>Feature sequence01 32 454 gene locus_tag LOCUS_00010 32 454 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_00010 561 1019 gene locus_tag LOCUS_00020 561 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1217 1077 gene locus_tag LOCUS_00030 1217 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1484 2359 gene locus_tag LOCUS_00040 gene focA 1484 2359 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694105.1 protein_id gnl|my_center|LOCUS_00040 4077 2455 gene locus_tag LOCUS_00050 4077 2455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_00050 5555 4209 gene locus_tag LOCUS_00060 5555 4209 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369739.1 protein_id gnl|my_center|LOCUS_00060 5975 6304 gene locus_tag LOCUS_00070 5975 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6294 6500 gene locus_tag LOCUS_00080 6294 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00080 7318 6839 gene locus_tag LOCUS_00090 7318 6839 CDS product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050789038.1 protein_id gnl|my_center|LOCUS_00090 7600 8571 gene locus_tag LOCUS_00100 gene kdsD 7600 8571 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_00100 8598 10028 gene locus_tag LOCUS_00110 gene hldE 8598 10028 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869160.1 protein_id gnl|my_center|LOCUS_00110 10048 10389 gene locus_tag LOCUS_00120 10048 10389 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_00120 12417 10798 gene locus_tag LOCUS_00130 12417 10798 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00130 15307 12782 gene locus_tag LOCUS_00140 15307 12782 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_00140 16537 15410 gene locus_tag LOCUS_00150 gene flhB 16537 15410 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705284.1 protein_id gnl|my_center|LOCUS_00150 18457 16541 gene locus_tag LOCUS_00160 gene parE 18457 16541 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195296.1 protein_id gnl|my_center|LOCUS_00160 21159 19747 gene locus_tag LOCUS_00170 21159 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21815 21135 gene locus_tag LOCUS_00180 21815 21135 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_00180 22781 22182 gene locus_tag LOCUS_00190 22781 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23236 24504 gene locus_tag LOCUS_00200 23236 24504 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_00200 25352 24528 gene locus_tag LOCUS_00210 gene cpdA 25352 24528 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_00210 26272 25628 gene locus_tag LOCUS_00220 gene nudF 26272 25628 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 protein_id gnl|my_center|LOCUS_00220 26333 27673 gene locus_tag LOCUS_00230 26333 27673 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_00230 28483 27791 gene locus_tag LOCUS_00240 28483 27791 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 protein_id gnl|my_center|LOCUS_00240 29157 28483 gene locus_tag LOCUS_00250 gene rpe 29157 28483 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 protein_id gnl|my_center|LOCUS_00250 31068 29158 gene locus_tag LOCUS_00260 31068 29158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32155 31070 gene locus_tag LOCUS_00270 gene aroB 32155 31070 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 protein_id gnl|my_center|LOCUS_00270 32676 32143 gene locus_tag LOCUS_00280 gene aroK 32676 32143 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116987.1 protein_id gnl|my_center|LOCUS_00280 32902 35379 gene locus_tag LOCUS_00290 32902 35379 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706971.1 protein_id gnl|my_center|LOCUS_00290 36465 35497 gene locus_tag LOCUS_00300 36465 35497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00300 37132 36455 gene locus_tag LOCUS_00310 37132 36455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 37315 38082 gene locus_tag LOCUS_00320 37315 38082 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_00320 39342 38170 gene locus_tag LOCUS_00330 39342 38170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_00330 41318 39678 gene locus_tag LOCUS_00340 gene groL 41318 39678 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704804.1 protein_id gnl|my_center|LOCUS_00340 41659 41369 gene locus_tag LOCUS_00350 41659 41369 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687043.1 protein_id gnl|my_center|LOCUS_00350 42958 41981 gene locus_tag LOCUS_00360 42958 41981 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101810.1 protein_id gnl|my_center|LOCUS_00360 43899 43693 gene locus_tag LOCUS_00370 43899 43693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44003 44341 gene locus_tag LOCUS_00380 44003 44341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45250 44807 gene locus_tag LOCUS_00390 45250 44807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45923 47536 gene locus_tag LOCUS_00400 45923 47536 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_00400 48581 48114 gene locus_tag LOCUS_00410 gene flgC 48581 48114 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_00410 49012 48596 gene locus_tag LOCUS_00420 gene flgB 49012 48596 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 protein_id gnl|my_center|LOCUS_00420 50949 49222 gene locus_tag LOCUS_00430 50949 49222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52134 51142 gene locus_tag LOCUS_00440 52134 51142 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_00440 52598 53185 gene locus_tag LOCUS_00450 52598 53185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53492 53815 gene locus_tag LOCUS_00460 53492 53815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54789 53917 gene locus_tag LOCUS_00470 54789 53917 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_00470 55569 55252 gene locus_tag LOCUS_00480 55569 55252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56823 55723 gene locus_tag LOCUS_00490 56823 55723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57224 56859 gene locus_tag LOCUS_00500 57224 56859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57988 57515 gene locus_tag LOCUS_00510 57988 57515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58459 57998 gene locus_tag LOCUS_00520 58459 57998 CDS product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705018.1 protein_id gnl|my_center|LOCUS_00520 59547 58468 gene locus_tag LOCUS_00530 59547 58468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59682 60839 gene locus_tag LOCUS_00540 59682 60839 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705016.1 protein_id gnl|my_center|LOCUS_00540 60891 60965 gene locus_tag LOCUS_t00010 60891 60965 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62815 60983 gene locus_tag LOCUS_00550 62815 60983 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00550 63686 62925 gene locus_tag LOCUS_00560 63686 62925 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894166.1 protein_id gnl|my_center|LOCUS_00560 65211 63760 gene locus_tag LOCUS_00570 65211 63760 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019829359.1 protein_id gnl|my_center|LOCUS_00570 66258 65233 gene locus_tag LOCUS_00580 66258 65233 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 protein_id gnl|my_center|LOCUS_00580 67175 66390 gene locus_tag LOCUS_00590 gene thiF 67175 66390 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_00590 71279 67386 gene locus_tag LOCUS_00600 gene purL 71279 67386 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_00600 71598 71738 gene locus_tag LOCUS_00610 71598 71738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71960 72427 gene locus_tag LOCUS_00620 gene fliS 71960 72427 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705592.1 protein_id gnl|my_center|LOCUS_00620 72437 72772 gene locus_tag LOCUS_00630 72437 72772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72819 75077 gene locus_tag LOCUS_00640 72819 75077 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819987.1 protein_id gnl|my_center|LOCUS_00640 75281 75628 gene locus_tag LOCUS_00650 75281 75628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75628 75903 gene locus_tag LOCUS_00660 75628 75903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 77707 75950 gene locus_tag LOCUS_00670 gene der 77707 75950 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705649.1 protein_id gnl|my_center|LOCUS_00670 79319 77802 gene locus_tag LOCUS_00680 79319 77802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80102 79401 gene locus_tag LOCUS_00690 80102 79401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 81430 80153 gene locus_tag LOCUS_00700 gene hisS 81430 80153 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_00700 82529 81447 gene locus_tag LOCUS_00710 gene ispG 82529 81447 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705645.1 protein_id gnl|my_center|LOCUS_00710 84289 82541 gene locus_tag LOCUS_00720 84289 82541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 85410 84313 gene locus_tag LOCUS_00730 85410 84313 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073191.1 protein_id gnl|my_center|LOCUS_00730 85768 85496 gene locus_tag LOCUS_00740 85768 85496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 86016 86222 gene locus_tag LOCUS_00750 86016 86222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 86946 86212 gene locus_tag LOCUS_00760 gene cobB 86946 86212 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194688031.1 protein_id gnl|my_center|LOCUS_00760 88485 87133 gene locus_tag LOCUS_00770 gene pepB 88485 87133 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107237.1 protein_id gnl|my_center|LOCUS_00770 89651 88470 gene locus_tag LOCUS_00780 89651 88470 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 protein_id gnl|my_center|LOCUS_00780 90163 89750 gene locus_tag LOCUS_00790 90163 89750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 91154 90174 gene locus_tag LOCUS_00800 gene nlpI 91154 90174 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705628.1 protein_id gnl|my_center|LOCUS_00800 92122 91175 gene locus_tag LOCUS_00810 gene secF 92122 91175 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073006.1 protein_id gnl|my_center|LOCUS_00810 94008 92134 gene locus_tag LOCUS_00820 gene secD 94008 92134 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_00820 94455 94078 gene locus_tag LOCUS_00830 gene yajC 94455 94078 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 protein_id gnl|my_center|LOCUS_00830 95804 94683 gene locus_tag LOCUS_00840 gene tgt 95804 94683 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 protein_id gnl|my_center|LOCUS_00840 96928 95849 gene locus_tag LOCUS_00850 gene queA 96928 95849 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694057.1 protein_id gnl|my_center|LOCUS_00850 98711 97053 gene locus_tag LOCUS_00860 98711 97053 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121745.1 protein_id gnl|my_center|LOCUS_00860 99169 100740 gene locus_tag LOCUS_00870 99169 100740 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_00870 101305 102696 gene locus_tag LOCUS_00880 101305 102696 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461736.1 protein_id gnl|my_center|LOCUS_00880 102709 103545 gene locus_tag LOCUS_00890 102709 103545 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705224.1 protein_id gnl|my_center|LOCUS_00890 104780 103641 gene locus_tag LOCUS_00900 104780 103641 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 protein_id gnl|my_center|LOCUS_00900 105260 104925 gene locus_tag LOCUS_00910 105260 104925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 105397 106866 gene locus_tag LOCUS_00920 105397 106866 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 protein_id gnl|my_center|LOCUS_00920 107095 107946 gene locus_tag LOCUS_00930 gene panC 107095 107946 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_00930 107949 108329 gene locus_tag LOCUS_00940 gene panD 107949 108329 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_00940 108329 109285 gene locus_tag LOCUS_00950 108329 109285 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_00950 110104 109388 gene locus_tag LOCUS_00960 gene hda 110104 109388 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205596950.1 protein_id gnl|my_center|LOCUS_00960 111412 110141 gene locus_tag LOCUS_00970 111412 110141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 111545 112597 gene locus_tag LOCUS_00980 gene purM 111545 112597 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 protein_id gnl|my_center|LOCUS_00980 112877 114763 gene locus_tag LOCUS_00990 gene speA 112877 114763 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 protein_id gnl|my_center|LOCUS_00990 114763 115677 gene locus_tag LOCUS_01000 gene speB 114763 115677 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 protein_id gnl|my_center|LOCUS_01000 116677 115763 gene locus_tag LOCUS_01010 116677 115763 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_01010 118443 116731 gene locus_tag LOCUS_01020 118443 116731 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382333.1 protein_id gnl|my_center|LOCUS_01020 119020 120996 gene locus_tag LOCUS_01030 119020 120996 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 protein_id gnl|my_center|LOCUS_01030 121695 121114 gene locus_tag LOCUS_01040 gene lpcA 121695 121114 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420499.1 protein_id gnl|my_center|LOCUS_01040 122654 121725 gene locus_tag LOCUS_01050 122654 121725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 123134 123601 gene locus_tag LOCUS_01060 gene rnhA 123134 123601 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072513.1 protein_id gnl|my_center|LOCUS_01060 123665 124666 gene locus_tag LOCUS_01070 123665 124666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 126931 124802 gene locus_tag LOCUS_01080 gene ligA 126931 124802 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_01080 127683 126937 gene locus_tag LOCUS_01090 127683 126937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 127981 128757 gene locus_tag LOCUS_01100 gene cysZ 127981 128757 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167408.1 protein_id gnl|my_center|LOCUS_01100 128887 130533 gene locus_tag LOCUS_01110 gene ptsP 128887 130533 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_01110 130597 131133 gene locus_tag LOCUS_01120 gene crr 130597 131133 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861316.1 protein_id gnl|my_center|LOCUS_01120 131914 131264 gene locus_tag LOCUS_01130 131914 131264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 132250 132107 gene locus_tag LOCUS_01140 132250 132107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 133810 132380 gene locus_tag LOCUS_01150 gene pntB 133810 132380 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_01150 135367 133832 gene locus_tag LOCUS_01160 135367 133832 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073522.1 protein_id gnl|my_center|LOCUS_01160 137517 135841 gene locus_tag LOCUS_01170 137517 135841 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_01170 137889 140240 gene locus_tag LOCUS_01180 137889 140240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 141522 140503 gene locus_tag LOCUS_01190 141522 140503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 142032 141532 gene locus_tag LOCUS_01200 gene rimI 142032 141532 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 protein_id gnl|my_center|LOCUS_01200 142826 142029 gene locus_tag LOCUS_01210 142826 142029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 144516 142849 gene locus_tag LOCUS_01220 144516 142849 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_01220 144935 144651 gene locus_tag LOCUS_01230 144935 144651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 145468 145393 gene locus_tag LOCUS_t00020 145468 145393 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 146777 145584 gene locus_tag LOCUS_01240 146777 145584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393813.1 protein_id gnl|my_center|LOCUS_01240 147852 146770 gene locus_tag LOCUS_01250 147852 146770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 148171 148791 gene locus_tag LOCUS_01260 148171 148791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 148784 149761 gene locus_tag LOCUS_01270 148784 149761 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_01270 149799 151637 gene locus_tag LOCUS_01280 149799 151637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 151650 152747 gene locus_tag LOCUS_01290 151650 152747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_01290 152744 153844 gene locus_tag LOCUS_01300 152744 153844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_01300 153989 154912 gene locus_tag LOCUS_01310 gene pyrB 153989 154912 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 protein_id gnl|my_center|LOCUS_01310 154914 155414 gene locus_tag LOCUS_01320 gene pyrI 154914 155414 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 protein_id gnl|my_center|LOCUS_01320 155729 155526 gene locus_tag LOCUS_01330 155729 155526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 158020 156050 gene locus_tag LOCUS_01340 158020 156050 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_01340 159711 158266 gene locus_tag LOCUS_01350 159711 158266 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_01350 161324 160002 gene locus_tag LOCUS_01360 161324 160002 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_01360 161609 161466 gene locus_tag LOCUS_01370 161609 161466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 161854 163179 gene locus_tag LOCUS_01380 161854 163179 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_01380 163231 163470 gene locus_tag LOCUS_01390 163231 163470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 163668 164984 gene locus_tag LOCUS_01400 163668 164984 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071689.1 protein_id gnl|my_center|LOCUS_01400 166148 165087 gene locus_tag LOCUS_01410 gene trpS 166148 165087 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_01410 167405 166551 gene locus_tag LOCUS_01420 167405 166551 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_01420 167733 167560 gene locus_tag LOCUS_01430 167733 167560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 168807 167761 gene locus_tag LOCUS_01440 168807 167761 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_01440 170563 169187 gene locus_tag LOCUS_01450 gene rlmD 170563 169187 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_01450 170681 171202 gene locus_tag LOCUS_01460 170681 171202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 171299 171223 gene locus_tag LOCUS_t00030 171299 171223 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 173193 171340 gene locus_tag LOCUS_01470 gene dnaG 173193 171340 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649498.1 protein_id gnl|my_center|LOCUS_01470 173449 174315 gene locus_tag LOCUS_01480 gene apaH 173449 174315 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 protein_id gnl|my_center|LOCUS_01480 174711 175568 gene locus_tag LOCUS_01490 174711 175568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 175579 176973 gene locus_tag LOCUS_01500 175579 176973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 177503 177024 gene locus_tag LOCUS_01510 gene dfrA 177503 177024 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_01510 178651 177506 gene locus_tag LOCUS_01520 gene cgtA 178651 177506 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673554.1 protein_id gnl|my_center|LOCUS_01520 179046 178783 gene locus_tag LOCUS_01530 gene rpmA 179046 178783 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 protein_id gnl|my_center|LOCUS_01530 179380 179069 gene locus_tag LOCUS_01540 gene rplU 179380 179069 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_01540 179694 180662 gene locus_tag LOCUS_01550 gene ispB 179694 180662 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479642.1 protein_id gnl|my_center|LOCUS_01550 181170 180760 gene locus_tag LOCUS_01560 181170 180760 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_01560 182572 181271 gene locus_tag LOCUS_01570 gene purA 182572 181271 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989280.1 protein_id gnl|my_center|LOCUS_01570 183684 182638 gene locus_tag LOCUS_01580 gene hflC 183684 182638 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209155.1 protein_id gnl|my_center|LOCUS_01580 184934 183684 gene locus_tag LOCUS_01590 gene hflK 184934 183684 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 protein_id gnl|my_center|LOCUS_01590 186282 184939 gene locus_tag LOCUS_01600 gene hflX 186282 184939 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460377.1 protein_id gnl|my_center|LOCUS_01600 186564 186307 gene locus_tag LOCUS_01610 gene hfq 186564 186307 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704864.1 protein_id gnl|my_center|LOCUS_01610 188042 186840 gene locus_tag LOCUS_01620 188042 186840 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_01620 189223 188324 gene locus_tag LOCUS_01630 189223 188324 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_01630 190271 189258 gene locus_tag LOCUS_01640 190271 189258 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_01640 190439 190448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 190733 192337 gene locus_tag LOCUS_01650 190733 192337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 192613 192936 gene locus_tag LOCUS_01660 192613 192936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01660 193132 193500 gene locus_tag LOCUS_01670 193132 193500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 193583 194470 gene locus_tag LOCUS_01680 193583 194470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 194491 195348 gene locus_tag LOCUS_01690 194491 195348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 197057 195447 gene locus_tag LOCUS_01700 gene pnbA 197057 195447 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_01700 198016 197057 gene locus_tag LOCUS_01710 gene miaA 198016 197057 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693854.1 protein_id gnl|my_center|LOCUS_01710 200120 198006 gene locus_tag LOCUS_01720 200120 198006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 201825 200128 gene locus_tag LOCUS_01730 201825 200128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 202420 201932 gene locus_tag LOCUS_01740 gene tsaE 202420 201932 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_01740 204032 202488 gene locus_tag LOCUS_01750 204032 202488 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130880.1 protein_id gnl|my_center|LOCUS_01750 204598 204146 gene locus_tag LOCUS_01760 204598 204146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 204979 204776 gene locus_tag LOCUS_01770 204979 204776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 205760 206497 gene locus_tag LOCUS_01780 205760 206497 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_01780 206888 207262 gene locus_tag LOCUS_01790 206888 207262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 209066 207369 gene locus_tag LOCUS_01800 gene recJ 209066 207369 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098610.1 protein_id gnl|my_center|LOCUS_01800 209625 210284 gene locus_tag LOCUS_01810 209625 210284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 210735 210301 gene locus_tag LOCUS_01820 210735 210301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 210905 212329 gene locus_tag LOCUS_01830 210905 212329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 212326 213213 gene locus_tag LOCUS_01840 gene prmA 212326 213213 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 protein_id gnl|my_center|LOCUS_01840 214304 213288 gene locus_tag LOCUS_01850 214304 213288 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938461.1 protein_id gnl|my_center|LOCUS_01850 215391 214702 gene locus_tag LOCUS_01860 gene urtE 215391 214702 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 protein_id gnl|my_center|LOCUS_01860 216206 215403 gene locus_tag LOCUS_01870 gene urtD 216206 215403 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 protein_id gnl|my_center|LOCUS_01870 217407 216208 gene locus_tag LOCUS_01880 gene urtC 217407 216208 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_01880 218344 217418 gene locus_tag LOCUS_01890 gene urtB 218344 217418 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_01890 219644 218418 gene locus_tag LOCUS_01900 gene urtA 219644 218418 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965210.1 protein_id gnl|my_center|LOCUS_01900 219822 223235 gene locus_tag LOCUS_01910 219822 223235 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972310.1 protein_id gnl|my_center|LOCUS_01910 223239 224141 gene locus_tag LOCUS_01920 223239 224141 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 protein_id gnl|my_center|LOCUS_01920 224412 224606 gene locus_tag LOCUS_01930 gene tatA 224412 224606 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199902.1 protein_id gnl|my_center|LOCUS_01930 224607 225044 gene locus_tag LOCUS_01940 224607 225044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 225115 225885 gene locus_tag LOCUS_01950 gene tatC 225115 225885 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222849.1 protein_id gnl|my_center|LOCUS_01950 226124 227455 gene locus_tag LOCUS_01960 226124 227455 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390757.1 protein_id gnl|my_center|LOCUS_01960 228820 228008 gene locus_tag LOCUS_01970 gene fabG 228820 228008 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_01970 229852 228833 gene locus_tag LOCUS_01980 229852 228833 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974512.1 protein_id gnl|my_center|LOCUS_01980 230144 231274 gene locus_tag LOCUS_01990 230144 231274 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390763.1 protein_id gnl|my_center|LOCUS_01990 231438 231271 gene locus_tag LOCUS_02000 231438 231271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 231968 233083 gene locus_tag LOCUS_02010 231968 233083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390762.1 protein_id gnl|my_center|LOCUS_02010 233099 233995 gene locus_tag LOCUS_02020 233099 233995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390761.1 protein_id gnl|my_center|LOCUS_02020 234005 234814 gene locus_tag LOCUS_02030 234005 234814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390760.1 protein_id gnl|my_center|LOCUS_02030 234930 235724 gene locus_tag LOCUS_02040 234930 235724 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390758.1 protein_id gnl|my_center|LOCUS_02040 235783 236271 gene locus_tag LOCUS_02050 235783 236271 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_02050 236448 238106 gene locus_tag LOCUS_02060 236448 238106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 238340 239083 gene locus_tag LOCUS_02070 238340 239083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 239522 239307 gene locus_tag LOCUS_02080 239522 239307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 239705 239896 gene locus_tag LOCUS_02090 239705 239896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 240640 239888 gene locus_tag LOCUS_02100 240640 239888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 241009 242376 gene locus_tag LOCUS_02110 241009 242376 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_02110 242471 244651 gene locus_tag LOCUS_02120 242471 244651 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_02120 246689 244674 gene locus_tag LOCUS_02130 246689 244674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 246922 248103 gene locus_tag LOCUS_02140 246922 248103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 250125 248356 gene locus_tag LOCUS_02150 250125 248356 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence02 <1 449 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttccccacgttgtggggatgtttct 693 1910 gene locus_tag LOCUS_02160 gene rluB 693 1910 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072081652.1 protein_id gnl|my_center|LOCUS_02160 1956 3149 gene locus_tag LOCUS_02170 1956 3149 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116616918.1 protein_id gnl|my_center|LOCUS_02170 3439 5043 gene locus_tag LOCUS_02180 3439 5043 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 protein_id gnl|my_center|LOCUS_02180 5245 5745 gene locus_tag LOCUS_02190 gene rimP 5245 5745 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071432.1 protein_id gnl|my_center|LOCUS_02190 5764 7251 gene locus_tag LOCUS_02200 gene nusA 5764 7251 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 protein_id gnl|my_center|LOCUS_02200 7267 9795 gene locus_tag LOCUS_02210 gene infB 7267 9795 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 protein_id gnl|my_center|LOCUS_02210 9804 10160 gene locus_tag LOCUS_02220 gene rbfA 9804 10160 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_02220 10733 10461 gene locus_tag LOCUS_02230 10733 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10890 11807 gene locus_tag LOCUS_02240 gene nadK 10890 11807 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 protein_id gnl|my_center|LOCUS_02240 11846 13522 gene locus_tag LOCUS_02250 gene recN 11846 13522 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073309.1 protein_id gnl|my_center|LOCUS_02250 13537 14031 gene locus_tag LOCUS_02260 13537 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14024 14800 gene locus_tag LOCUS_02270 gene dapB 14024 14800 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544030.1 protein_id gnl|my_center|LOCUS_02270 15657 14902 gene locus_tag LOCUS_02280 15657 14902 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_02280 16643 16371 gene locus_tag LOCUS_02290 16643 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02290 16792 16643 gene locus_tag LOCUS_02300 16792 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02300 18282 16930 gene locus_tag LOCUS_02310 gene gdhA 18282 16930 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263849.1 protein_id gnl|my_center|LOCUS_02310 20224 18773 gene locus_tag LOCUS_02320 20224 18773 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_02320 24812 20226 gene locus_tag LOCUS_02330 24812 20226 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_02330 26363 24945 gene locus_tag LOCUS_02340 gene glnA 26363 24945 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 protein_id gnl|my_center|LOCUS_02340 27789 27292 gene locus_tag LOCUS_02350 27789 27292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_02350 28096 28257 gene locus_tag LOCUS_02360 28096 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 28370 28681 gene locus_tag LOCUS_02370 28370 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02370 28678 29181 gene locus_tag LOCUS_02380 28678 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 29234 30199 gene locus_tag LOCUS_02390 29234 30199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 30666 31484 gene locus_tag LOCUS_02400 30666 31484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 34997 31764 gene locus_tag LOCUS_02410 gene carB 34997 31764 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 protein_id gnl|my_center|LOCUS_02410 36147 35008 gene locus_tag LOCUS_02420 gene carA 36147 35008 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_02420 36720 36568 gene locus_tag LOCUS_02430 36720 36568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 36713 38455 gene locus_tag LOCUS_02440 36713 38455 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_02440 38487 42416 gene locus_tag LOCUS_02450 gene tamB 38487 42416 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 protein_id gnl|my_center|LOCUS_02450 42509 44104 gene locus_tag LOCUS_02460 42509 44104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 44398 44652 gene locus_tag LOCUS_02470 44398 44652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 44760 45131 gene locus_tag LOCUS_02480 44760 45131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 45361 46110 gene locus_tag LOCUS_02490 45361 46110 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_02490 46749 46195 gene locus_tag LOCUS_02500 46749 46195 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_02500 46949 46874 gene locus_tag LOCUS_t00040 46949 46874 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 47032 47131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48984 47314 gene locus_tag LOCUS_02510 gene bcsG 48984 47314 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 protein_id gnl|my_center|LOCUS_02510 50415 49081 gene locus_tag LOCUS_02520 gene bcsG 50415 49081 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192026.1 protein_id gnl|my_center|LOCUS_02520 50525 50719 gene locus_tag LOCUS_02530 50525 50719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 50863 50678 gene locus_tag LOCUS_02540 50863 50678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 52457 50856 gene locus_tag LOCUS_02550 52457 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 55639 52460 gene locus_tag LOCUS_02560 55639 52460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 56789 55749 gene locus_tag LOCUS_02570 gene bcsZ 56789 55749 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263699.1 protein_id gnl|my_center|LOCUS_02570 59104 56801 gene locus_tag LOCUS_02580 gene bcsB 59104 56801 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823808.1 protein_id gnl|my_center|LOCUS_02580 61745 59115 gene locus_tag LOCUS_02590 gene bcsA 61745 59115 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025858.1 protein_id gnl|my_center|LOCUS_02590 62494 61745 gene locus_tag LOCUS_02600 62494 61745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 62774 62505 gene locus_tag LOCUS_02610 62774 62505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 63271 65310 gene locus_tag LOCUS_02620 gene uvrB 63271 65310 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 protein_id gnl|my_center|LOCUS_02620 65903 65373 gene locus_tag LOCUS_02630 65903 65373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 66138 66992 gene locus_tag LOCUS_02640 gene suhB 66138 66992 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553449.1 protein_id gnl|my_center|LOCUS_02640 67751 67050 gene locus_tag LOCUS_02650 67751 67050 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263231.1 protein_id gnl|my_center|LOCUS_02650 69628 67754 gene locus_tag LOCUS_02660 69628 67754 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 protein_id gnl|my_center|LOCUS_02660 72354 69832 gene locus_tag LOCUS_02670 72354 69832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 72868 73848 gene locus_tag LOCUS_02680 gene rluC 72868 73848 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 protein_id gnl|my_center|LOCUS_02680 73854 74579 gene locus_tag LOCUS_02690 73854 74579 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_02690 75345 74644 gene locus_tag LOCUS_02700 75345 74644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 75466 76002 gene locus_tag LOCUS_02710 gene yceD 75466 76002 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 protein_id gnl|my_center|LOCUS_02710 76232 76450 gene locus_tag LOCUS_02720 76232 76450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 76532 77509 gene locus_tag LOCUS_02730 gene plsX 76532 77509 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490633.1 protein_id gnl|my_center|LOCUS_02730 77579 78535 gene locus_tag LOCUS_02740 77579 78535 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 protein_id gnl|my_center|LOCUS_02740 78589 79521 gene locus_tag LOCUS_02750 gene fabD 78589 79521 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_02750 79534 80280 gene locus_tag LOCUS_02760 gene fabG 79534 80280 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_02760 80503 80745 gene locus_tag LOCUS_02770 gene acpP 80503 80745 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 protein_id gnl|my_center|LOCUS_02770 80866 82116 gene locus_tag LOCUS_02780 gene fabF 80866 82116 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_02780 82717 82151 gene locus_tag LOCUS_02790 gene traF 82717 82151 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 protein_id gnl|my_center|LOCUS_02790 83730 82876 gene locus_tag LOCUS_02800 83730 82876 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423346.1 protein_id gnl|my_center|LOCUS_02800 84006 84905 gene locus_tag LOCUS_02810 84006 84905 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859383.1 protein_id gnl|my_center|LOCUS_02810 85184 86710 gene locus_tag LOCUS_02820 gene hutW 85184 86710 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175593.1 protein_id gnl|my_center|LOCUS_02820 86786 88963 gene locus_tag LOCUS_02830 86786 88963 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 protein_id gnl|my_center|LOCUS_02830 89020 89556 gene locus_tag LOCUS_02840 89020 89556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 89534 90307 gene locus_tag LOCUS_02850 89534 90307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 90304 91695 gene locus_tag LOCUS_02860 90304 91695 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682198.1 protein_id gnl|my_center|LOCUS_02860 91717 92214 gene locus_tag LOCUS_02870 91717 92214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 92260 92775 gene locus_tag LOCUS_02880 92260 92775 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_02880 92777 93379 gene locus_tag LOCUS_02890 92777 93379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 93426 93875 gene locus_tag LOCUS_02900 93426 93875 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 protein_id gnl|my_center|LOCUS_02900 93902 94666 gene locus_tag LOCUS_02910 93902 94666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 94854 95666 gene locus_tag LOCUS_02920 94854 95666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 95663 96082 gene locus_tag LOCUS_02930 gene ruvX 95663 96082 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073217.1 protein_id gnl|my_center|LOCUS_02930 96075 96410 gene locus_tag LOCUS_02940 96075 96410 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 protein_id gnl|my_center|LOCUS_02940 96466 98676 gene locus_tag LOCUS_02950 gene flhA 96466 98676 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705285.1 protein_id gnl|my_center|LOCUS_02950 98838 100319 gene locus_tag LOCUS_02960 gene flhF 98838 100319 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457694.1 protein_id gnl|my_center|LOCUS_02960 100347 101177 gene locus_tag LOCUS_02970 100347 101177 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420320.1 protein_id gnl|my_center|LOCUS_02970 101236 101976 gene locus_tag LOCUS_02980 101236 101976 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073095.1 protein_id gnl|my_center|LOCUS_02980 102087 102470 gene locus_tag LOCUS_02990 gene cheY 102087 102470 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_02990 102481 103236 gene locus_tag LOCUS_03000 102481 103236 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262351.1 protein_id gnl|my_center|LOCUS_03000 103255 105303 gene locus_tag LOCUS_03010 103255 105303 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 protein_id gnl|my_center|LOCUS_03010 105344 106690 gene locus_tag LOCUS_03020 105344 106690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 106747 107496 gene locus_tag LOCUS_03030 106747 107496 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705668.1 protein_id gnl|my_center|LOCUS_03030 107513 108721 gene locus_tag LOCUS_03040 107513 108721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 108779 109675 gene locus_tag LOCUS_03050 108779 109675 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479466.1 protein_id gnl|my_center|LOCUS_03050 109705 110727 gene locus_tag LOCUS_03060 109705 110727 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262349.1 protein_id gnl|my_center|LOCUS_03060 110865 111371 gene locus_tag LOCUS_03070 110865 111371 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 protein_id gnl|my_center|LOCUS_03070 112137 111484 gene locus_tag LOCUS_03080 112137 111484 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816243.1 protein_id gnl|my_center|LOCUS_03080 112393 113118 gene locus_tag LOCUS_03090 112393 113118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 113127 113654 gene locus_tag LOCUS_03100 113127 113654 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_03100 113663 114205 gene locus_tag LOCUS_03110 113663 114205 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880124.1 protein_id gnl|my_center|LOCUS_03110 114227 115000 gene locus_tag LOCUS_03120 114227 115000 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775643.1 protein_id gnl|my_center|LOCUS_03120 116705 115026 gene locus_tag LOCUS_03130 116705 115026 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705772.1 protein_id gnl|my_center|LOCUS_03130 117974 116955 gene locus_tag LOCUS_03140 gene terC 117974 116955 CDS product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 protein_id gnl|my_center|LOCUS_03140 118641 118138 gene locus_tag LOCUS_03150 118641 118138 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_03150 119803 118667 gene locus_tag LOCUS_03160 119803 118667 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_03160 121130 119943 gene locus_tag LOCUS_03170 121130 119943 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071524.1 protein_id gnl|my_center|LOCUS_03170 121245 122432 gene locus_tag LOCUS_03180 gene tyrS 121245 122432 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633247.1 protein_id gnl|my_center|LOCUS_03180 122446 123108 gene locus_tag LOCUS_03190 gene rpiA 122446 123108 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_03190 123268 124947 gene locus_tag LOCUS_03200 123268 124947 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_03200 125357 125779 gene locus_tag LOCUS_03210 125357 125779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 125814 127667 gene locus_tag LOCUS_03220 gene fliF 125814 127667 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705272.1 protein_id gnl|my_center|LOCUS_03220 127677 128786 gene locus_tag LOCUS_03230 gene fliG 127677 128786 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705273.1 protein_id gnl|my_center|LOCUS_03230 128867 130147 gene locus_tag LOCUS_03240 128867 130147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 130159 131634 gene locus_tag LOCUS_03250 gene fliI 130159 131634 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_03250 131664 132128 gene locus_tag LOCUS_03260 131664 132128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 132319 132768 gene locus_tag LOCUS_03270 132319 132768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 133135 135063 gene locus_tag LOCUS_03280 133135 135063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 135120 135656 gene locus_tag LOCUS_03290 135120 135656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 135668 136714 gene locus_tag LOCUS_03300 gene fliM 135668 136714 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 protein_id gnl|my_center|LOCUS_03300 136723 137124 gene locus_tag LOCUS_03310 gene fliN 136723 137124 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457660.1 protein_id gnl|my_center|LOCUS_03310 137126 137554 gene locus_tag LOCUS_03320 137126 137554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 137568 138386 gene locus_tag LOCUS_03330 gene fliP 137568 138386 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705281.1 protein_id gnl|my_center|LOCUS_03330 138390 138659 gene locus_tag LOCUS_03340 gene fliQ 138390 138659 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705282.1 protein_id gnl|my_center|LOCUS_03340 138659 139450 gene locus_tag LOCUS_03350 gene fliR 138659 139450 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 protein_id gnl|my_center|LOCUS_03350 139687 139469 gene locus_tag LOCUS_03360 139687 139469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 140296 139700 gene locus_tag LOCUS_03370 140296 139700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03370 140992 140813 gene locus_tag LOCUS_03380 140992 140813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 142534 141158 gene locus_tag LOCUS_03390 gene ppnN 142534 141158 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 protein_id gnl|my_center|LOCUS_03390 143606 142743 gene locus_tag LOCUS_03400 gene queF 143606 142743 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261348.1 protein_id gnl|my_center|LOCUS_03400 144331 143606 gene locus_tag LOCUS_03410 gene rsmE 144331 143606 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222501.1 protein_id gnl|my_center|LOCUS_03410 145077 144331 gene locus_tag LOCUS_03420 gene endA 145077 144331 CDS product endonuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071125.1 protein_id gnl|my_center|LOCUS_03420 145305 146159 gene locus_tag LOCUS_03430 145305 146159 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_03430 147380 146232 gene locus_tag LOCUS_03440 gene metK 147380 146232 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence03 105 1214 gene locus_tag LOCUS_03450 105 1214 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_03450 1889 1326 gene locus_tag LOCUS_03460 gene efp 1889 1326 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 protein_id gnl|my_center|LOCUS_03460 3219 2122 gene locus_tag LOCUS_03470 gene earP 3219 2122 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 protein_id gnl|my_center|LOCUS_03470 3470 5740 gene locus_tag LOCUS_03480 3470 5740 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_03480 5850 6008 gene locus_tag LOCUS_03490 5850 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 6015 6545 gene locus_tag LOCUS_03500 gene nrdG 6015 6545 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_03500 6654 7751 gene locus_tag LOCUS_03510 6654 7751 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707506.1 protein_id gnl|my_center|LOCUS_03510 7754 9316 gene locus_tag LOCUS_03520 gene pqiB 7754 9316 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707505.1 protein_id gnl|my_center|LOCUS_03520 9320 9853 gene locus_tag LOCUS_03530 9320 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 11270 9897 gene locus_tag LOCUS_03540 gene mnmE 11270 9897 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152320698.1 protein_id gnl|my_center|LOCUS_03540 12902 11274 gene locus_tag LOCUS_03550 gene yidC 12902 11274 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 protein_id gnl|my_center|LOCUS_03550 13123 12923 gene locus_tag LOCUS_03560 gene yidD 13123 12923 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_03560 13491 13132 gene locus_tag LOCUS_03570 gene rnpA 13491 13132 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_03570 13627 13484 gene locus_tag LOCUS_03580 gene rpmH 13627 13484 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198824.1 protein_id gnl|my_center|LOCUS_03580 13835 15520 gene locus_tag LOCUS_03590 13835 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 15539 16675 gene locus_tag LOCUS_03600 gene dnaN 15539 16675 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 protein_id gnl|my_center|LOCUS_03600 16724 17803 gene locus_tag LOCUS_03610 gene recF 16724 17803 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884355.1 protein_id gnl|my_center|LOCUS_03610 17822 20254 gene locus_tag LOCUS_03620 gene gyrB 17822 20254 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260901.1 protein_id gnl|my_center|LOCUS_03620 20827 22140 gene locus_tag LOCUS_03630 gene ltrA 20827 22140 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272692.1 protein_id gnl|my_center|LOCUS_03630 26138 24072 gene locus_tag LOCUS_03640 gene glyS 26138 24072 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 protein_id gnl|my_center|LOCUS_03640 27011 26154 gene locus_tag LOCUS_03650 gene glyQ 27011 26154 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339464.1 protein_id gnl|my_center|LOCUS_03650 27442 27215 gene locus_tag LOCUS_03660 gene tusA 27442 27215 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070435.1 protein_id gnl|my_center|LOCUS_03660 27564 27639 gene locus_tag LOCUS_t00050 27564 27639 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27826 28644 gene locus_tag LOCUS_03670 gene mutM 27826 28644 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369156.1 protein_id gnl|my_center|LOCUS_03670 29136 28663 gene locus_tag LOCUS_03680 gene coaD 29136 28663 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 protein_id gnl|my_center|LOCUS_03680 30195 29140 gene locus_tag LOCUS_03690 30195 29140 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 protein_id gnl|my_center|LOCUS_03690 30304 31041 gene locus_tag LOCUS_03700 30304 31041 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260996.1 protein_id gnl|my_center|LOCUS_03700 31114 31659 gene locus_tag LOCUS_03710 31114 31659 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896302.1 protein_id gnl|my_center|LOCUS_03710 32992 31715 gene locus_tag LOCUS_03720 gene waaA 32992 31715 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410829.1 protein_id gnl|my_center|LOCUS_03720 33964 33002 gene locus_tag LOCUS_03730 gene waaF 33964 33002 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693429.1 protein_id gnl|my_center|LOCUS_03730 34208 35170 gene locus_tag LOCUS_03740 gene rfaD 34208 35170 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_03740 35152 36015 gene locus_tag LOCUS_03750 gene glpG 35152 36015 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_03750 37651 36110 gene locus_tag LOCUS_03760 gene gpmM 37651 36110 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 protein_id gnl|my_center|LOCUS_03760 38018 38482 gene locus_tag LOCUS_03770 38018 38482 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001368341.1 protein_id gnl|my_center|LOCUS_03770 38505 39020 gene locus_tag LOCUS_03780 gene secB 38505 39020 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 protein_id gnl|my_center|LOCUS_03780 39032 40036 gene locus_tag LOCUS_03790 gene gpsA 39032 40036 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815279.1 protein_id gnl|my_center|LOCUS_03790 40718 40128 gene locus_tag LOCUS_03800 gene nfuA 40718 40128 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 protein_id gnl|my_center|LOCUS_03800 40967 42574 gene locus_tag LOCUS_03810 gene pckA 40967 42574 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_03810 42651 43271 gene locus_tag LOCUS_03820 gene greB 42651 43271 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099090.1 protein_id gnl|my_center|LOCUS_03820 43886 43344 gene locus_tag LOCUS_03830 43886 43344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 44774 43977 gene locus_tag LOCUS_03840 gene bioH 44774 43977 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 protein_id gnl|my_center|LOCUS_03840 45459 44809 gene locus_tag LOCUS_03850 gene ribB 45459 44809 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939063.1 protein_id gnl|my_center|LOCUS_03850 46213 45470 gene locus_tag LOCUS_03860 gene pdxJ 46213 45470 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 protein_id gnl|my_center|LOCUS_03860 46489 47424 gene locus_tag LOCUS_03870 46489 47424 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_03870 47435 47836 gene locus_tag LOCUS_03880 gene rbsD 47435 47836 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 protein_id gnl|my_center|LOCUS_03880 47873 49111 gene locus_tag LOCUS_03890 47873 49111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 49423 50391 gene locus_tag LOCUS_03900 49423 50391 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025379354.1 protein_id gnl|my_center|LOCUS_03900 50495 51136 gene locus_tag LOCUS_03910 50495 51136 CDS product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398944.1 protein_id gnl|my_center|LOCUS_03910 51149 52684 gene locus_tag LOCUS_03920 51149 52684 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704699.1 protein_id gnl|my_center|LOCUS_03920 52705 53727 gene locus_tag LOCUS_03930 52705 53727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525781.1 protein_id gnl|my_center|LOCUS_03930 53742 54221 gene locus_tag LOCUS_03940 53742 54221 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964663.1 protein_id gnl|my_center|LOCUS_03940 54260 55663 gene locus_tag LOCUS_03950 54260 55663 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_03950 55666 56490 gene locus_tag LOCUS_03960 55666 56490 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989643.1 protein_id gnl|my_center|LOCUS_03960 56493 57428 gene locus_tag LOCUS_03970 56493 57428 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_03970 57421 58914 gene locus_tag LOCUS_03980 57421 58914 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548232.1 protein_id gnl|my_center|LOCUS_03980 59028 60092 gene locus_tag LOCUS_03990 59028 60092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 60279 61640 gene locus_tag LOCUS_04000 60279 61640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_04000 61657 62988 gene locus_tag LOCUS_04010 61657 62988 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_04010 64245 63064 gene locus_tag LOCUS_04020 64245 63064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_04020 65167 64295 gene locus_tag LOCUS_04030 gene hslO 65167 64295 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081545.1 protein_id gnl|my_center|LOCUS_04030 65570 65172 gene locus_tag LOCUS_04040 gene hslR 65570 65172 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 protein_id gnl|my_center|LOCUS_04040 65667 66233 gene locus_tag LOCUS_04050 gene nudE 65667 66233 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262822.1 protein_id gnl|my_center|LOCUS_04050 66417 67325 gene locus_tag LOCUS_04060 66417 67325 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819287.1 protein_id gnl|my_center|LOCUS_04060 67345 68580 gene locus_tag LOCUS_04070 67345 68580 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704563.1 protein_id gnl|my_center|LOCUS_04070 68701 70086 gene locus_tag LOCUS_04080 68701 70086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 70315 70641 gene locus_tag LOCUS_04090 70315 70641 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963577.1 protein_id gnl|my_center|LOCUS_04090 71142 70687 gene locus_tag LOCUS_04100 gene dut 71142 70687 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631431.1 protein_id gnl|my_center|LOCUS_04100 72453 71146 gene locus_tag LOCUS_04110 gene coaBC 72453 71146 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260987.1 protein_id gnl|my_center|LOCUS_04110 72789 73025 gene locus_tag LOCUS_04120 gene rpmB 72789 73025 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417050.1 protein_id gnl|my_center|LOCUS_04120 73037 73207 gene locus_tag LOCUS_04130 gene rpmG 73037 73207 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_04130 73591 74640 gene locus_tag LOCUS_04140 gene ompA 73591 74640 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883252.1 protein_id gnl|my_center|LOCUS_04140 75905 74760 gene locus_tag LOCUS_04150 75905 74760 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818883.1 protein_id gnl|my_center|LOCUS_04150 76879 75917 gene locus_tag LOCUS_04160 gene pldB 76879 75917 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703989.1 protein_id gnl|my_center|LOCUS_04160 79116 76948 gene locus_tag LOCUS_04170 gene spoT 79116 76948 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 protein_id gnl|my_center|LOCUS_04170 79412 79128 gene locus_tag LOCUS_04180 79412 79128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 80306 79707 gene locus_tag LOCUS_04190 gene gmk 80306 79707 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 protein_id gnl|my_center|LOCUS_04190 80965 80324 gene locus_tag LOCUS_04200 gene yihA 80965 80324 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416925.1 protein_id gnl|my_center|LOCUS_04200 81589 80966 gene locus_tag LOCUS_04210 81589 80966 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462648.1 protein_id gnl|my_center|LOCUS_04210 83172 81739 gene locus_tag LOCUS_04220 gene glnG 83172 81739 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 protein_id gnl|my_center|LOCUS_04220 84266 83184 gene locus_tag LOCUS_04230 gene glnL 84266 83184 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512787.1 protein_id gnl|my_center|LOCUS_04230 86326 84488 gene locus_tag LOCUS_04240 gene typA 86326 84488 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_04240 86711 87565 gene locus_tag LOCUS_04250 86711 87565 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209010.1 protein_id gnl|my_center|LOCUS_04250 90066 87604 gene locus_tag LOCUS_04260 90066 87604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 92171 90075 gene locus_tag LOCUS_04270 gene recG 92171 90075 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693902.1 protein_id gnl|my_center|LOCUS_04270 93612 92242 gene locus_tag LOCUS_04280 gene pssA 93612 92242 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 protein_id gnl|my_center|LOCUS_04280 95565 93628 gene locus_tag LOCUS_04290 95565 93628 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 protein_id gnl|my_center|LOCUS_04290 95712 97775 gene locus_tag LOCUS_04300 gene prlC 95712 97775 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_04300 99885 97873 gene locus_tag LOCUS_04310 gene rnb 99885 97873 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484954.1 protein_id gnl|my_center|LOCUS_04310 100006 100953 gene locus_tag LOCUS_04320 100006 100953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 100996 101934 gene locus_tag LOCUS_04330 100996 101934 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457195.1 protein_id gnl|my_center|LOCUS_04330 103495 102041 gene locus_tag LOCUS_04340 103495 102041 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704262.1 protein_id gnl|my_center|LOCUS_04340 104880 103489 gene locus_tag LOCUS_04350 gene trkA 104880 103489 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 protein_id gnl|my_center|LOCUS_04350 106313 104910 gene locus_tag LOCUS_04360 gene rsmB 106313 104910 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694643.1 protein_id gnl|my_center|LOCUS_04360 107247 106306 gene locus_tag LOCUS_04370 gene fmt 107247 106306 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262886.1 protein_id gnl|my_center|LOCUS_04370 107777 107250 gene locus_tag LOCUS_04380 gene def 107777 107250 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940621.1 protein_id gnl|my_center|LOCUS_04380 107895 108452 gene locus_tag LOCUS_04390 107895 108452 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087521.1 protein_id gnl|my_center|LOCUS_04390 108499 109008 gene locus_tag LOCUS_04400 gene purE 108499 109008 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_04400 109024 109611 gene locus_tag LOCUS_04410 109024 109611 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_04410 109611 110411 gene locus_tag LOCUS_04420 gene aroE 109611 110411 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262878.1 protein_id gnl|my_center|LOCUS_04420 110411 111181 gene locus_tag LOCUS_04430 gene rsmJ 110411 111181 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017384177.1 protein_id gnl|my_center|LOCUS_04430 111948 111193 gene locus_tag LOCUS_04440 111948 111193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 112835 111924 gene locus_tag LOCUS_04450 112835 111924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 113221 113412 gene locus_tag LOCUS_04460 113221 113412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 113494 113703 gene locus_tag LOCUS_04470 113494 113703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 115760 113931 gene locus_tag LOCUS_04480 gene glmS 115760 113931 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817475.1 protein_id gnl|my_center|LOCUS_04480 117345 115957 gene locus_tag LOCUS_04490 gene glmU 117345 115957 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 protein_id gnl|my_center|LOCUS_04490 118143 117349 gene locus_tag LOCUS_04500 gene lgt 118143 117349 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_04500 118202 118735 gene locus_tag LOCUS_04510 118202 118735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 118740 119474 gene locus_tag LOCUS_04520 118740 119474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 123155 119487 gene locus_tag LOCUS_04530 gene dnaE 123155 119487 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 protein_id gnl|my_center|LOCUS_04530 124913 123261 gene locus_tag LOCUS_04540 gene pgi 124913 123261 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704176.1 protein_id gnl|my_center|LOCUS_04540 126198 125266 gene locus_tag LOCUS_04550 gene ilvY 126198 125266 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455228.1 protein_id gnl|my_center|LOCUS_04550 126346 127833 gene locus_tag LOCUS_04560 gene ilvC 126346 127833 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704175.1 protein_id gnl|my_center|LOCUS_04560 129983 127950 gene locus_tag LOCUS_04570 gene rep 129983 127950 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869028.1 protein_id gnl|my_center|LOCUS_04570 131961 129985 gene locus_tag LOCUS_04580 131961 129985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 132728 131985 gene locus_tag LOCUS_04590 gene tcdA 132728 131985 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117742.1 protein_id gnl|my_center|LOCUS_04590 132830 132904 gene locus_tag LOCUS_t00060 132830 132904 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 132923 133007 gene locus_tag LOCUS_t00070 132923 133007 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 133547 135628 gene locus_tag LOCUS_04600 133547 135628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence04 28 355 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agaaacatccccacaacgtggggaagac 732 451 gene locus_tag LOCUS_04610 gene cas2e 732 451 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933634.1 protein_id gnl|my_center|LOCUS_04610 1580 735 gene locus_tag LOCUS_04620 gene cas1e 1580 735 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933633.1 protein_id gnl|my_center|LOCUS_04620 2262 1561 gene locus_tag LOCUS_04630 gene cas5e 2262 1561 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 protein_id gnl|my_center|LOCUS_04630 3375 2281 gene locus_tag LOCUS_04640 gene cas7e 3375 2281 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933631.1 protein_id gnl|my_center|LOCUS_04640 4020 3409 gene locus_tag LOCUS_04650 gene cas6e 4020 3409 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_04650 4544 4017 gene locus_tag LOCUS_04660 gene casB 4544 4017 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933629.1 protein_id gnl|my_center|LOCUS_04660 6028 4547 gene locus_tag LOCUS_04670 gene casA 6028 4547 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 protein_id gnl|my_center|LOCUS_04670 8627 6015 gene locus_tag LOCUS_04680 8627 6015 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 protein_id gnl|my_center|LOCUS_04680 9117 9419 gene locus_tag LOCUS_04690 9117 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9412 10002 gene locus_tag LOCUS_04700 9412 10002 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173520.1 protein_id gnl|my_center|LOCUS_04700 10465 10070 gene locus_tag LOCUS_04710 gene secG 10465 10070 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633113.1 protein_id gnl|my_center|LOCUS_04710 11884 10532 gene locus_tag LOCUS_04720 gene glmM 11884 10532 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_04720 12811 11951 gene locus_tag LOCUS_04730 12811 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 14938 12947 gene locus_tag LOCUS_04740 gene ftsH 14938 12947 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_04740 15638 14949 gene locus_tag LOCUS_04750 gene rlmE 15638 14949 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 protein_id gnl|my_center|LOCUS_04750 15783 16073 gene locus_tag LOCUS_04760 gene yhbY 15783 16073 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389225.1 protein_id gnl|my_center|LOCUS_04760 17444 16134 gene locus_tag LOCUS_04770 17444 16134 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_04770 18103 17615 gene locus_tag LOCUS_04780 gene greA 18103 17615 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 protein_id gnl|my_center|LOCUS_04780 19451 18246 gene locus_tag LOCUS_04790 gene dnaJ 19451 18246 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706780.1 protein_id gnl|my_center|LOCUS_04790 21459 19528 gene locus_tag LOCUS_04800 gene dnaK 21459 19528 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706781.1 protein_id gnl|my_center|LOCUS_04800 22335 21589 gene locus_tag LOCUS_04810 22335 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 22498 22890 gene locus_tag LOCUS_04820 gene bamE 22498 22890 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455981.1 protein_id gnl|my_center|LOCUS_04820 22874 23704 gene locus_tag LOCUS_04830 22874 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 23885 25987 gene locus_tag LOCUS_04840 gene ppk1 23885 25987 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 protein_id gnl|my_center|LOCUS_04840 26249 26641 gene locus_tag LOCUS_04850 26249 26641 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_04850 26813 27793 gene locus_tag LOCUS_04860 26813 27793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 28419 29945 gene locus_tag LOCUS_04870 28419 29945 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_04870 30326 30631 gene locus_tag LOCUS_04880 30326 30631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 30728 31195 gene locus_tag LOCUS_04890 30728 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 31538 33034 gene locus_tag LOCUS_04900 gene rmuC 31538 33034 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020419.1 protein_id gnl|my_center|LOCUS_04900 33606 33103 gene locus_tag LOCUS_04910 gene ilvN 33606 33103 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_04910 35330 33606 gene locus_tag LOCUS_04920 35330 33606 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 protein_id gnl|my_center|LOCUS_04920 36569 35541 gene locus_tag LOCUS_04930 36569 35541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 37121 36618 gene locus_tag LOCUS_04940 gene ilvN 37121 36618 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_04940 38835 37123 gene locus_tag LOCUS_04950 38835 37123 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 protein_id gnl|my_center|LOCUS_04950 39363 38854 gene locus_tag LOCUS_04960 39363 38854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 42458 39363 gene locus_tag LOCUS_04970 42458 39363 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817986.1 protein_id gnl|my_center|LOCUS_04970 42733 42927 gene locus_tag LOCUS_04980 42733 42927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 43123 43048 gene locus_tag LOCUS_t00080 43123 43048 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43254 43178 gene locus_tag LOCUS_t00090 43254 43178 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 43340 43265 gene locus_tag LOCUS_t00100 43340 43265 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43448 43373 gene locus_tag LOCUS_t00110 43448 43373 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44229 43660 gene locus_tag LOCUS_04990 44229 43660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 44453 45307 gene locus_tag LOCUS_05000 44453 45307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 45340 47322 gene locus_tag LOCUS_05010 45340 47322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 48170 47391 gene locus_tag LOCUS_05020 gene tatC 48170 47391 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_05020 48564 48184 gene locus_tag LOCUS_05030 48564 48184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 48844 48653 gene locus_tag LOCUS_05040 48844 48653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 50139 48991 gene locus_tag LOCUS_05050 50139 48991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 50903 51502 gene locus_tag LOCUS_05060 50903 51502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 52390 52548 gene locus_tag LOCUS_05070 52390 52548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 52552 53148 gene locus_tag LOCUS_05080 52552 53148 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_05080 53154 54512 gene locus_tag LOCUS_05090 gene miaB 53154 54512 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 protein_id gnl|my_center|LOCUS_05090 54565 55644 gene locus_tag LOCUS_05100 54565 55644 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 protein_id gnl|my_center|LOCUS_05100 55647 56117 gene locus_tag LOCUS_05110 gene ybeY 55647 56117 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 protein_id gnl|my_center|LOCUS_05110 56244 57098 gene locus_tag LOCUS_05120 gene corC 56244 57098 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707019.1 protein_id gnl|my_center|LOCUS_05120 57186 58781 gene locus_tag LOCUS_05130 gene lnt 57186 58781 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 protein_id gnl|my_center|LOCUS_05130 59063 59299 gene locus_tag LOCUS_05140 59063 59299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 59262 60011 gene locus_tag LOCUS_05150 59262 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05150 62707 60086 gene locus_tag LOCUS_05160 62707 60086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 63637 62720 gene locus_tag LOCUS_05170 gene ldtB 63637 62720 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367569.1 protein_id gnl|my_center|LOCUS_05170 63941 66538 gene locus_tag LOCUS_05180 gene leuS 63941 66538 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157892.1 protein_id gnl|my_center|LOCUS_05180 66605 67420 gene locus_tag LOCUS_05190 66605 67420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 68001 69107 gene locus_tag LOCUS_05200 68001 69107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 69107 69844 gene locus_tag LOCUS_05210 69107 69844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 69893 70234 gene locus_tag LOCUS_05220 gene rsfS 69893 70234 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418177.1 protein_id gnl|my_center|LOCUS_05220 70263 70733 gene locus_tag LOCUS_05230 gene rlmH 70263 70733 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071400.1 protein_id gnl|my_center|LOCUS_05230 71204 72961 gene locus_tag LOCUS_05240 gene mrdA 71204 72961 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707027.1 protein_id gnl|my_center|LOCUS_05240 72963 74111 gene locus_tag LOCUS_05250 gene rodA 72963 74111 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_05250 74148 75158 gene locus_tag LOCUS_05260 gene mltB 74148 75158 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 protein_id gnl|my_center|LOCUS_05260 75155 76195 gene locus_tag LOCUS_05270 75155 76195 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707031.1 protein_id gnl|my_center|LOCUS_05270 76294 77583 gene locus_tag LOCUS_05280 76294 77583 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 protein_id gnl|my_center|LOCUS_05280 77625 77909 gene locus_tag LOCUS_05290 77625 77909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 77932 79068 gene locus_tag LOCUS_05300 77932 79068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 79145 79954 gene locus_tag LOCUS_05310 79145 79954 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_05310 80861 79989 gene locus_tag LOCUS_05320 80861 79989 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_05320 81751 80924 gene locus_tag LOCUS_05330 81751 80924 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_05330 82278 81826 gene locus_tag LOCUS_05340 gene rplI 82278 81826 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073672.1 protein_id gnl|my_center|LOCUS_05340 82522 82292 gene locus_tag LOCUS_05350 gene rpsR 82522 82292 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308890.1 protein_id gnl|my_center|LOCUS_05350 82941 82534 gene locus_tag LOCUS_05360 gene rpsF 82941 82534 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_05360 83953 83174 gene locus_tag LOCUS_05370 gene rlmB 83953 83174 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 protein_id gnl|my_center|LOCUS_05370 86496 83953 gene locus_tag LOCUS_05380 86496 83953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 88056 86929 gene locus_tag LOCUS_05390 gene hemW 88056 86929 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_05390 88655 88053 gene locus_tag LOCUS_05400 88655 88053 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369727.1 protein_id gnl|my_center|LOCUS_05400 90096 88684 gene locus_tag LOCUS_05410 90096 88684 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 protein_id gnl|my_center|LOCUS_05410 90374 90985 gene locus_tag LOCUS_05420 90374 90985 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706953.1 protein_id gnl|my_center|LOCUS_05420 91599 91105 gene locus_tag LOCUS_05430 91599 91105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 92367 92107 gene locus_tag LOCUS_05440 92367 92107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 92757 94364 gene locus_tag LOCUS_05450 92757 94364 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545536.1 protein_id gnl|my_center|LOCUS_05450 94576 94501 gene locus_tag LOCUS_t00120 94576 94501 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 94681 94606 gene locus_tag LOCUS_t00130 94681 94606 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 97683 95008 gene locus_tag LOCUS_05460 gene secA 97683 95008 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_05460 97951 97876 gene locus_tag LOCUS_t00140 97951 97876 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 98191 99828 gene locus_tag LOCUS_05470 gene xseA 98191 99828 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 protein_id gnl|my_center|LOCUS_05470 99912 100622 gene locus_tag LOCUS_05480 99912 100622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 100784 101431 gene locus_tag LOCUS_05490 gene adk 100784 101431 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_05490 101433 101945 gene locus_tag LOCUS_05500 101433 101945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence05 262 423 gene locus_tag LOCUS_05510 262 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1273 491 gene locus_tag LOCUS_05520 1273 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2742 1582 gene locus_tag LOCUS_05530 2742 1582 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063127.1 protein_id gnl|my_center|LOCUS_05530 3054 2965 gene locus_tag LOCUS_t00150 3054 2965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3828 3100 gene locus_tag LOCUS_05540 3828 3100 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_05540 3994 4070 gene locus_tag LOCUS_t00160 3994 4070 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5009 4086 gene locus_tag LOCUS_05550 5009 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5805 5014 gene locus_tag LOCUS_05560 5805 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7150 5786 gene locus_tag LOCUS_05570 7150 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 8157 7159 gene locus_tag LOCUS_05580 gene trbG 8157 7159 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875422.1 protein_id gnl|my_center|LOCUS_05580 8855 8154 gene locus_tag LOCUS_05590 8855 8154 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_05590 11280 8818 gene locus_tag LOCUS_05600 11280 8818 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970257.1 protein_id gnl|my_center|LOCUS_05600 11726 11424 gene locus_tag LOCUS_05610 11726 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 12389 11784 gene locus_tag LOCUS_05620 12389 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 13357 12386 gene locus_tag LOCUS_05630 gene trbB 13357 12386 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_05630 14470 15909 gene locus_tag LOCUS_05640 14470 15909 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_05640 15975 17072 gene locus_tag LOCUS_05650 15975 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 18741 17500 gene locus_tag LOCUS_05660 gene sstT 18741 17500 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174187.1 protein_id gnl|my_center|LOCUS_05660 19124 19822 gene locus_tag LOCUS_05670 19124 19822 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_05670 19837 20838 gene locus_tag LOCUS_05680 19837 20838 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_05680 21035 21580 gene locus_tag LOCUS_05690 21035 21580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 21493 21894 gene locus_tag LOCUS_05700 21493 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 22261 23391 gene locus_tag LOCUS_05710 22261 23391 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659266.1 protein_id gnl|my_center|LOCUS_05710 23481 26123 gene locus_tag LOCUS_05720 gene rlmKL 23481 26123 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_05720 26123 28027 gene locus_tag LOCUS_05730 26123 28027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053083.1 protein_id gnl|my_center|LOCUS_05730 28029 28889 gene locus_tag LOCUS_05740 28029 28889 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 protein_id gnl|my_center|LOCUS_05740 29259 30560 gene locus_tag LOCUS_05750 gene eno 29259 30560 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 protein_id gnl|my_center|LOCUS_05750 30787 31932 gene locus_tag LOCUS_05760 30787 31932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 32141 33796 gene locus_tag LOCUS_05770 32141 33796 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_05770 34636 33857 gene locus_tag LOCUS_05780 34636 33857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 35048 36577 gene locus_tag LOCUS_05790 35048 36577 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 protein_id gnl|my_center|LOCUS_05790 40331 36816 gene locus_tag LOCUS_05800 gene mfd 40331 36816 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 protein_id gnl|my_center|LOCUS_05800 40583 42067 gene locus_tag LOCUS_05810 40583 42067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 42046 42342 gene locus_tag LOCUS_05820 42046 42342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 43487 42339 gene locus_tag LOCUS_05830 gene spuD 43487 42339 CDS product putrescine-binding protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084299.1 protein_id gnl|my_center|LOCUS_05830 43809 43946 gene locus_tag LOCUS_05840 43809 43946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 44364 44618 gene locus_tag LOCUS_05850 44364 44618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 44775 45284 gene locus_tag LOCUS_05860 44775 45284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 46398 45712 gene locus_tag LOCUS_05870 46398 45712 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_05870 47664 46399 gene locus_tag LOCUS_05880 47664 46399 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_05880 47975 49192 gene locus_tag LOCUS_05890 47975 49192 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_05890 49332 51248 gene locus_tag LOCUS_05900 49332 51248 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_05900 51828 54074 gene locus_tag LOCUS_05910 gene pflB 51828 54074 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_05910 54209 54943 gene locus_tag LOCUS_05920 gene pflA 54209 54943 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476647.1 protein_id gnl|my_center|LOCUS_05920 56100 55423 gene locus_tag LOCUS_05930 56100 55423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 58307 56223 gene locus_tag LOCUS_05940 gene glgX 58307 56223 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_05940 58801 60651 gene locus_tag LOCUS_05950 gene nadE 58801 60651 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_05950 61015 62880 gene locus_tag LOCUS_05960 gene msbA 61015 62880 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_05960 63529 64569 gene locus_tag LOCUS_05970 63529 64569 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_05970 64957 65136 gene locus_tag LOCUS_05980 64957 65136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 65485 65856 gene locus_tag LOCUS_05990 65485 65856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 65820 66167 gene locus_tag LOCUS_06000 65820 66167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 66303 66551 gene locus_tag LOCUS_06010 66303 66551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 67437 68579 gene locus_tag LOCUS_06020 67437 68579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 69278 70297 gene locus_tag LOCUS_06030 69278 70297 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_06030 70299 71570 gene locus_tag LOCUS_06040 70299 71570 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_06040 71555 72232 gene locus_tag LOCUS_06050 gene gmhA 71555 72232 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_06050 72232 72969 gene locus_tag LOCUS_06060 72232 72969 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_06060 73074 73922 gene locus_tag LOCUS_06070 73074 73922 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462483.1 protein_id gnl|my_center|LOCUS_06070 74010 74141 gene locus_tag LOCUS_06080 74010 74141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 74480 75673 gene locus_tag LOCUS_06090 74480 75673 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_06090 76020 76139 gene locus_tag LOCUS_06100 76020 76139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 76136 76858 gene locus_tag LOCUS_06110 76136 76858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 77836 78945 gene locus_tag LOCUS_06120 77836 78945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 79144 80274 gene locus_tag LOCUS_06130 79144 80274 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476092.1 protein_id gnl|my_center|LOCUS_06130 80403 80954 gene locus_tag LOCUS_06140 80403 80954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 81088 81342 gene locus_tag LOCUS_06150 81088 81342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence06 2344 71 gene locus_tag LOCUS_06160 gene parC 2344 71 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_06160 2679 2455 gene locus_tag LOCUS_06170 2679 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2594 3241 gene locus_tag LOCUS_06180 2594 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3619 3260 gene locus_tag LOCUS_06190 3619 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4163 3621 gene locus_tag LOCUS_06200 4163 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5230 4241 gene locus_tag LOCUS_06210 gene rpoA 5230 4241 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417271.1 protein_id gnl|my_center|LOCUS_06210 5701 5303 gene locus_tag LOCUS_06220 gene rplQ 5701 5303 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648400.1 protein_id gnl|my_center|LOCUS_06220 6714 5722 gene locus_tag LOCUS_06230 gene rpoA 6714 5722 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648402.1 protein_id gnl|my_center|LOCUS_06230 7385 6762 gene locus_tag LOCUS_06240 gene rpsD 7385 6762 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704319.1 protein_id gnl|my_center|LOCUS_06240 7845 7417 gene locus_tag LOCUS_06250 gene rpsK 7845 7417 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 protein_id gnl|my_center|LOCUS_06250 8212 7856 gene locus_tag LOCUS_06260 gene rpsM 8212 7856 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 protein_id gnl|my_center|LOCUS_06260 9887 8541 gene locus_tag LOCUS_06270 gene secY 9887 8541 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 protein_id gnl|my_center|LOCUS_06270 10529 9927 gene locus_tag LOCUS_06280 10529 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 10718 10533 gene locus_tag LOCUS_06290 gene rpmD 10718 10533 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083582.1 protein_id gnl|my_center|LOCUS_06290 11228 10722 gene locus_tag LOCUS_06300 gene rpsE 11228 10722 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213337.1 protein_id gnl|my_center|LOCUS_06300 11592 11239 gene locus_tag LOCUS_06310 gene rplR 11592 11239 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 protein_id gnl|my_center|LOCUS_06310 12140 11607 gene locus_tag LOCUS_06320 gene rplF 12140 11607 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213334.1 protein_id gnl|my_center|LOCUS_06320 12543 12154 gene locus_tag LOCUS_06330 gene rpsH 12543 12154 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062614.1 protein_id gnl|my_center|LOCUS_06330 12863 12558 gene locus_tag LOCUS_06340 gene rpsN 12863 12558 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 protein_id gnl|my_center|LOCUS_06340 13430 12879 gene locus_tag LOCUS_06350 gene rplE 13430 12879 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 protein_id gnl|my_center|LOCUS_06350 13783 13454 gene locus_tag LOCUS_06360 gene rplX 13783 13454 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729178.1 protein_id gnl|my_center|LOCUS_06360 14173 13805 gene locus_tag LOCUS_06370 gene rplN 14173 13805 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_06370 14569 14300 gene locus_tag LOCUS_06380 gene rpsQ 14569 14300 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625886.1 protein_id gnl|my_center|LOCUS_06380 14785 14582 gene locus_tag LOCUS_06390 gene rpmC 14785 14582 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 protein_id gnl|my_center|LOCUS_06390 15198 14785 gene locus_tag LOCUS_06400 gene rplP 15198 14785 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 protein_id gnl|my_center|LOCUS_06400 15998 15213 gene locus_tag LOCUS_06410 gene rpsC 15998 15213 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331168.1 protein_id gnl|my_center|LOCUS_06410 16342 16001 gene locus_tag LOCUS_06420 gene rplV 16342 16001 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_06420 16633 16358 gene locus_tag LOCUS_06430 gene rpsS 16633 16358 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004394525.1 protein_id gnl|my_center|LOCUS_06430 17469 16654 gene locus_tag LOCUS_06440 gene rplB 17469 16654 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307957.1 protein_id gnl|my_center|LOCUS_06440 17789 17469 gene locus_tag LOCUS_06450 gene rplW 17789 17469 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 protein_id gnl|my_center|LOCUS_06450 18400 17789 gene locus_tag LOCUS_06460 gene rplD 18400 17789 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 protein_id gnl|my_center|LOCUS_06460 19056 18418 gene locus_tag LOCUS_06470 gene rplC 19056 18418 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 protein_id gnl|my_center|LOCUS_06470 19383 19072 gene locus_tag LOCUS_06480 gene rpsJ 19383 19072 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 protein_id gnl|my_center|LOCUS_06480 21429 19606 gene locus_tag LOCUS_06490 21429 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 21496 22125 gene locus_tag LOCUS_06500 21496 22125 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948438.1 protein_id gnl|my_center|LOCUS_06500 22779 22138 gene locus_tag LOCUS_06510 gene pyrE 22779 22138 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_06510 22887 23750 gene locus_tag LOCUS_06520 22887 23750 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_06520 25766 23775 gene locus_tag LOCUS_06530 25766 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 27269 25899 gene locus_tag LOCUS_06540 gene cysS 27269 25899 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071913.1 protein_id gnl|my_center|LOCUS_06540 27523 28014 gene locus_tag LOCUS_06550 27523 28014 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693842.1 protein_id gnl|my_center|LOCUS_06550 28065 28811 gene locus_tag LOCUS_06560 gene lpxH 28065 28811 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693139.1 protein_id gnl|my_center|LOCUS_06560 31597 28808 gene locus_tag LOCUS_06570 gene polA 31597 28808 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_06570 31857 32405 gene locus_tag LOCUS_06580 31857 32405 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015358.1 protein_id gnl|my_center|LOCUS_06580 32494 32820 gene locus_tag LOCUS_06590 gene trxA 32494 32820 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211990.1 protein_id gnl|my_center|LOCUS_06590 32986 33984 gene locus_tag LOCUS_06600 32986 33984 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455294.1 protein_id gnl|my_center|LOCUS_06600 34412 36694 gene locus_tag LOCUS_06610 gene metE 34412 36694 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864555.1 protein_id gnl|my_center|LOCUS_06610 36672 37532 gene locus_tag LOCUS_06620 gene metF 36672 37532 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_06620 38846 37632 gene locus_tag LOCUS_06630 gene rho 38846 37632 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307308.1 protein_id gnl|my_center|LOCUS_06630 39097 39474 gene locus_tag LOCUS_06640 39097 39474 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963572.1 protein_id gnl|my_center|LOCUS_06640 41705 39531 gene locus_tag LOCUS_06650 gene uvrD 41705 39531 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647471.1 protein_id gnl|my_center|LOCUS_06650 42593 41859 gene locus_tag LOCUS_06660 42593 41859 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704450.1 protein_id gnl|my_center|LOCUS_06660 43501 42590 gene locus_tag LOCUS_06670 gene xerC 43501 42590 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 protein_id gnl|my_center|LOCUS_06670 44365 43532 gene locus_tag LOCUS_06680 gene dapF 44365 43532 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 protein_id gnl|my_center|LOCUS_06680 45617 44370 gene locus_tag LOCUS_06690 gene lysA 45617 44370 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693130.1 protein_id gnl|my_center|LOCUS_06690 45885 45697 gene locus_tag LOCUS_06700 45885 45697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 48378 45982 gene locus_tag LOCUS_06710 48378 45982 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704443.1 protein_id gnl|my_center|LOCUS_06710 48723 50168 gene locus_tag LOCUS_06720 48723 50168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 50161 51366 gene locus_tag LOCUS_06730 50161 51366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 51888 51454 gene locus_tag LOCUS_06740 51888 51454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 53414 51888 gene locus_tag LOCUS_06750 gene ilvA 53414 51888 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 protein_id gnl|my_center|LOCUS_06750 55266 53416 gene locus_tag LOCUS_06760 gene ilvD 55266 53416 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 protein_id gnl|my_center|LOCUS_06760 56336 55407 gene locus_tag LOCUS_06770 56336 55407 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_06770 56619 57533 gene locus_tag LOCUS_06780 56619 57533 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819016.1 protein_id gnl|my_center|LOCUS_06780 58204 57587 gene locus_tag LOCUS_06790 58204 57587 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732279.1 protein_id gnl|my_center|LOCUS_06790 59376 58330 gene locus_tag LOCUS_06800 59376 58330 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920814.1 protein_id gnl|my_center|LOCUS_06800 59458 59970 gene locus_tag LOCUS_06810 gene yciA 59458 59970 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655643.1 protein_id gnl|my_center|LOCUS_06810 60658 60011 gene locus_tag LOCUS_06820 60658 60011 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706713.1 protein_id gnl|my_center|LOCUS_06820 61128 62285 gene locus_tag LOCUS_06830 61128 62285 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_06830 62303 65551 gene locus_tag LOCUS_06840 62303 65551 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 protein_id gnl|my_center|LOCUS_06840 66783 65638 gene locus_tag LOCUS_06850 66783 65638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 66956 67465 gene locus_tag LOCUS_06860 gene fldB 66956 67465 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817021.1 protein_id gnl|my_center|LOCUS_06860 67683 69077 gene locus_tag LOCUS_06870 67683 69077 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_06870 70838 69414 gene locus_tag LOCUS_06880 gene phoA 70838 69414 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113164.1 protein_id gnl|my_center|LOCUS_06880 72158 71016 gene locus_tag LOCUS_06890 72158 71016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence07 219 1349 gene locus_tag LOCUS_06900 219 1349 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_06900 1544 1407 gene locus_tag LOCUS_06910 1544 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1543 3282 gene locus_tag LOCUS_06920 1543 3282 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071015.1 protein_id gnl|my_center|LOCUS_06920 5097 3466 gene locus_tag LOCUS_06930 5097 3466 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_06930 7047 5422 gene locus_tag LOCUS_06940 7047 5422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_06940 8261 7443 gene locus_tag LOCUS_06950 gene fkpA 8261 7443 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_06950 9268 8294 gene locus_tag LOCUS_06960 gene thiL 9268 8294 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261428.1 protein_id gnl|my_center|LOCUS_06960 9702 9268 gene locus_tag LOCUS_06970 gene nusB 9702 9268 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 protein_id gnl|my_center|LOCUS_06970 10294 9824 gene locus_tag LOCUS_06980 gene ribE 10294 9824 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 protein_id gnl|my_center|LOCUS_06980 11060 10308 gene locus_tag LOCUS_06990 11060 10308 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707099.1 protein_id gnl|my_center|LOCUS_06990 12202 11060 gene locus_tag LOCUS_07000 gene ribD 12202 11060 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073316.1 protein_id gnl|my_center|LOCUS_07000 13489 12227 gene locus_tag LOCUS_07010 13489 12227 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 protein_id gnl|my_center|LOCUS_07010 13806 14255 gene locus_tag LOCUS_07020 gene aroQ 13806 14255 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098991.1 protein_id gnl|my_center|LOCUS_07020 14286 14762 gene locus_tag LOCUS_07030 gene accB 14286 14762 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 protein_id gnl|my_center|LOCUS_07030 14784 16145 gene locus_tag LOCUS_07040 gene accC 14784 16145 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 protein_id gnl|my_center|LOCUS_07040 16450 17115 gene locus_tag LOCUS_07050 16450 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 19247 17271 gene locus_tag LOCUS_07060 19247 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 21846 19330 gene locus_tag LOCUS_07070 21846 19330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 24038 21852 gene locus_tag LOCUS_07080 24038 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 24816 24553 gene locus_tag LOCUS_07090 24816 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 25701 25285 gene locus_tag LOCUS_07100 25701 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 26452 25874 gene locus_tag LOCUS_07110 26452 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 26723 28324 gene locus_tag LOCUS_07120 26723 28324 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_07120 29316 28402 gene locus_tag LOCUS_07130 29316 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 30411 29515 gene locus_tag LOCUS_07140 gene xerD 30411 29515 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_07140 31165 30683 gene locus_tag LOCUS_07150 31165 30683 CDS product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704809.1 protein_id gnl|my_center|LOCUS_07150 31321 32043 gene locus_tag LOCUS_07160 gene coaE 31321 32043 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_07160 32068 32817 gene locus_tag LOCUS_07170 gene zapD 32068 32817 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 protein_id gnl|my_center|LOCUS_07170 32814 33125 gene locus_tag LOCUS_07180 32814 33125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 33207 35855 gene locus_tag LOCUS_07190 gene lptD 33207 35855 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704882.1 protein_id gnl|my_center|LOCUS_07190 36032 37447 gene locus_tag LOCUS_07200 gene surA 36032 37447 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800482.1 protein_id gnl|my_center|LOCUS_07200 37473 38471 gene locus_tag LOCUS_07210 gene pdxA 37473 38471 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 protein_id gnl|my_center|LOCUS_07210 38473 39270 gene locus_tag LOCUS_07220 gene rsmA 38473 39270 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815545.1 protein_id gnl|my_center|LOCUS_07220 39270 40349 gene locus_tag LOCUS_07230 gene rsmC 39270 40349 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262584.1 protein_id gnl|my_center|LOCUS_07230 40874 40410 gene locus_tag LOCUS_07240 40874 40410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 41033 41545 gene locus_tag LOCUS_07250 41033 41545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07250 41748 42038 gene locus_tag LOCUS_07260 41748 42038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07260 42150 44261 gene locus_tag LOCUS_07270 42150 44261 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_07270 44456 45706 gene locus_tag LOCUS_07280 44456 45706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 46982 45969 gene locus_tag LOCUS_07290 46982 45969 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_07290 47520 48764 gene locus_tag LOCUS_07300 gene glgC 47520 48764 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263626.1 protein_id gnl|my_center|LOCUS_07300 48789 50249 gene locus_tag LOCUS_07310 gene glgA 48789 50249 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707514.1 protein_id gnl|my_center|LOCUS_07310 51946 50315 gene locus_tag LOCUS_07320 51946 50315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_07320 53077 52136 gene locus_tag LOCUS_07330 53077 52136 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 protein_id gnl|my_center|LOCUS_07330 54239 53079 gene locus_tag LOCUS_07340 gene nagA 54239 53079 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_07340 55635 54274 gene locus_tag LOCUS_07350 gene srmB 55635 54274 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707392.1 protein_id gnl|my_center|LOCUS_07350 55901 55635 gene locus_tag LOCUS_07360 55901 55635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 56769 55975 gene locus_tag LOCUS_07370 gene thyA 56769 55975 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369929.1 protein_id gnl|my_center|LOCUS_07370 59060 56772 gene locus_tag LOCUS_07380 gene ptsP 59060 56772 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 protein_id gnl|my_center|LOCUS_07380 59623 59063 gene locus_tag LOCUS_07390 gene rppH 59623 59063 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704634.1 protein_id gnl|my_center|LOCUS_07390 59781 60482 gene locus_tag LOCUS_07400 gene mutH 59781 60482 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369924.1 protein_id gnl|my_center|LOCUS_07400 60956 61279 gene locus_tag LOCUS_07410 60956 61279 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704632.1 protein_id gnl|my_center|LOCUS_07410 61617 61693 gene locus_tag LOCUS_t00170 61617 61693 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 62150 62599 gene locus_tag LOCUS_07420 62150 62599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 62814 63269 gene locus_tag LOCUS_07430 62814 63269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 63643 63428 gene locus_tag LOCUS_07440 63643 63428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 64581 64952 gene locus_tag LOCUS_07450 64581 64952 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_07450 65365 65012 gene locus_tag LOCUS_07460 gene rplS 65365 65012 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005313505.1 protein_id gnl|my_center|LOCUS_07460 66166 65402 gene locus_tag LOCUS_07470 gene trmD 66166 65402 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_07470 66678 66148 gene locus_tag LOCUS_07480 gene rimM 66678 66148 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653863.1 protein_id gnl|my_center|LOCUS_07480 67116 66688 gene locus_tag LOCUS_07490 67116 66688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 68636 67242 gene locus_tag LOCUS_07500 gene ffh 68636 67242 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_07500 69658 68927 gene locus_tag LOCUS_07510 69658 68927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence08 1667 351 gene locus_tag LOCUS_07520 gene tilS 1667 351 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262421.1 protein_id gnl|my_center|LOCUS_07520 2620 1661 gene locus_tag LOCUS_07530 gene accA 2620 1661 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 protein_id gnl|my_center|LOCUS_07530 3366 2698 gene locus_tag LOCUS_07540 gene rnhB 3366 2698 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_07540 4729 3398 gene locus_tag LOCUS_07550 gene lpxB 4729 3398 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480975.1 protein_id gnl|my_center|LOCUS_07550 5517 4729 gene locus_tag LOCUS_07560 gene lpxA 5517 4729 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705103.1 protein_id gnl|my_center|LOCUS_07560 6007 5543 gene locus_tag LOCUS_07570 gene fabZ 6007 5543 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634777.1 protein_id gnl|my_center|LOCUS_07570 7057 6026 gene locus_tag LOCUS_07580 gene lpxD 7057 6026 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705102.1 protein_id gnl|my_center|LOCUS_07580 7665 7090 gene locus_tag LOCUS_07590 7665 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10080 7681 gene locus_tag LOCUS_07600 gene bamA 10080 7681 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705100.1 protein_id gnl|my_center|LOCUS_07600 11560 10199 gene locus_tag LOCUS_07610 gene rseP 11560 10199 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262429.1 protein_id gnl|my_center|LOCUS_07610 12750 11560 gene locus_tag LOCUS_07620 gene ispC 12750 11560 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262430.1 protein_id gnl|my_center|LOCUS_07620 13613 12753 gene locus_tag LOCUS_07630 13613 12753 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 protein_id gnl|my_center|LOCUS_07630 14364 13603 gene locus_tag LOCUS_07640 gene uppS 14364 13603 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071788.1 protein_id gnl|my_center|LOCUS_07640 14931 14374 gene locus_tag LOCUS_07650 gene frr 14931 14374 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606619.1 protein_id gnl|my_center|LOCUS_07650 15668 14943 gene locus_tag LOCUS_07660 gene pyrH 15668 14943 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 protein_id gnl|my_center|LOCUS_07660 16571 15684 gene locus_tag LOCUS_07670 gene tsf 16571 15684 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 protein_id gnl|my_center|LOCUS_07670 17431 16679 gene locus_tag LOCUS_07680 gene rpsB 17431 16679 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 protein_id gnl|my_center|LOCUS_07680 17747 18535 gene locus_tag LOCUS_07690 gene map 17747 18535 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 protein_id gnl|my_center|LOCUS_07690 18751 21402 gene locus_tag LOCUS_07700 gene glnD 18751 21402 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 protein_id gnl|my_center|LOCUS_07700 21431 22276 gene locus_tag LOCUS_07710 gene dapD 21431 22276 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 protein_id gnl|my_center|LOCUS_07710 24271 22364 gene locus_tag LOCUS_07720 24271 22364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 25840 24614 gene locus_tag LOCUS_07730 gene nqrF 25840 24614 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095735.1 protein_id gnl|my_center|LOCUS_07730 26450 25851 gene locus_tag LOCUS_07740 gene nqrE 26450 25851 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303538.1 protein_id gnl|my_center|LOCUS_07740 27112 26453 gene locus_tag LOCUS_07750 27112 26453 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 protein_id gnl|my_center|LOCUS_07750 27896 27105 gene locus_tag LOCUS_07760 27896 27105 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705063.1 protein_id gnl|my_center|LOCUS_07760 29133 27883 gene locus_tag LOCUS_07770 29133 27883 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095731.1 protein_id gnl|my_center|LOCUS_07770 30495 29137 gene locus_tag LOCUS_07780 30495 29137 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906078.1 protein_id gnl|my_center|LOCUS_07780 31141 30977 gene locus_tag LOCUS_07790 31141 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 32531 31251 gene locus_tag LOCUS_07800 32531 31251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_07800 33028 32540 gene locus_tag LOCUS_07810 33028 32540 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705055.1 protein_id gnl|my_center|LOCUS_07810 34985 33096 gene locus_tag LOCUS_07820 gene dxs 34985 33096 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_07820 35877 34990 gene locus_tag LOCUS_07830 gene ispA 35877 34990 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_07830 36273 35959 gene locus_tag LOCUS_07840 36273 35959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 38664 36286 gene locus_tag LOCUS_07850 gene pheT 38664 36286 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706166.1 protein_id gnl|my_center|LOCUS_07850 39680 38697 gene locus_tag LOCUS_07860 gene pheS 39680 38697 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 protein_id gnl|my_center|LOCUS_07860 40148 40798 gene locus_tag LOCUS_07870 40148 40798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 41468 40863 gene locus_tag LOCUS_07880 gene ureG 41468 40863 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021389.1 protein_id gnl|my_center|LOCUS_07880 42121 41471 gene locus_tag LOCUS_07890 42121 41471 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_07890 42664 42155 gene locus_tag LOCUS_07900 42664 42155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 44385 42682 gene locus_tag LOCUS_07910 gene ureC 44385 42682 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_07910 44703 44395 gene locus_tag LOCUS_07920 44703 44395 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525615.1 protein_id gnl|my_center|LOCUS_07920 45015 44713 gene locus_tag LOCUS_07930 gene ureA 45015 44713 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_07930 45992 45105 gene locus_tag LOCUS_07940 45992 45105 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_07940 46690 45995 gene locus_tag LOCUS_07950 gene urtE 46690 45995 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_07950 47523 46690 gene locus_tag LOCUS_07960 gene urtD 47523 46690 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_07960 48692 47526 gene locus_tag LOCUS_07970 gene urtC 48692 47526 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_07970 50256 48721 gene locus_tag LOCUS_07980 gene urtB 50256 48721 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 protein_id gnl|my_center|LOCUS_07980 51706 50426 gene locus_tag LOCUS_07990 gene urtA 51706 50426 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_07990 52213 53070 gene locus_tag LOCUS_08000 52213 53070 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 protein_id gnl|my_center|LOCUS_08000 53329 54576 gene locus_tag LOCUS_08010 53329 54576 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_08010 54680 55885 gene locus_tag LOCUS_08020 54680 55885 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 protein_id gnl|my_center|LOCUS_08020 55887 56567 gene locus_tag LOCUS_08030 gene lolD 55887 56567 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_08030 56557 57804 gene locus_tag LOCUS_08040 gene lolE 56557 57804 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168092.1 protein_id gnl|my_center|LOCUS_08040 58062 59681 gene locus_tag LOCUS_08050 58062 59681 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_08050 61255 59786 gene locus_tag LOCUS_08060 gene thiI 61255 59786 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 protein_id gnl|my_center|LOCUS_08060 61986 61318 gene locus_tag LOCUS_08070 61986 61318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 62638 62039 gene locus_tag LOCUS_08080 62638 62039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 63836 62703 gene locus_tag LOCUS_08090 63836 62703 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 protein_id gnl|my_center|LOCUS_08090 64149 65996 gene locus_tag LOCUS_08100 64149 65996 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_08100 67622 66180 gene locus_tag LOCUS_08110 gene dgt 67622 66180 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704846.1 protein_id gnl|my_center|LOCUS_08110 69008 67686 gene locus_tag LOCUS_08120 gene glgC 69008 67686 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706551.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence09 295 32 gene locus_tag LOCUS_08130 gene rpsT 295 32 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 protein_id gnl|my_center|LOCUS_08130 605 1552 gene locus_tag LOCUS_08140 gene ribF 605 1552 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_08140 1579 4407 gene locus_tag LOCUS_08150 gene ileS 1579 4407 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_08150 4417 4929 gene locus_tag LOCUS_08160 gene lspA 4417 4929 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 protein_id gnl|my_center|LOCUS_08160 4932 5870 gene locus_tag LOCUS_08170 gene ispH 4932 5870 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020788.1 protein_id gnl|my_center|LOCUS_08170 5933 7204 gene locus_tag LOCUS_08180 5933 7204 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_08180 7640 7221 gene locus_tag LOCUS_08190 7640 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10572 7702 gene locus_tag LOCUS_08200 10572 7702 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818824.1 protein_id gnl|my_center|LOCUS_08200 10921 12255 gene locus_tag LOCUS_08210 10921 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 12435 14177 gene locus_tag LOCUS_08220 12435 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 14270 14896 gene locus_tag LOCUS_08230 gene tmk 14270 14896 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072562.1 protein_id gnl|my_center|LOCUS_08230 14889 16013 gene locus_tag LOCUS_08240 14889 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 16409 16167 gene locus_tag LOCUS_08250 16409 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16444 17202 gene locus_tag LOCUS_08260 16444 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 18095 17295 gene locus_tag LOCUS_08270 18095 17295 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613410.1 protein_id gnl|my_center|LOCUS_08270 18636 19700 gene locus_tag LOCUS_08280 gene lptG 18636 19700 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 protein_id gnl|my_center|LOCUS_08280 19753 19839 gene locus_tag LOCUS_t00180 19753 19839 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21176 20409 gene locus_tag LOCUS_08290 21176 20409 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_08290 22363 21338 gene locus_tag LOCUS_08300 gene galM 22363 21338 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 protein_id gnl|my_center|LOCUS_08300 22728 23372 gene locus_tag LOCUS_08310 22728 23372 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 protein_id gnl|my_center|LOCUS_08310 23390 23647 gene locus_tag LOCUS_08320 23390 23647 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_08320 24340 23726 gene locus_tag LOCUS_08330 gene leuD 24340 23726 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818262.1 protein_id gnl|my_center|LOCUS_08330 25755 24352 gene locus_tag LOCUS_08340 gene leuC 25755 24352 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891951.1 protein_id gnl|my_center|LOCUS_08340 26886 25789 gene locus_tag LOCUS_08350 gene leuB 26886 25789 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 protein_id gnl|my_center|LOCUS_08350 28451 26889 gene locus_tag LOCUS_08360 gene leuA 28451 26889 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853134.1 protein_id gnl|my_center|LOCUS_08360 28888 29424 gene locus_tag LOCUS_08370 28888 29424 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272310.1 protein_id gnl|my_center|LOCUS_08370 31979 29487 gene locus_tag LOCUS_08380 gene feoB 31979 29487 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_08380 32312 34354 gene locus_tag LOCUS_08390 32312 34354 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_08390 35929 34463 gene locus_tag LOCUS_08400 35929 34463 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072239.1 protein_id gnl|my_center|LOCUS_08400 36434 35937 gene locus_tag LOCUS_08410 36434 35937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 37652 36522 gene locus_tag LOCUS_08420 37652 36522 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 protein_id gnl|my_center|LOCUS_08420 37893 38057 gene locus_tag LOCUS_08430 37893 38057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 38059 38466 gene locus_tag LOCUS_08440 38059 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 38703 39467 gene locus_tag LOCUS_08450 38703 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 40116 39574 gene locus_tag LOCUS_08460 40116 39574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 41872 40358 gene locus_tag LOCUS_08470 gene dacB 41872 40358 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 protein_id gnl|my_center|LOCUS_08470 42166 43368 gene locus_tag LOCUS_08480 42166 43368 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462412.1 protein_id gnl|my_center|LOCUS_08480 44344 43478 gene locus_tag LOCUS_08490 gene folD 44344 43478 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071914.1 protein_id gnl|my_center|LOCUS_08490 45288 44344 gene locus_tag LOCUS_08500 45288 44344 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389102.1 protein_id gnl|my_center|LOCUS_08500 45584 45660 gene locus_tag LOCUS_t00190 45584 45660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45689 45764 gene locus_tag LOCUS_t00200 45689 45764 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 45783 45866 gene locus_tag LOCUS_t00210 45783 45866 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46085 45951 gene locus_tag LOCUS_08510 46085 45951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 46406 46131 gene locus_tag LOCUS_08520 46406 46131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 48106 46748 gene locus_tag LOCUS_08530 48106 46748 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_08530 48672 49136 gene locus_tag LOCUS_08540 48672 49136 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_08540 49750 49256 gene locus_tag LOCUS_08550 49750 49256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08550 50305 49967 gene locus_tag LOCUS_08560 50305 49967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08560 50773 50546 gene locus_tag LOCUS_08570 50773 50546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373720.1 protein_id gnl|my_center|LOCUS_08570 51259 50789 gene locus_tag LOCUS_08580 51259 50789 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_08580 51495 51256 gene locus_tag LOCUS_08590 51495 51256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 51706 53298 gene locus_tag LOCUS_08600 gene prfC 51706 53298 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704687.1 protein_id gnl|my_center|LOCUS_08600 53357 54097 gene locus_tag LOCUS_08610 53357 54097 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_08610 54142 55017 gene locus_tag LOCUS_08620 54142 55017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 55019 56395 gene locus_tag LOCUS_08630 gene radA 55019 56395 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_08630 56956 56450 gene locus_tag LOCUS_08640 56956 56450 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 protein_id gnl|my_center|LOCUS_08640 58778 57126 gene locus_tag LOCUS_08650 gene mepM 58778 57126 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707439.1 protein_id gnl|my_center|LOCUS_08650 59115 59705 gene locus_tag LOCUS_08660 59115 59705 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 protein_id gnl|my_center|LOCUS_08660 59942 59846 gene locus_tag LOCUS_t00220 59942 59846 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 61826 60543 gene locus_tag LOCUS_08670 gene purD 61826 60543 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 protein_id gnl|my_center|LOCUS_08670 63531 61942 gene locus_tag LOCUS_08680 gene purH 63531 61942 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187551.1 protein_id gnl|my_center|LOCUS_08680 64163 64438 gene locus_tag LOCUS_08690 gene hupB 64163 64438 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_08690 64805 66454 gene locus_tag LOCUS_08700 gene pgm 64805 66454 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_08700 66664 67368 gene locus_tag LOCUS_08710 66664 67368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence10 2561 267 gene locus_tag LOCUS_08720 2561 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6730 2570 gene locus_tag LOCUS_08730 6730 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10655 6750 gene locus_tag LOCUS_08740 gene recC 10655 6750 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495624.1 protein_id gnl|my_center|LOCUS_08740 11230 11003 gene locus_tag LOCUS_08750 11230 11003 CDS product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071508.1 protein_id gnl|my_center|LOCUS_08750 12027 11473 gene locus_tag LOCUS_08760 gene gmhB 12027 11473 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261414.1 protein_id gnl|my_center|LOCUS_08760 12542 12027 gene locus_tag LOCUS_08770 gene luxS 12542 12027 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209453.1 protein_id gnl|my_center|LOCUS_08770 13145 12612 gene locus_tag LOCUS_08780 13145 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_08780 13580 13242 gene locus_tag LOCUS_08790 gene glnB 13580 13242 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 protein_id gnl|my_center|LOCUS_08790 14029 14688 gene locus_tag LOCUS_08800 14029 14688 CDS product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635988.1 protein_id gnl|my_center|LOCUS_08800 15220 14819 gene locus_tag LOCUS_08810 gene mutT 15220 14819 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_08810 18214 15248 gene locus_tag LOCUS_08820 18214 15248 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_08820 19342 18356 gene locus_tag LOCUS_08830 gene glpX 19342 18356 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_08830 19757 20188 gene locus_tag LOCUS_08840 19757 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 21871 20285 gene locus_tag LOCUS_08850 21871 20285 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_08850 22611 21940 gene locus_tag LOCUS_08860 22611 21940 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_08860 23269 22619 gene locus_tag LOCUS_08870 gene phoU 23269 22619 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_08870 24059 23298 gene locus_tag LOCUS_08880 gene pstB 24059 23298 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_08880 24913 24062 gene locus_tag LOCUS_08890 gene pstA 24913 24062 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001912363.1 protein_id gnl|my_center|LOCUS_08890 25757 24915 gene locus_tag LOCUS_08900 gene pstC 25757 24915 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_08900 26634 25840 gene locus_tag LOCUS_08910 26634 25840 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_08910 29447 27231 gene locus_tag LOCUS_08920 29447 27231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 30837 29461 gene locus_tag LOCUS_08930 30837 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 31809 30883 gene locus_tag LOCUS_08940 31809 30883 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202197.1 protein_id gnl|my_center|LOCUS_08940 32418 31840 gene locus_tag LOCUS_08950 32418 31840 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_08950 34956 33061 gene locus_tag LOCUS_08960 34956 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 35260 35550 gene locus_tag LOCUS_08970 35260 35550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 35571 35864 gene locus_tag LOCUS_08980 35571 35864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 37804 36062 gene locus_tag LOCUS_08990 gene mdxD 37804 36062 CDS product maltogenic alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886619.1 protein_id gnl|my_center|LOCUS_08990 38062 38868 gene locus_tag LOCUS_09000 38062 38868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 40142 38958 gene locus_tag LOCUS_09010 gene tuf 40142 38958 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 protein_id gnl|my_center|LOCUS_09010 42330 40225 gene locus_tag LOCUS_09020 gene fusA 42330 40225 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707695.1 protein_id gnl|my_center|LOCUS_09020 42819 42349 gene locus_tag LOCUS_09030 gene rpsG 42819 42349 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138050.1 protein_id gnl|my_center|LOCUS_09030 43277 42903 gene locus_tag LOCUS_09040 gene rpsL 43277 42903 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306278.1 protein_id gnl|my_center|LOCUS_09040 43797 43534 gene locus_tag LOCUS_09050 43797 43534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 44216 43926 gene locus_tag LOCUS_09060 44216 43926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 44594 44226 gene locus_tag LOCUS_09070 44594 44226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 45065 44682 gene locus_tag LOCUS_09080 45065 44682 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131142.1 protein_id gnl|my_center|LOCUS_09080 49715 45255 gene locus_tag LOCUS_09090 gene rpoC 49715 45255 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707700.1 protein_id gnl|my_center|LOCUS_09090 54257 49776 gene locus_tag LOCUS_09100 54257 49776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 54792 54424 gene locus_tag LOCUS_09110 gene rplL 54792 54424 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095002.1 protein_id gnl|my_center|LOCUS_09110 55381 54872 gene locus_tag LOCUS_09120 gene rplJ 55381 54872 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095001.1 protein_id gnl|my_center|LOCUS_09120 56279 55563 gene locus_tag LOCUS_09130 gene rplA 56279 55563 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096669.1 protein_id gnl|my_center|LOCUS_09130 56711 56283 gene locus_tag LOCUS_09140 gene rplK 56711 56283 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 protein_id gnl|my_center|LOCUS_09140 57656 56982 gene locus_tag LOCUS_09150 gene nusG 57656 56982 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287510.1 protein_id gnl|my_center|LOCUS_09150 58136 57678 gene locus_tag LOCUS_09160 58136 57678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 58302 58401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58616 58542 gene locus_tag LOCUS_t00230 58616 58542 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58741 58657 gene locus_tag LOCUS_t00240 58741 58657 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 59314 60015 gene locus_tag LOCUS_09170 59314 60015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 61093 60140 gene locus_tag LOCUS_09180 gene birA 61093 60140 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_09180 62073 61078 gene locus_tag LOCUS_09190 gene murB 62073 61078 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070601.1 protein_id gnl|my_center|LOCUS_09190 63355 62075 gene locus_tag LOCUS_09200 gene murA 63355 62075 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707623.1 protein_id gnl|my_center|LOCUS_09200 64470 63553 gene locus_tag LOCUS_09210 gene metA 64470 63553 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212076.1 protein_id gnl|my_center|LOCUS_09210 65117 64632 gene locus_tag LOCUS_09220 65117 64632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence11 159 2045 gene locus_tag LOCUS_09230 gene mnmG 159 2045 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074340.1 protein_id gnl|my_center|LOCUS_09230 2054 2716 gene locus_tag LOCUS_09240 gene rsmG 2054 2716 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652031.1 protein_id gnl|my_center|LOCUS_09240 2730 3497 gene locus_tag LOCUS_09250 2730 3497 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_09250 3509 4444 gene locus_tag LOCUS_09260 3509 4444 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 protein_id gnl|my_center|LOCUS_09260 4973 5929 gene locus_tag LOCUS_09270 4973 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5966 6193 gene locus_tag LOCUS_09280 gene atpE 5966 6193 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_09280 6227 6697 gene locus_tag LOCUS_09290 gene atpF 6227 6697 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099406.1 protein_id gnl|my_center|LOCUS_09290 6712 7242 gene locus_tag LOCUS_09300 gene atpH 6712 7242 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220760.1 protein_id gnl|my_center|LOCUS_09300 7256 8797 gene locus_tag LOCUS_09310 gene atpA 7256 8797 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707910.1 protein_id gnl|my_center|LOCUS_09310 8808 9668 gene locus_tag LOCUS_09320 gene atpG 8808 9668 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 protein_id gnl|my_center|LOCUS_09320 9688 11103 gene locus_tag LOCUS_09330 gene atpD 9688 11103 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307215.1 protein_id gnl|my_center|LOCUS_09330 11119 11547 gene locus_tag LOCUS_09340 11119 11547 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307217.1 protein_id gnl|my_center|LOCUS_09340 12257 11607 gene locus_tag LOCUS_09350 gene rsmD 12257 11607 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262816.1 protein_id gnl|my_center|LOCUS_09350 12547 13521 gene locus_tag LOCUS_09360 12547 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 13604 14512 gene locus_tag LOCUS_09370 gene rpoH 13604 14512 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694033.1 protein_id gnl|my_center|LOCUS_09370 14707 15270 gene locus_tag LOCUS_09380 gene kdsC 14707 15270 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_09380 15257 15826 gene locus_tag LOCUS_09390 gene lptC 15257 15826 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 protein_id gnl|my_center|LOCUS_09390 15798 16343 gene locus_tag LOCUS_09400 gene lptA 15798 16343 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_09400 16354 17079 gene locus_tag LOCUS_09410 gene lptB 16354 17079 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_09410 17097 18749 gene locus_tag LOCUS_09420 17097 18749 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707612.1 protein_id gnl|my_center|LOCUS_09420 18926 19210 gene locus_tag LOCUS_09430 gene hpf 18926 19210 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_09430 19282 19800 gene locus_tag LOCUS_09440 gene ptsN 19282 19800 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 protein_id gnl|my_center|LOCUS_09440 19810 20703 gene locus_tag LOCUS_09450 gene rapZ 19810 20703 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707611.1 protein_id gnl|my_center|LOCUS_09450 20863 21657 gene locus_tag LOCUS_09460 gene mlaF 20863 21657 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 protein_id gnl|my_center|LOCUS_09460 21657 22430 gene locus_tag LOCUS_09470 gene mlaE 21657 22430 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_09470 22444 22968 gene locus_tag LOCUS_09480 gene mlaD 22444 22968 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707620.1 protein_id gnl|my_center|LOCUS_09480 22980 23591 gene locus_tag LOCUS_09490 gene mlaC 22980 23591 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707621.1 protein_id gnl|my_center|LOCUS_09490 23600 23845 gene locus_tag LOCUS_09500 23600 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 23878 24435 gene locus_tag LOCUS_09510 gene yjgA 23878 24435 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073786.1 protein_id gnl|my_center|LOCUS_09510 25956 24514 gene locus_tag LOCUS_09520 gene tldD 25956 24514 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_09520 26577 25990 gene locus_tag LOCUS_09530 26577 25990 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_09530 27097 26579 gene locus_tag LOCUS_09540 gene mreD 27097 26579 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_09540 28106 27090 gene locus_tag LOCUS_09550 gene mreC 28106 27090 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_09550 29212 28163 gene locus_tag LOCUS_09560 29212 28163 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417472.1 protein_id gnl|my_center|LOCUS_09560 30159 29452 gene locus_tag LOCUS_09570 gene ssb 30159 29452 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073744.1 protein_id gnl|my_center|LOCUS_09570 30410 33253 gene locus_tag LOCUS_09580 gene uvrA 30410 33253 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 protein_id gnl|my_center|LOCUS_09580 33265 33645 gene locus_tag LOCUS_09590 33265 33645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 33974 34129 gene locus_tag LOCUS_09600 33974 34129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 34086 35975 gene locus_tag LOCUS_09610 34086 35975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 36001 36819 gene locus_tag LOCUS_09620 36001 36819 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679895.1 protein_id gnl|my_center|LOCUS_09620 36862 38169 gene locus_tag LOCUS_09630 36862 38169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 39276 38278 gene locus_tag LOCUS_09640 39276 38278 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_09640 39480 40838 gene locus_tag LOCUS_09650 gene pmbA 39480 40838 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707624.1 protein_id gnl|my_center|LOCUS_09650 41388 40945 gene locus_tag LOCUS_09660 41388 40945 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704197.1 protein_id gnl|my_center|LOCUS_09660 43866 41398 gene locus_tag LOCUS_09670 gene plsB 43866 41398 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460370.1 protein_id gnl|my_center|LOCUS_09670 44359 44165 gene locus_tag LOCUS_09680 44359 44165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 44292 45110 gene locus_tag LOCUS_09690 44292 45110 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 protein_id gnl|my_center|LOCUS_09690 45246 46094 gene locus_tag LOCUS_09700 gene cysE 45246 46094 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_09700 46244 48145 gene locus_tag LOCUS_09710 46244 48145 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_09710 49719 48400 gene locus_tag LOCUS_09720 gene hslU 49719 48400 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073857.1 protein_id gnl|my_center|LOCUS_09720 50276 49737 gene locus_tag LOCUS_09730 gene hslV 50276 49737 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714422.1 protein_id gnl|my_center|LOCUS_09730 50935 50288 gene locus_tag LOCUS_09740 50935 50288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 52680 50941 gene locus_tag LOCUS_09750 gene argS 52680 50941 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707774.1 protein_id gnl|my_center|LOCUS_09750 55014 52762 gene locus_tag LOCUS_09760 gene priA 55014 52762 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707854.1 protein_id gnl|my_center|LOCUS_09760 55177 55401 gene locus_tag LOCUS_09770 gene rpmE 55177 55401 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 protein_id gnl|my_center|LOCUS_09770 55772 57025 gene locus_tag LOCUS_09780 55772 57025 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_09780 58295 57153 gene locus_tag LOCUS_09790 gene trmA 58295 57153 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421342.1 protein_id gnl|my_center|LOCUS_09790 58396 59151 gene locus_tag LOCUS_09800 gene murI 58396 59151 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176045.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence12 243 3188 gene locus_tag LOCUS_09810 gene gyrA 243 3188 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281169.1 protein_id gnl|my_center|LOCUS_09810 3302 4390 gene locus_tag LOCUS_09820 gene serC 3302 4390 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211326.1 protein_id gnl|my_center|LOCUS_09820 4424 6115 gene locus_tag LOCUS_09830 gene fadD 4424 6115 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455511.1 protein_id gnl|my_center|LOCUS_09830 6163 7314 gene locus_tag LOCUS_09840 gene rnd 6163 7314 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280573.1 protein_id gnl|my_center|LOCUS_09840 9133 7472 gene locus_tag LOCUS_09850 9133 7472 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_09850 9275 9433 gene locus_tag LOCUS_09860 9275 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 9387 9396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11434 9773 gene locus_tag LOCUS_09870 11434 9773 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_09870 12061 13083 gene locus_tag LOCUS_09880 12061 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13086 13730 gene locus_tag LOCUS_09890 13086 13730 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189783.1 protein_id gnl|my_center|LOCUS_09890 14293 13781 gene locus_tag LOCUS_09900 14293 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 14623 14315 gene locus_tag LOCUS_09910 14623 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15514 16428 gene locus_tag LOCUS_09920 15514 16428 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_09920 17112 16516 gene locus_tag LOCUS_09930 17112 16516 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_09930 17867 17121 gene locus_tag LOCUS_09940 17867 17121 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_09940 19129 17876 gene locus_tag LOCUS_09950 19129 17876 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067908.1 protein_id gnl|my_center|LOCUS_09950 19893 19132 gene locus_tag LOCUS_09960 19893 19132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099535.1 protein_id gnl|my_center|LOCUS_09960 20764 19907 gene locus_tag LOCUS_09970 20764 19907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 protein_id gnl|my_center|LOCUS_09970 21948 20878 gene locus_tag LOCUS_09980 21948 20878 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397735.1 protein_id gnl|my_center|LOCUS_09980 23071 21959 gene locus_tag LOCUS_09990 23071 21959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974952.1 protein_id gnl|my_center|LOCUS_09990 23867 24796 gene locus_tag LOCUS_10000 gene cysK 23867 24796 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_10000 24813 25715 gene locus_tag LOCUS_10010 24813 25715 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110235.1 protein_id gnl|my_center|LOCUS_10010 25730 26887 gene locus_tag LOCUS_10020 25730 26887 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964248.1 protein_id gnl|my_center|LOCUS_10020 26908 27807 gene locus_tag LOCUS_10030 gene cysK 26908 27807 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948444.1 protein_id gnl|my_center|LOCUS_10030 28356 28886 gene locus_tag LOCUS_10040 28356 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 29382 28945 gene locus_tag LOCUS_10050 29382 28945 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_10050 29503 30435 gene locus_tag LOCUS_10060 29503 30435 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_10060 30805 31329 gene locus_tag LOCUS_10070 gene porC 30805 31329 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_10070 31339 31626 gene locus_tag LOCUS_10080 gene porD 31339 31626 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868479.1 protein_id gnl|my_center|LOCUS_10080 31626 32786 gene locus_tag LOCUS_10090 31626 32786 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_10090 32789 33676 gene locus_tag LOCUS_10100 32789 33676 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393421.1 protein_id gnl|my_center|LOCUS_10100 33685 35016 gene locus_tag LOCUS_10110 33685 35016 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_10110 36681 35122 gene locus_tag LOCUS_10120 36681 35122 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_10120 37768 36788 gene locus_tag LOCUS_10130 37768 36788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 38205 39830 gene locus_tag LOCUS_10140 38205 39830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_10140 40226 40008 gene locus_tag LOCUS_10150 40226 40008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 41662 40451 gene locus_tag LOCUS_10160 41662 40451 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404729.1 protein_id gnl|my_center|LOCUS_10160 42800 41847 gene locus_tag LOCUS_10170 42800 41847 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 protein_id gnl|my_center|LOCUS_10170 43817 42939 gene locus_tag LOCUS_10180 gene potI 43817 42939 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367524.1 protein_id gnl|my_center|LOCUS_10180 44784 43819 gene locus_tag LOCUS_10190 gene potH 44784 43819 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 protein_id gnl|my_center|LOCUS_10190 46012 44795 gene locus_tag LOCUS_10200 gene potG 46012 44795 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 protein_id gnl|my_center|LOCUS_10200 46230 47408 gene locus_tag LOCUS_10210 46230 47408 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_10210 49274 47478 gene locus_tag LOCUS_10220 49274 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 51182 49317 gene locus_tag LOCUS_10230 51182 49317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 51456 52721 gene locus_tag LOCUS_10240 51456 52721 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_10240 52857 54101 gene locus_tag LOCUS_10250 52857 54101 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814873.1 protein_id gnl|my_center|LOCUS_10250 54150 55139 gene locus_tag LOCUS_10260 gene dusA 54150 55139 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_10260 55150 56025 gene locus_tag LOCUS_10270 55150 56025 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_10270 56739 56284 gene locus_tag LOCUS_10280 56739 56284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 56878 57111 gene locus_tag LOCUS_10290 56878 57111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 57375 57653 gene locus_tag LOCUS_10300 57375 57653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence13 347 1285 gene locus_tag LOCUS_10310 gene flaA 347 1285 CDS product flagellin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705588.1 protein_id gnl|my_center|LOCUS_10310 2051 2986 gene locus_tag LOCUS_10320 gene flaB 2051 2986 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_10320 3452 3126 gene locus_tag LOCUS_10330 3452 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4315 3617 gene locus_tag LOCUS_10340 gene tsaB 4315 3617 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 protein_id gnl|my_center|LOCUS_10340 4829 4662 gene locus_tag LOCUS_10350 4829 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 6947 4869 gene locus_tag LOCUS_10360 6947 4869 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105733.1 protein_id gnl|my_center|LOCUS_10360 7696 6962 gene locus_tag LOCUS_10370 7696 6962 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073780.1 protein_id gnl|my_center|LOCUS_10370 8295 7888 gene locus_tag LOCUS_10380 gene dhaM 8295 7888 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399031.1 protein_id gnl|my_center|LOCUS_10380 9145 8663 gene locus_tag LOCUS_10390 9145 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 9531 9307 gene locus_tag LOCUS_10400 9531 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9770 10132 gene locus_tag LOCUS_10410 gene hinT 9770 10132 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 protein_id gnl|my_center|LOCUS_10410 10119 11171 gene locus_tag LOCUS_10420 10119 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 11212 13161 gene locus_tag LOCUS_10430 11212 13161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 protein_id gnl|my_center|LOCUS_10430 13846 13214 gene locus_tag LOCUS_10440 13846 13214 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_10440 14037 14828 gene locus_tag LOCUS_10450 14037 14828 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 protein_id gnl|my_center|LOCUS_10450 15363 14890 gene locus_tag LOCUS_10460 15363 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 15871 15476 gene locus_tag LOCUS_10470 15871 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 16917 16042 gene locus_tag LOCUS_10480 gene sucD 16917 16042 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 protein_id gnl|my_center|LOCUS_10480 18092 16926 gene locus_tag LOCUS_10490 gene sucC 18092 16926 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 protein_id gnl|my_center|LOCUS_10490 20118 18196 gene locus_tag LOCUS_10500 gene ppiD 20118 18196 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 protein_id gnl|my_center|LOCUS_10500 20559 20284 gene locus_tag LOCUS_10510 20559 20284 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_10510 21262 20846 gene locus_tag LOCUS_10520 21262 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 23723 21273 gene locus_tag LOCUS_10530 gene lon 23723 21273 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_10530 23686 23841 gene locus_tag LOCUS_10540 23686 23841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 25215 23944 gene locus_tag LOCUS_10550 gene clpX 25215 23944 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167638.1 protein_id gnl|my_center|LOCUS_10550 25868 25218 gene locus_tag LOCUS_10560 gene clpP 25868 25218 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 protein_id gnl|my_center|LOCUS_10560 27226 25907 gene locus_tag LOCUS_10570 gene tig 27226 25907 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163508.1 protein_id gnl|my_center|LOCUS_10570 27633 28709 gene locus_tag LOCUS_10580 27633 28709 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_10580 28789 32109 gene locus_tag LOCUS_10590 28789 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 32672 32175 gene locus_tag LOCUS_10600 32672 32175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 33476 32688 gene locus_tag LOCUS_10610 33476 32688 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444259.1 protein_id gnl|my_center|LOCUS_10610 33733 33494 gene locus_tag LOCUS_10620 33733 33494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 34068 35801 gene locus_tag LOCUS_10630 34068 35801 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_10630 35808 36581 gene locus_tag LOCUS_10640 35808 36581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 36792 38372 gene locus_tag LOCUS_10650 gene nhaB 36792 38372 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868985.1 protein_id gnl|my_center|LOCUS_10650 38537 39082 gene locus_tag LOCUS_10660 gene dsbB 38537 39082 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816443.1 protein_id gnl|my_center|LOCUS_10660 39292 39026 gene locus_tag LOCUS_10670 39292 39026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 39396 39530 gene locus_tag LOCUS_10680 39396 39530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 39582 40028 gene locus_tag LOCUS_10690 39582 40028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 40475 41203 gene locus_tag LOCUS_10700 40475 41203 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853259.1 protein_id gnl|my_center|LOCUS_10700 41235 42083 gene locus_tag LOCUS_10710 41235 42083 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360586.1 protein_id gnl|my_center|LOCUS_10710 42173 42895 gene locus_tag LOCUS_10720 42173 42895 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853332.1 protein_id gnl|my_center|LOCUS_10720 42904 43686 gene locus_tag LOCUS_10730 42904 43686 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_10730 43698 44303 gene locus_tag LOCUS_10740 43698 44303 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_10740 44589 45521 gene locus_tag LOCUS_10750 gene hisG 44589 45521 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706053.1 protein_id gnl|my_center|LOCUS_10750 45590 46873 gene locus_tag LOCUS_10760 gene hisD 45590 46873 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706052.1 protein_id gnl|my_center|LOCUS_10760 46886 47959 gene locus_tag LOCUS_10770 gene hisC 46886 47959 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706051.1 protein_id gnl|my_center|LOCUS_10770 47961 49064 gene locus_tag LOCUS_10780 gene hisB 47961 49064 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706050.1 protein_id gnl|my_center|LOCUS_10780 49067 49675 gene locus_tag LOCUS_10790 gene hisH 49067 49675 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193249.1 protein_id gnl|my_center|LOCUS_10790 49684 50418 gene locus_tag LOCUS_10800 gene hisA 49684 50418 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706031.1 protein_id gnl|my_center|LOCUS_10800 50400 51173 gene locus_tag LOCUS_10810 gene hisF 50400 51173 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706044.1 protein_id gnl|my_center|LOCUS_10810 51166 51570 gene locus_tag LOCUS_10820 51166 51570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence14 1179 214 gene locus_tag LOCUS_10830 gene pfkA 1179 214 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 protein_id gnl|my_center|LOCUS_10830 1963 1205 gene locus_tag LOCUS_10840 gene tpiA 1963 1205 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 protein_id gnl|my_center|LOCUS_10840 2640 2308 gene locus_tag LOCUS_10850 2640 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10850 2799 2641 gene locus_tag LOCUS_10860 2799 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3451 2969 gene locus_tag LOCUS_10870 3451 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10870 4730 3666 gene locus_tag LOCUS_10880 4730 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5165 7627 gene locus_tag LOCUS_10890 gene thrA 5165 7627 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 protein_id gnl|my_center|LOCUS_10890 7637 8602 gene locus_tag LOCUS_10900 gene thrB 7637 8602 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706815.1 protein_id gnl|my_center|LOCUS_10900 8613 9896 gene locus_tag LOCUS_10910 gene thrC 8613 9896 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693831.1 protein_id gnl|my_center|LOCUS_10910 10037 10981 gene locus_tag LOCUS_10920 10037 10981 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_10920 11267 11416 gene locus_tag LOCUS_10930 11267 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10930 14243 12540 gene locus_tag LOCUS_10940 14243 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15449 14325 gene locus_tag LOCUS_10950 15449 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 17416 15500 gene locus_tag LOCUS_10960 17416 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 17835 17647 gene locus_tag LOCUS_10970 17835 17647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 17945 19123 gene locus_tag LOCUS_10980 17945 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 19125 21839 gene locus_tag LOCUS_10990 19125 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 21860 23023 gene locus_tag LOCUS_11000 21860 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 23066 25135 gene locus_tag LOCUS_11010 23066 25135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 25150 26805 gene locus_tag LOCUS_11020 25150 26805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 26802 29387 gene locus_tag LOCUS_11030 26802 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 30637 29465 gene locus_tag LOCUS_11040 gene sstT 30637 29465 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263624.1 protein_id gnl|my_center|LOCUS_11040 31169 31393 gene locus_tag LOCUS_11050 31169 31393 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_11050 31393 33615 gene locus_tag LOCUS_11060 gene feoB 31393 33615 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_11060 33788 35650 gene locus_tag LOCUS_11070 33788 35650 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11070 35857 36078 gene locus_tag LOCUS_11080 35857 36078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 36234 38099 gene locus_tag LOCUS_11090 36234 38099 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_11090 38297 40792 gene locus_tag LOCUS_11100 38297 40792 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_11100 40785 41276 gene locus_tag LOCUS_11110 40785 41276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 41451 42425 gene locus_tag LOCUS_11120 41451 42425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 42540 43790 gene locus_tag LOCUS_11130 gene nifS 42540 43790 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_11130 44144 45286 gene locus_tag LOCUS_11140 44144 45286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 45273 46487 gene locus_tag LOCUS_11150 45273 46487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 46632 47744 gene locus_tag LOCUS_11160 gene hisC 46632 47744 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 protein_id gnl|my_center|LOCUS_11160 47745 49019 gene locus_tag LOCUS_11170 gene aroA 47745 49019 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 protein_id gnl|my_center|LOCUS_11170 49284 49928 gene locus_tag LOCUS_11180 49284 49928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence15 257 1807 gene locus_tag LOCUS_11190 257 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2108 3712 gene locus_tag LOCUS_11200 2108 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3925 4782 gene locus_tag LOCUS_11210 gene asd 3925 4782 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421177.1 protein_id gnl|my_center|LOCUS_11210 4997 6805 gene locus_tag LOCUS_11220 gene frdA 4997 6805 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706984.1 protein_id gnl|my_center|LOCUS_11220 6805 7557 gene locus_tag LOCUS_11230 6805 7557 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_11230 7562 8014 gene locus_tag LOCUS_11240 gene frdC 7562 8014 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381491.1 protein_id gnl|my_center|LOCUS_11240 8028 8405 gene locus_tag LOCUS_11250 gene frdD 8028 8405 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706986.1 protein_id gnl|my_center|LOCUS_11250 8581 9999 gene locus_tag LOCUS_11260 gene pykF 8581 9999 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633307.1 protein_id gnl|my_center|LOCUS_11260 10684 10067 gene locus_tag LOCUS_11270 10684 10067 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_11270 11206 10781 gene locus_tag LOCUS_11280 gene fliS 11206 10781 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705592.1 protein_id gnl|my_center|LOCUS_11280 11514 11879 gene locus_tag LOCUS_11290 11514 11879 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263342.1 protein_id gnl|my_center|LOCUS_11290 11889 12323 gene locus_tag LOCUS_11300 11889 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11300 12361 12903 gene locus_tag LOCUS_11310 12361 12903 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_11310 13537 13019 gene locus_tag LOCUS_11320 13537 13019 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705590.1 protein_id gnl|my_center|LOCUS_11320 14089 13796 gene locus_tag LOCUS_11330 14089 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 15325 14114 gene locus_tag LOCUS_11340 15325 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 17390 15339 gene locus_tag LOCUS_11350 gene flgK 17390 15339 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_11350 18445 17465 gene locus_tag LOCUS_11360 gene flgJ 18445 17465 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_11360 19133 19906 gene locus_tag LOCUS_11370 19133 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 21688 20237 gene locus_tag LOCUS_11380 21688 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478449.1 protein_id gnl|my_center|LOCUS_11380 22638 23870 gene locus_tag LOCUS_11390 22638 23870 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818210.1 protein_id gnl|my_center|LOCUS_11390 23880 24917 gene locus_tag LOCUS_11400 gene pseB 23880 24917 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_11400 24918 26078 gene locus_tag LOCUS_11410 gene pseC 24918 26078 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707809.1 protein_id gnl|my_center|LOCUS_11410 26112 26804 gene locus_tag LOCUS_11420 gene pseF 26112 26804 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707835.1 protein_id gnl|my_center|LOCUS_11420 26830 27837 gene locus_tag LOCUS_11430 26830 27837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 28954 28265 gene locus_tag LOCUS_11440 gene ung 28954 28265 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693885.1 protein_id gnl|my_center|LOCUS_11440 29147 29890 gene locus_tag LOCUS_11450 29147 29890 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260655.1 protein_id gnl|my_center|LOCUS_11450 30740 29958 gene locus_tag LOCUS_11460 30740 29958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 31408 33123 gene locus_tag LOCUS_11470 31408 33123 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029314244.1 protein_id gnl|my_center|LOCUS_11470 33556 33942 gene locus_tag LOCUS_11480 33556 33942 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_11480 35267 34113 gene locus_tag LOCUS_11490 gene pheA 35267 34113 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 protein_id gnl|my_center|LOCUS_11490 35616 37427 gene locus_tag LOCUS_11500 35616 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 37539 38471 gene locus_tag LOCUS_11510 37539 38471 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 protein_id gnl|my_center|LOCUS_11510 38468 39295 gene locus_tag LOCUS_11520 gene panB 38468 39295 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_11520 39561 41417 gene locus_tag LOCUS_11530 gene iorA 39561 41417 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_11530 41410 42009 gene locus_tag LOCUS_11540 41410 42009 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_11540 41996 43237 gene locus_tag LOCUS_11550 41996 43237 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_11550 43536 43249 gene locus_tag LOCUS_11560 43536 43249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 43853 44560 gene locus_tag LOCUS_11570 43853 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 44754 45002 gene locus_tag LOCUS_11580 44754 45002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 45345 45187 gene locus_tag LOCUS_11590 45345 45187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 45601 45356 gene locus_tag LOCUS_11600 45601 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 46343 45594 gene locus_tag LOCUS_11610 46343 45594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 46358 47548 gene locus_tag LOCUS_11620 46358 47548 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263404.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence16 662 291 gene locus_tag LOCUS_11630 662 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 1856 897 gene locus_tag LOCUS_11640 gene mdh 1856 897 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861588.1 protein_id gnl|my_center|LOCUS_11640 4675 2123 gene locus_tag LOCUS_11650 gene acnB 4675 2123 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218961313.1 protein_id gnl|my_center|LOCUS_11650 5246 4716 gene locus_tag LOCUS_11660 gene ampD 5246 4716 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_11660 6199 5261 gene locus_tag LOCUS_11670 gene lpxC 6199 5261 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 protein_id gnl|my_center|LOCUS_11670 7546 6497 gene locus_tag LOCUS_11680 gene ftsZ 7546 6497 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_11680 9125 7758 gene locus_tag LOCUS_11690 9125 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 10652 9237 gene locus_tag LOCUS_11700 gene ftsA 10652 9237 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019996.1 protein_id gnl|my_center|LOCUS_11700 11481 10708 gene locus_tag LOCUS_11710 gene ftsQ 11481 10708 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075728.1 protein_id gnl|my_center|LOCUS_11710 12926 11499 gene locus_tag LOCUS_11720 gene murC 12926 11499 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 protein_id gnl|my_center|LOCUS_11720 14038 12992 gene locus_tag LOCUS_11730 gene murG 14038 12992 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_11730 15083 14052 gene locus_tag LOCUS_11740 gene ftsW 15083 14052 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352178.1 protein_id gnl|my_center|LOCUS_11740 16563 15226 gene locus_tag LOCUS_11750 gene murD 16563 15226 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704401.1 protein_id gnl|my_center|LOCUS_11750 17656 16574 gene locus_tag LOCUS_11760 gene mraY 17656 16574 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 protein_id gnl|my_center|LOCUS_11760 19032 17653 gene locus_tag LOCUS_11770 gene murF 19032 17653 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707584.1 protein_id gnl|my_center|LOCUS_11770 20527 19025 gene locus_tag LOCUS_11780 gene murE 20527 19025 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458180.1 protein_id gnl|my_center|LOCUS_11780 22314 20605 gene locus_tag LOCUS_11790 22314 20605 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707586.1 protein_id gnl|my_center|LOCUS_11790 22875 22315 gene locus_tag LOCUS_11800 22875 22315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 23826 22876 gene locus_tag LOCUS_11810 gene rsmH 23826 22876 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073908.1 protein_id gnl|my_center|LOCUS_11810 24334 23852 gene locus_tag LOCUS_11820 gene mraZ 24334 23852 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295533.1 protein_id gnl|my_center|LOCUS_11820 26091 25243 gene locus_tag LOCUS_11830 gene rsmI 26091 25243 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_11830 26864 26289 gene locus_tag LOCUS_11840 26864 26289 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 27008 28834 gene locus_tag LOCUS_11850 27008 28834 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818899.1 protein_id gnl|my_center|LOCUS_11850 28967 30172 gene locus_tag LOCUS_11860 28967 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 30159 30716 gene locus_tag LOCUS_11870 30159 30716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 31286 30741 gene locus_tag LOCUS_11880 gene sspB 31286 30741 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 protein_id gnl|my_center|LOCUS_11880 31779 31387 gene locus_tag LOCUS_11890 gene rpsI 31779 31387 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 protein_id gnl|my_center|LOCUS_11890 32221 31793 gene locus_tag LOCUS_11900 gene rplM 32221 31793 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 protein_id gnl|my_center|LOCUS_11900 33619 32432 gene locus_tag LOCUS_11910 gene nagA 33619 32432 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_11910 33977 34504 gene locus_tag LOCUS_11920 33977 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 34584 35981 gene locus_tag LOCUS_11930 34584 35981 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743136.1 protein_id gnl|my_center|LOCUS_11930 36175 38019 gene locus_tag LOCUS_11940 36175 38019 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11940 38159 39241 gene locus_tag LOCUS_11950 gene degS 38159 39241 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707601.1 protein_id gnl|my_center|LOCUS_11950 40303 39329 gene locus_tag LOCUS_11960 gene bioB 40303 39329 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_11960 40700 44938 gene locus_tag LOCUS_11970 40700 44938 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812165.1 protein_id gnl|my_center|LOCUS_11970 46302 47123 gene locus_tag LOCUS_11980 46302 47123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence17 189 1211 gene locus_tag LOCUS_11990 gene terC 189 1211 CDS product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 protein_id gnl|my_center|LOCUS_11990 2241 1354 gene locus_tag LOCUS_12000 2241 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3115 2276 gene locus_tag LOCUS_12010 3115 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3435 5972 gene locus_tag LOCUS_12020 gene lon 3435 5972 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_12020 7245 6049 gene locus_tag LOCUS_12030 7245 6049 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_12030 8671 7469 gene locus_tag LOCUS_12040 8671 7469 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_12040 8930 9373 gene locus_tag LOCUS_12050 8930 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 9384 9737 gene locus_tag LOCUS_12060 9384 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 10558 9815 gene locus_tag LOCUS_12070 gene rsuA 10558 9815 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 protein_id gnl|my_center|LOCUS_12070 11774 10551 gene locus_tag LOCUS_12080 gene fabB 11774 10551 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_12080 11768 11965 gene locus_tag LOCUS_12090 11768 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 12026 13021 gene locus_tag LOCUS_12100 12026 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 13193 13411 gene locus_tag LOCUS_12110 gene infA 13193 13411 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081934.1 protein_id gnl|my_center|LOCUS_12110 13535 14299 gene locus_tag LOCUS_12120 13535 14299 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_12120 14911 14381 gene locus_tag LOCUS_12130 14911 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 15821 14895 gene locus_tag LOCUS_12140 gene dusC 15821 14895 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694032.1 protein_id gnl|my_center|LOCUS_12140 16017 17000 gene locus_tag LOCUS_12150 16017 17000 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895332.1 protein_id gnl|my_center|LOCUS_12150 17471 17073 gene locus_tag LOCUS_12160 17471 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 18467 17493 gene locus_tag LOCUS_12170 18467 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 19105 20100 gene locus_tag LOCUS_12180 19105 20100 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_12180 20290 21435 gene locus_tag LOCUS_12190 gene dapE 20290 21435 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693818.1 protein_id gnl|my_center|LOCUS_12190 22803 21550 gene locus_tag LOCUS_12200 gene icd 22803 21550 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210910.1 protein_id gnl|my_center|LOCUS_12200 23134 23601 gene locus_tag LOCUS_12210 23134 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 23639 24763 gene locus_tag LOCUS_12220 gene mnmA 23639 24763 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210913.1 protein_id gnl|my_center|LOCUS_12220 24765 25418 gene locus_tag LOCUS_12230 gene hflD 24765 25418 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767416.1 protein_id gnl|my_center|LOCUS_12230 25510 26877 gene locus_tag LOCUS_12240 gene purB 25510 26877 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423724.1 protein_id gnl|my_center|LOCUS_12240 27295 28422 gene locus_tag LOCUS_12250 27295 28422 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 protein_id gnl|my_center|LOCUS_12250 28425 29489 gene locus_tag LOCUS_12260 28425 29489 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622962.1 protein_id gnl|my_center|LOCUS_12260 29486 30160 gene locus_tag LOCUS_12270 29486 30160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 protein_id gnl|my_center|LOCUS_12270 30243 31067 gene locus_tag LOCUS_12280 30243 31067 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 protein_id gnl|my_center|LOCUS_12280 31994 31140 gene locus_tag LOCUS_12290 gene kdsA 31994 31140 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 protein_id gnl|my_center|LOCUS_12290 33206 32193 gene locus_tag LOCUS_12300 33206 32193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 33820 33374 gene locus_tag LOCUS_12310 33820 33374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 38005 33821 gene locus_tag LOCUS_12320 38005 33821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 40483 38027 gene locus_tag LOCUS_12330 gene bcsB 40483 38027 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205645.1 protein_id gnl|my_center|LOCUS_12330 42590 40485 gene locus_tag LOCUS_12340 gene bcsA 42590 40485 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 protein_id gnl|my_center|LOCUS_12340 43397 42603 gene locus_tag LOCUS_12350 43397 42603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 43993 43388 gene locus_tag LOCUS_12360 43993 43388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 45805 44192 gene locus_tag LOCUS_12370 45805 44192 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence18 2529 91 gene locus_tag LOCUS_12380 2529 91 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_12380 2781 3437 gene locus_tag LOCUS_12390 2781 3437 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 protein_id gnl|my_center|LOCUS_12390 3693 4643 gene locus_tag LOCUS_12400 gene corA 3693 4643 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705843.1 protein_id gnl|my_center|LOCUS_12400 5276 4749 gene locus_tag LOCUS_12410 gene yfcD 5276 4749 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705180.1 protein_id gnl|my_center|LOCUS_12410 5420 5623 gene locus_tag LOCUS_12420 5420 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6293 6946 gene locus_tag LOCUS_12430 6293 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 7629 7033 gene locus_tag LOCUS_12440 7629 7033 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_12440 7972 9306 gene locus_tag LOCUS_12450 7972 9306 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389538.1 protein_id gnl|my_center|LOCUS_12450 10379 9405 gene locus_tag LOCUS_12460 10379 9405 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_12460 10608 11339 gene locus_tag LOCUS_12470 10608 11339 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_12470 11701 12174 gene locus_tag LOCUS_12480 11701 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 12158 12688 gene locus_tag LOCUS_12490 12158 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 12702 14102 gene locus_tag LOCUS_12500 gene asnS 12702 14102 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367451.1 protein_id gnl|my_center|LOCUS_12500 14436 15941 gene locus_tag LOCUS_12510 14436 15941 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948595.1 protein_id gnl|my_center|LOCUS_12510 15944 16531 gene locus_tag LOCUS_12520 15944 16531 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 protein_id gnl|my_center|LOCUS_12520 16917 17936 gene locus_tag LOCUS_12530 gene trpD 16917 17936 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706725.1 protein_id gnl|my_center|LOCUS_12530 17987 19408 gene locus_tag LOCUS_12540 gene trpCF 17987 19408 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141446.1 protein_id gnl|my_center|LOCUS_12540 19424 20653 gene locus_tag LOCUS_12550 gene trpB 19424 20653 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 protein_id gnl|my_center|LOCUS_12550 20664 21479 gene locus_tag LOCUS_12560 gene trpA 20664 21479 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022758.1 protein_id gnl|my_center|LOCUS_12560 21538 22710 gene locus_tag LOCUS_12570 21538 22710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_12570 23677 22769 gene locus_tag LOCUS_12580 23677 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 25109 23874 gene locus_tag LOCUS_12590 gene serA 25109 23874 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482463.1 protein_id gnl|my_center|LOCUS_12590 26301 25186 gene locus_tag LOCUS_12600 gene aroG 26301 25186 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165590136.1 protein_id gnl|my_center|LOCUS_12600 27572 26766 gene locus_tag LOCUS_12610 27572 26766 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940517.1 protein_id gnl|my_center|LOCUS_12610 28928 27600 gene locus_tag LOCUS_12620 28928 27600 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208366.1 protein_id gnl|my_center|LOCUS_12620 30324 29053 gene locus_tag LOCUS_12630 gene pepT 30324 29053 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_12630 32284 30335 gene locus_tag LOCUS_12640 32284 30335 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697391.1 protein_id gnl|my_center|LOCUS_12640 33525 32299 gene locus_tag LOCUS_12650 gene macA 33525 32299 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706787.1 protein_id gnl|my_center|LOCUS_12650 33805 35013 gene locus_tag LOCUS_12660 33805 35013 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_12660 35042 35674 gene locus_tag LOCUS_12670 35042 35674 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972137.1 protein_id gnl|my_center|LOCUS_12670 37391 35781 gene locus_tag LOCUS_12680 37391 35781 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_12680 37976 37650 gene locus_tag LOCUS_12690 37976 37650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 38209 39018 gene locus_tag LOCUS_12700 38209 39018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 39060 40067 gene locus_tag LOCUS_12710 39060 40067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 40082 40375 gene locus_tag LOCUS_12720 gene minE 40082 40375 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552653.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence19 379 1944 gene locus_tag LOCUS_12730 gene murJ 379 1944 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_12730 2073 2993 gene locus_tag LOCUS_12740 gene uspE 2073 2993 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300766.1 protein_id gnl|my_center|LOCUS_12740 3466 3224 gene locus_tag LOCUS_12750 3466 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3363 4184 gene locus_tag LOCUS_12760 3363 4184 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389548.1 protein_id gnl|my_center|LOCUS_12760 5027 4266 gene locus_tag LOCUS_12770 gene bioC 5027 4266 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107785.1 protein_id gnl|my_center|LOCUS_12770 5734 5066 gene locus_tag LOCUS_12780 5734 5066 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107784.1 protein_id gnl|my_center|LOCUS_12780 6940 5744 gene locus_tag LOCUS_12790 6940 5744 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202494.1 protein_id gnl|my_center|LOCUS_12790 7131 8579 gene locus_tag LOCUS_12800 7131 8579 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694602.1 protein_id gnl|my_center|LOCUS_12800 8600 10663 gene locus_tag LOCUS_12810 gene malZ 8600 10663 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816914.1 protein_id gnl|my_center|LOCUS_12810 11311 12534 gene locus_tag LOCUS_12820 gene ackA 11311 12534 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072820.1 protein_id gnl|my_center|LOCUS_12820 12797 13438 gene locus_tag LOCUS_12830 gene pdxH 12797 13438 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282325.1 protein_id gnl|my_center|LOCUS_12830 14361 13513 gene locus_tag LOCUS_12840 gene purU 14361 13513 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 protein_id gnl|my_center|LOCUS_12840 14570 15883 gene locus_tag LOCUS_12850 14570 15883 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 protein_id gnl|my_center|LOCUS_12850 16950 16003 gene locus_tag LOCUS_12860 16950 16003 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 protein_id gnl|my_center|LOCUS_12860 17492 17133 gene locus_tag LOCUS_12870 gene rplT 17492 17133 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_12870 17724 17512 gene locus_tag LOCUS_12880 gene rpmI 17724 17512 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300673.1 protein_id gnl|my_center|LOCUS_12880 18362 17802 gene locus_tag LOCUS_12890 gene infC 18362 17802 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080374.1 protein_id gnl|my_center|LOCUS_12890 20368 18389 gene locus_tag LOCUS_12900 gene thrS 20368 18389 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706169.1 protein_id gnl|my_center|LOCUS_12900 20905 20982 gene locus_tag LOCUS_t00250 20905 20982 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21470 22513 gene locus_tag LOCUS_12910 gene chvE 21470 22513 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_12910 23783 23148 gene locus_tag LOCUS_12920 23783 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 25945 24764 gene locus_tag LOCUS_12930 gene manA 25945 24764 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263541.1 protein_id gnl|my_center|LOCUS_12930 26790 27794 gene locus_tag LOCUS_12940 26790 27794 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975869.1 protein_id gnl|my_center|LOCUS_12940 29425 27908 gene locus_tag LOCUS_12950 gene purF 29425 27908 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 protein_id gnl|my_center|LOCUS_12950 29931 29428 gene locus_tag LOCUS_12960 gene cvpA 29931 29428 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420022.1 protein_id gnl|my_center|LOCUS_12960 31238 29931 gene locus_tag LOCUS_12970 gene serS 31238 29931 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705744.1 protein_id gnl|my_center|LOCUS_12970 32801 31365 gene locus_tag LOCUS_12980 32801 31365 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196299305.1 protein_id gnl|my_center|LOCUS_12980 33417 32779 gene locus_tag LOCUS_12990 gene lolA 33417 32779 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693608.1 protein_id gnl|my_center|LOCUS_12990 37359 33487 gene locus_tag LOCUS_13000 37359 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 37715 38182 gene locus_tag LOCUS_13010 gene trmL 37715 38182 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932342.1 protein_id gnl|my_center|LOCUS_13010 38329 38976 gene locus_tag LOCUS_13020 38329 38976 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224979.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence20 58 1143 gene locus_tag LOCUS_13030 58 1143 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_13030 1136 1816 gene locus_tag LOCUS_13040 1136 1816 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 protein_id gnl|my_center|LOCUS_13040 1838 3175 gene locus_tag LOCUS_13050 1838 3175 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_13050 3207 4058 gene locus_tag LOCUS_13060 3207 4058 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 protein_id gnl|my_center|LOCUS_13060 4156 5181 gene locus_tag LOCUS_13070 4156 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13070 5093 5473 gene locus_tag LOCUS_13080 5093 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 7730 5931 gene locus_tag LOCUS_13090 7730 5931 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13090 8702 7911 gene locus_tag LOCUS_13100 8702 7911 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_13100 9581 8892 gene locus_tag LOCUS_13110 9581 8892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 protein_id gnl|my_center|LOCUS_13110 10637 9582 gene locus_tag LOCUS_13120 10637 9582 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388546.1 protein_id gnl|my_center|LOCUS_13120 10971 11489 gene locus_tag LOCUS_13130 10971 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13130 11437 11985 gene locus_tag LOCUS_13140 11437 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12234 14054 gene locus_tag LOCUS_13150 12234 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 15016 14150 gene locus_tag LOCUS_13160 15016 14150 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116972861.1 protein_id gnl|my_center|LOCUS_13160 15693 15028 gene locus_tag LOCUS_13170 15693 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 16101 16688 gene locus_tag LOCUS_13180 gene rsxA 16101 16688 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210595.1 protein_id gnl|my_center|LOCUS_13180 16685 17251 gene locus_tag LOCUS_13190 gene rsxB 16685 17251 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_13190 17251 19275 gene locus_tag LOCUS_13200 gene rsxC 17251 19275 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915818.1 protein_id gnl|my_center|LOCUS_13200 19279 20463 gene locus_tag LOCUS_13210 gene rsxD 19279 20463 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_13210 20463 21137 gene locus_tag LOCUS_13220 gene rsxG 20463 21137 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 protein_id gnl|my_center|LOCUS_13220 21138 21881 gene locus_tag LOCUS_13230 21138 21881 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944880.1 protein_id gnl|my_center|LOCUS_13230 22635 21928 gene locus_tag LOCUS_13240 gene queC 22635 21928 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_13240 22914 24356 gene locus_tag LOCUS_13250 gene flgE 22914 24356 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 protein_id gnl|my_center|LOCUS_13250 25215 24499 gene locus_tag LOCUS_13260 25215 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 26026 26481 gene locus_tag LOCUS_13270 26026 26481 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_13270 27650 26526 gene locus_tag LOCUS_13280 27650 26526 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706497.1 protein_id gnl|my_center|LOCUS_13280 27737 28927 gene locus_tag LOCUS_13290 gene purT 27737 28927 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705978.1 protein_id gnl|my_center|LOCUS_13290 28985 30961 gene locus_tag LOCUS_13300 28985 30961 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178979.1 protein_id gnl|my_center|LOCUS_13300 30982 31173 gene locus_tag LOCUS_13310 30982 31173 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_13310 31226 32464 gene locus_tag LOCUS_13320 31226 32464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 35216 32529 gene locus_tag LOCUS_13330 gene topA 35216 32529 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429232.1 protein_id gnl|my_center|LOCUS_13330 36355 35234 gene locus_tag LOCUS_13340 gene sohB 36355 35234 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 protein_id gnl|my_center|LOCUS_13340 37326 36442 gene locus_tag LOCUS_13350 37326 36442 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_13350 37907 37623 gene locus_tag LOCUS_13360 gene rplY 37907 37623 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945378.1 protein_id gnl|my_center|LOCUS_13360 38325 38834 gene locus_tag LOCUS_13370 38325 38834 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence21 358 927 gene locus_tag LOCUS_13380 358 927 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_13380 920 2164 gene locus_tag LOCUS_13390 gene porA 920 2164 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_13390 2177 3238 gene locus_tag LOCUS_13400 2177 3238 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 protein_id gnl|my_center|LOCUS_13400 3253 4881 gene locus_tag LOCUS_13410 3253 4881 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_13410 5060 5449 gene locus_tag LOCUS_13420 5060 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5853 6005 gene locus_tag LOCUS_13430 5853 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6137 6778 gene locus_tag LOCUS_13440 gene crp 6137 6778 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704916.1 protein_id gnl|my_center|LOCUS_13440 6878 7408 gene locus_tag LOCUS_13450 gene fabA 6878 7408 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_13450 7803 8873 gene locus_tag LOCUS_13460 7803 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9902 9012 gene locus_tag LOCUS_13470 gene flaA 9902 9012 CDS product flagellin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705588.1 protein_id gnl|my_center|LOCUS_13470 10799 10026 gene locus_tag LOCUS_13480 10799 10026 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_13480 10944 12086 gene locus_tag LOCUS_13490 10944 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 12406 13533 gene locus_tag LOCUS_13500 gene potF 12406 13533 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_13500 16418 13635 gene locus_tag LOCUS_13510 16418 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 16624 16749 gene locus_tag LOCUS_13520 16624 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 18019 16844 gene locus_tag LOCUS_13530 18019 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 18686 18030 gene locus_tag LOCUS_13540 gene apt 18686 18030 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301904.1 protein_id gnl|my_center|LOCUS_13540 18860 19585 gene locus_tag LOCUS_13550 gene gph 18860 19585 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_13550 19805 20944 gene locus_tag LOCUS_13560 19805 20944 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 protein_id gnl|my_center|LOCUS_13560 21181 21951 gene locus_tag LOCUS_13570 21181 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 22145 22909 gene locus_tag LOCUS_13580 22145 22909 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224973.1 protein_id gnl|my_center|LOCUS_13580 22909 23715 gene locus_tag LOCUS_13590 22909 23715 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_13590 24890 26518 gene locus_tag LOCUS_13600 24890 26518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 28551 26716 gene locus_tag LOCUS_13610 gene uvrC 28551 26716 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706578.1 protein_id gnl|my_center|LOCUS_13610 30307 28679 gene locus_tag LOCUS_13620 30307 28679 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_13620 32158 30575 gene locus_tag LOCUS_13630 32158 30575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 33285 32326 gene locus_tag LOCUS_13640 33285 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 33776 34666 gene locus_tag LOCUS_13650 33776 34666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 35099 34719 gene locus_tag LOCUS_13660 35099 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 37000 35981 gene locus_tag LOCUS_13670 gene rfbB 37000 35981 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_13670 37613 37062 gene locus_tag LOCUS_13680 gene rfbC 37613 37062 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_13680 38493 37600 gene locus_tag LOCUS_13690 gene rfbA 38493 37600 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence22 1312 728 gene locus_tag LOCUS_13700 1312 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2032 1463 gene locus_tag LOCUS_13710 2032 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2667 2083 gene locus_tag LOCUS_13720 2667 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2999 2700 gene locus_tag LOCUS_13730 2999 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3313 2993 gene locus_tag LOCUS_13740 3313 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3993 3433 gene locus_tag LOCUS_13750 3993 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4684 4076 gene locus_tag LOCUS_13760 4684 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5871 5035 gene locus_tag LOCUS_13770 gene prmC 5871 5035 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 protein_id gnl|my_center|LOCUS_13770 6965 5871 gene locus_tag LOCUS_13780 gene prfA 6965 5871 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456867.1 protein_id gnl|my_center|LOCUS_13780 7804 7163 gene locus_tag LOCUS_13790 7804 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8760 8620 gene locus_tag LOCUS_13800 8760 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 9339 8851 gene locus_tag LOCUS_13810 9339 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10192 9422 gene locus_tag LOCUS_13820 10192 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11809 10244 gene locus_tag LOCUS_13830 11809 10244 CDS product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626525.1 protein_id gnl|my_center|LOCUS_13830 13408 11870 gene locus_tag LOCUS_13840 13408 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 15116 13410 gene locus_tag LOCUS_13850 15116 13410 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032711012.1 protein_id gnl|my_center|LOCUS_13850 16314 15118 gene locus_tag LOCUS_13860 16314 15118 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267836.1 protein_id gnl|my_center|LOCUS_13860 17071 16304 gene locus_tag LOCUS_13870 17071 16304 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771461.1 protein_id gnl|my_center|LOCUS_13870 19003 17075 gene locus_tag LOCUS_13880 19003 17075 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267838.1 protein_id gnl|my_center|LOCUS_13880 20219 19023 gene locus_tag LOCUS_13890 20219 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 23092 20261 gene locus_tag LOCUS_13900 23092 20261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 27147 23101 gene locus_tag LOCUS_13910 27147 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 27428 27351 gene locus_tag LOCUS_t00260 27428 27351 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27507 27432 gene locus_tag LOCUS_t00270 27507 27432 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27609 27534 gene locus_tag LOCUS_t00280 27609 27534 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27707 27632 gene locus_tag LOCUS_t00290 27707 27632 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 28897 28049 gene locus_tag LOCUS_13920 28897 28049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 29620 29099 gene locus_tag LOCUS_13930 gene pal 29620 29099 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_13930 30987 29701 gene locus_tag LOCUS_13940 gene tolB 30987 29701 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707363.1 protein_id gnl|my_center|LOCUS_13940 32093 31029 gene locus_tag LOCUS_13950 32093 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 32540 32106 gene locus_tag LOCUS_13960 gene tolR 32540 32106 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_13960 33532 32543 gene locus_tag LOCUS_13970 33532 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 33976 33533 gene locus_tag LOCUS_13980 gene ybgC 33976 33533 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483618.1 protein_id gnl|my_center|LOCUS_13980 35046 33976 gene locus_tag LOCUS_13990 gene ruvB 35046 33976 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220958.1 protein_id gnl|my_center|LOCUS_13990 35667 35050 gene locus_tag LOCUS_14000 gene ruvA 35667 35050 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580325.1 protein_id gnl|my_center|LOCUS_14000 36265 35726 gene locus_tag LOCUS_14010 gene ruvC 36265 35726 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111361.1 protein_id gnl|my_center|LOCUS_14010 37828 36536 gene locus_tag LOCUS_14020 37828 36536 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280242.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence23 1464 844 gene locus_tag LOCUS_14030 1464 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2486 1446 gene locus_tag LOCUS_14040 2486 1446 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940117.1 protein_id gnl|my_center|LOCUS_14040 2883 2473 gene locus_tag LOCUS_14050 2883 2473 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269111.1 protein_id gnl|my_center|LOCUS_14050 3127 2867 gene locus_tag LOCUS_14060 3127 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3837 3133 gene locus_tag LOCUS_14070 3837 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5034 3838 gene locus_tag LOCUS_14080 5034 3838 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 protein_id gnl|my_center|LOCUS_14080 5313 5038 gene locus_tag LOCUS_14090 5313 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6636 5380 gene locus_tag LOCUS_14100 6636 5380 CDS product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940121.1 protein_id gnl|my_center|LOCUS_14100 8399 6633 gene locus_tag LOCUS_14110 8399 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8846 8523 gene locus_tag LOCUS_14120 8846 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 9241 8885 gene locus_tag LOCUS_14130 9241 8885 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062338.1 protein_id gnl|my_center|LOCUS_14130 10759 9254 gene locus_tag LOCUS_14140 10759 9254 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269115.1 protein_id gnl|my_center|LOCUS_14140 11371 10778 gene locus_tag LOCUS_14150 11371 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 11797 11372 gene locus_tag LOCUS_14160 11797 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 12185 11790 gene locus_tag LOCUS_14170 12185 11790 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702391.1 protein_id gnl|my_center|LOCUS_14170 12526 12185 gene locus_tag LOCUS_14180 12526 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13817 12627 gene locus_tag LOCUS_14190 13817 12627 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337207.1 protein_id gnl|my_center|LOCUS_14190 14497 13817 gene locus_tag LOCUS_14200 14497 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15746 14511 gene locus_tag LOCUS_14210 15746 14511 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337209.1 protein_id gnl|my_center|LOCUS_14210 17441 15756 gene locus_tag LOCUS_14220 17441 15756 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_14220 17896 17444 gene locus_tag LOCUS_14230 17896 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 18394 18014 gene locus_tag LOCUS_14240 18394 18014 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140048.1 protein_id gnl|my_center|LOCUS_14240 18448 18981 gene locus_tag LOCUS_14250 18448 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 19151 19945 gene locus_tag LOCUS_14260 19151 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 20605 20093 gene locus_tag LOCUS_14270 20605 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 21150 20668 gene locus_tag LOCUS_14280 21150 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21400 21134 gene locus_tag LOCUS_14290 21400 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 22454 21744 gene locus_tag LOCUS_14300 22454 21744 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_14300 22895 22620 gene locus_tag LOCUS_14310 22895 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 23330 22896 gene locus_tag LOCUS_14320 23330 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 23733 23320 gene locus_tag LOCUS_14330 23733 23320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 24850 23720 gene locus_tag LOCUS_14340 24850 23720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 26586 24862 gene locus_tag LOCUS_14350 26586 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 27907 26612 gene locus_tag LOCUS_14360 27907 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 28127 27918 gene locus_tag LOCUS_14370 28127 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 28284 28970 gene locus_tag LOCUS_14380 28284 28970 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_14380 29366 30451 gene locus_tag LOCUS_14390 29366 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 30463 31470 gene locus_tag LOCUS_14400 30463 31470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 31509 32204 gene locus_tag LOCUS_14410 31509 32204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 32214 32435 gene locus_tag LOCUS_14420 32214 32435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 32428 34116 gene locus_tag LOCUS_14430 32428 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 34117 34725 gene locus_tag LOCUS_14440 34117 34725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 34735 34950 gene locus_tag LOCUS_14450 34735 34950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 34943 35581 gene locus_tag LOCUS_14460 34943 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 35565 36365 gene locus_tag LOCUS_14470 35565 36365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 36355 36699 gene locus_tag LOCUS_14480 36355 36699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 36834 37064 gene locus_tag LOCUS_14490 36834 37064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 37061 37264 gene locus_tag LOCUS_14500 37061 37264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence24 697 200 gene locus_tag LOCUS_14510 gene tadA 697 200 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706618.1 protein_id gnl|my_center|LOCUS_14510 1124 735 gene locus_tag LOCUS_14520 1124 735 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_14520 1419 6167 gene locus_tag LOCUS_14530 1419 6167 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087210.1 protein_id gnl|my_center|LOCUS_14530 6186 8264 gene locus_tag LOCUS_14540 gene pbpC 6186 8264 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923313.1 protein_id gnl|my_center|LOCUS_14540 9873 8749 gene locus_tag LOCUS_14550 gene thiH 9873 8749 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_14550 10657 9875 gene locus_tag LOCUS_14560 10657 9875 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260916.1 protein_id gnl|my_center|LOCUS_14560 10863 10660 gene locus_tag LOCUS_14570 10863 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 12389 10878 gene locus_tag LOCUS_14580 gene thiE 12389 10878 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 protein_id gnl|my_center|LOCUS_14580 13935 12379 gene locus_tag LOCUS_14590 gene thiC 13935 12379 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121180.1 protein_id gnl|my_center|LOCUS_14590 14965 14174 gene locus_tag LOCUS_14600 gene kdsB 14965 14174 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011329.1 protein_id gnl|my_center|LOCUS_14600 16043 15021 gene locus_tag LOCUS_14610 gene lpxK 16043 15021 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456276.1 protein_id gnl|my_center|LOCUS_14610 16761 16036 gene locus_tag LOCUS_14620 16761 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 17780 16776 gene locus_tag LOCUS_14630 gene truB 17780 16776 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429261.1 protein_id gnl|my_center|LOCUS_14630 18143 19399 gene locus_tag LOCUS_14640 18143 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 19396 20049 gene locus_tag LOCUS_14650 19396 20049 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_14650 20699 20061 gene locus_tag LOCUS_14660 20699 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 22207 20729 gene locus_tag LOCUS_14670 gene putP 22207 20729 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 protein_id gnl|my_center|LOCUS_14670 23259 22351 gene locus_tag LOCUS_14680 gene rfbD 23259 22351 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_14680 23785 23381 gene locus_tag LOCUS_14690 23785 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 24554 23823 gene locus_tag LOCUS_14700 gene rnt 24554 23823 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 protein_id gnl|my_center|LOCUS_14700 25078 27015 gene locus_tag LOCUS_14710 25078 27015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 27691 27248 gene locus_tag LOCUS_14720 gene mscL 27691 27248 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 protein_id gnl|my_center|LOCUS_14720 28664 27756 gene locus_tag LOCUS_14730 28664 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 29072 30004 gene locus_tag LOCUS_14740 gene cysK 29072 30004 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_14740 30078 31361 gene locus_tag LOCUS_14750 30078 31361 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_14750 31638 31423 gene locus_tag LOCUS_14760 31638 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 32030 32413 gene locus_tag LOCUS_14770 32030 32413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 33612 32491 gene locus_tag LOCUS_14780 33612 32491 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_14780 35730 33820 gene locus_tag LOCUS_14790 gene htpG 35730 33820 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence25 591 115 gene locus_tag LOCUS_14800 gene smpB 591 115 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705343.1 protein_id gnl|my_center|LOCUS_14800 933 2699 gene locus_tag LOCUS_14810 933 2699 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481899.1 protein_id gnl|my_center|LOCUS_14810 2834 3769 gene locus_tag LOCUS_14820 gene flaA 2834 3769 CDS product flagellin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705588.1 protein_id gnl|my_center|LOCUS_14820 3914 5578 gene locus_tag LOCUS_14830 gene ettA 3914 5578 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 protein_id gnl|my_center|LOCUS_14830 7276 5651 gene locus_tag LOCUS_14840 7276 5651 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_14840 7994 7422 gene locus_tag LOCUS_14850 7994 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 8151 8906 gene locus_tag LOCUS_14860 8151 8906 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_14860 9726 8980 gene locus_tag LOCUS_14870 9726 8980 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 protein_id gnl|my_center|LOCUS_14870 11038 9749 gene locus_tag LOCUS_14880 11038 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 11769 11032 gene locus_tag LOCUS_14890 gene tsaA 11769 11032 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261411.1 protein_id gnl|my_center|LOCUS_14890 12145 11741 gene locus_tag LOCUS_14900 12145 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 13598 12195 gene locus_tag LOCUS_14910 gene gltX 13598 12195 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 protein_id gnl|my_center|LOCUS_14910 14644 13769 gene locus_tag LOCUS_14920 14644 13769 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_14920 15089 16915 gene locus_tag LOCUS_14930 15089 16915 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_14930 17770 16994 gene locus_tag LOCUS_14940 17770 16994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009854121.1 protein_id gnl|my_center|LOCUS_14940 18185 17886 gene locus_tag LOCUS_14950 18185 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 18736 20370 gene locus_tag LOCUS_14960 gene ptsP 18736 20370 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_14960 20386 21708 gene locus_tag LOCUS_14970 20386 21708 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 protein_id gnl|my_center|LOCUS_14970 22018 22091 gene locus_tag LOCUS_t00300 22018 22091 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22462 23298 gene locus_tag LOCUS_14980 22462 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 23505 24545 gene locus_tag LOCUS_14990 23505 24545 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_14990 27997 24779 gene locus_tag LOCUS_15000 27997 24779 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_15000 29216 28038 gene locus_tag LOCUS_15010 29216 28038 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123229.1 protein_id gnl|my_center|LOCUS_15010 30999 29257 gene locus_tag LOCUS_15020 30999 29257 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_15020 32866 31169 gene locus_tag LOCUS_15030 32866 31169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 34525 33188 gene locus_tag LOCUS_15040 gene tolC 34525 33188 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_15040 34763 34688 gene locus_tag LOCUS_t00310 34763 34688 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 34863 34788 gene locus_tag LOCUS_t00320 34863 34788 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35042 34967 gene locus_tag LOCUS_t00330 35042 34967 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35146 35071 gene locus_tag LOCUS_t00340 35146 35071 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 972 1166 gene locus_tag LOCUS_15050 972 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2547 1363 gene locus_tag LOCUS_15060 2547 1363 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129562.1 protein_id gnl|my_center|LOCUS_15060 2838 2754 gene locus_tag LOCUS_t00350 2838 2754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5208 2914 gene locus_tag LOCUS_15070 gene sltY 5208 2914 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280705.1 protein_id gnl|my_center|LOCUS_15070 6664 5285 gene locus_tag LOCUS_15080 6664 5285 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_15080 8133 6754 gene locus_tag LOCUS_15090 8133 6754 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_15090 9579 8170 gene locus_tag LOCUS_15100 9579 8170 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_15100 11877 9640 gene locus_tag LOCUS_15110 gene pnp 11877 9640 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139988996.1 protein_id gnl|my_center|LOCUS_15110 12239 11973 gene locus_tag LOCUS_15120 gene rpsO 12239 11973 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 protein_id gnl|my_center|LOCUS_15120 13571 12537 gene locus_tag LOCUS_15130 13571 12537 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083937.1 protein_id gnl|my_center|LOCUS_15130 15825 13648 gene locus_tag LOCUS_15140 15825 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 17176 15950 gene locus_tag LOCUS_15150 gene gguB 17176 15950 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_15150 18754 17180 gene locus_tag LOCUS_15160 gene gguA 18754 17180 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_15160 19894 18827 gene locus_tag LOCUS_15170 gene chvE 19894 18827 CDS product sugar ABC transporter substrate-binding protein ChvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311697.1 protein_id gnl|my_center|LOCUS_15170 22003 20474 gene locus_tag LOCUS_15180 22003 20474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 21927 22103 gene locus_tag LOCUS_15190 21927 22103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 22245 23411 gene locus_tag LOCUS_15200 22245 23411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_15200 23533 25137 gene locus_tag LOCUS_15210 23533 25137 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_15210 25325 26356 gene locus_tag LOCUS_15220 25325 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 27234 26605 gene locus_tag LOCUS_15230 27234 26605 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_15230 27918 27316 gene locus_tag LOCUS_15240 27918 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 28973 28068 gene locus_tag LOCUS_15250 28973 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 29327 29761 gene locus_tag LOCUS_15260 29327 29761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 29789 30205 gene locus_tag LOCUS_15270 29789 30205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 30235 30945 gene locus_tag LOCUS_15280 30235 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 31994 31005 gene locus_tag LOCUS_15290 31994 31005 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_15290 32742 32380 gene locus_tag LOCUS_tm00010 32742 32380 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 33061 34773 gene locus_tag LOCUS_15300 gene sulP 33061 34773 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence27 1631 1026 gene locus_tag LOCUS_15310 1631 1026 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389386.1 protein_id gnl|my_center|LOCUS_15310 1911 2555 gene locus_tag LOCUS_15320 1911 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2548 3690 gene locus_tag LOCUS_15330 gene dapE 2548 3690 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693818.1 protein_id gnl|my_center|LOCUS_15330 4756 3758 gene locus_tag LOCUS_15340 4756 3758 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_15340 5646 4768 gene locus_tag LOCUS_15350 5646 4768 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209762.1 protein_id gnl|my_center|LOCUS_15350 7028 5643 gene locus_tag LOCUS_15360 7028 5643 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_15360 7158 8048 gene locus_tag LOCUS_15370 7158 8048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_15370 8166 8510 gene locus_tag LOCUS_15380 8166 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 9360 8533 gene locus_tag LOCUS_15390 gene nudC 9360 8533 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_15390 10295 9357 gene locus_tag LOCUS_15400 gene trxB 10295 9357 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946716.1 protein_id gnl|my_center|LOCUS_15400 10969 10292 gene locus_tag LOCUS_15410 10969 10292 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705376.1 protein_id gnl|my_center|LOCUS_15410 15233 10959 gene locus_tag LOCUS_15420 15233 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 16349 15345 gene locus_tag LOCUS_15430 16349 15345 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706496.1 protein_id gnl|my_center|LOCUS_15430 17092 16742 gene locus_tag LOCUS_15440 17092 16742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 17489 17779 gene locus_tag LOCUS_15450 gene ihfA 17489 17779 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229265.1 protein_id gnl|my_center|LOCUS_15450 17876 18136 gene locus_tag LOCUS_15460 17876 18136 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_15460 20016 18472 gene locus_tag LOCUS_15470 20016 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 21754 20024 gene locus_tag LOCUS_15480 21754 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 23020 21938 gene locus_tag LOCUS_15490 23020 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 23791 23216 gene locus_tag LOCUS_15500 23791 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 28091 24063 gene locus_tag LOCUS_15510 gene hrpA 28091 24063 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706074.1 protein_id gnl|my_center|LOCUS_15510 30050 28188 gene locus_tag LOCUS_15520 30050 28188 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340298.1 protein_id gnl|my_center|LOCUS_15520 30644 32341 gene locus_tag LOCUS_15530 gene asnB 30644 32341 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_15530 32511 33419 gene locus_tag LOCUS_15540 32511 33419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 33595 34335 gene locus_tag LOCUS_15550 33595 34335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence28 1396 284 gene locus_tag LOCUS_15560 gene asd 1396 284 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694497.1 protein_id gnl|my_center|LOCUS_15560 2433 1441 gene locus_tag LOCUS_15570 2433 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4557 2689 gene locus_tag LOCUS_15580 4557 2689 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_15580 4802 6604 gene locus_tag LOCUS_15590 4802 6604 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 protein_id gnl|my_center|LOCUS_15590 6616 7233 gene locus_tag LOCUS_15600 gene lolB 6616 7233 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993150.1 protein_id gnl|my_center|LOCUS_15600 7236 8078 gene locus_tag LOCUS_15610 gene ispE 7236 8078 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 protein_id gnl|my_center|LOCUS_15610 8261 9211 gene locus_tag LOCUS_15620 gene prs 8261 9211 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298109.1 protein_id gnl|my_center|LOCUS_15620 10605 9331 gene locus_tag LOCUS_15630 10605 9331 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_15630 12038 10902 gene locus_tag LOCUS_15640 12038 10902 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 protein_id gnl|my_center|LOCUS_15640 13163 12048 gene locus_tag LOCUS_15650 gene menC 13163 12048 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 protein_id gnl|my_center|LOCUS_15650 14076 13243 gene locus_tag LOCUS_15660 14076 13243 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 protein_id gnl|my_center|LOCUS_15660 14398 15426 gene locus_tag LOCUS_15670 14398 15426 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_15670 15423 16106 gene locus_tag LOCUS_15680 15423 16106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_15680 17648 16275 gene locus_tag LOCUS_15690 17648 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 19075 17702 gene locus_tag LOCUS_15700 gene mpl 19075 17702 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479669.1 protein_id gnl|my_center|LOCUS_15700 20264 19158 gene locus_tag LOCUS_15710 20264 19158 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706752.1 protein_id gnl|my_center|LOCUS_15710 20563 20330 gene locus_tag LOCUS_15720 20563 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 20900 22624 gene locus_tag LOCUS_15730 20900 22624 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_15730 22636 22911 gene locus_tag LOCUS_15740 22636 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 23063 24862 gene locus_tag LOCUS_15750 23063 24862 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_15750 25034 26365 gene locus_tag LOCUS_15760 25034 26365 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_15760 26380 26592 gene locus_tag LOCUS_15770 26380 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 26675 28297 gene locus_tag LOCUS_15780 gene almE 26675 28297 CDS product lipid A modification system glycine--protein ligase AlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146752.1 protein_id gnl|my_center|LOCUS_15780 28299 29153 gene locus_tag LOCUS_15790 28299 29153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 30378 29260 gene locus_tag LOCUS_15800 30378 29260 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706637.1 protein_id gnl|my_center|LOCUS_15800 31086 30397 gene locus_tag LOCUS_15810 gene flgH 31086 30397 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 protein_id gnl|my_center|LOCUS_15810 31935 31147 gene locus_tag LOCUS_15820 gene flgG 31935 31147 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706639.1 protein_id gnl|my_center|LOCUS_15820 32698 31949 gene locus_tag LOCUS_15830 gene flgF 32698 31949 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706640.1 protein_id gnl|my_center|LOCUS_15830 33753 33049 gene locus_tag LOCUS_15840 gene flgD 33753 33049 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244383.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence29 252 773 gene locus_tag LOCUS_15850 252 773 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_15850 1591 776 gene locus_tag LOCUS_15860 1591 776 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_15860 2849 1629 gene locus_tag LOCUS_15870 2849 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4569 3001 gene locus_tag LOCUS_15880 gene guaA 4569 3001 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815789.1 protein_id gnl|my_center|LOCUS_15880 6100 4634 gene locus_tag LOCUS_15890 gene guaB 6100 4634 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705859.1 protein_id gnl|my_center|LOCUS_15890 6360 6830 gene locus_tag LOCUS_15900 6360 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6845 7258 gene locus_tag LOCUS_15910 6845 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 7327 8277 gene locus_tag LOCUS_15920 7327 8277 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_15920 8402 10414 gene locus_tag LOCUS_15930 gene sppA 8402 10414 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705783.1 protein_id gnl|my_center|LOCUS_15930 12677 10500 gene locus_tag LOCUS_15940 gene glgX 12677 10500 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707355.1 protein_id gnl|my_center|LOCUS_15940 15008 12831 gene locus_tag LOCUS_15950 gene glgB 15008 12831 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707356.1 protein_id gnl|my_center|LOCUS_15950 17227 15026 gene locus_tag LOCUS_15960 gene malQ 17227 15026 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818803.1 protein_id gnl|my_center|LOCUS_15960 17856 18866 gene locus_tag LOCUS_15970 gene gap 17856 18866 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707358.1 protein_id gnl|my_center|LOCUS_15970 19990 18971 gene locus_tag LOCUS_15980 gene pseI 19990 18971 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 protein_id gnl|my_center|LOCUS_15980 20988 20095 gene locus_tag LOCUS_15990 gene htpX 20988 20095 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_15990 22471 21095 gene locus_tag LOCUS_16000 22471 21095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 23604 22474 gene locus_tag LOCUS_16010 gene tyrA 23604 22474 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_16010 24413 23604 gene locus_tag LOCUS_16020 24413 23604 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301472.1 protein_id gnl|my_center|LOCUS_16020 24585 29048 gene locus_tag LOCUS_16030 24585 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 29056 29544 gene locus_tag LOCUS_16040 29056 29544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 32275 29651 gene locus_tag LOCUS_16050 gene mrcB 32275 29651 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_16050 32633 33094 gene locus_tag LOCUS_16060 gene dksA 32633 33094 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 protein_id gnl|my_center|LOCUS_16060 33124 34017 gene locus_tag LOCUS_16070 gene gluQRS 33124 34017 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence30 1634 453 gene locus_tag LOCUS_16080 1634 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3253 2315 gene locus_tag LOCUS_16090 3253 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5006 3441 gene locus_tag LOCUS_16100 5006 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 6279 5083 gene locus_tag LOCUS_16110 6279 5083 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 protein_id gnl|my_center|LOCUS_16110 7787 6369 gene locus_tag LOCUS_16120 7787 6369 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705398.1 protein_id gnl|my_center|LOCUS_16120 8757 8038 gene locus_tag LOCUS_16130 8757 8038 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_16130 9449 8763 gene locus_tag LOCUS_16140 9449 8763 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_16140 10232 9498 gene locus_tag LOCUS_16150 10232 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 10879 10454 gene locus_tag LOCUS_16160 10879 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 11204 11821 gene locus_tag LOCUS_16170 11204 11821 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_16170 11870 12085 gene locus_tag LOCUS_16180 11870 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 13368 12217 gene locus_tag LOCUS_16190 gene ugpC 13368 12217 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705560.1 protein_id gnl|my_center|LOCUS_16190 14651 13416 gene locus_tag LOCUS_16200 14651 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 16333 14669 gene locus_tag LOCUS_16210 gene malF 16333 14669 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705559.1 protein_id gnl|my_center|LOCUS_16210 17594 16410 gene locus_tag LOCUS_16220 gene malE 17594 16410 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_16220 19210 18326 gene locus_tag LOCUS_16230 19210 18326 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_16230 19339 19818 gene locus_tag LOCUS_16240 gene ybaK 19339 19818 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707484.1 protein_id gnl|my_center|LOCUS_16240 21448 19901 gene locus_tag LOCUS_16250 21448 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 22416 21967 gene locus_tag LOCUS_16260 22416 21967 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_16260 22892 22449 gene locus_tag LOCUS_16270 22892 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 23252 23094 gene locus_tag LOCUS_16280 23252 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 23998 23342 gene locus_tag LOCUS_16290 23998 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 25136 24072 gene locus_tag LOCUS_16300 gene nadA 25136 24072 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818805.1 protein_id gnl|my_center|LOCUS_16300 25743 25210 gene locus_tag LOCUS_16310 25743 25210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 28517 25839 gene locus_tag LOCUS_16320 28517 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 29378 28932 gene locus_tag LOCUS_16330 29378 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 31569 29869 gene locus_tag LOCUS_16340 31569 29869 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_16340 32074 33033 gene locus_tag LOCUS_16350 32074 33033 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_16350 33512 33435 gene locus_tag LOCUS_t00360 33512 33435 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence31 121 210 gene locus_tag LOCUS_t00370 121 210 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 517 2367 gene locus_tag LOCUS_16360 517 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2696 2364 gene locus_tag LOCUS_16370 gene tusE 2696 2364 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 protein_id gnl|my_center|LOCUS_16370 2719 2808 gene locus_tag LOCUS_t00380 2719 2808 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3198 3794 gene locus_tag LOCUS_16380 3198 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3949 3776 gene locus_tag LOCUS_16390 3949 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4557 3958 gene locus_tag LOCUS_16400 gene ribA 4557 3958 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110510.1 protein_id gnl|my_center|LOCUS_16400 4916 5602 gene locus_tag LOCUS_16410 gene cmk 4916 5602 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420163.1 protein_id gnl|my_center|LOCUS_16410 5624 7360 gene locus_tag LOCUS_16420 gene rpsA 5624 7360 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 protein_id gnl|my_center|LOCUS_16420 8738 7446 gene locus_tag LOCUS_16430 8738 7446 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073142.1 protein_id gnl|my_center|LOCUS_16430 8971 9279 gene locus_tag LOCUS_16440 gene ihfB 8971 9279 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 protein_id gnl|my_center|LOCUS_16440 9452 9742 gene locus_tag LOCUS_16450 9452 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 9749 10912 gene locus_tag LOCUS_16460 gene lapB 9749 10912 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 protein_id gnl|my_center|LOCUS_16460 10916 11614 gene locus_tag LOCUS_16470 gene pyrF 10916 11614 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999562.1 protein_id gnl|my_center|LOCUS_16470 12049 11645 gene locus_tag LOCUS_16480 12049 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 12191 12658 gene locus_tag LOCUS_16490 gene sixA 12191 12658 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406129.1 protein_id gnl|my_center|LOCUS_16490 12909 13130 gene locus_tag LOCUS_16500 12909 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 13312 14334 gene locus_tag LOCUS_16510 gene prmB 13312 14334 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706198.1 protein_id gnl|my_center|LOCUS_16510 14324 15421 gene locus_tag LOCUS_16520 gene aroC 14324 15421 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_16520 15506 15982 gene locus_tag LOCUS_16530 15506 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 17414 16071 gene locus_tag LOCUS_16540 17414 16071 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764627.1 protein_id gnl|my_center|LOCUS_16540 18070 17468 gene locus_tag LOCUS_16550 gene xpt 18070 17468 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786581.1 protein_id gnl|my_center|LOCUS_16550 19419 18094 gene locus_tag LOCUS_16560 gene rimO 19419 18094 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037694.1 protein_id gnl|my_center|LOCUS_16560 20414 19497 gene locus_tag LOCUS_16570 20414 19497 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938927.1 protein_id gnl|my_center|LOCUS_16570 20639 21250 gene locus_tag LOCUS_16580 20639 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 21270 21818 gene locus_tag LOCUS_16590 21270 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 22076 21888 gene locus_tag LOCUS_16600 22076 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 22000 22644 gene locus_tag LOCUS_16610 22000 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 22650 23252 gene locus_tag LOCUS_16620 22650 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 23303 24283 gene locus_tag LOCUS_16630 gene uspE 23303 24283 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656626.1 protein_id gnl|my_center|LOCUS_16630 24296 25168 gene locus_tag LOCUS_16640 gene ttcA 24296 25168 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157406.1 protein_id gnl|my_center|LOCUS_16640 25950 25213 gene locus_tag LOCUS_16650 25950 25213 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_16650 26792 25956 gene locus_tag LOCUS_16660 gene folP 26792 25956 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694653.1 protein_id gnl|my_center|LOCUS_16660 27539 26910 gene locus_tag LOCUS_16670 27539 26910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 27866 29839 gene locus_tag LOCUS_16680 27866 29839 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944118.1 protein_id gnl|my_center|LOCUS_16680 29896 30216 gene locus_tag LOCUS_16690 29896 30216 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 protein_id gnl|my_center|LOCUS_16690 30219 30824 gene locus_tag LOCUS_16700 gene recR 30219 30824 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 protein_id gnl|my_center|LOCUS_16700 31564 31097 gene locus_tag LOCUS_16710 31564 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 31821 31570 gene locus_tag LOCUS_16720 31821 31570 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence32 497 1447 gene locus_tag LOCUS_16730 497 1447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527033.1 protein_id gnl|my_center|LOCUS_16730 1459 2961 gene locus_tag LOCUS_16740 gene rbsA 1459 2961 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_16740 2973 3938 gene locus_tag LOCUS_16750 gene rbsC 2973 3938 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211864.1 protein_id gnl|my_center|LOCUS_16750 3997 5436 gene locus_tag LOCUS_16760 gene araA 3997 5436 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287282.1 protein_id gnl|my_center|LOCUS_16760 5591 6253 gene locus_tag LOCUS_16770 5591 6253 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390759.1 protein_id gnl|my_center|LOCUS_16770 6314 8149 gene locus_tag LOCUS_16780 6314 8149 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_16780 9419 8190 gene locus_tag LOCUS_16790 gene pepT 9419 8190 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 protein_id gnl|my_center|LOCUS_16790 11042 9471 gene locus_tag LOCUS_16800 11042 9471 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211634.1 protein_id gnl|my_center|LOCUS_16800 13061 11634 gene locus_tag LOCUS_16810 13061 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 14761 13625 gene locus_tag LOCUS_16820 14761 13625 CDS product IS110-like element IS1328 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815600.1 protein_id gnl|my_center|LOCUS_16820 15143 15799 gene locus_tag LOCUS_16830 15143 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 16720 17028 gene locus_tag LOCUS_16840 16720 17028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 17307 17406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18558 17446 gene locus_tag LOCUS_16850 18558 17446 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_16850 20444 18579 gene locus_tag LOCUS_16860 20444 18579 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_16860 21454 20849 gene locus_tag LOCUS_16870 21454 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 23152 21842 gene locus_tag LOCUS_16880 23152 21842 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_16880 24147 23152 gene locus_tag LOCUS_16890 24147 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 24464 24210 gene locus_tag LOCUS_16900 24464 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 24679 25527 gene locus_tag LOCUS_16910 24679 25527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 26498 25611 gene locus_tag LOCUS_16920 26498 25611 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_16920 29578 26558 gene locus_tag LOCUS_16930 29578 26558 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence33 181 2763 gene locus_tag LOCUS_16940 gene mutS 181 2763 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261298.1 protein_id gnl|my_center|LOCUS_16940 3794 2814 gene locus_tag LOCUS_16950 gene rpoS 3794 2814 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_16950 5108 3840 gene locus_tag LOCUS_16960 5108 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6042 5419 gene locus_tag LOCUS_16970 6042 5419 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_16970 6526 6047 gene locus_tag LOCUS_16980 gene ispF 6526 6047 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704772.1 protein_id gnl|my_center|LOCUS_16980 7211 6528 gene locus_tag LOCUS_16990 gene ispD 7211 6528 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 protein_id gnl|my_center|LOCUS_16990 7519 7223 gene locus_tag LOCUS_17000 gene ftsB 7519 7223 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420699.1 protein_id gnl|my_center|LOCUS_17000 9172 7529 gene locus_tag LOCUS_17010 9172 7529 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455581.1 protein_id gnl|my_center|LOCUS_17010 11603 9336 gene locus_tag LOCUS_17020 gene relA 11603 9336 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 protein_id gnl|my_center|LOCUS_17020 13023 11674 gene locus_tag LOCUS_17030 gene rlmD 13023 11674 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704765.1 protein_id gnl|my_center|LOCUS_17030 13730 13023 gene locus_tag LOCUS_17040 gene recO 13730 13023 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 protein_id gnl|my_center|LOCUS_17040 14652 13759 gene locus_tag LOCUS_17050 gene era 14652 13759 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657841.1 protein_id gnl|my_center|LOCUS_17050 15377 14673 gene locus_tag LOCUS_17060 gene rnc 15377 14673 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_17060 16312 15383 gene locus_tag LOCUS_17070 gene lepB 16312 15383 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704748.1 protein_id gnl|my_center|LOCUS_17070 18142 16331 gene locus_tag LOCUS_17080 gene lepA 18142 16331 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 protein_id gnl|my_center|LOCUS_17080 19123 18272 gene locus_tag LOCUS_17090 19123 18272 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071553.1 protein_id gnl|my_center|LOCUS_17090 19825 19226 gene locus_tag LOCUS_17100 19825 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 20434 19847 gene locus_tag LOCUS_17110 gene rpoE 20434 19847 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_17110 20826 22436 gene locus_tag LOCUS_17120 gene nadB 20826 22436 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 protein_id gnl|my_center|LOCUS_17120 22570 25917 gene locus_tag LOCUS_17130 gene mscK 22570 25917 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704612.1 protein_id gnl|my_center|LOCUS_17130 26219 26034 gene locus_tag LOCUS_17140 26219 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 26298 27815 gene locus_tag LOCUS_17150 26298 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 27840 28376 gene locus_tag LOCUS_17160 27840 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence34 2773 191 gene locus_tag LOCUS_17170 gene clpB 2773 191 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 protein_id gnl|my_center|LOCUS_17170 3846 3061 gene locus_tag LOCUS_17180 gene pgeF 3846 3061 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477884.1 protein_id gnl|my_center|LOCUS_17180 4804 3830 gene locus_tag LOCUS_17190 gene rluD 4804 3830 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460300.1 protein_id gnl|my_center|LOCUS_17190 4924 5643 gene locus_tag LOCUS_17200 gene bamD 4924 5643 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166516.1 protein_id gnl|my_center|LOCUS_17200 5789 6421 gene locus_tag LOCUS_17210 gene rluA 5789 6421 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478830.1 protein_id gnl|my_center|LOCUS_17210 7349 6414 gene locus_tag LOCUS_17220 gene djlA 7349 6414 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417332.1 protein_id gnl|my_center|LOCUS_17220 8431 7370 gene locus_tag LOCUS_17230 8431 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 9194 8520 gene locus_tag LOCUS_17240 9194 8520 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_17240 10201 9194 gene locus_tag LOCUS_17250 10201 9194 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704883.1 protein_id gnl|my_center|LOCUS_17250 10895 10167 gene locus_tag LOCUS_17260 gene trmB 10895 10167 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_17260 11782 10904 gene locus_tag LOCUS_17270 gene dapA 11782 10904 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 protein_id gnl|my_center|LOCUS_17270 13422 11902 gene locus_tag LOCUS_17280 gene lysS 13422 11902 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707134.1 protein_id gnl|my_center|LOCUS_17280 14349 13447 gene locus_tag LOCUS_17290 gene prfB 14349 13447 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707133.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 14813 15658 gene locus_tag LOCUS_17300 gene nadC 14813 15658 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_17300 16810 15728 gene locus_tag LOCUS_17310 gene alr 16810 15728 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 protein_id gnl|my_center|LOCUS_17310 18296 16839 gene locus_tag LOCUS_17320 gene dnaB 18296 16839 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073663.1 protein_id gnl|my_center|LOCUS_17320 18542 18466 gene locus_tag LOCUS_t00390 18542 18466 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18615 18714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18930 18836 gene locus_tag LOCUS_t00400 18930 18836 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19200 19012 gene locus_tag LOCUS_17330 19200 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 21840 19207 gene locus_tag LOCUS_17340 gene alaS 21840 19207 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707429.1 protein_id gnl|my_center|LOCUS_17340 22154 23278 gene locus_tag LOCUS_17350 22154 23278 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930625.1 protein_id gnl|my_center|LOCUS_17350 23984 24145 gene locus_tag LOCUS_17360 23984 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 24749 24261 gene locus_tag LOCUS_17370 gene recX 24749 24261 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947526.1 protein_id gnl|my_center|LOCUS_17370 25987 24815 gene locus_tag LOCUS_17380 gene recA 25987 24815 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence35 894 2669 gene locus_tag LOCUS_17390 894 2669 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551340.1 protein_id gnl|my_center|LOCUS_17390 2678 3424 gene locus_tag LOCUS_17400 2678 3424 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707832.1 protein_id gnl|my_center|LOCUS_17400 3424 4281 gene locus_tag LOCUS_17410 3424 4281 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_17410 4297 5271 gene locus_tag LOCUS_17420 4297 5271 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_17420 5261 6883 gene locus_tag LOCUS_17430 5261 6883 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_17430 7021 7359 gene locus_tag LOCUS_17440 7021 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 7430 8608 gene locus_tag LOCUS_17450 7430 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 8729 9925 gene locus_tag LOCUS_17460 8729 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 9960 10775 gene locus_tag LOCUS_17470 9960 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10823 11551 gene locus_tag LOCUS_17480 10823 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 11563 12639 gene locus_tag LOCUS_17490 11563 12639 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_17490 12614 13831 gene locus_tag LOCUS_17500 12614 13831 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_17500 13947 14927 gene locus_tag LOCUS_17510 13947 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 15072 15920 gene locus_tag LOCUS_17520 15072 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 15980 17098 gene locus_tag LOCUS_17530 gene wecB 15980 17098 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966345.1 protein_id gnl|my_center|LOCUS_17530 17101 18177 gene locus_tag LOCUS_17540 17101 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 18193 19059 gene locus_tag LOCUS_17550 18193 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 19222 19458 gene locus_tag LOCUS_17560 19222 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 19509 20258 gene locus_tag LOCUS_17570 gene fabG 19509 20258 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681771.1 protein_id gnl|my_center|LOCUS_17570 20375 21145 gene locus_tag LOCUS_17580 20375 21145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 21251 22699 gene locus_tag LOCUS_17590 21251 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 22713 23924 gene locus_tag LOCUS_17600 22713 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence36 906 328 gene locus_tag LOCUS_17610 gene pgsA 906 328 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_17610 1728 943 gene locus_tag LOCUS_17620 gene truA 1728 943 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072966.1 protein_id gnl|my_center|LOCUS_17620 2154 1732 gene locus_tag LOCUS_17630 2154 1732 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303379.1 protein_id gnl|my_center|LOCUS_17630 3164 2154 gene locus_tag LOCUS_17640 3164 2154 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705135.1 protein_id gnl|my_center|LOCUS_17640 3840 3178 gene locus_tag LOCUS_17650 gene folE 3840 3178 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419880.1 protein_id gnl|my_center|LOCUS_17650 4615 3824 gene locus_tag LOCUS_17660 4615 3824 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_17660 5528 4650 gene locus_tag LOCUS_17670 5528 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6835 5537 gene locus_tag LOCUS_17680 gene folC 6835 5537 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104737.1 protein_id gnl|my_center|LOCUS_17680 7803 6835 gene locus_tag LOCUS_17690 gene accD 7803 6835 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_17690 8801 8085 gene locus_tag LOCUS_17700 8801 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 9802 8987 gene locus_tag LOCUS_17710 9802 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 10339 10172 gene locus_tag LOCUS_17720 10339 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 10529 11617 gene locus_tag LOCUS_17730 10529 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 11634 13307 gene locus_tag LOCUS_17740 11634 13307 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_17740 13307 14305 gene locus_tag LOCUS_17750 13307 14305 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_17750 14402 15157 gene locus_tag LOCUS_17760 14402 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 15169 15768 gene locus_tag LOCUS_17770 15169 15768 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210640.1 protein_id gnl|my_center|LOCUS_17770 15783 16691 gene locus_tag LOCUS_17780 gene galU 15783 16691 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 protein_id gnl|my_center|LOCUS_17780 16918 18150 gene locus_tag LOCUS_17790 16918 18150 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567142.1 protein_id gnl|my_center|LOCUS_17790 18678 19367 gene locus_tag LOCUS_17800 18678 19367 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_17800 19536 20663 gene locus_tag LOCUS_17810 19536 20663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475460.1 protein_id gnl|my_center|LOCUS_17810 21051 21323 gene locus_tag LOCUS_17820 21051 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 21361 21897 gene locus_tag LOCUS_17830 21361 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22175 24142 gene locus_tag LOCUS_17840 22175 24142 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065250839.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence37 1531 191 gene locus_tag LOCUS_17850 gene bioA 1531 191 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_17850 2195 1521 gene locus_tag LOCUS_17860 gene bioD 2195 1521 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_17860 3142 2252 gene locus_tag LOCUS_17870 gene flaA 3142 2252 CDS product flagellin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705588.1 protein_id gnl|my_center|LOCUS_17870 3815 5284 gene locus_tag LOCUS_17880 3815 5284 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706437.1 protein_id gnl|my_center|LOCUS_17880 6806 5625 gene locus_tag LOCUS_17890 6806 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 7387 6926 gene locus_tag LOCUS_17900 7387 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 9091 7412 gene locus_tag LOCUS_17910 gene glnS 9091 7412 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705426.1 protein_id gnl|my_center|LOCUS_17910 9525 9878 gene locus_tag LOCUS_17920 9525 9878 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 protein_id gnl|my_center|LOCUS_17920 10674 10024 gene locus_tag LOCUS_17930 10674 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 11178 10867 gene locus_tag LOCUS_17940 11178 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11933 11178 gene locus_tag LOCUS_17950 11933 11178 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_17950 12269 13624 gene locus_tag LOCUS_17960 gene lysC 12269 13624 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261141.1 protein_id gnl|my_center|LOCUS_17960 13797 15311 gene locus_tag LOCUS_17970 gene fliD 13797 15311 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_17970 16631 15462 gene locus_tag LOCUS_17980 gene fbaA 16631 15462 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 protein_id gnl|my_center|LOCUS_17980 17809 16643 gene locus_tag LOCUS_17990 17809 16643 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_17990 20112 18112 gene locus_tag LOCUS_18000 gene tkt 20112 18112 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995655.1 protein_id gnl|my_center|LOCUS_18000 21164 20136 gene locus_tag LOCUS_18010 21164 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 22127 21477 gene locus_tag LOCUS_18020 gene fsa 22127 21477 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423115.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence38 1653 97 gene locus_tag LOCUS_18030 1653 97 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_18030 3140 1923 gene locus_tag LOCUS_18040 3140 1923 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_18040 4434 3214 gene locus_tag LOCUS_18050 4434 3214 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_18050 6823 4820 gene locus_tag LOCUS_18060 6823 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7394 6984 gene locus_tag LOCUS_18070 7394 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9015 7381 gene locus_tag LOCUS_18080 9015 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 9144 10502 gene locus_tag LOCUS_18090 gene cca 9144 10502 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 protein_id gnl|my_center|LOCUS_18090 11417 10578 gene locus_tag LOCUS_18100 11417 10578 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_18100 11965 11420 gene locus_tag LOCUS_18110 gene folK 11965 11420 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262665.1 protein_id gnl|my_center|LOCUS_18110 12323 11955 gene locus_tag LOCUS_18120 12323 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 13359 12343 gene locus_tag LOCUS_18130 gene tsaD 13359 12343 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098775.1 protein_id gnl|my_center|LOCUS_18130 13875 13438 gene locus_tag LOCUS_18140 gene dtd 13875 13438 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207966.1 protein_id gnl|my_center|LOCUS_18140 13940 14317 gene locus_tag LOCUS_18150 gene crcB 13940 14317 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_18150 14483 14698 gene locus_tag LOCUS_18160 gene rpsU 14483 14698 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_18160 15118 14837 gene locus_tag LOCUS_18170 15118 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 15825 15403 gene locus_tag LOCUS_18180 15825 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 16950 16021 gene locus_tag LOCUS_18190 16950 16021 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 protein_id gnl|my_center|LOCUS_18190 17989 17054 gene locus_tag LOCUS_18200 17989 17054 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_18200 18991 18002 gene locus_tag LOCUS_18210 18991 18002 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_18210 19507 19223 gene locus_tag LOCUS_18220 19507 19223 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_18220 19931 20890 gene locus_tag LOCUS_18230 19931 20890 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_18230 21509 20985 gene locus_tag LOCUS_18240 21509 20985 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_18240 22037 21540 gene locus_tag LOCUS_18250 22037 21540 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811992.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence39 83 3466 gene locus_tag LOCUS_18260 83 3466 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_18260 3587 5425 gene locus_tag LOCUS_18270 3587 5425 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18270 5563 7050 gene locus_tag LOCUS_18280 gene pcnB 5563 7050 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707279.1 protein_id gnl|my_center|LOCUS_18280 7052 7546 gene locus_tag LOCUS_18290 gene folK 7052 7546 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438641.1 protein_id gnl|my_center|LOCUS_18290 7539 8135 gene locus_tag LOCUS_18300 gene pth 7539 8135 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152942.1 protein_id gnl|my_center|LOCUS_18300 8148 9242 gene locus_tag LOCUS_18310 gene ychF 8148 9242 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 protein_id gnl|my_center|LOCUS_18310 9614 9327 gene locus_tag LOCUS_18320 9614 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 9842 9994 gene locus_tag LOCUS_18330 9842 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 10901 10011 gene locus_tag LOCUS_18340 gene uspE 10901 10011 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 protein_id gnl|my_center|LOCUS_18340 11288 12751 gene locus_tag LOCUS_18350 gene modF 11288 12751 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 protein_id gnl|my_center|LOCUS_18350 14509 13253 gene locus_tag LOCUS_18360 14509 13253 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483082.1 protein_id gnl|my_center|LOCUS_18360 15687 14563 gene locus_tag LOCUS_18370 gene proB 15687 14563 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210573.1 protein_id gnl|my_center|LOCUS_18370 17046 15787 gene locus_tag LOCUS_18380 gene frsA 17046 15787 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368041.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence40 <1 1628 gene locus_tag LOCUS_18390 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964265.1:site-specific DNA-methyltransferase 1640 3754 gene locus_tag LOCUS_18400 1640 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4586 3867 gene locus_tag LOCUS_18410 4586 3867 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925911.1 protein_id gnl|my_center|LOCUS_18410 5001 6104 gene locus_tag LOCUS_18420 5001 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6187 9102 gene locus_tag LOCUS_18430 gene glnE 6187 9102 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819368.1 protein_id gnl|my_center|LOCUS_18430 9603 9154 gene locus_tag LOCUS_18440 9603 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 10659 9616 gene locus_tag LOCUS_18450 gene lpxL 10659 9616 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202108103.1 protein_id gnl|my_center|LOCUS_18450 11791 10769 gene locus_tag LOCUS_18460 gene galR 11791 10769 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209845.1 protein_id gnl|my_center|LOCUS_18460 11990 13009 gene locus_tag LOCUS_18470 gene galE 11990 13009 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 protein_id gnl|my_center|LOCUS_18470 13109 14152 gene locus_tag LOCUS_18480 gene galT 13109 14152 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_18480 14172 15332 gene locus_tag LOCUS_18490 gene galK 14172 15332 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_18490 15615 16601 gene locus_tag LOCUS_18500 15615 16601 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_18500 16741 17004 gene locus_tag LOCUS_18510 16741 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence41 187 963 gene locus_tag LOCUS_18520 187 963 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_18520 1872 1054 gene locus_tag LOCUS_18530 1872 1054 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_18530 2348 2563 gene locus_tag LOCUS_18540 2348 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2634 4388 gene locus_tag LOCUS_18550 gene ggt 2634 4388 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_18550 4949 5353 gene locus_tag LOCUS_18560 4949 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 5812 7581 gene locus_tag LOCUS_18570 gene aspS 5812 7581 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694347.1 protein_id gnl|my_center|LOCUS_18570 7609 8367 gene locus_tag LOCUS_18580 7609 8367 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705419.1 protein_id gnl|my_center|LOCUS_18580 8504 10453 gene locus_tag LOCUS_18590 gene rpoD 8504 10453 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071499.1 protein_id gnl|my_center|LOCUS_18590 11554 10577 gene locus_tag LOCUS_18600 gene glk 11554 10577 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211615.1 protein_id gnl|my_center|LOCUS_18600 11877 11713 gene locus_tag LOCUS_18610 11877 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 13884 11923 gene locus_tag LOCUS_18620 13884 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 15436 13931 gene locus_tag LOCUS_18630 15436 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 15940 15542 gene locus_tag LOCUS_18640 15940 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 16180 16255 gene locus_tag LOCUS_t00410 16180 16255 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence42 312 2135 gene locus_tag LOCUS_18650 312 2135 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18650 2238 2639 gene locus_tag LOCUS_18660 2238 2639 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007781386.1 protein_id gnl|my_center|LOCUS_18660 3013 2669 gene locus_tag LOCUS_18670 3013 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3582 3052 gene locus_tag LOCUS_18680 3582 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6564 3733 gene locus_tag LOCUS_18690 6564 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6784 8391 gene locus_tag LOCUS_18700 6784 8391 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18700 9447 8464 gene locus_tag LOCUS_18710 9447 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9664 9891 gene locus_tag LOCUS_18720 9664 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 10028 10273 gene locus_tag LOCUS_18730 10028 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 10598 11938 gene locus_tag LOCUS_18740 10598 11938 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792073.1 protein_id gnl|my_center|LOCUS_18740 13556 12234 gene locus_tag LOCUS_18750 13556 12234 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence43 1124 234 gene locus_tag LOCUS_18760 1124 234 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_18760 1696 3090 gene locus_tag LOCUS_18770 1696 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3426 3133 gene locus_tag LOCUS_18780 3426 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3560 4402 gene locus_tag LOCUS_18790 gene rlmJ 3560 4402 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_18790 4409 5275 gene locus_tag LOCUS_18800 4409 5275 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_18800 5480 5770 gene locus_tag LOCUS_18810 5480 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5780 6448 gene locus_tag LOCUS_18820 5780 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6449 8605 gene locus_tag LOCUS_18830 6449 8605 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 protein_id gnl|my_center|LOCUS_18830 8689 8928 gene locus_tag LOCUS_18840 8689 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 11316 9013 gene locus_tag LOCUS_18850 11316 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 11994 12230 gene locus_tag LOCUS_18860 11994 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18860 12940 13206 gene locus_tag LOCUS_18870 12940 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 >Feature sequence44 458 105 gene locus_tag LOCUS_18880 458 105 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903552.1 protein_id gnl|my_center|LOCUS_18880 1003 506 gene locus_tag LOCUS_18890 1003 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1221 2387 gene locus_tag LOCUS_18900 1221 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3662 2586 gene locus_tag LOCUS_18910 3662 2586 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_18910 5048 3915 gene locus_tag LOCUS_18920 5048 3915 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_18920 6555 5524 gene locus_tag LOCUS_18930 gene pyrD 6555 5524 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261892.1 protein_id gnl|my_center|LOCUS_18930 6899 6669 gene locus_tag LOCUS_18940 6899 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 9565 6926 gene locus_tag LOCUS_18950 gene pepN 9565 6926 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704896.1 protein_id gnl|my_center|LOCUS_18950 11690 9618 gene locus_tag LOCUS_18960 gene prc 11690 9618 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 protein_id gnl|my_center|LOCUS_18960 12389 11703 gene locus_tag LOCUS_18970 gene proQ 12389 11703 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072551.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence45 <1 1101 gene locus_tag LOCUS_18980 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1669 1217 gene locus_tag LOCUS_18990 gene yfbV 1669 1217 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704832.1 protein_id gnl|my_center|LOCUS_18990 1906 3885 gene locus_tag LOCUS_19000 gene pta 1906 3885 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091710.1 protein_id gnl|my_center|LOCUS_19000 3949 4809 gene locus_tag LOCUS_19010 3949 4809 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_19010 5000 5707 gene locus_tag LOCUS_19020 gene araD 5000 5707 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 protein_id gnl|my_center|LOCUS_19020 7155 5785 gene locus_tag LOCUS_19030 7155 5785 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061731.1 protein_id gnl|my_center|LOCUS_19030 8410 7382 gene locus_tag LOCUS_19040 8410 7382 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975437.1 protein_id gnl|my_center|LOCUS_19040 8780 10078 gene locus_tag LOCUS_19050 gene umuC 8780 10078 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705911.1 protein_id gnl|my_center|LOCUS_19050 10165 10887 gene locus_tag LOCUS_19060 10165 10887 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_19060 11136 10888 gene locus_tag LOCUS_19070 11136 10888 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764645.1 protein_id gnl|my_center|LOCUS_19070 11199 11289 gene locus_tag LOCUS_t00420 11199 11289 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence46 <1 1315 gene locus_tag LOCUS_19080 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681436.1:ATP-binding protein 1655 2191 gene locus_tag LOCUS_19090 1655 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2559 2990 gene locus_tag LOCUS_19100 2559 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4159 3515 gene locus_tag LOCUS_19110 gene upp 4159 3515 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360558.1 protein_id gnl|my_center|LOCUS_19110 5802 4381 gene locus_tag LOCUS_19120 5802 4381 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_19120 5955 6134 gene locus_tag LOCUS_19130 5955 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6511 8532 gene locus_tag LOCUS_19140 6511 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8551 9861 gene locus_tag LOCUS_19150 8551 9861 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence47 587 297 gene locus_tag LOCUS_19160 587 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5868 655 gene locus_tag LOCUS_19170 5868 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6629 5943 gene locus_tag LOCUS_19180 6629 5943 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870965.1 protein_id gnl|my_center|LOCUS_19180 6846 9290 gene locus_tag LOCUS_19190 6846 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 <10915 9441 gene locus_tag LOCUS_19200 <10915 9441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence48 58 285 gene locus_tag LOCUS_19210 58 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 537 1919 gene locus_tag LOCUS_19220 537 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2079 2702 gene locus_tag LOCUS_19230 2079 2702 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_19230 2938 3201 gene locus_tag LOCUS_19240 2938 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3433 3957 gene locus_tag LOCUS_19250 3433 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5093 4056 gene locus_tag LOCUS_19260 gene asnA 5093 4056 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_19260 5456 5974 gene locus_tag LOCUS_19270 5456 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 6350 7135 gene locus_tag LOCUS_19280 6350 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 7138 8340 gene locus_tag LOCUS_19290 7138 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9701 8391 gene locus_tag LOCUS_19300 gene yegQ 9701 8391 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476014.1 protein_id gnl|my_center|LOCUS_19300 10605 9688 gene locus_tag LOCUS_19310 gene rdgC 10605 9688 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208691.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence49 66 1268 gene locus_tag LOCUS_19320 66 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1509 2813 gene locus_tag LOCUS_19330 gene amtB 1509 2813 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095872.1 protein_id gnl|my_center|LOCUS_19330 2831 3169 gene locus_tag LOCUS_19340 gene glnB 2831 3169 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_19340 4619 3249 gene locus_tag LOCUS_19350 4619 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4866 4663 gene locus_tag LOCUS_19360 4866 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6368 4971 gene locus_tag LOCUS_19370 6368 4971 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072297.1 protein_id gnl|my_center|LOCUS_19370 8474 6429 gene locus_tag LOCUS_19380 gene metG 8474 6429 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097928.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence50 1476 454 gene locus_tag LOCUS_19390 gene yjfF 1476 454 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_19390 2527 1469 gene locus_tag LOCUS_19400 2527 1469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877168.1 protein_id gnl|my_center|LOCUS_19400 4046 2511 gene locus_tag LOCUS_19410 4046 2511 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061820.1 protein_id gnl|my_center|LOCUS_19410 5192 4203 gene locus_tag LOCUS_19420 5192 4203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_19420 5641 7500 gene locus_tag LOCUS_19430 5641 7500 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence51 936 85 gene locus_tag LOCUS_19440 936 85 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_19440 2978 1119 gene locus_tag LOCUS_19450 2978 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4057 3296 gene locus_tag LOCUS_19460 4057 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4615 4232 gene locus_tag LOCUS_19470 4615 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4800 6023 gene locus_tag LOCUS_19480 4800 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 6062 6472 gene locus_tag LOCUS_19490 6062 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence52 1012 788 gene locus_tag LOCUS_19500 1012 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2159 987 gene locus_tag LOCUS_19510 2159 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2674 2159 gene locus_tag LOCUS_19520 2674 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 3871 2675 gene locus_tag LOCUS_19530 3871 2675 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 protein_id gnl|my_center|LOCUS_19530 4152 3874 gene locus_tag LOCUS_19540 4152 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4457 4176 gene locus_tag LOCUS_19550 4457 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4759 4481 gene locus_tag LOCUS_19560 4759 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5052 4783 gene locus_tag LOCUS_19570 5052 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5379 5206 gene locus_tag LOCUS_19580 5379 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 5702 5881 gene locus_tag LOCUS_19590 5702 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 6228 6599 gene locus_tag LOCUS_19600 6228 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 6847 7152 gene locus_tag LOCUS_19610 6847 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence53 460 536 gene locus_tag LOCUS_t00430 460 536 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1858 689 gene locus_tag LOCUS_19620 1858 689 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_19620 3279 1909 gene locus_tag LOCUS_19630 3279 1909 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_19630 4004 3330 gene locus_tag LOCUS_19640 4004 3330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 protein_id gnl|my_center|LOCUS_19640 5025 3997 gene locus_tag LOCUS_19650 5025 3997 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622962.1 protein_id gnl|my_center|LOCUS_19650 5921 5073 gene locus_tag LOCUS_19660 5921 5073 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 protein_id gnl|my_center|LOCUS_19660 7084 6275 gene locus_tag LOCUS_19670 7084 6275 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 protein_id gnl|my_center|LOCUS_19670 7020 7205 gene locus_tag LOCUS_19680 7020 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence54 124 825 gene locus_tag LOCUS_19690 124 825 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476002.1 protein_id gnl|my_center|LOCUS_19690 834 1835 gene locus_tag LOCUS_19700 834 1835 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819771.1 protein_id gnl|my_center|LOCUS_19700 1919 2554 gene locus_tag LOCUS_19710 gene smrA 1919 2554 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_19710 3481 2609 gene locus_tag LOCUS_19720 gene yqhC 3481 2609 CDS product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322279.1 protein_id gnl|my_center|LOCUS_19720 3730 4920 gene locus_tag LOCUS_19730 3730 4920 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_19730 5033 5887 gene locus_tag LOCUS_19740 5033 5887 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_19740 5880 7046 gene locus_tag LOCUS_19750 5880 7046 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_19750 7609 7088 gene locus_tag LOCUS_19760 7609 7088 CDS product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705452.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence55 1964 450 gene locus_tag LOCUS_19770 1964 450 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_19770 3352 2330 gene locus_tag LOCUS_19780 gene chvE 3352 2330 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_19780 3666 3499 gene locus_tag LOCUS_19790 3666 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4405 3668 gene locus_tag LOCUS_19800 4405 3668 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958530.1 protein_id gnl|my_center|LOCUS_19800 5597 4383 gene locus_tag LOCUS_19810 5597 4383 CDS product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 protein_id gnl|my_center|LOCUS_19810 6702 5704 gene locus_tag LOCUS_19820 6702 5704 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence56 495 923 gene locus_tag LOCUS_19830 495 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1284 2045 gene locus_tag LOCUS_19840 gene argB 1284 2045 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078164571.1 protein_id gnl|my_center|LOCUS_19840 2244 2900 gene locus_tag LOCUS_19850 2244 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2902 4113 gene locus_tag LOCUS_19860 2902 4113 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070947.1 protein_id gnl|my_center|LOCUS_19860 4558 6405 gene locus_tag LOCUS_19870 4558 6405 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence57 2974 377 gene locus_tag LOCUS_19880 2974 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_19880 3626 3273 gene locus_tag LOCUS_19890 3626 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4358 3654 gene locus_tag LOCUS_19900 4358 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4844 4629 gene locus_tag LOCUS_19910 4844 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 5222 5004 gene locus_tag LOCUS_19920 5222 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6538 5537 gene locus_tag LOCUS_19930 gene argC 6538 5537 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921321.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence58 <1 1590 gene locus_tag LOCUS_19940 <1 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1779 3221 gene locus_tag LOCUS_19950 1779 3221 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047962.1 protein_id gnl|my_center|LOCUS_19950 5105 3306 gene locus_tag LOCUS_19960 5105 3306 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105053.1 protein_id gnl|my_center|LOCUS_19960 5981 5109 gene locus_tag LOCUS_19970 5981 5109 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence59 725 1141 gene locus_tag LOCUS_19980 725 1141 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269111.1 protein_id gnl|my_center|LOCUS_19980 1128 2165 gene locus_tag LOCUS_19990 1128 2165 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937528.1 protein_id gnl|my_center|LOCUS_19990 2150 2758 gene locus_tag LOCUS_20000 2150 2758 CDS product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010439013.1 protein_id gnl|my_center|LOCUS_20000 2770 3822 gene locus_tag LOCUS_20010 2770 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 4348 3926 gene locus_tag LOCUS_20020 4348 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4591 4409 gene locus_tag LOCUS_20030 4591 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence60 163 654 gene locus_tag LOCUS_20040 163 654 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_20040 787 1278 gene locus_tag LOCUS_20050 787 1278 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_20050 1615 1421 gene locus_tag LOCUS_20060 1615 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3113 1995 gene locus_tag LOCUS_20070 3113 1995 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_20070 4562 3360 gene locus_tag LOCUS_20080 4562 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence61 1056 235 gene locus_tag LOCUS_20090 gene mepA 1056 235 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483061.1 protein_id gnl|my_center|LOCUS_20090 2758 1109 gene locus_tag LOCUS_20100 2758 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3586 2771 gene locus_tag LOCUS_20110 3586 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence62 142 1275 gene locus_tag LOCUS_20120 142 1275 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_20120 2400 2966 gene locus_tag LOCUS_20130 2400 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence63 250 1845 gene locus_tag LOCUS_20140 gene istA 250 1845 CDS product IS21-like element ISRsp2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440448.1 protein_id gnl|my_center|LOCUS_20140 <3342 1923 gene locus_tag LOCUS_20150 <3342 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171280242.1:maltoporin >Feature sequence64 1694 96 gene locus_tag LOCUS_20160 1694 96 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_20160 2055 2627 gene locus_tag LOCUS_20170 gene yfcE 2055 2627 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 protein_id gnl|my_center|LOCUS_20170 2648 3100 gene locus_tag LOCUS_20180 2648 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence65 <1 1173 gene locus_tag LOCUS_20190 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171280242.1:maltoporin 2606 1293 gene locus_tag LOCUS_20200 2606 1293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_20200