUS_08760 5999 7027 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039166.1 protein_id gnl|my_center|LOCUS_08760 7208 8302 gene locus_tag LOCUS_08770 gene lptF 7208 8302 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040214.1 protein_id gnl|my_center|LOCUS_08770 8299 9435 gene locus_tag LOCUS_08780 gene lptG 8299 9435 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_08780 10010 9495 gene locus_tag LOCUS_08790 10010 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15707 10137 gene locus_tag LOCUS_08800 gene uvrA 15707 10137 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939035.1 protein_id gnl|my_center|LOCUS_08800 16271 15960 gene locus_tag LOCUS_08810 16271 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence037 2290 629 gene locus_tag LOCUS_08820 2290 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2563 3705 gene locus_tag LOCUS_08830 2563 3705 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448266.1 protein_id gnl|my_center|LOCUS_08830 3737 4357 gene locus_tag LOCUS_08840 3737 4357 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973728.1 protein_id gnl|my_center|LOCUS_08840 4537 6030 gene locus_tag LOCUS_08850 4537 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6191 8404 gene locus_tag LOCUS_08860 6191 8404 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943374.1 protein_id gnl|my_center|LOCUS_08860 8401 9033 gene locus_tag LOCUS_08870 8401 9033 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461607.1 protein_id gnl|my_center|LOCUS_08870 10566 9115 gene locus_tag LOCUS_08880 gene radA 10566 9115 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_08880 10796 12247 gene locus_tag LOCUS_08890 10796 12247 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_08890 12273 13349 gene locus_tag LOCUS_08900 gene rfbB 12273 13349 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140471.1 protein_id gnl|my_center|LOCUS_08900 13397 13945 gene locus_tag LOCUS_08910 gene rfbC 13397 13945 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_08910 15991 14777 gene locus_tag LOCUS_08920 15991 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence038 163 1431 gene locus_tag LOCUS_08930 163 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1498 2493 gene locus_tag LOCUS_08940 1498 2493 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 protein_id gnl|my_center|LOCUS_08940 2528 3934 gene locus_tag LOCUS_08950 2528 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4167 5435 gene locus_tag LOCUS_08960 4167 5435 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_08960 5663 7186 gene locus_tag LOCUS_08970 5663 7186 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 protein_id gnl|my_center|LOCUS_08970 7294 7797 gene locus_tag LOCUS_08980 7294 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8753 7815 gene locus_tag LOCUS_08990 gene miaA 8753 7815 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194103.1 protein_id gnl|my_center|LOCUS_08990 10648 8753 gene locus_tag LOCUS_09000 gene mutL 10648 8753 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039151.1 protein_id gnl|my_center|LOCUS_09000 10819 11469 gene locus_tag LOCUS_09010 10819 11469 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_09010 11561 11839 gene locus_tag LOCUS_09020 11561 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09020 11769 11778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11991 12203 gene locus_tag LOCUS_09030 11991 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09030 12892 14292 gene locus_tag LOCUS_09040 12892 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940069.1 protein_id gnl|my_center|LOCUS_09040 14308 15456 gene locus_tag LOCUS_09050 14308 15456 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence039 281 27 gene locus_tag LOCUS_09060 281 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1518 376 gene locus_tag LOCUS_09070 gene iadA 1518 376 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 protein_id gnl|my_center|LOCUS_09070 2907 1531 gene locus_tag LOCUS_09080 gene dcuC 2907 1531 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466989.1 protein_id gnl|my_center|LOCUS_09080 3711 3352 gene locus_tag LOCUS_09090 3711 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4099 3917 gene locus_tag LOCUS_09100 4099 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4292 4567 gene locus_tag LOCUS_09110 4292 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4831 5820 gene locus_tag LOCUS_09120 4831 5820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 protein_id gnl|my_center|LOCUS_09120 5904 7574 gene locus_tag LOCUS_09130 5904 7574 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_09130 7575 8666 gene locus_tag LOCUS_09140 7575 8666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 protein_id gnl|my_center|LOCUS_09140 8832 9527 gene locus_tag LOCUS_09150 8832 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 10443 9628 gene locus_tag LOCUS_09160 gene fetB 10443 9628 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_09160 11758 10592 gene locus_tag LOCUS_09170 11758 10592 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_09170 11950 12960 gene locus_tag LOCUS_09180 11950 12960 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_09180 14166 13054 gene locus_tag LOCUS_09190 14166 13054 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_09190 14555 15244 gene locus_tag LOCUS_09200 14555 15244 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704274.1 protein_id gnl|my_center|LOCUS_09200 15237 15716 gene locus_tag LOCUS_09210 15237 15716 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704275.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence040 <1 897 gene locus_tag LOCUS_09220 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000955028.1:transporter YfdV 1386 973 gene locus_tag LOCUS_09230 1386 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1623 3092 gene locus_tag LOCUS_09240 gene hutW 1623 3092 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993317.1 protein_id gnl|my_center|LOCUS_09240 3181 3537 gene locus_tag LOCUS_09250 3181 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3870 5672 gene locus_tag LOCUS_09260 3870 5672 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925920.1 protein_id gnl|my_center|LOCUS_09260 5656 6318 gene locus_tag LOCUS_09270 gene fixJ 5656 6318 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_09270 6326 7780 gene locus_tag LOCUS_09280 6326 7780 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_09280 7880 9667 gene locus_tag LOCUS_09290 7880 9667 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_09290 10062 10517 gene locus_tag LOCUS_09300 10062 10517 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294635.1 protein_id gnl|my_center|LOCUS_09300 10570 12228 gene locus_tag LOCUS_09310 gene ilvD 10570 12228 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_09310 13546 12539 gene locus_tag LOCUS_09320 gene ansZ 13546 12539 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_09320 14905 13604 gene locus_tag LOCUS_09330 gene serS 14905 13604 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_09330 15380 15389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence041 707 1045 gene locus_tag LOCUS_09340 707 1045 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_09340 2195 1182 gene locus_tag LOCUS_09350 gene hemB 2195 1182 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_09350 2863 2273 gene locus_tag LOCUS_09360 gene yihA 2863 2273 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_09360 4114 2987 gene locus_tag LOCUS_09370 4114 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5285 4245 gene locus_tag LOCUS_09380 5285 4245 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 protein_id gnl|my_center|LOCUS_09380 5703 5518 gene locus_tag LOCUS_09390 5703 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7134 5821 gene locus_tag LOCUS_09400 gene lysA 7134 5821 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806944.1 protein_id gnl|my_center|LOCUS_09400 7490 7161 gene locus_tag LOCUS_09410 7490 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7453 7782 gene locus_tag LOCUS_09420 7453 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7784 8632 gene locus_tag LOCUS_09430 gene folP 7784 8632 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_09430 8629 9966 gene locus_tag LOCUS_09440 gene glmM 8629 9966 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_09440 9976 10668 gene locus_tag LOCUS_09450 gene phoB 9976 10668 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_09450 11017 11469 gene locus_tag LOCUS_09460 11017 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 11472 12056 gene locus_tag LOCUS_09470 11472 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09470 12449 13546 gene locus_tag LOCUS_09480 gene phoR 12449 13546 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_09480 13772 13848 gene locus_tag LOCUS_t00170 13772 13848 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13879 13955 gene locus_tag LOCUS_t00180 13879 13955 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13967 14042 gene locus_tag LOCUS_t00190 13967 14042 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 150 1019 gene locus_tag LOCUS_09490 150 1019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_09490 2626 1094 gene locus_tag LOCUS_09500 2626 1094 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_09500 4602 2827 gene locus_tag LOCUS_09510 gene msbA 4602 2827 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928167.1 protein_id gnl|my_center|LOCUS_09510 4691 5632 gene locus_tag LOCUS_09520 4691 5632 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926806.1 protein_id gnl|my_center|LOCUS_09520 5984 5993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6036 6611 gene locus_tag LOCUS_09530 6036 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09530 6706 8085 gene locus_tag LOCUS_09540 gene dcuC 6706 8085 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 protein_id gnl|my_center|LOCUS_09540 8958 8182 gene locus_tag LOCUS_09550 8958 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9726 9160 gene locus_tag LOCUS_09560 9726 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 10508 9723 gene locus_tag LOCUS_09570 10508 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 11557 10658 gene locus_tag LOCUS_09580 11557 10658 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_09580 11911 11836 gene locus_tag LOCUS_t00200 11911 11836 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12021 11946 gene locus_tag LOCUS_t00210 12021 11946 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13535 12099 gene locus_tag LOCUS_09590 gene gltX 13535 12099 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_09590 15386 13707 gene locus_tag LOCUS_09600 15386 13707 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence043 2200 98 gene locus_tag LOCUS_09610 gene fusA 2200 98 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_09610 2731 2258 gene locus_tag LOCUS_09620 gene rpsG 2731 2258 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_09620 3217 2840 gene locus_tag LOCUS_09630 gene rpsL 3217 2840 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_09630 7754 3507 gene locus_tag LOCUS_09640 gene rpoC 7754 3507 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_09640 11884 7751 gene locus_tag LOCUS_09650 gene rpoB 11884 7751 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_09650 12490 12113 gene locus_tag LOCUS_09660 gene rplL 12490 12113 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_09660 13069 12539 gene locus_tag LOCUS_09670 gene rplJ 13069 12539 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_09670 14019 13327 gene locus_tag LOCUS_09680 gene rplA 14019 13327 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_09680 14453 14019 gene locus_tag LOCUS_09690 gene rplK 14453 14019 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_09690 15098 14562 gene locus_tag LOCUS_09700 gene nusG 15098 14562 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525645.1 protein_id gnl|my_center|LOCUS_09700 15494 15111 gene locus_tag LOCUS_09710 gene secE 15494 15111 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_09710 15623 15548 gene locus_tag LOCUS_t00220 15623 15548 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 844 194 gene locus_tag LOCUS_09720 844 194 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_09720 2609 831 gene locus_tag LOCUS_09730 2609 831 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 protein_id gnl|my_center|LOCUS_09730 3492 2896 gene locus_tag LOCUS_09740 3492 2896 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070826.1 protein_id gnl|my_center|LOCUS_09740 3878 3489 gene locus_tag LOCUS_09750 3878 3489 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070827.1 protein_id gnl|my_center|LOCUS_09750 5746 3875 gene locus_tag LOCUS_09760 gene nrfE 5746 3875 CDS product heme lyase NrfEFG subunit NrfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070828.1 protein_id gnl|my_center|LOCUS_09760 6586 5777 gene locus_tag LOCUS_09770 6586 5777 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070838.1 protein_id gnl|my_center|LOCUS_09770 7455 6583 gene locus_tag LOCUS_09780 7455 6583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070837.1 protein_id gnl|my_center|LOCUS_09780 8729 7452 gene locus_tag LOCUS_09790 gene nosD 8729 7452 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070836.1 protein_id gnl|my_center|LOCUS_09790 9232 8732 gene locus_tag LOCUS_09800 9232 8732 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070835.1 protein_id gnl|my_center|LOCUS_09800 10269 9331 gene locus_tag LOCUS_09810 gene nrfD 10269 9331 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070834.1 protein_id gnl|my_center|LOCUS_09810 11015 10272 gene locus_tag LOCUS_09820 11015 10272 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070833.1 protein_id gnl|my_center|LOCUS_09820 11707 11054 gene locus_tag LOCUS_09830 11707 11054 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070832.1 protein_id gnl|my_center|LOCUS_09830 12524 11730 gene locus_tag LOCUS_09840 12524 11730 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070831.1 protein_id gnl|my_center|LOCUS_09840 13000 12575 gene locus_tag LOCUS_09850 13000 12575 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 protein_id gnl|my_center|LOCUS_09850 15111 13066 gene locus_tag LOCUS_09860 gene sirA 15111 13066 CDS product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070829.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence045 1709 1308 gene locus_tag LOCUS_09870 gene rplQ 1709 1308 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064753.1 protein_id gnl|my_center|LOCUS_09870 2910 1870 gene locus_tag LOCUS_09880 gene rpoA 2910 1870 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_09880 3687 3064 gene locus_tag LOCUS_09890 gene rpsD 3687 3064 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 protein_id gnl|my_center|LOCUS_09890 4168 3755 gene locus_tag LOCUS_09900 gene rpsK 4168 3755 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197937.1 protein_id gnl|my_center|LOCUS_09900 4548 4183 gene locus_tag LOCUS_09910 gene rpsM 4548 4183 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806929.1 protein_id gnl|my_center|LOCUS_09910 6156 4828 gene locus_tag LOCUS_09920 gene secY 6156 4828 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_09920 6623 6177 gene locus_tag LOCUS_09930 gene rplO 6623 6177 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_09930 6817 6638 gene locus_tag LOCUS_09940 gene rpmD 6817 6638 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_09940 7353 6835 gene locus_tag LOCUS_09950 gene rpsE 7353 6835 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_09950 7733 7365 gene locus_tag LOCUS_09960 gene rplR 7733 7365 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_09960 8284 7751 gene locus_tag LOCUS_09970 gene rplF 8284 7751 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_09970 8696 8301 gene locus_tag LOCUS_09980 gene rpsH 8696 8301 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_09980 9018 8713 gene locus_tag LOCUS_09990 gene rpsN 9018 8713 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 protein_id gnl|my_center|LOCUS_09990 9572 9033 gene locus_tag LOCUS_10000 gene rplE 9572 9033 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806918.1 protein_id gnl|my_center|LOCUS_10000 9907 9587 gene locus_tag LOCUS_10010 gene rplX 9907 9587 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_10010 10289 9921 gene locus_tag LOCUS_10020 gene rplN 10289 9921 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_10020 10820 10563 gene locus_tag LOCUS_10030 gene rpsQ 10820 10563 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_10030 11011 10817 gene locus_tag LOCUS_10040 gene rpmC 11011 10817 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_10040 11440 11024 gene locus_tag LOCUS_10050 gene rplP 11440 11024 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_10050 12237 11443 gene locus_tag LOCUS_10060 gene rpsC 12237 11443 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_10060 12592 12248 gene locus_tag LOCUS_10070 gene rplV 12592 12248 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 protein_id gnl|my_center|LOCUS_10070 12882 12598 gene locus_tag LOCUS_10080 gene rpsS 12882 12598 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 protein_id gnl|my_center|LOCUS_10080 13720 12893 gene locus_tag LOCUS_10090 gene rplB 13720 12893 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018908.1 protein_id gnl|my_center|LOCUS_10090 14016 13720 gene locus_tag LOCUS_10100 gene rplW 14016 13720 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_10100 14633 14013 gene locus_tag LOCUS_10110 gene rplD 14633 14013 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_10110 15294 14644 gene locus_tag LOCUS_10120 gene rplC 15294 14644 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence046 623 1210 gene locus_tag LOCUS_10130 623 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1290 2897 gene locus_tag LOCUS_10140 1290 2897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195435952.1 protein_id gnl|my_center|LOCUS_10140 2907 3338 gene locus_tag LOCUS_10150 2907 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3313 3972 gene locus_tag LOCUS_10160 3313 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5128 4847 gene locus_tag LOCUS_10170 gene yafQ 5128 4847 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 protein_id gnl|my_center|LOCUS_10170 5394 5122 gene locus_tag LOCUS_10180 5394 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 5448 7013 gene locus_tag LOCUS_10190 5448 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7323 7042 gene locus_tag LOCUS_10200 gene yafQ 7323 7042 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 protein_id gnl|my_center|LOCUS_10200 7589 7317 gene locus_tag LOCUS_10210 7589 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7643 9070 gene locus_tag LOCUS_10220 7643 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11568 10081 gene locus_tag LOCUS_10230 11568 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 12745 12497 gene locus_tag LOCUS_10240 12745 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14191 13082 gene locus_tag LOCUS_10250 14191 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 <15523 14188 gene locus_tag LOCUS_10260 <15523 14188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001045361.1:N-6 DNA methylase >Feature sequence047 <1 823 gene locus_tag LOCUS_10270 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929656.1:TIM44-like domain-containing protein 970 2433 gene locus_tag LOCUS_10280 970 2433 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_10280 2451 3806 gene locus_tag LOCUS_10290 gene glmU 2451 3806 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215550.1 protein_id gnl|my_center|LOCUS_10290 3820 5646 gene locus_tag LOCUS_10300 gene glmS 3820 5646 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_10300 6360 5713 gene locus_tag LOCUS_10310 6360 5713 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388412.1 protein_id gnl|my_center|LOCUS_10310 7159 6515 gene locus_tag LOCUS_10320 gene nalC 7159 6515 CDS product efflux system transcriptional repressor NalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113837.1 protein_id gnl|my_center|LOCUS_10320 7320 8201 gene locus_tag LOCUS_10330 7320 8201 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 protein_id gnl|my_center|LOCUS_10330 8237 9091 gene locus_tag LOCUS_10340 gene menB 8237 9091 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_10340 9105 10436 gene locus_tag LOCUS_10350 9105 10436 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387679.1 protein_id gnl|my_center|LOCUS_10350 11940 10495 gene locus_tag LOCUS_10360 11940 10495 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_10360 13398 12046 gene locus_tag LOCUS_10370 13398 12046 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194633.1 protein_id gnl|my_center|LOCUS_10370 14054 13398 gene locus_tag LOCUS_10380 14054 13398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_10380 14192 14626 gene locus_tag LOCUS_10390 14192 14626 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence048 8 1813 gene locus_tag LOCUS_10400 8 1813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703251.1 protein_id gnl|my_center|LOCUS_10400 3161 1893 gene locus_tag LOCUS_10410 3161 1893 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 protein_id gnl|my_center|LOCUS_10410 4437 3172 gene locus_tag LOCUS_10420 gene dcuC 4437 3172 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 protein_id gnl|my_center|LOCUS_10420 4540 5463 gene locus_tag LOCUS_10430 4540 5463 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705963.1 protein_id gnl|my_center|LOCUS_10430 5453 6373 gene locus_tag LOCUS_10440 5453 6373 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705681.1 protein_id gnl|my_center|LOCUS_10440 8397 6883 gene locus_tag LOCUS_10450 8397 6883 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_10450 11897 8394 gene locus_tag LOCUS_10460 11897 8394 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_10460 13084 11909 gene locus_tag LOCUS_10470 13084 11909 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_10470 13392 14012 gene locus_tag LOCUS_10480 13392 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence049 192 2261 gene locus_tag LOCUS_10490 192 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3805 2309 gene locus_tag LOCUS_10500 3805 2309 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049572.1 protein_id gnl|my_center|LOCUS_10500 3695 3994 gene locus_tag LOCUS_10510 3695 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4589 4053 gene locus_tag LOCUS_10520 4589 4053 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070826.1 protein_id gnl|my_center|LOCUS_10520 4773 4630 gene locus_tag LOCUS_10530 4773 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4725 4734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4907 5347 gene locus_tag LOCUS_10540 4907 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5441 5719 gene locus_tag LOCUS_10550 5441 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5742 9188 gene locus_tag LOCUS_10560 5742 9188 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 protein_id gnl|my_center|LOCUS_10560 9825 9193 gene locus_tag LOCUS_10570 9825 9193 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_10570 10781 9846 gene locus_tag LOCUS_10580 10781 9846 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_10580 11722 10778 gene locus_tag LOCUS_10590 11722 10778 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_10590 12252 11725 gene locus_tag LOCUS_10600 12252 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 13185 12508 gene locus_tag LOCUS_10610 13185 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14483 13167 gene locus_tag LOCUS_10620 14483 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14951 14745 gene locus_tag LOCUS_10630 14951 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15201 15285 gene locus_tag LOCUS_t00230 15201 15285 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 <1 2229 gene locus_tag LOCUS_10640 <1 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040317.1:pertactin autotransporter 3380 2280 gene locus_tag LOCUS_10650 gene add 3380 2280 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966287.1 protein_id gnl|my_center|LOCUS_10650 3588 4958 gene locus_tag LOCUS_10660 gene dcuC 3588 4958 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360057.1 protein_id gnl|my_center|LOCUS_10660 5100 5486 gene locus_tag LOCUS_10670 5100 5486 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016571.1 protein_id gnl|my_center|LOCUS_10670 6709 5483 gene locus_tag LOCUS_10680 6709 5483 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536360.1 protein_id gnl|my_center|LOCUS_10680 8120 6720 gene locus_tag LOCUS_10690 8120 6720 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_10690 8251 8595 gene locus_tag LOCUS_10700 8251 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9770 8586 gene locus_tag LOCUS_10710 9770 8586 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 protein_id gnl|my_center|LOCUS_10710 11301 10027 gene locus_tag LOCUS_10720 gene dcuC 11301 10027 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 protein_id gnl|my_center|LOCUS_10720 11498 13159 gene locus_tag LOCUS_10730 gene rmuC 11498 13159 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_10730 13574 13248 gene locus_tag LOCUS_10740 13574 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 14948 13605 gene locus_tag LOCUS_10750 14948 13605 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707340.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence051 686 60 gene locus_tag LOCUS_10760 gene narJ 686 60 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 protein_id gnl|my_center|LOCUS_10760 858 2153 gene locus_tag LOCUS_10770 858 2153 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_10770 2199 5960 gene locus_tag LOCUS_10780 2199 5960 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 protein_id gnl|my_center|LOCUS_10780 5957 7561 gene locus_tag LOCUS_10790 gene narH 5957 7561 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_10790 7561 8274 gene locus_tag LOCUS_10800 gene narI 7561 8274 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528383.1 protein_id gnl|my_center|LOCUS_10800 8802 10139 gene locus_tag LOCUS_10810 8802 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10246 11151 gene locus_tag LOCUS_10820 10246 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12396 11308 gene locus_tag LOCUS_10830 12396 11308 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_10830 12862 12377 gene locus_tag LOCUS_10840 12862 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 14961 13864 gene locus_tag LOCUS_10850 14961 13864 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence052 96 2231 gene locus_tag LOCUS_10860 96 2231 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_10860 2256 2759 gene locus_tag LOCUS_10870 2256 2759 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_10870 2616 2625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2772 4028 gene locus_tag LOCUS_10880 gene porA 2772 4028 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_10880 4032 5093 gene locus_tag LOCUS_10890 4032 5093 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 protein_id gnl|my_center|LOCUS_10890 5106 6734 gene locus_tag LOCUS_10900 5106 6734 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_10900 7476 6856 gene locus_tag LOCUS_10910 7476 6856 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941463.1 protein_id gnl|my_center|LOCUS_10910 8372 7473 gene locus_tag LOCUS_10920 gene rarD 8372 7473 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_10920 11408 8385 gene locus_tag LOCUS_10930 11408 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 12736 11510 gene locus_tag LOCUS_10940 12736 11510 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812214.1 protein_id gnl|my_center|LOCUS_10940 14566 12917 gene locus_tag LOCUS_10950 14566 12917 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence053 <1 847 gene locus_tag LOCUS_10960 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009938417.1:site-specific integrase 1111 887 gene locus_tag LOCUS_10970 1111 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1419 1108 gene locus_tag LOCUS_10980 1419 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1597 1397 gene locus_tag LOCUS_10990 1597 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2079 1600 gene locus_tag LOCUS_11000 2079 1600 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109521.1 protein_id gnl|my_center|LOCUS_11000 2594 2208 gene locus_tag LOCUS_11010 2594 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3282 2878 gene locus_tag LOCUS_11020 3282 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3945 3346 gene locus_tag LOCUS_11030 3945 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4695 3958 gene locus_tag LOCUS_11040 4695 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5554 5132 gene locus_tag LOCUS_11050 5554 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5869 5615 gene locus_tag LOCUS_11060 5869 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6285 5875 gene locus_tag LOCUS_11070 6285 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6689 6339 gene locus_tag LOCUS_11080 6689 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7522 6686 gene locus_tag LOCUS_11090 gene recT 7522 6686 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166313.1 protein_id gnl|my_center|LOCUS_11090 8808 7777 gene locus_tag LOCUS_11100 8808 7777 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_11100 9032 8805 gene locus_tag LOCUS_11110 9032 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 9256 9023 gene locus_tag LOCUS_11120 9256 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9390 9247 gene locus_tag LOCUS_11130 9390 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10369 9479 gene locus_tag LOCUS_11140 10369 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10976 10683 gene locus_tag LOCUS_11150 10976 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11275 11520 gene locus_tag LOCUS_11160 11275 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 11785 11489 gene locus_tag LOCUS_11170 11785 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 12035 11808 gene locus_tag LOCUS_11180 12035 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 12523 12305 gene locus_tag LOCUS_11190 12523 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 12914 12501 gene locus_tag LOCUS_11200 12914 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 13116 12922 gene locus_tag LOCUS_11210 13116 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 13205 13513 gene locus_tag LOCUS_11220 13205 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence054 297 707 gene locus_tag LOCUS_11230 297 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1818 916 gene locus_tag LOCUS_11240 1818 916 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_11240 1987 2508 gene locus_tag LOCUS_11250 1987 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3763 2615 gene locus_tag LOCUS_11260 3763 2615 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_11260 4718 3801 gene locus_tag LOCUS_11270 4718 3801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_11270 5803 4715 gene locus_tag LOCUS_11280 5803 4715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112631.1 protein_id gnl|my_center|LOCUS_11280 7221 5803 gene locus_tag LOCUS_11290 7221 5803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967791.1 protein_id gnl|my_center|LOCUS_11290 8919 7423 gene locus_tag LOCUS_11300 8919 7423 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_11300 9015 9527 gene locus_tag LOCUS_11310 9015 9527 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_11310 10951 9482 gene locus_tag LOCUS_11320 10951 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 12160 12378 gene locus_tag LOCUS_11330 12160 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 12560 13606 gene locus_tag LOCUS_11340 12560 13606 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448266.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence055 410 952 gene locus_tag LOCUS_11350 410 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1037 1648 gene locus_tag LOCUS_11360 gene dsbA 1037 1648 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_11360 1802 2653 gene locus_tag LOCUS_11370 1802 2653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_11370 4774 3143 gene locus_tag LOCUS_11380 gene recQ 4774 3143 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_11380 4936 5436 gene locus_tag LOCUS_11390 4936 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6693 5509 gene locus_tag LOCUS_11400 gene sstT 6693 5509 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458382.1 protein_id gnl|my_center|LOCUS_11400 6859 8103 gene locus_tag LOCUS_11410 6859 8103 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_11410 8145 8684 gene locus_tag LOCUS_11420 8145 8684 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204048.1 protein_id gnl|my_center|LOCUS_11420 8811 9659 gene locus_tag LOCUS_11430 8811 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10033 10236 gene locus_tag LOCUS_11440 10033 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10236 11795 gene locus_tag LOCUS_11450 gene cydA 10236 11795 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 protein_id gnl|my_center|LOCUS_11450 11808 12950 gene locus_tag LOCUS_11460 gene cydB 11808 12950 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_11460 13109 13363 gene locus_tag LOCUS_11470 13109 13363 CDS product cyd operon YbgE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence056 502 1329 gene locus_tag LOCUS_11480 gene atpB 502 1329 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815364.1 protein_id gnl|my_center|LOCUS_11480 1381 1623 gene locus_tag LOCUS_11490 gene atpE 1381 1623 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_11490 1694 2164 gene locus_tag LOCUS_11500 1694 2164 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931385.1 protein_id gnl|my_center|LOCUS_11500 2167 2715 gene locus_tag LOCUS_11510 2167 2715 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815348.1 protein_id gnl|my_center|LOCUS_11510 2734 4275 gene locus_tag LOCUS_11520 gene atpA 2734 4275 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_11520 4373 5170 gene locus_tag LOCUS_11530 gene atpG 4373 5170 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817813.1 protein_id gnl|my_center|LOCUS_11530 5200 6603 gene locus_tag LOCUS_11540 gene atpD 5200 6603 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_11540 6648 7061 gene locus_tag LOCUS_11550 6648 7061 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_11550 7171 7539 gene locus_tag LOCUS_11560 7171 7539 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 protein_id gnl|my_center|LOCUS_11560 7783 8718 gene locus_tag LOCUS_11570 gene hemE 7783 8718 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815337.1 protein_id gnl|my_center|LOCUS_11570 8919 10871 gene locus_tag LOCUS_11580 8919 10871 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 protein_id gnl|my_center|LOCUS_11580 10873 12126 gene locus_tag LOCUS_11590 10873 12126 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_11590 12216 12140 gene locus_tag LOCUS_t00240 12216 12140 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12347 12757 gene locus_tag LOCUS_11600 12347 12757 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_11600 12759 13523 gene locus_tag LOCUS_11610 gene ubiE 12759 13523 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence057 2017 1145 gene locus_tag LOCUS_11620 gene accD 2017 1145 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_11620 2895 2116 gene locus_tag LOCUS_11630 gene truA 2895 2116 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_11630 4032 2902 gene locus_tag LOCUS_11640 gene asd 4032 2902 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_11640 5139 4069 gene locus_tag LOCUS_11650 gene leuB 5139 4069 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187693.1 protein_id gnl|my_center|LOCUS_11650 5812 5165 gene locus_tag LOCUS_11660 gene leuD 5812 5165 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_11660 7260 5824 gene locus_tag LOCUS_11670 gene leuC 7260 5824 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951104.1 protein_id gnl|my_center|LOCUS_11670 7652 9085 gene locus_tag LOCUS_11680 7652 9085 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_11680 10204 9131 gene locus_tag LOCUS_11690 gene aroC 10204 9131 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820487.1 protein_id gnl|my_center|LOCUS_11690 10304 10834 gene locus_tag LOCUS_11700 10304 10834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083294.1 protein_id gnl|my_center|LOCUS_11700 10859 11167 gene locus_tag LOCUS_11710 10859 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 12784 11234 gene locus_tag LOCUS_11720 gene murJ 12784 11234 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931127.1 protein_id gnl|my_center|LOCUS_11720 13042 13305 gene locus_tag LOCUS_11730 gene rpsT 13042 13305 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812908.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence058 509 1942 gene locus_tag LOCUS_11740 gene aspA 509 1942 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217520.1 protein_id gnl|my_center|LOCUS_11740 2983 2018 gene locus_tag LOCUS_11750 2983 2018 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 protein_id gnl|my_center|LOCUS_11750 3177 4136 gene locus_tag LOCUS_11760 gene speB 3177 4136 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_11760 5049 4186 gene locus_tag LOCUS_11770 5049 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6282 5308 gene locus_tag LOCUS_11780 6282 5308 CDS product IS5-like element ISVch5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019370.1 protein_id gnl|my_center|LOCUS_11780 6616 7593 gene locus_tag LOCUS_11790 6616 7593 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_11790 7680 9869 gene locus_tag LOCUS_11800 7680 9869 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_11800 10945 9998 gene locus_tag LOCUS_11810 10945 9998 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209238565.1 protein_id gnl|my_center|LOCUS_11810 11076 11927 gene locus_tag LOCUS_11820 11076 11927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 protein_id gnl|my_center|LOCUS_11820 13154 12012 gene locus_tag LOCUS_11830 13154 12012 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence059 2 1516 gene locus_tag LOCUS_11840 gene bcsG 2 1516 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099223.1 protein_id gnl|my_center|LOCUS_11840 1645 2898 gene locus_tag LOCUS_11850 gene murA 1645 2898 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_11850 2895 3536 gene locus_tag LOCUS_11860 gene hisG 2895 3536 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_11860 3533 4843 gene locus_tag LOCUS_11870 gene hisD 3533 4843 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220532.1 protein_id gnl|my_center|LOCUS_11870 4854 5444 gene locus_tag LOCUS_11880 gene hisB 4854 5444 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_11880 5441 6076 gene locus_tag LOCUS_11890 gene hisH 5441 6076 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_11890 6089 6862 gene locus_tag LOCUS_11900 gene hisA 6089 6862 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_11900 6867 7628 gene locus_tag LOCUS_11910 gene hisF 6867 7628 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_11910 7643 8029 gene locus_tag LOCUS_11920 gene hisI 7643 8029 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687532.1 protein_id gnl|my_center|LOCUS_11920 8041 8367 gene locus_tag LOCUS_11930 8041 8367 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_11930 8459 8803 gene locus_tag LOCUS_11940 8459 8803 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_11940 8813 9052 gene locus_tag LOCUS_11950 8813 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 9074 9856 gene locus_tag LOCUS_11960 9074 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 9860 10651 gene locus_tag LOCUS_11970 gene tatC 9860 10651 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_11970 11374 10727 gene locus_tag LOCUS_11980 11374 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 11909 11580 gene locus_tag LOCUS_11990 11909 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11990 12622 11912 gene locus_tag LOCUS_12000 12622 11912 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454365.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence060 162 500 gene locus_tag LOCUS_12010 162 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12010 3273 973 gene locus_tag LOCUS_12020 3273 973 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_12020 3584 3384 gene locus_tag LOCUS_12030 gene rpoZ 3584 3384 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_12030 4247 3603 gene locus_tag LOCUS_12040 gene gmk 4247 3603 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_12040 5247 4279 gene locus_tag LOCUS_12050 gene tal 5247 4279 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_12050 5415 5906 gene locus_tag LOCUS_12060 5415 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6338 7528 gene locus_tag LOCUS_12070 gene carA 6338 7528 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071374.1 protein_id gnl|my_center|LOCUS_12070 7525 8127 gene locus_tag LOCUS_12080 gene lpcA 7525 8127 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705469.1 protein_id gnl|my_center|LOCUS_12080 8134 11358 gene locus_tag LOCUS_12090 gene carB 8134 11358 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193866.1 protein_id gnl|my_center|LOCUS_12090 11413 12417 gene locus_tag LOCUS_12100 11413 12417 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267886.1 protein_id gnl|my_center|LOCUS_12100 12562 13035 gene locus_tag LOCUS_12110 gene greA 12562 13035 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence061 2292 493 gene locus_tag LOCUS_12120 2292 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2762 2337 gene locus_tag LOCUS_12130 2762 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3902 2898 gene locus_tag LOCUS_12140 3902 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4125 3892 gene locus_tag LOCUS_12150 4125 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5468 4458 gene locus_tag LOCUS_12160 5468 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6490 5498 gene locus_tag LOCUS_12170 6490 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7825 6773 gene locus_tag LOCUS_12180 7825 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8262 7990 gene locus_tag LOCUS_12190 8262 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9557 8259 gene locus_tag LOCUS_12200 gene virB11 9557 8259 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264003.1 protein_id gnl|my_center|LOCUS_12200 10963 9578 gene locus_tag LOCUS_12210 10963 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 11570 10974 gene locus_tag LOCUS_12220 11570 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 11953 11567 gene locus_tag LOCUS_12230 11953 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 12901 11972 gene locus_tag LOCUS_12240 12901 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence062 <1 654 gene locus_tag LOCUS_12250 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040233.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 733 832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 953 1029 gene locus_tag LOCUS_t00250 953 1029 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1983 1078 gene locus_tag LOCUS_12260 1983 1078 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_12260 1530 1539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2416 1985 gene locus_tag LOCUS_12270 2416 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3683 2430 gene locus_tag LOCUS_12280 3683 2430 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_12280 3768 4058 gene locus_tag LOCUS_12290 3768 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4224 6149 gene locus_tag LOCUS_12300 gene thrS 4224 6149 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_12300 6223 6687 gene locus_tag LOCUS_12310 gene infC 6223 6687 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189469.1 protein_id gnl|my_center|LOCUS_12310 6827 7024 gene locus_tag LOCUS_12320 gene rpmI 6827 7024 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 protein_id gnl|my_center|LOCUS_12320 7043 7399 gene locus_tag LOCUS_12330 gene rplT 7043 7399 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_12330 7527 8543 gene locus_tag LOCUS_12340 gene pheS 7527 8543 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_12340 8561 10972 gene locus_tag LOCUS_12350 gene pheT 8561 10972 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_12350 10982 11338 gene locus_tag LOCUS_12360 10982 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 11345 11770 gene locus_tag LOCUS_12370 11345 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 11802 11878 gene locus_tag LOCUS_t00260 11802 11878 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 218 1516 gene locus_tag LOCUS_12380 gene odhB 218 1516 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521670.1 protein_id gnl|my_center|LOCUS_12380 1527 2960 gene locus_tag LOCUS_12390 gene lpdA 1527 2960 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065168.1 protein_id gnl|my_center|LOCUS_12390 3040 3807 gene locus_tag LOCUS_12400 3040 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3871 5868 gene locus_tag LOCUS_12410 3871 5868 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_12410 6736 5936 gene locus_tag LOCUS_12420 6736 5936 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870429.1 protein_id gnl|my_center|LOCUS_12420 7395 6838 gene locus_tag LOCUS_12430 7395 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8169 7405 gene locus_tag LOCUS_12440 8169 7405 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 protein_id gnl|my_center|LOCUS_12440 8228 9457 gene locus_tag LOCUS_12450 8228 9457 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_12450 9469 10242 gene locus_tag LOCUS_12460 gene pgeF 9469 10242 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_12460 10217 10801 gene locus_tag LOCUS_12470 10217 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10794 11132 gene locus_tag LOCUS_12480 10794 11132 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073001.1 protein_id gnl|my_center|LOCUS_12480 11137 12477 gene locus_tag LOCUS_12490 gene rimO 11137 12477 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence064 1111 59 gene locus_tag LOCUS_12500 1111 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1388 3688 gene locus_tag LOCUS_12510 1388 3688 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_12510 3830 4042 gene locus_tag LOCUS_12520 3830 4042 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853198.1 protein_id gnl|my_center|LOCUS_12520 7209 4108 gene locus_tag LOCUS_12530 7209 4108 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192715.1 protein_id gnl|my_center|LOCUS_12530 8011 9015 gene locus_tag LOCUS_12540 8011 9015 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_12540 9053 9706 gene locus_tag LOCUS_12550 9053 9706 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_12550 10415 9684 gene locus_tag LOCUS_12560 10415 9684 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_12560 11011 10415 gene locus_tag LOCUS_12570 11011 10415 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 protein_id gnl|my_center|LOCUS_12570 11092 11616 gene locus_tag LOCUS_12580 11092 11616 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193919.1 protein_id gnl|my_center|LOCUS_12580 11710 11898 gene locus_tag LOCUS_12590 gene rpmF 11710 11898 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence065 1618 821 gene locus_tag LOCUS_12600 1618 821 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_12600 1865 2929 gene locus_tag LOCUS_12610 1865 2929 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_12610 2926 3690 gene locus_tag LOCUS_12620 2926 3690 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_12620 3693 4688 gene locus_tag LOCUS_12630 3693 4688 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_12630 4697 5302 gene locus_tag LOCUS_12640 4697 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5403 6233 gene locus_tag LOCUS_12650 5403 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 6997 6353 gene locus_tag LOCUS_12660 gene rsmG 6997 6353 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_12660 7956 7000 gene locus_tag LOCUS_12670 7956 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12670 8912 8010 gene locus_tag LOCUS_12680 8912 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12680 8056 8065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9955 8936 gene locus_tag LOCUS_12690 9955 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 10342 10632 gene locus_tag LOCUS_12700 10342 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 12390 10693 gene locus_tag LOCUS_12710 gene yidC 12390 10693 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence066 <1 1100 gene locus_tag LOCUS_12720 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940071.1:GTP-binding protein 1091 1696 gene locus_tag LOCUS_12730 1091 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1733 2146 gene locus_tag LOCUS_12740 1733 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2257 2670 gene locus_tag LOCUS_12750 2257 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4071 2872 gene locus_tag LOCUS_12760 4071 2872 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064312.1 protein_id gnl|my_center|LOCUS_12760 5148 4135 gene locus_tag LOCUS_12770 gene gap 5148 4135 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522067.1 protein_id gnl|my_center|LOCUS_12770 7142 5151 gene locus_tag LOCUS_12780 gene tkt 7142 5151 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244175.1 protein_id gnl|my_center|LOCUS_12780 7350 8060 gene locus_tag LOCUS_12790 7350 8060 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_12790 8987 8073 gene locus_tag LOCUS_12800 8987 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9109 9801 gene locus_tag LOCUS_12810 9109 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 10799 9798 gene locus_tag LOCUS_12820 10799 9798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461767.1 protein_id gnl|my_center|LOCUS_12820 11169 12284 gene locus_tag LOCUS_12830 11169 12284 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence067 1479 247 gene locus_tag LOCUS_12840 gene gltS 1479 247 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_12840 2371 1742 gene locus_tag LOCUS_12850 2371 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4257 2614 gene locus_tag LOCUS_12860 4257 2614 CDS product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602238.1 protein_id gnl|my_center|LOCUS_12860 6120 4357 gene locus_tag LOCUS_12870 gene urdA 6120 4357 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_12870 7461 6265 gene locus_tag LOCUS_12880 7461 6265 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728727.1 protein_id gnl|my_center|LOCUS_12880 8486 7719 gene locus_tag LOCUS_12890 8486 7719 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987153.1 protein_id gnl|my_center|LOCUS_12890 8705 9181 gene locus_tag LOCUS_12900 8705 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10539 9226 gene locus_tag LOCUS_12910 10539 9226 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 protein_id gnl|my_center|LOCUS_12910 10864 11868 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcttacgcggggaactc 12122 12032 gene locus_tag LOCUS_t00270 12122 12032 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 574 861 gene locus_tag LOCUS_12920 574 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1790 936 gene locus_tag LOCUS_12930 1790 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2377 1802 gene locus_tag LOCUS_12940 2377 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2644 3111 gene locus_tag LOCUS_12950 2644 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3143 3412 gene locus_tag LOCUS_12960 3143 3412 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_12960 4989 3550 gene locus_tag LOCUS_12970 gene aspA 4989 3550 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 protein_id gnl|my_center|LOCUS_12970 5970 5494 gene locus_tag LOCUS_12980 5970 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7013 6030 gene locus_tag LOCUS_12990 7013 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 9868 7034 gene locus_tag LOCUS_13000 9868 7034 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191922.1 protein_id gnl|my_center|LOCUS_13000 10031 10040 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10154 11251 gene locus_tag LOCUS_13010 gene ansZ 10154 11251 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence069 563 93 gene locus_tag LOCUS_13020 gene trmL 563 93 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 protein_id gnl|my_center|LOCUS_13020 1476 556 gene locus_tag LOCUS_13030 gene rpoH 1476 556 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 protein_id gnl|my_center|LOCUS_13030 2361 1507 gene locus_tag LOCUS_13040 2361 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2993 2358 gene locus_tag LOCUS_13050 2993 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4471 3008 gene locus_tag LOCUS_13060 gene ppx 4471 3008 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930172.1 protein_id gnl|my_center|LOCUS_13060 5415 4468 gene locus_tag LOCUS_13070 5415 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5466 6050 gene locus_tag LOCUS_13080 gene rsmD 5466 6050 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_13080 6047 6544 gene locus_tag LOCUS_13090 gene coaD 6047 6544 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_13090 6947 6525 gene locus_tag LOCUS_13100 6947 6525 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_13100 10852 6944 gene locus_tag LOCUS_13110 10852 6944 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence070 292 948 gene locus_tag LOCUS_13120 292 948 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 protein_id gnl|my_center|LOCUS_13120 1111 2934 gene locus_tag LOCUS_13130 1111 2934 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 protein_id gnl|my_center|LOCUS_13130 2927 3553 gene locus_tag LOCUS_13140 2927 3553 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073853.1 protein_id gnl|my_center|LOCUS_13140 3550 5082 gene locus_tag LOCUS_13150 3550 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5135 5854 gene locus_tag LOCUS_13160 gene ispD 5135 5854 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_13160 5847 6338 gene locus_tag LOCUS_13170 gene ispF 5847 6338 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_13170 7750 6335 gene locus_tag LOCUS_13180 7750 6335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 protein_id gnl|my_center|LOCUS_13180 8557 7775 gene locus_tag LOCUS_13190 gene ompR 8557 7775 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_13190 8698 9372 gene locus_tag LOCUS_13200 8698 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 9414 10121 gene locus_tag LOCUS_13210 9414 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13210 10129 10581 gene locus_tag LOCUS_13220 gene rimI 10129 10581 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_13220 10585 11550 gene locus_tag LOCUS_13230 10585 11550 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452148.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence071 191 961 gene locus_tag LOCUS_13240 191 961 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978288.1 protein_id gnl|my_center|LOCUS_13240 963 1475 gene locus_tag LOCUS_13250 963 1475 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477487.1 protein_id gnl|my_center|LOCUS_13250 1797 1522 gene locus_tag LOCUS_13260 1797 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2160 2169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2419 5439 gene locus_tag LOCUS_13270 2419 5439 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_13270 3845 3854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5439 5846 gene locus_tag LOCUS_13280 gene mutT 5439 5846 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_13280 6782 5946 gene locus_tag LOCUS_13290 6782 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7936 7034 gene locus_tag LOCUS_13300 7936 7034 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527624.1 protein_id gnl|my_center|LOCUS_13300 8139 9710 gene locus_tag LOCUS_13310 8139 9710 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814032.1 protein_id gnl|my_center|LOCUS_13310 9857 10117 gene locus_tag LOCUS_13320 9857 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10570 10334 gene locus_tag LOCUS_13330 10570 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 protein_id gnl|my_center|LOCUS_13330 10693 11256 gene locus_tag LOCUS_13340 10693 11256 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121269.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence072 251 30 gene locus_tag LOCUS_13350 251 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 608 258 gene locus_tag LOCUS_13360 608 258 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_13360 978 1511 gene locus_tag LOCUS_13370 978 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1537 1815 gene locus_tag LOCUS_13380 gene ptlA 1537 1815 CDS product type IV secretion system protein PtlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064782.1 protein_id gnl|my_center|LOCUS_13380 1816 2142 gene locus_tag LOCUS_13390 1816 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2146 4611 gene locus_tag LOCUS_13400 2146 4611 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263998.1 protein_id gnl|my_center|LOCUS_13400 4608 4982 gene locus_tag LOCUS_13410 4608 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5563 4943 gene locus_tag LOCUS_13420 5563 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5859 6587 gene locus_tag LOCUS_13430 gene virB5 5859 6587 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264014.1 protein_id gnl|my_center|LOCUS_13430 6600 8288 gene locus_tag LOCUS_13440 6600 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8597 8307 gene locus_tag LOCUS_13450 8597 8307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_13450 8955 8581 gene locus_tag LOCUS_13460 8955 8581 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_13460 9027 9269 gene locus_tag LOCUS_13470 9027 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9628 9275 gene locus_tag LOCUS_13480 gene chpB 9628 9275 CDS product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239579.1 protein_id gnl|my_center|LOCUS_13480 9900 9625 gene locus_tag LOCUS_13490 9900 9625 CDS product MazE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042074.1 protein_id gnl|my_center|LOCUS_13490 9958 10707 gene locus_tag LOCUS_13500 gene ptlE 9958 10707 CDS product type IV secretion system peptidoglycanase PtlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929498.1 protein_id gnl|my_center|LOCUS_13500 10704 11240 gene locus_tag LOCUS_13510 10704 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence073 238 1194 gene locus_tag LOCUS_13520 238 1194 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_13520 1280 1834 gene locus_tag LOCUS_13530 1280 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1889 2452 gene locus_tag LOCUS_13540 1889 2452 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814161.1 protein_id gnl|my_center|LOCUS_13540 2684 3742 gene locus_tag LOCUS_13550 2684 3742 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534868.1 protein_id gnl|my_center|LOCUS_13550 3748 4245 gene locus_tag LOCUS_13560 3748 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4262 6262 gene locus_tag LOCUS_13570 4262 6262 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_13570 6322 7125 gene locus_tag LOCUS_13580 6322 7125 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191360.1 protein_id gnl|my_center|LOCUS_13580 7402 7692 gene locus_tag LOCUS_13590 7402 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 7731 9797 gene locus_tag LOCUS_13600 gene dmsA 7731 9797 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 9808 10413 gene locus_tag LOCUS_13610 gene dmsB 9808 10413 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence074 133 549 gene locus_tag LOCUS_13620 133 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 561 929 gene locus_tag LOCUS_13630 561 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 935 2146 gene locus_tag LOCUS_13640 935 2146 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197093.1 protein_id gnl|my_center|LOCUS_13640 2317 2778 gene locus_tag LOCUS_13650 2317 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2781 3830 gene locus_tag LOCUS_13660 2781 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3839 4861 gene locus_tag LOCUS_13670 3839 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4865 5470 gene locus_tag LOCUS_13680 4865 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5841 6206 gene locus_tag LOCUS_13690 5841 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6653 7009 gene locus_tag LOCUS_13700 6653 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7441 7815 gene locus_tag LOCUS_13710 7441 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7837 8196 gene locus_tag LOCUS_13720 7837 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8287 8625 gene locus_tag LOCUS_13730 8287 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8615 8917 gene locus_tag LOCUS_13740 8615 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8914 9201 gene locus_tag LOCUS_13750 8914 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9328 9137 gene locus_tag LOCUS_13760 9328 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 9345 9809 gene locus_tag LOCUS_13770 9345 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9728 10270 gene locus_tag LOCUS_13780 9728 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 10273 10644 gene locus_tag LOCUS_13790 10273 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence075 625 293 gene locus_tag LOCUS_13800 625 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1175 861 gene locus_tag LOCUS_13810 1175 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1822 1205 gene locus_tag LOCUS_13820 1822 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1213 1222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3572 2070 gene locus_tag LOCUS_13830 gene argH 3572 2070 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_13830 4231 5343 gene locus_tag LOCUS_13840 4231 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6097 5390 gene locus_tag LOCUS_13850 6097 5390 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455823.1 protein_id gnl|my_center|LOCUS_13850 6624 7985 gene locus_tag LOCUS_13860 6624 7985 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195435952.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13860 7909 8232 gene locus_tag LOCUS_13870 7909 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7951 7960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8480 9598 gene locus_tag LOCUS_13880 8480 9598 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_13880 9731 10093 gene locus_tag LOCUS_13890 9731 10093 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence076 70 534 gene locus_tag LOCUS_13900 70 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13900 423 1205 gene locus_tag LOCUS_13910 423 1205 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_13910 1315 2394 gene locus_tag LOCUS_13920 1315 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2486 3772 gene locus_tag LOCUS_13930 2486 3772 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_13930 5045 3837 gene locus_tag LOCUS_13940 5045 3837 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 protein_id gnl|my_center|LOCUS_13940 5517 6692 gene locus_tag LOCUS_13950 5517 6692 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860897.1 protein_id gnl|my_center|LOCUS_13950 6721 8331 gene locus_tag LOCUS_13960 6721 8331 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_13960 8663 8415 gene locus_tag LOCUS_13970 8663 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 8828 10426 gene locus_tag LOCUS_13980 8828 10426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence077 <1 1278 gene locus_tag LOCUS_13990 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084144.1:aspartate ammonia-lyase 1963 1364 gene locus_tag LOCUS_14000 1963 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2382 1960 gene locus_tag LOCUS_14010 2382 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2442 3683 gene locus_tag LOCUS_14020 2442 3683 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 protein_id gnl|my_center|LOCUS_14020 3749 5257 gene locus_tag LOCUS_14030 3749 5257 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_14030 6270 5287 gene locus_tag LOCUS_14040 6270 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6747 6274 gene locus_tag LOCUS_14050 6747 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 7001 7429 gene locus_tag LOCUS_14060 7001 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 7827 7450 gene locus_tag LOCUS_14070 7827 7450 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_14070 8440 7961 gene locus_tag LOCUS_14080 8440 7961 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 protein_id gnl|my_center|LOCUS_14080 9654 8437 gene locus_tag LOCUS_14090 9654 8437 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419961.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence078 646 359 gene locus_tag LOCUS_14100 gene gatC 646 359 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 protein_id gnl|my_center|LOCUS_14100 825 1871 gene locus_tag LOCUS_14110 825 1871 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_14110 1983 2804 gene locus_tag LOCUS_14120 gene mreC 1983 2804 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_14120 2801 3331 gene locus_tag LOCUS_14130 gene mreD 2801 3331 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815202.1 protein_id gnl|my_center|LOCUS_14130 3331 5328 gene locus_tag LOCUS_14140 gene mrdA 3331 5328 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_14140 5325 6488 gene locus_tag LOCUS_14150 gene rodA 5325 6488 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_14150 6516 7673 gene locus_tag LOCUS_14160 6516 7673 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_14160 7679 9091 gene locus_tag LOCUS_14170 7679 9091 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039717.1 protein_id gnl|my_center|LOCUS_14170 9096 9302 gene locus_tag LOCUS_14180 9096 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9636 9373 gene locus_tag LOCUS_14190 9636 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence079 258 267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 533 1438 gene locus_tag LOCUS_14200 533 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1524 3260 gene locus_tag LOCUS_14210 gene traD 1524 3260 CDS product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 protein_id gnl|my_center|LOCUS_14210 3262 3882 gene locus_tag LOCUS_14220 3262 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3886 4359 gene locus_tag LOCUS_14230 3886 4359 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817036.1 protein_id gnl|my_center|LOCUS_14230 4488 4820 gene locus_tag LOCUS_14240 4488 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4881 5171 gene locus_tag LOCUS_14250 4881 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5178 5774 gene locus_tag LOCUS_14260 5178 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5774 6499 gene locus_tag LOCUS_14270 5774 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6475 7704 gene locus_tag LOCUS_14280 6475 7704 CDS product TraB/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331475.1 protein_id gnl|my_center|LOCUS_14280 7714 8598 gene locus_tag LOCUS_14290 7714 8598 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214390.1 protein_id gnl|my_center|LOCUS_14290 8599 9210 gene locus_tag LOCUS_14300 8599 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence080 326 138 gene locus_tag LOCUS_14310 326 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 345 1028 gene locus_tag LOCUS_14320 345 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1021 1857 gene locus_tag LOCUS_14330 1021 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3178 1904 gene locus_tag LOCUS_14340 gene larA 3178 1904 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_14340 4511 3309 gene locus_tag LOCUS_14350 4511 3309 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_14350 5985 4504 gene locus_tag LOCUS_14360 gene argH 5985 4504 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110925521.1 protein_id gnl|my_center|LOCUS_14360 7245 6040 gene locus_tag LOCUS_14370 7245 6040 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115536571.1 protein_id gnl|my_center|LOCUS_14370 8677 7268 gene locus_tag LOCUS_14380 8677 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 9954 8680 gene locus_tag LOCUS_14390 gene dcuC 9954 8680 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704728.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence081 336 824 gene locus_tag LOCUS_14400 336 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 868 2043 gene locus_tag LOCUS_14410 868 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2036 2761 gene locus_tag LOCUS_14420 2036 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2859 3119 gene locus_tag LOCUS_14430 2859 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3112 5622 gene locus_tag LOCUS_14440 3112 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5622 5879 gene locus_tag LOCUS_14450 5622 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5984 6376 gene locus_tag LOCUS_14460 5984 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6475 7026 gene locus_tag LOCUS_14470 6475 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 7877 7362 gene locus_tag LOCUS_14480 7877 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 9860 8694 gene locus_tag LOCUS_14490 9860 8694 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552508.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence082 <1 977 gene locus_tag LOCUS_14500 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020424.1:DUF362 domain-containing protein 1206 1733 gene locus_tag LOCUS_14510 1206 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1694 1703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1783 2340 gene locus_tag LOCUS_14520 1783 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4216 2423 gene locus_tag LOCUS_14530 4216 2423 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939059.1 protein_id gnl|my_center|LOCUS_14530 6219 4234 gene locus_tag LOCUS_14540 6219 4234 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097011061.1 protein_id gnl|my_center|LOCUS_14540 6448 7356 gene locus_tag LOCUS_14550 6448 7356 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_14550 8210 7368 gene locus_tag LOCUS_14560 8210 7368 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_14560 8368 8853 gene locus_tag LOCUS_14570 8368 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 8874 9848 gene locus_tag LOCUS_14580 8874 9848 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812707.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence083 257 970 gene locus_tag LOCUS_14590 gene mtgA 257 970 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_14590 1904 1011 gene locus_tag LOCUS_14600 1904 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2076 2666 gene locus_tag LOCUS_14610 2076 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2831 3001 gene locus_tag LOCUS_14620 2831 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3866 3105 gene locus_tag LOCUS_14630 3866 3105 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_14630 4127 5662 gene locus_tag LOCUS_14640 4127 5662 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338624.1 protein_id gnl|my_center|LOCUS_14640 5540 5549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6115 5816 gene locus_tag LOCUS_14650 6115 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7089 6070 gene locus_tag LOCUS_14660 7089 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 6157 6166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7668 7946 gene locus_tag LOCUS_14670 7668 7946 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_14670 8102 8314 gene locus_tag LOCUS_14680 8102 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8631 8437 gene locus_tag LOCUS_14690 8631 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 9567 8755 gene locus_tag LOCUS_14700 9567 8755 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence084 <1 763 gene locus_tag LOCUS_14710 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813089.1:replicative DNA helicase 767 1249 gene locus_tag LOCUS_14720 767 1249 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_14720 1325 2998 gene locus_tag LOCUS_14730 1325 2998 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_14730 3149 4492 gene locus_tag LOCUS_14740 gene alaC 3149 4492 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_14740 4512 5822 gene locus_tag LOCUS_14750 4512 5822 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_14750 5822 7255 gene locus_tag LOCUS_14760 gene thrC 5822 7255 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 protein_id gnl|my_center|LOCUS_14760 7302 7829 gene locus_tag LOCUS_14770 gene mobB 7302 7829 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531704.1 protein_id gnl|my_center|LOCUS_14770 7823 9016 gene locus_tag LOCUS_14780 7823 9016 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_14780 9026 9475 gene locus_tag LOCUS_14790 gene moaE 9026 9475 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence085 1275 661 gene locus_tag LOCUS_14800 1275 661 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_14800 2270 1407 gene locus_tag LOCUS_14810 gene pdxY 2270 1407 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_14810 2807 2280 gene locus_tag LOCUS_14820 2807 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3406 2804 gene locus_tag LOCUS_14830 3406 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4067 3471 gene locus_tag LOCUS_14840 gene yhdE 4067 3471 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203107.1 protein_id gnl|my_center|LOCUS_14840 4538 4071 gene locus_tag LOCUS_14850 gene rlmH 4538 4071 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_14850 4919 4548 gene locus_tag LOCUS_14860 4919 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5102 6226 gene locus_tag LOCUS_14870 5102 6226 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_14870 6916 6263 gene locus_tag LOCUS_14880 gene nadD 6916 6263 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_14880 7647 6913 gene locus_tag LOCUS_14890 7647 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8935 7658 gene locus_tag LOCUS_14900 gene purD 8935 7658 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_14900 <9540 8971 gene locus_tag LOCUS_14910 <9540 8971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930861.1:YebC/PmpR family DNA-binding transcriptional regulator >Feature sequence086 683 3868 gene locus_tag LOCUS_14920 gene fdh 683 3868 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 protein_id gnl|my_center|LOCUS_14920 3871 4803 gene locus_tag LOCUS_14930 3871 4803 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_14930 4814 5734 gene locus_tag LOCUS_14940 4814 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5933 6268 gene locus_tag LOCUS_14950 5933 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7495 6338 gene locus_tag LOCUS_14960 7495 6338 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 protein_id gnl|my_center|LOCUS_14960 8994 7699 gene locus_tag LOCUS_14970 8994 7699 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence087 1028 393 gene locus_tag LOCUS_14980 1028 393 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206232.1 protein_id gnl|my_center|LOCUS_14980 1233 2048 gene locus_tag LOCUS_14990 1233 2048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810407.1 protein_id gnl|my_center|LOCUS_14990 2884 3147 gene locus_tag LOCUS_15000 2884 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15000 3157 3600 gene locus_tag LOCUS_15010 3157 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15010 3954 3676 gene locus_tag LOCUS_15020 3954 3676 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195781.1 protein_id gnl|my_center|LOCUS_15020 4626 4174 gene locus_tag LOCUS_15030 4626 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 6063 6242 gene locus_tag LOCUS_15040 6063 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 8892 6508 gene locus_tag LOCUS_15050 gene feoB 8892 6508 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_15050 9131 8904 gene locus_tag LOCUS_15060 9131 8904 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958429.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence088 574 900 gene locus_tag LOCUS_15070 574 900 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_15070 905 1516 gene locus_tag LOCUS_15080 gene recR 905 1516 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_15080 1863 2906 gene locus_tag LOCUS_15090 1863 2906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_15090 2979 3788 gene locus_tag LOCUS_15100 2979 3788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568207.1 protein_id gnl|my_center|LOCUS_15100 3790 4626 gene locus_tag LOCUS_15110 3790 4626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809582.1 protein_id gnl|my_center|LOCUS_15110 5050 6093 gene locus_tag LOCUS_15120 gene ansB 5050 6093 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394115.1 protein_id gnl|my_center|LOCUS_15120 6671 7183 gene locus_tag LOCUS_15130 6671 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7666 8700 gene locus_tag LOCUS_15140 7666 8700 CDS product IS110-like element ISCc4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640573.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence089 264 1028 gene locus_tag LOCUS_15150 264 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3864 1066 gene locus_tag LOCUS_15160 3864 1066 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_15160 3958 4350 gene locus_tag LOCUS_15170 3958 4350 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_15170 4422 5630 gene locus_tag LOCUS_15180 4422 5630 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169951.1 protein_id gnl|my_center|LOCUS_15180 5821 7275 gene locus_tag LOCUS_15190 5821 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7275 8195 gene locus_tag LOCUS_15200 7275 8195 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_15200 8841 8263 gene locus_tag LOCUS_15210 gene orn 8841 8263 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence090 1265 471 gene locus_tag LOCUS_15220 1265 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 protein_id gnl|my_center|LOCUS_15220 3127 1328 gene locus_tag LOCUS_15230 3127 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 <9088 3386 gene locus_tag LOCUS_15240 <9088 3386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211638.1:autotransporter adhesin YapH >Feature sequence091 2321 432 gene locus_tag LOCUS_15250 2321 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3044 2334 gene locus_tag LOCUS_15260 3044 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3567 3067 gene locus_tag LOCUS_15270 3567 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4094 3564 gene locus_tag LOCUS_15280 4094 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6637 4124 gene locus_tag LOCUS_15290 6637 4124 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263998.1 protein_id gnl|my_center|LOCUS_15290 5806 5815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6386 6395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7002 6727 gene locus_tag LOCUS_15300 7002 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7358 7065 gene locus_tag LOCUS_15310 7358 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8551 7358 gene locus_tag LOCUS_15320 8551 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence092 1706 252 gene locus_tag LOCUS_15330 1706 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3189 1726 gene locus_tag LOCUS_15340 3189 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3319 4779 gene locus_tag LOCUS_15350 gene rng 3319 4779 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813204.1 protein_id gnl|my_center|LOCUS_15350 4779 5444 gene locus_tag LOCUS_15360 4779 5444 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 protein_id gnl|my_center|LOCUS_15360 5557 5931 gene locus_tag LOCUS_15370 5557 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6536 6120 gene locus_tag LOCUS_15380 6536 6120 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706127.1 protein_id gnl|my_center|LOCUS_15380 6689 7630 gene locus_tag LOCUS_15390 6689 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7759 8001 gene locus_tag LOCUS_15400 7759 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8014 8529 gene locus_tag LOCUS_15410 8014 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 8784 8584 gene locus_tag LOCUS_15420 8784 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence093 26 784 gene locus_tag LOCUS_15430 gene btr 26 784 CDS product oxygen-responsive transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930241.1 protein_id gnl|my_center|LOCUS_15430 1067 2050 gene locus_tag LOCUS_15440 1067 2050 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931671.1 protein_id gnl|my_center|LOCUS_15440 2115 2585 gene locus_tag LOCUS_15450 2115 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2597 4105 gene locus_tag LOCUS_15460 2597 4105 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063702.1 protein_id gnl|my_center|LOCUS_15460 5556 4669 gene locus_tag LOCUS_15470 gene nrfD 5556 4669 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262125.1 protein_id gnl|my_center|LOCUS_15470 6131 5553 gene locus_tag LOCUS_15480 6131 5553 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761920.1 protein_id gnl|my_center|LOCUS_15480 8648 6135 gene locus_tag LOCUS_15490 8648 6135 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761921.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence094 1445 18 gene locus_tag LOCUS_15500 1445 18 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_15500 1628 2176 gene locus_tag LOCUS_15510 1628 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2166 2846 gene locus_tag LOCUS_15520 2166 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3119 4456 gene locus_tag LOCUS_15530 gene argG 3119 4456 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206117.1 protein_id gnl|my_center|LOCUS_15530 5450 4563 gene locus_tag LOCUS_15540 5450 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 6026 5472 gene locus_tag LOCUS_15550 6026 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5484 5493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8606 6030 gene locus_tag LOCUS_15560 8606 6030 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761921.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence095 2171 708 gene locus_tag LOCUS_15570 2171 708 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_15570 2272 2442 gene locus_tag LOCUS_15580 2272 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2844 2533 gene locus_tag LOCUS_15590 2844 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3581 4624 gene locus_tag LOCUS_15600 3581 4624 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448266.1 protein_id gnl|my_center|LOCUS_15600 4751 5911 gene locus_tag LOCUS_15610 4751 5911 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448266.1 protein_id gnl|my_center|LOCUS_15610 6037 7116 gene locus_tag LOCUS_15620 6037 7116 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931158.1 protein_id gnl|my_center|LOCUS_15620 7237 8313 gene locus_tag LOCUS_15630 7237 8313 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813945.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence096 288 1073 gene locus_tag LOCUS_15640 288 1073 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_15640 2533 1157 gene locus_tag LOCUS_15650 2533 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 3039 2530 gene locus_tag LOCUS_15660 3039 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3575 3039 gene locus_tag LOCUS_15670 3575 3039 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_15670 5543 3588 gene locus_tag LOCUS_15680 5543 3588 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_15680 5998 5552 gene locus_tag LOCUS_15690 gene ccmE 5998 5552 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_15690 6183 5995 gene locus_tag LOCUS_15700 6183 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6920 6183 gene locus_tag LOCUS_15710 gene ccmC 6920 6183 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_15710 7609 6941 gene locus_tag LOCUS_15720 gene ccmB 7609 6941 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_15720 8307 7612 gene locus_tag LOCUS_15730 gene ccmA 8307 7612 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888541.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence097 <1 581 gene locus_tag LOCUS_15740 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033447294.1:ketoacyl-ACP synthase III 599 1543 gene locus_tag LOCUS_15750 gene fabD 599 1543 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_15750 1547 2311 gene locus_tag LOCUS_15760 gene fabG 1547 2311 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_15760 2423 2662 gene locus_tag LOCUS_15770 gene acpP 2423 2662 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 protein_id gnl|my_center|LOCUS_15770 2687 3913 gene locus_tag LOCUS_15780 gene fabF 2687 3913 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028603047.1 protein_id gnl|my_center|LOCUS_15780 4190 5983 gene locus_tag LOCUS_15790 gene lepA 4190 5983 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065097.1 protein_id gnl|my_center|LOCUS_15790 6009 6899 gene locus_tag LOCUS_15800 gene lepB 6009 6899 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_15800 6911 7597 gene locus_tag LOCUS_15810 6911 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 7602 8513 gene locus_tag LOCUS_15820 gene era 7602 8513 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence098 <1 4672 gene locus_tag LOCUS_15830 <1 4672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001491890.1:autotransporter adhesin EhaA 4760 5446 gene locus_tag LOCUS_15840 4760 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5872 6021 gene locus_tag LOCUS_15850 5872 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 7648 6095 gene locus_tag LOCUS_15860 7648 6095 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816964.1 protein_id gnl|my_center|LOCUS_15860 8126 7659 gene locus_tag LOCUS_15870 8126 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence099 979 158 gene locus_tag LOCUS_15880 979 158 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_15880 2315 921 gene locus_tag LOCUS_15890 2315 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1042 1051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2995 2333 gene locus_tag LOCUS_15900 2995 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15900 3494 2997 gene locus_tag LOCUS_15910 3494 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3015 3024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3679 4824 gene locus_tag LOCUS_15920 3679 4824 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537788.1 protein_id gnl|my_center|LOCUS_15920 5331 4945 gene locus_tag LOCUS_15930 5331 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 6582 5527 gene locus_tag LOCUS_15940 6582 5527 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_15940 8340 6823 gene locus_tag LOCUS_15950 8340 6823 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence100 50 1342 gene locus_tag LOCUS_15960 50 1342 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_15960 1482 3287 gene locus_tag LOCUS_15970 1482 3287 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_15970 3274 3777 gene locus_tag LOCUS_15980 3274 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3774 4625 gene locus_tag LOCUS_15990 gene ispE 3774 4625 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_15990 4644 4719 gene locus_tag LOCUS_t00280 4644 4719 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4784 5743 gene locus_tag LOCUS_16000 4784 5743 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_16000 5799 6452 gene locus_tag LOCUS_16010 5799 6452 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_16010 6560 8320 gene locus_tag LOCUS_16020 6560 8320 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence101 3228 70 gene locus_tag LOCUS_16030 3228 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294648.1 protein_id gnl|my_center|LOCUS_16030 3481 4206 gene locus_tag LOCUS_16040 3481 4206 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_16040 5132 4299 gene locus_tag LOCUS_16050 5132 4299 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523537.1 protein_id gnl|my_center|LOCUS_16050 5447 7648 gene locus_tag LOCUS_16060 5447 7648 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943374.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence102 924 124 gene locus_tag LOCUS_16070 924 124 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870429.1 protein_id gnl|my_center|LOCUS_16070 1742 1008 gene locus_tag LOCUS_16080 1742 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1885 2121 gene locus_tag LOCUS_16090 1885 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2305 3297 gene locus_tag LOCUS_16100 2305 3297 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_16100 3501 4250 gene locus_tag LOCUS_16110 3501 4250 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 protein_id gnl|my_center|LOCUS_16110 4409 5626 gene locus_tag LOCUS_16120 4409 5626 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence103 179 361 gene locus_tag LOCUS_16130 179 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 489 1217 gene locus_tag LOCUS_16140 489 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2372 1266 gene locus_tag LOCUS_16150 2372 1266 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861648.1 protein_id gnl|my_center|LOCUS_16150 3614 2409 gene locus_tag LOCUS_16160 3614 2409 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040196.1 protein_id gnl|my_center|LOCUS_16160 4979 3693 gene locus_tag LOCUS_16170 4979 3693 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_16170 5996 4986 gene locus_tag LOCUS_16180 gene holA 5996 4986 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810253.1 protein_id gnl|my_center|LOCUS_16180 6534 5983 gene locus_tag LOCUS_16190 6534 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 <8362 6583 gene locus_tag LOCUS_16200 <8362 6583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535294.1:leucine--tRNA ligase >Feature sequence104 4524 439 gene locus_tag LOCUS_16210 4524 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4895 4644 gene locus_tag LOCUS_16220 4895 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 7198 4892 gene locus_tag LOCUS_16230 gene feoB 7198 4892 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_16230 7071 7080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7425 7198 gene locus_tag LOCUS_16240 7425 7198 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_16240 7689 7426 gene locus_tag LOCUS_16250 7689 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence105 5595 8186 gene locus_tag LOCUS_16260 5595 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence106 1140 19 gene locus_tag LOCUS_16270 1140 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2318 1173 gene locus_tag LOCUS_16280 2318 1173 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815249.1 protein_id gnl|my_center|LOCUS_16280 2770 4047 gene locus_tag LOCUS_16290 2770 4047 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 protein_id gnl|my_center|LOCUS_16290 4105 5385 gene locus_tag LOCUS_16300 gene dcuC 4105 5385 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 protein_id gnl|my_center|LOCUS_16300 6196 5477 gene locus_tag LOCUS_16310 6196 5477 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851094.1 protein_id gnl|my_center|LOCUS_16310 6367 7584 gene locus_tag LOCUS_16320 6367 7584 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence107 1673 885 gene locus_tag LOCUS_16330 1673 885 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_16330 2553 1807 gene locus_tag LOCUS_16340 2553 1807 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094423.1 protein_id gnl|my_center|LOCUS_16340 2911 3891 gene locus_tag LOCUS_16350 gene rfbB 2911 3891 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974014.1 protein_id gnl|my_center|LOCUS_16350 5947 4049 gene locus_tag LOCUS_16360 5947 4049 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_16360 6112 7014 gene locus_tag LOCUS_16370 6112 7014 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_16370 7769 7071 gene locus_tag LOCUS_16380 7769 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 7920 8261 gene locus_tag LOCUS_16390 7920 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence108 461 2530 gene locus_tag LOCUS_16400 gene traD 461 2530 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946717.1 protein_id gnl|my_center|LOCUS_16400 2889 3545 gene locus_tag LOCUS_16410 2889 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3584 4156 gene locus_tag LOCUS_16420 3584 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4081 4311 gene locus_tag LOCUS_16430 4081 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5108 4422 gene locus_tag LOCUS_16440 5108 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6041 5136 gene locus_tag LOCUS_16450 6041 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5956 5965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7054 6041 gene locus_tag LOCUS_16460 gene dcm 7054 6041 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_16460 7507 7055 gene locus_tag LOCUS_16470 7507 7055 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence109 <1 914 gene locus_tag LOCUS_16480 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192948.1:nitrous oxide reductase family maturation protein NosD 911 1618 gene locus_tag LOCUS_16490 gene napG 911 1618 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_16490 1615 2229 gene locus_tag LOCUS_16500 1615 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2233 2760 gene locus_tag LOCUS_16510 2233 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2762 3628 gene locus_tag LOCUS_16520 2762 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3636 4289 gene locus_tag LOCUS_16530 3636 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4390 4743 gene locus_tag LOCUS_16540 4390 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4772 5599 gene locus_tag LOCUS_16550 4772 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5699 7372 gene locus_tag LOCUS_16560 5699 7372 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 protein_id gnl|my_center|LOCUS_16560 7369 8025 gene locus_tag LOCUS_16570 7369 8025 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence110 3946 2447 gene locus_tag LOCUS_16580 gene nusA 3946 2447 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_16580 4551 3946 gene locus_tag LOCUS_16590 gene rimP 4551 3946 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_16590 5771 4830 gene locus_tag LOCUS_16600 5771 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6747 6139 gene locus_tag LOCUS_16610 6747 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6198 6207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <7974 6889 gene locus_tag LOCUS_16620 <7974 6889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557110.1:D-alanyl-D-alanine endopeptidase >Feature sequence111 312 902 gene locus_tag LOCUS_16630 312 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1247 1720 gene locus_tag LOCUS_16640 1247 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1714 2451 gene locus_tag LOCUS_16650 1714 2451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_16650 2466 3404 gene locus_tag LOCUS_16660 2466 3404 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434121.1 protein_id gnl|my_center|LOCUS_16660 3404 3928 gene locus_tag LOCUS_16670 3404 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4856 3888 gene locus_tag LOCUS_16680 gene lipA 4856 3888 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_16680 5216 4860 gene locus_tag LOCUS_16690 5216 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5847 5293 gene locus_tag LOCUS_16700 5847 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16700 5300 5309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6469 5831 gene locus_tag LOCUS_16710 gene lipB 6469 5831 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929623.1 protein_id gnl|my_center|LOCUS_16710 6771 6475 gene locus_tag LOCUS_16720 6771 6475 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_16720 7878 6775 gene locus_tag LOCUS_16730 7878 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence112 3224 1704 gene locus_tag LOCUS_16740 3224 1704 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_16740 3916 3278 gene locus_tag LOCUS_16750 3916 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4398 3925 gene locus_tag LOCUS_16760 4398 3925 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_16760 5463 4522 gene locus_tag LOCUS_16770 5463 4522 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_16770 6717 5623 gene locus_tag LOCUS_16780 6717 5623 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813945.1 protein_id gnl|my_center|LOCUS_16780 7066 6731 gene locus_tag LOCUS_16790 7066 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 <7725 7081 gene locus_tag LOCUS_16800 <7725 7081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073179.1:flavocytochrome c >Feature sequence113 1841 651 gene locus_tag LOCUS_16810 1841 651 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_16810 2441 2031 gene locus_tag LOCUS_16820 2441 2031 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 protein_id gnl|my_center|LOCUS_16820 2499 3134 gene locus_tag LOCUS_16830 2499 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3436 5085 gene locus_tag LOCUS_16840 3436 5085 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_16840 6463 5183 gene locus_tag LOCUS_16850 6463 5183 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_16850 7399 6467 gene locus_tag LOCUS_16860 7399 6467 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence114 701 57 gene locus_tag LOCUS_16870 701 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1385 759 gene locus_tag LOCUS_16880 1385 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2026 1400 gene locus_tag LOCUS_16890 2026 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2679 2035 gene locus_tag LOCUS_16900 2679 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3828 2692 gene locus_tag LOCUS_16910 3828 2692 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_16910 4147 3821 gene locus_tag LOCUS_16920 4147 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4539 4144 gene locus_tag LOCUS_16930 4539 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5252 4548 gene locus_tag LOCUS_16940 5252 4548 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679404.1 protein_id gnl|my_center|LOCUS_16940 6398 5253 gene locus_tag LOCUS_16950 6398 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6604 6395 gene locus_tag LOCUS_16960 6604 6395 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272385.1 protein_id gnl|my_center|LOCUS_16960 7450 6854 gene locus_tag LOCUS_16970 7450 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence115 773 99 gene locus_tag LOCUS_16980 773 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1807 785 gene locus_tag LOCUS_16990 1807 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2111 2728 gene locus_tag LOCUS_17000 gene lolA 2111 2728 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_17000 3067 3903 gene locus_tag LOCUS_17010 3067 3903 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 protein_id gnl|my_center|LOCUS_17010 5080 3869 gene locus_tag LOCUS_17020 gene moeA 5080 3869 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 protein_id gnl|my_center|LOCUS_17020 5747 5070 gene locus_tag LOCUS_17030 gene mobA 5747 5070 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693194.1 protein_id gnl|my_center|LOCUS_17030 5923 7230 gene locus_tag LOCUS_17040 5923 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence116 197 979 gene locus_tag LOCUS_17050 197 979 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_17050 3522 1012 gene locus_tag LOCUS_17060 gene gyrB 3522 1012 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_17060 4737 3562 gene locus_tag LOCUS_17070 gene dnaN 4737 3562 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_17070 6123 4750 gene locus_tag LOCUS_17080 gene dnaA 6123 4750 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_17080 6438 6447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6495 6635 gene locus_tag LOCUS_17090 gene rpmH 6495 6635 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214728.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence117 1365 2399 gene locus_tag LOCUS_17100 1365 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703898.1 protein_id gnl|my_center|LOCUS_17100 2420 2872 gene locus_tag LOCUS_17110 2420 2872 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_17110 5061 3268 gene locus_tag LOCUS_17120 gene urdA 5061 3268 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_17120 5956 6534 gene locus_tag LOCUS_17130 5956 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 6531 7106 gene locus_tag LOCUS_17140 6531 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence118 137 1786 gene locus_tag LOCUS_17150 137 1786 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_17150 2555 1884 gene locus_tag LOCUS_17160 2555 1884 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_17160 3104 2784 gene locus_tag LOCUS_17170 3104 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3444 4634 gene locus_tag LOCUS_17180 3444 4634 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 protein_id gnl|my_center|LOCUS_17180 4714 5643 gene locus_tag LOCUS_17190 4714 5643 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839436.1 protein_id gnl|my_center|LOCUS_17190 6501 5827 gene locus_tag LOCUS_17200 6501 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17200 7121 6513 gene locus_tag LOCUS_17210 7121 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence119 339 1046 gene locus_tag LOCUS_17220 339 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1394 2518 gene locus_tag LOCUS_17230 1394 2518 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 protein_id gnl|my_center|LOCUS_17230 2572 3552 gene locus_tag LOCUS_17240 2572 3552 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 protein_id gnl|my_center|LOCUS_17240 3555 4310 gene locus_tag LOCUS_17250 3555 4310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211375.1 protein_id gnl|my_center|LOCUS_17250 4318 5025 gene locus_tag LOCUS_17260 4318 5025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_17260 5078 5500 gene locus_tag LOCUS_17270 gene nikR 5078 5500 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 protein_id gnl|my_center|LOCUS_17270 6135 5602 gene locus_tag LOCUS_17280 6135 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 <7119 6160 gene locus_tag LOCUS_17290 <7119 6160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434121.1:NrtA/SsuA/CpmA family ABC transporter substrate-binding protein >Feature sequence120 325 879 gene locus_tag LOCUS_17300 325 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1041 3404 gene locus_tag LOCUS_17310 gene rnr 1041 3404 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 protein_id gnl|my_center|LOCUS_17310 3401 4144 gene locus_tag LOCUS_17320 gene rlmB 3401 4144 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_17320 4614 5030 gene locus_tag LOCUS_17330 4614 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 5045 5335 gene locus_tag LOCUS_17340 5045 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5339 5611 gene locus_tag LOCUS_17350 gene rpsR 5339 5611 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_17350 5627 6076 gene locus_tag LOCUS_17360 gene rplI 5627 6076 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence121 914 162 gene locus_tag LOCUS_17370 914 162 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 protein_id gnl|my_center|LOCUS_17370 2936 1032 gene locus_tag LOCUS_17380 gene htpG 2936 1032 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929604.1 protein_id gnl|my_center|LOCUS_17380 3145 4383 gene locus_tag LOCUS_17390 3145 4383 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806995.1 protein_id gnl|my_center|LOCUS_17390 6659 4494 gene locus_tag LOCUS_17400 6659 4494 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence122 371 2068 gene locus_tag LOCUS_17410 371 2068 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_17410 2363 2273 gene locus_tag LOCUS_t00290 2363 2273 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3284 2472 gene locus_tag LOCUS_17420 3284 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3675 3286 gene locus_tag LOCUS_17430 3675 3286 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_17430 4333 3692 gene locus_tag LOCUS_17440 4333 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4842 4336 gene locus_tag LOCUS_17450 4842 4336 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_17450 5365 4856 gene locus_tag LOCUS_17460 gene hutX 5365 4856 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 protein_id gnl|my_center|LOCUS_17460 6804 5383 gene locus_tag LOCUS_17470 6804 5383 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068102.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence123 901 1248 gene locus_tag LOCUS_17480 901 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1384 2622 gene locus_tag LOCUS_17490 1384 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2638 2931 gene locus_tag LOCUS_17500 2638 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2933 4105 gene locus_tag LOCUS_17510 2933 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3975 3984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4122 5987 gene locus_tag LOCUS_17520 4122 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence124 91 1992 gene locus_tag LOCUS_17530 91 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3467 2031 gene locus_tag LOCUS_17540 3467 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4092 3475 gene locus_tag LOCUS_17550 4092 3475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243804.1 protein_id gnl|my_center|LOCUS_17550 5857 4094 gene locus_tag LOCUS_17560 5857 4094 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 protein_id gnl|my_center|LOCUS_17560 6545 5940 gene locus_tag LOCUS_17570 6545 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence125 <1 638 gene locus_tag LOCUS_17580 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000988183.1:ATP-binding protein 635 898 gene locus_tag LOCUS_17590 635 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1785 2054 gene locus_tag LOCUS_17600 1785 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2064 2690 gene locus_tag LOCUS_17610 2064 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2704 3579 gene locus_tag LOCUS_17620 2704 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3594 4775 gene locus_tag LOCUS_17630 3594 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4808 5410 gene locus_tag LOCUS_17640 4808 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5403 5714 gene locus_tag LOCUS_17650 5403 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 <6841 5858 gene locus_tag LOCUS_17660 <6841 5858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275150.1:isoaspartyl peptidase/L-asparaginase >Feature sequence126 2144 831 gene locus_tag LOCUS_17670 2144 831 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053653.1 protein_id gnl|my_center|LOCUS_17670 3979 2147 gene locus_tag LOCUS_17680 3979 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3630 3639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4678 4232 gene locus_tag LOCUS_17690 4678 4232 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_17690 4921 4709 gene locus_tag LOCUS_17700 gene rpsU 4921 4709 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_17700 5192 5881 gene locus_tag LOCUS_17710 5192 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence127 174 1223 gene locus_tag LOCUS_17720 gene ansZ 174 1223 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_17720 1862 1290 gene locus_tag LOCUS_17730 1862 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2774 1881 gene locus_tag LOCUS_17740 2774 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3250 2831 gene locus_tag LOCUS_17750 3250 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4042 3278 gene locus_tag LOCUS_17760 4042 3278 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_17760 4623 4198 gene locus_tag LOCUS_17770 4623 4198 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053330.1 protein_id gnl|my_center|LOCUS_17770 5807 4623 gene locus_tag LOCUS_17780 5807 4623 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813011.1 protein_id gnl|my_center|LOCUS_17780 <6724 5822 gene locus_tag LOCUS_17790 <6724 5822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392675.1:FAD-binding oxidoreductase >Feature sequence128 107 2692 gene locus_tag LOCUS_17800 gene alaS 107 2692 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_17800 3831 2812 gene locus_tag LOCUS_17810 gene galE 3831 2812 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263233.1 protein_id gnl|my_center|LOCUS_17810 4557 3904 gene locus_tag LOCUS_17820 gene adk 4557 3904 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_17820 5438 4680 gene locus_tag LOCUS_17830 gene kdsB 5438 4680 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367464.1 protein_id gnl|my_center|LOCUS_17830 5629 5435 gene locus_tag LOCUS_17840 5629 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 <6710 5641 gene locus_tag LOCUS_17850 <6710 5641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555967.1:tetraacyldisaccharide 4'-kinase >Feature sequence129 285 503 gene locus_tag LOCUS_17860 285 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 517 1203 gene locus_tag LOCUS_17870 517 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1227 1409 gene locus_tag LOCUS_17880 1227 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1904 1515 gene locus_tag LOCUS_17890 1904 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2447 2115 gene locus_tag LOCUS_17900 2447 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2127 2136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3050 2772 gene locus_tag LOCUS_17910 3050 2772 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195781.1 protein_id gnl|my_center|LOCUS_17910 4277 3930 gene locus_tag LOCUS_17920 4277 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4847 4281 gene locus_tag LOCUS_17930 4847 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5529 4864 gene locus_tag LOCUS_17940 5529 4864 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914986.1 protein_id gnl|my_center|LOCUS_17940 6626 5670 gene locus_tag LOCUS_17950 6626 5670 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence130 117 740 gene locus_tag LOCUS_17960 117 740 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_17960 778 1431 gene locus_tag LOCUS_17970 778 1431 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447056.1 protein_id gnl|my_center|LOCUS_17970 1450 2040 gene locus_tag LOCUS_17980 1450 2040 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_17980 2145 3026 gene locus_tag LOCUS_17990 gene dapA 2145 3026 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_17990 3120 4292 gene locus_tag LOCUS_18000 gene bamC 3120 4292 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_18000 4357 4833 gene locus_tag LOCUS_18010 4357 4833 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 protein_id gnl|my_center|LOCUS_18010 4913 5431 gene locus_tag LOCUS_18020 4913 5431 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_18020 <6650 5504 gene locus_tag LOCUS_18030 <6650 5504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039337.1:DNA mismatch repair protein MutS >Feature sequence131 <1 714 gene locus_tag LOCUS_18040 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000953344.1:nickel ABC transporter substrate-binding protein 714 1649 gene locus_tag LOCUS_18050 gene nikB 714 1649 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703735.1 protein_id gnl|my_center|LOCUS_18050 1901 2479 gene locus_tag LOCUS_18060 1901 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2490 3278 gene locus_tag LOCUS_18070 2490 3278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 protein_id gnl|my_center|LOCUS_18070 3271 4008 gene locus_tag LOCUS_18080 3271 4008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598772.1 protein_id gnl|my_center|LOCUS_18080 4487 4023 gene locus_tag LOCUS_18090 gene nikR 4487 4023 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 protein_id gnl|my_center|LOCUS_18090 5198 4491 gene locus_tag LOCUS_18100 5198 4491 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_18100 5959 5204 gene locus_tag LOCUS_18110 5959 5204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211375.1 protein_id gnl|my_center|LOCUS_18110 <6636 5962 gene locus_tag LOCUS_18120 <6636 5962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972996.1:iron ABC transporter permease >Feature sequence132 <1 3867 gene locus_tag LOCUS_18130 <1 3867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009241452.1:YhdP family protein 3873 4694 gene locus_tag LOCUS_18140 3873 4694 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194407.1 protein_id gnl|my_center|LOCUS_18140 4687 6129 gene locus_tag LOCUS_18150 gene tldD 4687 6129 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence133 825 352 gene locus_tag LOCUS_18160 825 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2538 961 gene locus_tag LOCUS_18170 2538 961 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236747.1 protein_id gnl|my_center|LOCUS_18170 3396 2839 gene locus_tag LOCUS_18180 gene efp 3396 2839 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193484.1 protein_id gnl|my_center|LOCUS_18180 4707 3619 gene locus_tag LOCUS_18190 gene earP 4707 3619 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence134 <1 801 gene locus_tag LOCUS_18200 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016563.1:MetQ/NlpA family ABC transporter substrate-binding protein 816 1607 gene locus_tag LOCUS_18210 816 1607 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_18210 2212 1748 gene locus_tag LOCUS_18220 2212 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3003 4988 gene locus_tag LOCUS_18230 3003 4988 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 protein_id gnl|my_center|LOCUS_18230 5008 5862 gene locus_tag LOCUS_18240 5008 5862 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence135 1480 167 gene locus_tag LOCUS_18250 1480 167 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_18250 2163 1477 gene locus_tag LOCUS_18260 2163 1477 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_18260 3239 4552 gene locus_tag LOCUS_18270 3239 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5519 4581 gene locus_tag LOCUS_18280 5519 4581 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085469.1 protein_id gnl|my_center|LOCUS_18280 5632 6165 gene locus_tag LOCUS_18290 5632 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence136 878 1081 gene locus_tag LOCUS_18300 878 1081 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_18300 1145 1594 gene locus_tag LOCUS_18310 1145 1594 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530837.1 protein_id gnl|my_center|LOCUS_18310 3213 1666 gene locus_tag LOCUS_18320 3213 1666 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460454.1 protein_id gnl|my_center|LOCUS_18320 3427 3774 gene locus_tag LOCUS_18330 3427 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4175 3891 gene locus_tag LOCUS_18340 4175 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18340 4160 4169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6262 4529 gene locus_tag LOCUS_18350 6262 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence137 85 861 gene locus_tag LOCUS_18360 85 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 927 2177 gene locus_tag LOCUS_18370 927 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2632 2252 gene locus_tag LOCUS_18380 2632 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4148 2646 gene locus_tag LOCUS_18390 4148 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5885 4572 gene locus_tag LOCUS_18400 5885 4572 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_18400 6157 5915 gene locus_tag LOCUS_18410 6157 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence138 287 6 gene locus_tag LOCUS_18420 287 6 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_18420 1781 354 gene locus_tag LOCUS_18430 gene argA 1781 354 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_18430 1940 6085 gene locus_tag LOCUS_18440 gene hrpA 1940 6085 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence139 1134 364 gene locus_tag LOCUS_18450 1134 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3811 1223 gene locus_tag LOCUS_18460 3811 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 4351 4261 gene locus_tag LOCUS_t00300 4351 4261 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4574 5359 gene locus_tag LOCUS_18470 4574 5359 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_18470 5384 6094 gene locus_tag LOCUS_18480 5384 6094 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence140 1833 1012 gene locus_tag LOCUS_18490 1833 1012 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700189.1 protein_id gnl|my_center|LOCUS_18490 2214 3077 gene locus_tag LOCUS_18500 2214 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4300 3074 gene locus_tag LOCUS_18510 4300 3074 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_18510 <6118 4414 gene locus_tag LOCUS_18520 <6118 4414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192725.1:ATP-dependent chaperone ClpB >Feature sequence141 3005 351 gene locus_tag LOCUS_18530 gene polA 3005 351 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_18530 2485 2494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3625 3634 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3713 4075 gene locus_tag LOCUS_18540 3713 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4718 5932 gene locus_tag LOCUS_18550 4718 5932 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence142 82 585 gene locus_tag LOCUS_18560 82 585 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298503.1 protein_id gnl|my_center|LOCUS_18560 827 3595 gene locus_tag LOCUS_18570 827 3595 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_18570 5328 3841 gene locus_tag LOCUS_18580 5328 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5509 5518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence143 87 2147 gene locus_tag LOCUS_18590 87 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2242 3882 gene locus_tag LOCUS_18600 2242 3882 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 protein_id gnl|my_center|LOCUS_18600 3974 4711 gene locus_tag LOCUS_18610 3974 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence144 774 292 gene locus_tag LOCUS_18620 774 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1395 937 gene locus_tag LOCUS_18630 1395 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1537 2136 gene locus_tag LOCUS_18640 1537 2136 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108571.1 protein_id gnl|my_center|LOCUS_18640 3425 2133 gene locus_tag LOCUS_18650 3425 2133 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_18650 4088 3795 gene locus_tag LOCUS_18660 4088 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5772 4660 gene locus_tag LOCUS_18670 5772 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence145 <1 1102 gene locus_tag LOCUS_18680 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001232919.1:DNA-binding transcriptional regulator RtcR 1638 1222 gene locus_tag LOCUS_18690 gene tnpA 1638 1222 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_18690 3042 4427 gene locus_tag LOCUS_18700 gene amrA 3042 4427 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_18700 4429 5274 gene locus_tag LOCUS_18710 gene amrS 4429 5274 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence146 685 371 gene locus_tag LOCUS_18720 685 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1004 660 gene locus_tag LOCUS_18730 1004 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 761 770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1395 1099 gene locus_tag LOCUS_18740 1395 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1651 2577 gene locus_tag LOCUS_18750 1651 2577 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence147 1621 716 gene locus_tag LOCUS_18760 1621 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3973 1631 gene locus_tag LOCUS_18770 3973 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5169 3970 gene locus_tag LOCUS_18780 5169 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 <5705 5169 gene locus_tag LOCUS_18790 <5705 5169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444243.1:type-F conjugative transfer system pilin assembly protein TrbC >Feature sequence148 3076 3438 gene locus_tag LOCUS_18800 3076 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3202 3211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3531 4190 gene locus_tag LOCUS_18810 3531 4190 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942944.1 protein_id gnl|my_center|LOCUS_18810 5463 4249 gene locus_tag LOCUS_18820 5463 4249 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence149 1200 4 gene locus_tag LOCUS_18830 gene coaBC 1200 4 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_18830 1717 1214 gene locus_tag LOCUS_18840 gene lspA 1717 1214 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_18840 4587 1717 gene locus_tag LOCUS_18850 gene ileS 4587 1717 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541624.1 protein_id gnl|my_center|LOCUS_18850 5579 4632 gene locus_tag LOCUS_18860 5579 4632 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence150 184 786 gene locus_tag LOCUS_18870 184 786 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212179.1 protein_id gnl|my_center|LOCUS_18870 1998 988 gene locus_tag LOCUS_18880 1998 988 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081212.1 protein_id gnl|my_center|LOCUS_18880 2517 2966 gene locus_tag LOCUS_18890 2517 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2979 4487 gene locus_tag LOCUS_18900 2979 4487 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence151 223 1803 gene locus_tag LOCUS_18910 223 1803 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_18910 1856 2212 gene locus_tag LOCUS_18920 1856 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4544 2325 gene locus_tag LOCUS_18930 4544 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4967 4976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 247 1152 gene locus_tag LOCUS_18940 247 1152 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_18940 1276 4695 gene locus_tag LOCUS_18950 gene dnaE 1276 4695 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence153 514 20 gene locus_tag LOCUS_18960 514 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 780 1505 gene locus_tag LOCUS_18970 780 1505 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261215.1 protein_id gnl|my_center|LOCUS_18970 1508 2341 gene locus_tag LOCUS_18980 gene proC 1508 2341 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194039.1 protein_id gnl|my_center|LOCUS_18980 4433 2376 gene locus_tag LOCUS_18990 gene recG 4433 2376 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_18990 5271 4543 gene locus_tag LOCUS_19000 5271 4543 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence154 212 2419 gene locus_tag LOCUS_19010 212 2419 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754234.1 protein_id gnl|my_center|LOCUS_19010 2423 3058 gene locus_tag LOCUS_19020 2423 3058 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393407.1 protein_id gnl|my_center|LOCUS_19020 3231 4409 gene locus_tag LOCUS_19030 3231 4409 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_19030 4418 5335 gene locus_tag LOCUS_19040 gene argF 4418 5335 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence155 <1 672 gene locus_tag LOCUS_19050 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027947.1:amino acid ABC transporter permease 700 1527 gene locus_tag LOCUS_19060 700 1527 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_19060 1572 2384 gene locus_tag LOCUS_19070 1572 2384 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966597.1 protein_id gnl|my_center|LOCUS_19070 2527 2673 gene locus_tag LOCUS_19080 2527 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2711 2857 gene locus_tag LOCUS_19090 2711 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3341 3018 gene locus_tag LOCUS_19100 3341 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3292 3301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3676 3380 gene locus_tag LOCUS_19110 3676 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 5345 3894 gene locus_tag LOCUS_19120 gene putP 5345 3894 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018503.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence156 734 1546 gene locus_tag LOCUS_19130 734 1546 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 protein_id gnl|my_center|LOCUS_19130 2069 3514 gene locus_tag LOCUS_19140 gene nhaC 2069 3514 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068039.1 protein_id gnl|my_center|LOCUS_19140 3518 4663 gene locus_tag LOCUS_19150 3518 4663 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893427.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence157 128 928 gene locus_tag LOCUS_19160 gene aroE 128 928 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_19160 953 2410 gene locus_tag LOCUS_19170 gene mgtE 953 2410 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225872.1 protein_id gnl|my_center|LOCUS_19170 2436 3629 gene locus_tag LOCUS_19180 2436 3629 CDS product AppA family phytase/histidine-type acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816632.1 protein_id gnl|my_center|LOCUS_19180 3844 5337 gene locus_tag LOCUS_19190 3844 5337 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence158 1172 615 gene locus_tag LOCUS_19200 1172 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 628 637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2644 1334 gene locus_tag LOCUS_19210 gene potE 2644 1334 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173672.1 protein_id gnl|my_center|LOCUS_19210 4907 2712 gene locus_tag LOCUS_19220 gene speF 4907 2712 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086685.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence159 315 1493 gene locus_tag LOCUS_19230 315 1493 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860897.1 protein_id gnl|my_center|LOCUS_19230 1522 3132 gene locus_tag LOCUS_19240 1522 3132 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_19240 3464 3216 gene locus_tag LOCUS_19250 3464 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5118 3649 gene locus_tag LOCUS_19260 gene urdA 5118 3649 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence160 276 1391 gene locus_tag LOCUS_19270 276 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1562 2911 gene locus_tag LOCUS_19280 1562 2911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980448.1 protein_id gnl|my_center|LOCUS_19280 3951 2974 gene locus_tag LOCUS_19290 3951 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4724 3954 gene locus_tag LOCUS_19300 4724 3954 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence161 1842 277 gene locus_tag LOCUS_19310 gene xylB 1842 277 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_19310 2797 1922 gene locus_tag LOCUS_19320 2797 1922 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_19320 3489 2794 gene locus_tag LOCUS_19330 gene queC 3489 2794 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_19330 4017 3616 gene locus_tag LOCUS_19340 4017 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 <5315 4028 gene locus_tag LOCUS_19350 <5315 4028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538202.1:M20/M25/M40 family metallo-hydrolase >Feature sequence162 <1 1766 gene locus_tag LOCUS_19360 <1 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000241.1:AMP-dependent synthetase/ligase 1767 3599 gene locus_tag LOCUS_19370 1767 3599 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_19370 4368 3670 gene locus_tag LOCUS_19380 gene cysE 4368 3670 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_19380 5183 4386 gene locus_tag LOCUS_19390 5183 4386 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039343.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence163 1406 2722 gene locus_tag LOCUS_19400 1406 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence164 50 523 gene locus_tag LOCUS_19410 50 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 425 434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 913 587 gene locus_tag LOCUS_19420 913 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3742 1433 gene locus_tag LOCUS_19430 3742 1433 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901093.1 protein_id gnl|my_center|LOCUS_19430 3701 4048 gene locus_tag LOCUS_19440 3701 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4253 4609 gene locus_tag LOCUS_19450 4253 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4630 5220 gene locus_tag LOCUS_19460 4630 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence165 502 1740 gene locus_tag LOCUS_19470 502 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1750 2457 gene locus_tag LOCUS_19480 gene yycF 1750 2457 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985645.1 protein_id gnl|my_center|LOCUS_19480 2620 3903 gene locus_tag LOCUS_19490 2620 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3961 5193 gene locus_tag LOCUS_19500 3961 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence166 883 1209 gene locus_tag LOCUS_19510 883 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1206 1790 gene locus_tag LOCUS_19520 1206 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1787 2272 gene locus_tag LOCUS_19530 1787 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2272 2508 gene locus_tag LOCUS_19540 2272 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2498 3979 gene locus_tag LOCUS_19550 2498 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_19550 3991 4521 gene locus_tag LOCUS_19560 3991 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 4569 4901 gene locus_tag LOCUS_19570 4569 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence167 487 861 gene locus_tag LOCUS_19580 gene rbfA 487 861 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 protein_id gnl|my_center|LOCUS_19580 862 1791 gene locus_tag LOCUS_19590 gene truB 862 1791 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_19590 1800 3650 gene locus_tag LOCUS_19600 gene typA 1800 3650 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818637.1 protein_id gnl|my_center|LOCUS_19600 3634 4017 gene locus_tag LOCUS_19610 3634 4017 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_19610 4014 5045 gene locus_tag LOCUS_19620 gene dusA 4014 5045 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812705.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence168 519 160 gene locus_tag LOCUS_19630 519 160 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689494.1 protein_id gnl|my_center|LOCUS_19630 1611 754 gene locus_tag LOCUS_19640 gene serB 1611 754 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813898.1 protein_id gnl|my_center|LOCUS_19640 5087 1608 gene locus_tag LOCUS_19650 gene mfd 5087 1608 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_19650 3674 3683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence169 1363 752 gene locus_tag LOCUS_19660 1363 752 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073853.1 protein_id gnl|my_center|LOCUS_19660 3030 1360 gene locus_tag LOCUS_19670 3030 1360 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 protein_id gnl|my_center|LOCUS_19670 3533 3327 gene locus_tag LOCUS_19680 3533 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4733 3669 gene locus_tag LOCUS_19690 4733 3669 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_19690 5008 5084 gene locus_tag LOCUS_t00310 5008 5084 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence170 282 590 gene locus_tag LOCUS_19700 282 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1638 622 gene locus_tag LOCUS_19710 gene murB 1638 622 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_19710 3525 1654 gene locus_tag LOCUS_19720 gene dxs 3525 1654 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_19720 4441 3539 gene locus_tag LOCUS_19730 4441 3539 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_19730 4738 4448 gene locus_tag LOCUS_19740 4738 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence171 390 1412 gene locus_tag LOCUS_19750 390 1412 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_19750 1506 2666 gene locus_tag LOCUS_19760 1506 2666 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_19760 2663 3763 gene locus_tag LOCUS_19770 2663 3763 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_19770 3768 4289 gene locus_tag LOCUS_19780 3768 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4921 4358 gene locus_tag LOCUS_19790 gene ahpC 4921 4358 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389172.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence172 709 23 gene locus_tag LOCUS_19800 709 23 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818450.1 protein_id gnl|my_center|LOCUS_19800 1409 702 gene locus_tag LOCUS_19810 1409 702 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159184734.1 protein_id gnl|my_center|LOCUS_19810 2094 1411 gene locus_tag LOCUS_19820 gene rpe 2094 1411 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 protein_id gnl|my_center|LOCUS_19820 2209 3399 gene locus_tag LOCUS_19830 2209 3399 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_19830 3944 3459 gene locus_tag LOCUS_19840 3944 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4825 4013 gene locus_tag LOCUS_19850 4825 4013 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence173 281 75 gene locus_tag LOCUS_19860 281 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1466 417 gene locus_tag LOCUS_19870 1466 417 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_19870 2323 1481 gene locus_tag LOCUS_19880 2323 1481 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209762.1 protein_id gnl|my_center|LOCUS_19880 2900 2337 gene locus_tag LOCUS_19890 2900 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19890 3314 3048 gene locus_tag LOCUS_19900 3314 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19900 4253 3327 gene locus_tag LOCUS_19910 4253 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence174 449 225 gene locus_tag LOCUS_19920 449 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1763 3601 gene locus_tag LOCUS_19930 1763 3601 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 protein_id gnl|my_center|LOCUS_19930 3730 4371 gene locus_tag LOCUS_19940 3730 4371 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096232.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence175 709 8 gene locus_tag LOCUS_19950 709 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2052 1279 gene locus_tag LOCUS_19960 2052 1279 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921309.1 protein_id gnl|my_center|LOCUS_19960 4060 2267 gene locus_tag LOCUS_19970 gene urdA 4060 2267 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_19970 4674 4180 gene locus_tag LOCUS_19980 4674 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence176 <1 505 gene locus_tag LOCUS_19990 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815819.1:glutathione S-transferase N-terminal domain-containing protein 516 902 gene locus_tag LOCUS_20000 516 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 990 1062 gene locus_tag LOCUS_t00320 990 1062 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1443 1517 gene locus_tag LOCUS_t00330 1443 1517 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2398 1595 gene locus_tag LOCUS_20010 gene prmC 2398 1595 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455843.1 protein_id gnl|my_center|LOCUS_20010 3483 2401 gene locus_tag LOCUS_20020 gene prfA 3483 2401 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527811.1 protein_id gnl|my_center|LOCUS_20020 <4885 3580 gene locus_tag LOCUS_20030 <4885 3580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521984.1:glutamyl-tRNA reductase >Feature sequence177 407 99 gene locus_tag LOCUS_20040 407 99 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_20040 942 391 gene locus_tag LOCUS_20050 942 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1754 993 gene locus_tag LOCUS_20060 1754 993 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461967.1 protein_id gnl|my_center|LOCUS_20060 4318 1769 gene locus_tag LOCUS_20070 4318 1769 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_20070 4528 4537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 31 1245 gene locus_tag LOCUS_20080 31 1245 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_20080 1310 1735 gene locus_tag LOCUS_20090 1310 1735 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_20090 1866 2135 gene locus_tag LOCUS_20100 gene rpsO 1866 2135 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_20100 2288 4495 gene locus_tag LOCUS_20110 gene pnp 2288 4495 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence179 189 3320 gene locus_tag LOCUS_20120 gene fdnG 189 3320 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 protein_id gnl|my_center|LOCUS_20120 3336 4256 gene locus_tag LOCUS_20130 gene fdxH 3336 4256 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368961.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence180 <1 918 gene locus_tag LOCUS_20140 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082442.1:C4-dicarboxylate transporter DctC 2127 1003 gene locus_tag LOCUS_20150 2127 1003 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 protein_id gnl|my_center|LOCUS_20150 3638 2361 gene locus_tag LOCUS_20160 3638 2361 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_20160 3792 4781 gene locus_tag LOCUS_20170 3792 4781 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967839.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence181 265 579 gene locus_tag LOCUS_20180 265 579 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_20180 576 1736 gene locus_tag LOCUS_20190 576 1736 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_20190 4071 1807 gene locus_tag LOCUS_20200 gene torA 4071 1807 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338998.1 protein_id gnl|my_center|LOCUS_20200 4426 4435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 361 1053 gene locus_tag LOCUS_20210 361 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1141 1944 gene locus_tag LOCUS_20220 gene gpmA 1141 1944 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_20220 3505 2045 gene locus_tag LOCUS_20230 3505 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4339 3719 gene locus_tag LOCUS_20240 4339 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence183 2690 942 gene locus_tag LOCUS_20250 2690 942 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040481.1 protein_id gnl|my_center|LOCUS_20250 2851 3354 gene locus_tag LOCUS_20260 2851 3354 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047949975.1 protein_id gnl|my_center|LOCUS_20260 4499 3369 gene locus_tag LOCUS_20270 gene proB 4499 3369 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence184 2554 1889 gene locus_tag LOCUS_20280 2554 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4047 2791 gene locus_tag LOCUS_20290 4047 2791 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_20290 4539 4162 gene locus_tag LOCUS_20300 4539 4162 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence185 233 445 gene locus_tag LOCUS_20310 233 445 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 protein_id gnl|my_center|LOCUS_20310 1386 505 gene locus_tag LOCUS_20320 1386 505 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 protein_id gnl|my_center|LOCUS_20320 4340 1521 gene locus_tag LOCUS_20330 gene parC 4340 1521 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence186 <1 630 gene locus_tag LOCUS_20340 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040246.1:peptidylprolyl isomerase 879 1493 gene locus_tag LOCUS_20350 879 1493 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_20350 1496 1768 gene locus_tag LOCUS_20360 1496 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1790 2590 gene locus_tag LOCUS_20370 1790 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2716 3534 gene locus_tag LOCUS_20380 gene fabI 2716 3534 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_20380 4362 3577 gene locus_tag LOCUS_20390 4362 3577 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074162.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence187 215 1042 gene locus_tag LOCUS_20400 215 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_20400 2395 1169 gene locus_tag LOCUS_20410 2395 1169 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931392.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence188 <1 1790 gene locus_tag LOCUS_20420 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485697.1:flavocytochrome c 1930 2862 gene locus_tag LOCUS_20430 1930 2862 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465075.1 protein_id gnl|my_center|LOCUS_20430 2877 3740 gene locus_tag LOCUS_20440 2877 3740 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 protein_id gnl|my_center|LOCUS_20440 4514 3855 gene locus_tag LOCUS_20450 gene ribB 4514 3855 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477276.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence189 <1 611 gene locus_tag LOCUS_20460 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124911.1:Y-family DNA polymerase 2021 690 gene locus_tag LOCUS_20470 2021 690 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224972.1 protein_id gnl|my_center|LOCUS_20470 2974 2102 gene locus_tag LOCUS_20480 2974 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3149 3709 gene locus_tag LOCUS_20490 3149 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3944 4123 gene locus_tag LOCUS_20500 3944 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20500 >Feature sequence190 <1 651 gene locus_tag LOCUS_20510 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040015.1:FAD-dependent oxidoreductase 767 2248 gene locus_tag LOCUS_20520 767 2248 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810930.1 protein_id gnl|my_center|LOCUS_20520 2310 2705 gene locus_tag LOCUS_20530 2310 2705 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_20530 3938 4297 gene locus_tag LOCUS_20540 3938 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence191 1161 2348 gene locus_tag LOCUS_20550 gene mltB 1161 2348 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930108.1 protein_id gnl|my_center|LOCUS_20550 2434 2622 gene locus_tag LOCUS_20560 2434 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3398 2685 gene locus_tag LOCUS_20570 3398 2685 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365722.1 protein_id gnl|my_center|LOCUS_20570 4124 3672 gene locus_tag LOCUS_20580 4124 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence192 1169 252 gene locus_tag LOCUS_20590 gene cas1e 1169 252 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144847.1 protein_id gnl|my_center|LOCUS_20590 2505 1792 gene locus_tag LOCUS_20600 gene cas5e 2505 1792 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 protein_id gnl|my_center|LOCUS_20600 3601 2549 gene locus_tag LOCUS_20610 gene cas7e 3601 2549 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_20610 4170 3619 gene locus_tag LOCUS_20620 gene casB 4170 3619 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence193 202 630 gene locus_tag LOCUS_20630 202 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 684 914 gene locus_tag LOCUS_20640 684 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 995 1004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1014 1985 gene locus_tag LOCUS_20650 1014 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1991 3859 gene locus_tag LOCUS_20660 1991 3859 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765275.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence194 242 427 gene locus_tag LOCUS_20670 242 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3493 515 gene locus_tag LOCUS_20680 3493 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence195 <1 652 gene locus_tag LOCUS_20690 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047711.1:PhzF family phenazine biosynthesis protein 1328 666 gene locus_tag LOCUS_20700 1328 666 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_20700 1547 2098 gene locus_tag LOCUS_20710 1547 2098 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532828.1 protein_id gnl|my_center|LOCUS_20710 2299 2610 gene locus_tag LOCUS_20720 2299 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2615 4156 gene locus_tag LOCUS_20730 2615 4156 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence196 865 1281 gene locus_tag LOCUS_20740 865 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2015 1386 gene locus_tag LOCUS_20750 2015 1386 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_20750 2521 2057 gene locus_tag LOCUS_20760 2521 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 4173 2698 gene locus_tag LOCUS_20770 gene nrfA 4173 2698 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence197 2262 763 gene locus_tag LOCUS_20780 gene purF 2262 763 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_20780 2808 2296 gene locus_tag LOCUS_20790 2808 2296 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188369.1 protein_id gnl|my_center|LOCUS_20790 4019 2811 gene locus_tag LOCUS_20800 4019 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4214 4038 gene locus_tag LOCUS_20810 4214 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence198 85 2181 gene locus_tag LOCUS_20820 85 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2178 3023 gene locus_tag LOCUS_20830 2178 3023 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence199 2182 1037 gene locus_tag LOCUS_20840 gene iadA 2182 1037 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 protein_id gnl|my_center|LOCUS_20840 2687 2214 gene locus_tag LOCUS_20850 2687 2214 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073203.1 protein_id gnl|my_center|LOCUS_20850 3434 2703 gene locus_tag LOCUS_20860 3434 2703 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263748.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence200 1153 50 gene locus_tag LOCUS_20870 gene moaA 1153 50 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_20870 1372 2781 gene locus_tag LOCUS_20880 gene leuC 1372 2781 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368263.1 protein_id gnl|my_center|LOCUS_20880 2785 3393 gene locus_tag LOCUS_20890 gene leuD 2785 3393 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721055.1 protein_id gnl|my_center|LOCUS_20890 3963 3469 gene locus_tag LOCUS_20900 3963 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence201 2291 1485 gene locus_tag LOCUS_20910 gene folE2 2291 1485 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_20910 2632 2937 gene locus_tag LOCUS_20920 2632 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2942 3307 gene locus_tag LOCUS_20930 2942 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3332 3417 gene locus_tag LOCUS_t00340 3332 3417 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3543 3628 gene locus_tag LOCUS_t00350 3543 3628 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3674 3747 gene locus_tag LOCUS_t00360 3674 3747 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3753 3827 gene locus_tag LOCUS_t00370 3753 3827 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence202 1138 2592 gene locus_tag LOCUS_20940 1138 2592 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_20940 3557 2631 gene locus_tag LOCUS_20950 gene cysK 3557 2631 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence203 1055 2218 gene locus_tag LOCUS_20960 gene hydE 1055 2218 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_20960 2274 3041 gene locus_tag LOCUS_20970 gene tpiA 2274 3041 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_20970 3061 3438 gene locus_tag LOCUS_20980 gene secG 3061 3438 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_20980 3495 3579 gene locus_tag LOCUS_t00380 3495 3579 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3591 3675 gene locus_tag LOCUS_t00390 3591 3675 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 541 1455 gene locus_tag LOCUS_20990 541 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1610 3277 gene locus_tag LOCUS_21000 1610 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence205 1226 441 gene locus_tag LOCUS_21010 gene istB 1226 441 CDS product IS21-like element ISRel16 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539334.1 protein_id gnl|my_center|LOCUS_21010 2769 1198 gene locus_tag LOCUS_21020 gene istA 2769 1198 CDS product IS21-like element ISFK1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090936.1 protein_id gnl|my_center|LOCUS_21020 3467 3476 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence206 2340 202 gene locus_tag LOCUS_21030 2340 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2591 2331 gene locus_tag LOCUS_21040 2591 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 <3766 2588 gene locus_tag LOCUS_21050 <3766 2588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021779460.1:DEAD/DEAH box helicase family protein >Feature sequence207 1085 2101 gene locus_tag LOCUS_21060 1085 2101 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_21060 3626 2571 gene locus_tag LOCUS_21070 3626 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence208 1314 328 gene locus_tag LOCUS_21080 1314 328 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599080.1 protein_id gnl|my_center|LOCUS_21080 3089 1314 gene locus_tag LOCUS_21090 3089 1314 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023237.1 protein_id gnl|my_center|LOCUS_21090 3554 3279 gene locus_tag LOCUS_21100 3554 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence209 141 383 gene locus_tag LOCUS_21110 141 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 345 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 358 2031 gene locus_tag LOCUS_21120 358 2031 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence210 346 579 gene locus_tag LOCUS_21130 346 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 580 744 gene locus_tag LOCUS_21140 580 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 824 1072 gene locus_tag LOCUS_21150 824 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1065 1376 gene locus_tag LOCUS_21160 1065 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1397 1585 gene locus_tag LOCUS_21170 1397 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1756 1553 gene locus_tag LOCUS_21180 1756 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1976 2368 gene locus_tag LOCUS_21190 1976 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2346 2645 gene locus_tag LOCUS_21200 2346 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2645 2980 gene locus_tag LOCUS_21210 2645 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3098 3283 gene locus_tag LOCUS_21220 3098 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3284 3520 gene locus_tag LOCUS_21230 3284 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence211 374 871 gene locus_tag LOCUS_21240 374 871 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298503.1 protein_id gnl|my_center|LOCUS_21240 1563 2048 gene locus_tag LOCUS_21250 1563 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3431 2163 gene locus_tag LOCUS_21260 3431 2163 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence212 58 828 gene locus_tag LOCUS_21270 gene pstB 58 828 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_21270 1222 884 gene locus_tag LOCUS_21280 gene trxA 1222 884 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 protein_id gnl|my_center|LOCUS_21280 2472 1240 gene locus_tag LOCUS_21290 gene gltS 2472 1240 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_21290 2584 3183 gene locus_tag LOCUS_21300 2584 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3158 3167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence213 399 794 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcttacgcggggaactc 1118 1042 gene locus_tag LOCUS_t00400 1118 1042 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <3429 1439 gene locus_tag LOCUS_21310 <3429 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930783.1:RNA polymerase sigma factor RpoD >Feature sequence214 832 653 gene locus_tag LOCUS_21320 832 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2907 886 gene locus_tag LOCUS_21330 2907 886 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence215 >Feature sequence216 1465 101 gene locus_tag LOCUS_21340 1465 101 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_21340 2683 1562 gene locus_tag LOCUS_21350 2683 1562 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence217 826 1518 gene locus_tag LOCUS_21360 826 1518 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048781225.1 protein_id gnl|my_center|LOCUS_21360 1957 2238 gene locus_tag LOCUS_21370 1957 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence218 575 1219 gene locus_tag LOCUS_21380 575 1219 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930175.1 protein_id gnl|my_center|LOCUS_21380 1880 1317 gene locus_tag LOCUS_21390 1880 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2314 1922 gene locus_tag LOCUS_21400 gene perR 2314 1922 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_21400 <3371 2470 gene locus_tag LOCUS_21410 <3371 2470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202735.1:alpha/beta hydrolase >Feature sequence219 1576 956 gene locus_tag LOCUS_21420 1576 956 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_21420 2923 1580 gene locus_tag LOCUS_21430 2923 1580 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263003.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21430 >Feature sequence220 570 1856 gene locus_tag LOCUS_21440 570 1856 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_21440 3192 1915 gene locus_tag LOCUS_21450 3192 1915 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence221 974 537 gene locus_tag LOCUS_21460 974 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1190 1939 gene locus_tag LOCUS_21470 gene gpmA 1190 1939 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_21470 1951 3327 gene locus_tag LOCUS_21480 1951 3327 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105427.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence222 3 797 gene locus_tag LOCUS_21490 3 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 841 2415 gene locus_tag LOCUS_21500 841 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2405 3031 gene locus_tag LOCUS_21510 2405 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence223 409 1029 gene locus_tag LOCUS_21520 409 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21520 906 915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 981 1874 gene locus_tag LOCUS_21530 981 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21530 <3295 1962 gene locus_tag LOCUS_21540 <3295 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202731.1:MATE family efflux transporter >Feature sequence224 969 160 gene locus_tag LOCUS_21550 969 160 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_21550 1405 1154 gene locus_tag LOCUS_21560 1405 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2822 1638 gene locus_tag LOCUS_21570 2822 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence225 <1 971 gene locus_tag LOCUS_21580 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947587.1:site-specific integrase 2011 968 gene locus_tag LOCUS_21590 2011 968 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_21590 2610 2002 gene locus_tag LOCUS_21600 gene tmk 2610 2002 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_21600 <3234 2611 gene locus_tag LOCUS_21610 <3234 2611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930596.1:endolytic transglycosylase MltG >Feature sequence226 288 1670 gene locus_tag LOCUS_21620 gene dcuC 288 1670 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 protein_id gnl|my_center|LOCUS_21620 <3233 1762 gene locus_tag LOCUS_21630 <3233 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887075.1:RtcB family protein >Feature sequence227 1519 56 gene locus_tag LOCUS_21640 1519 56 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191270.1 protein_id gnl|my_center|LOCUS_21640 2585 1683 gene locus_tag LOCUS_21650 2585 1683 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence228 250 2868 gene locus_tag LOCUS_21660 250 2868 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233935.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence229 1556 981 gene locus_tag LOCUS_21670 gene greB 1556 981 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_21670 <3199 1717 gene locus_tag LOCUS_21680 <3199 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039235.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence230 2747 1671 gene locus_tag LOCUS_21690 gene virB11 2747 1671 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264003.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence231 516 1781 gene locus_tag LOCUS_21700 516 1781 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_21700 1788 2696 gene locus_tag LOCUS_21710 gene rsgA 1788 2696 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence232 2045 1773 gene locus_tag LOCUS_21720 2045 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2588 2382 gene locus_tag LOCUS_21730 2588 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3064 2873 gene locus_tag LOCUS_21740 3064 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence233 249 82 gene locus_tag LOCUS_21750 gene rpmG 249 82 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_21750 495 262 gene locus_tag LOCUS_21760 gene rpmB 495 262 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_21760 819 1775 gene locus_tag LOCUS_21770 gene ispH 819 1775 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_21770 1759 2229 gene locus_tag LOCUS_21780 1759 2229 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 protein_id gnl|my_center|LOCUS_21780 2239 2730 gene locus_tag LOCUS_21790 gene ybaK 2239 2730 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence234 452 243 gene locus_tag LOCUS_21800 452 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 796 449 gene locus_tag LOCUS_21810 796 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1538 813 gene locus_tag LOCUS_21820 1538 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1819 1541 gene locus_tag LOCUS_21830 1819 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2106 2399 gene locus_tag LOCUS_21840 2106 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence235 1380 67 gene locus_tag LOCUS_21850 1380 67 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792073.1 protein_id gnl|my_center|LOCUS_21850 1583 2056 gene locus_tag LOCUS_21860 1583 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2663 2151 gene locus_tag LOCUS_21870 2663 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence236 93 230 gene locus_tag LOCUS_21880 93 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1971 286 gene locus_tag LOCUS_21890 1971 286 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460619.1 protein_id gnl|my_center|LOCUS_21890 <2908 2074 gene locus_tag LOCUS_21900 <2908 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810606.1:MerR family transcriptional regulator >Feature sequence237 266 99 gene locus_tag LOCUS_21910 266 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 382 1437 gene locus_tag LOCUS_21920 382 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence238 18 278 gene locus_tag LOCUS_21930 gene rpsP 18 278 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214315.1 protein_id gnl|my_center|LOCUS_21930 296 820 gene locus_tag LOCUS_21940 gene rimM 296 820 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021994923.1 protein_id gnl|my_center|LOCUS_21940 829 1578 gene locus_tag LOCUS_21950 gene trmD 829 1578 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 protein_id gnl|my_center|LOCUS_21950 1660 2028 gene locus_tag LOCUS_21960 gene rplS 1660 2028 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_21960 2688 2170 gene locus_tag LOCUS_21970 2688 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence239 187 2112 gene locus_tag LOCUS_21980 gene ppiD 187 2112 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 protein_id gnl|my_center|LOCUS_21980 2201 2701 gene locus_tag LOCUS_21990 2201 2701 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279106.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence240 128 514 gene locus_tag LOCUS_22000 128 514 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297874.1 protein_id gnl|my_center|LOCUS_22000 1753 530 gene locus_tag LOCUS_22010 1753 530 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689382.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence241 >Feature sequence242 318 1088 gene locus_tag LOCUS_22020 318 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1104 1364 gene locus_tag LOCUS_22030 1104 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence243 <2712 626 gene locus_tag LOCUS_22040 <2712 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791356.1:heavy metal translocating P-type ATPase >Feature sequence244 >Feature sequence245 1483 353 gene locus_tag LOCUS_22050 1483 353 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 protein_id gnl|my_center|LOCUS_22050 <2544 1516 gene locus_tag LOCUS_22060 <2544 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033448266.1:porin >Feature sequence246 538 158 gene locus_tag LOCUS_22070 538 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1634 540 gene locus_tag LOCUS_22080 gene ychF 1634 540 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence247 240 767 gene locus_tag LOCUS_22090 240 767 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477329.1 protein_id gnl|my_center|LOCUS_22090 1655 864 gene locus_tag LOCUS_22100 1655 864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_22100 <2478 1652 gene locus_tag LOCUS_22110 <2478 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521934.1:ABC transporter ATP-binding protein >Feature sequence248 372 85 gene locus_tag LOCUS_22120 372 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 709 362 gene locus_tag LOCUS_22130 709 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence249 81 156 gene locus_tag LOCUS_t00410 81 156 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 357 935 gene locus_tag LOCUS_22140 357 935 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_22140 1026 1793 gene locus_tag LOCUS_22150 1026 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2301 1753 gene locus_tag LOCUS_22160 2301 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence250 <1 721 gene locus_tag LOCUS_22170 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785879.1:potassium transporter TrkG 735 1433 gene locus_tag LOCUS_22180 735 1433 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence251 <1 533 gene locus_tag LOCUS_22190 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268560.1:SDR family oxidoreductase 596 1381 gene locus_tag LOCUS_22200 596 1381 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_22200 2333 1461 gene locus_tag LOCUS_22210 2333 1461 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence252 387 311 gene locus_tag LOCUS_t00420 387 311 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 758 2167 gene locus_tag LOCUS_22220 758 2167 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence253 390 399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1716 997 gene locus_tag LOCUS_22230 1716 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2247 1732 gene locus_tag LOCUS_22240 2247 1732 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087344.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence254 <2325 1608 gene locus_tag LOCUS_22250 <2325 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191664.1:inositol monophosphatase family protein >Feature sequence255 1329 925 gene locus_tag LOCUS_22260 1329 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1597 1752 gene locus_tag LOCUS_22270 1597 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2273 1872 gene locus_tag LOCUS_22280 2273 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence256 1131 526 gene locus_tag LOCUS_22290 1131 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1901 1119 gene locus_tag LOCUS_22300 1901 1119 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813853.1 protein_id gnl|my_center|LOCUS_22300 2233 1904 gene locus_tag LOCUS_22310 2233 1904 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence257 <1 1888 gene locus_tag LOCUS_22320 <1 1888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087206.1:type IV secretion system protein TraC >Feature sequence258 447 456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 574 1017 gene locus_tag LOCUS_22330 574 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2226 1126 gene locus_tag LOCUS_22340 gene glf 2226 1126 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence259 >Feature sequence260 133 208 gene locus_tag LOCUS_t00430 133 208 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 261 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1853 402 gene locus_tag LOCUS_22350 1853 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence261 155 2092 gene locus_tag LOCUS_22360 155 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence262 299 1747 gene locus_tag LOCUS_22370 299 1747 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242995.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence263 2 1300 gene locus_tag LOCUS_22380 gene argH 2 1300 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870298.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence264 <1 1334 gene locus_tag LOCUS_22390 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202731.1:MATE family efflux transporter 1887 1414 gene locus_tag LOCUS_22400 1887 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence265 >Feature sequence266 1874 1290 gene locus_tag LOCUS_22410 1874 1290 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence267 <2052 1454 gene locus_tag LOCUS_22420 <2052 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261842.1:heme anaerobic degradation radical SAM methyltransferase ChuW/HutW >Feature sequence268 3 383 gene locus_tag LOCUS_22430 3 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence269 1748 222 gene locus_tag LOCUS_22440 1748 222 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_22440 1926 2002 gene locus_tag LOCUS_t00440 1926 2002 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence270 466 1494 gene locus_tag LOCUS_22450 466 1494 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence271 <1 714 gene locus_tag LOCUS_22460 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948398.1:tRNA-dihydrouridine synthase family protein 1604 732 gene locus_tag LOCUS_22470 gene pstA 1604 732 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence272 <1 977 gene locus_tag LOCUS_22480 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016040.1:EamA family transporter 1079 1882 gene locus_tag LOCUS_22490 gene thyA 1079 1882 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence273 1604 609 gene locus_tag LOCUS_22500 1604 609 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence274 766 80 gene locus_tag LOCUS_22510 766 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1697 906 gene locus_tag LOCUS_22520 1697 906 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893097.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence275 <1 1086 gene locus_tag LOCUS_22530 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966051.1:FAD:protein FMN transferase 1516 1205 gene locus_tag LOCUS_22540 gene rpsJ 1516 1205 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence276 877 92 gene locus_tag LOCUS_22550 877 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 <1655 874 gene locus_tag LOCUS_22560 <1655 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707707.1:bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA >Feature sequence277 76 1047 gene locus_tag LOCUS_22570 76 1047 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816572.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence278 940 949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence279 515 171 gene locus_tag LOCUS_22580 515 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 <1610 565 gene locus_tag LOCUS_22590 <1610 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816607.1:FAD-binding protein >Feature sequence280 >Feature sequence281 232 1440 gene locus_tag LOCUS_22600 gene trpB 232 1440 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence282 >Feature sequence283 788 1438 gene locus_tag LOCUS_22610 788 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence284 >Feature sequence285 163 1413 gene locus_tag LOCUS_22620 163 1413 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence286 1445 822 gene locus_tag LOCUS_22630 1445 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence287 <1502 672 gene locus_tag LOCUS_22640 <1502 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939747.1:phosphate ABC transporter substrate-binding protein >Feature sequence288 <1 1182 gene locus_tag LOCUS_22650 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074216.1:urocanate reductase >Feature sequence289 >Feature sequence290 <1 1332 gene locus_tag LOCUS_22660 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003689506.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence291 >Feature sequence292 916 113 gene locus_tag LOCUS_22670 916 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1277 1053 gene locus_tag LOCUS_22680 1277 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence293 1065 136 gene locus_tag LOCUS_22690 1065 136 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_22690