>Feature sequence001 294 133 gene locus_tag LOCUS_00010 gene scfA 294 133 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_00010 1014 475 gene locus_tag LOCUS_00020 1014 475 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869997.1 protein_id gnl|my_center|LOCUS_00020 1188 2609 gene locus_tag LOCUS_00030 1188 2609 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_00030 2813 4714 gene locus_tag LOCUS_00040 2813 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4723 4732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4749 6155 gene locus_tag LOCUS_00050 4749 6155 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_00050 6218 7546 gene locus_tag LOCUS_00060 6218 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7543 9912 gene locus_tag LOCUS_00070 7543 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10025 11830 gene locus_tag LOCUS_00080 10025 11830 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_00080 11861 12115 gene locus_tag LOCUS_00090 11861 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12189 15911 gene locus_tag LOCUS_00100 12189 15911 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00100 16101 17705 gene locus_tag LOCUS_00110 16101 17705 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_00110 17955 19400 gene locus_tag LOCUS_00120 17955 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 >Feature sequence002 1 4269 gene locus_tag LOCUS_00130 1 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 4368 5102 gene locus_tag LOCUS_00140 4368 5102 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_00140 5032 5041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5172 6512 gene locus_tag LOCUS_00150 5172 6512 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257421.1 protein_id gnl|my_center|LOCUS_00150 6552 7268 gene locus_tag LOCUS_00160 6552 7268 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_00160 7300 8589 gene locus_tag LOCUS_00170 7300 8589 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_00170 8677 9705 gene locus_tag LOCUS_00180 8677 9705 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_00180 10932 9787 gene locus_tag LOCUS_00190 10932 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 11148 11073 gene locus_tag LOCUS_t00010 11148 11073 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13055 11259 gene locus_tag LOCUS_00200 13055 11259 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_00200 14107 13052 gene locus_tag LOCUS_00210 14107 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15348 14104 gene locus_tag LOCUS_00220 15348 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 16415 15405 gene locus_tag LOCUS_00230 16415 15405 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_00230 <17795 16432 gene locus_tag LOCUS_00240 <17795 16432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000387782.1:ribose ABC transporter ATP-binding protein RbsA >Feature sequence003 744 938 gene locus_tag LOCUS_00250 744 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 1407 1228 gene locus_tag LOCUS_00260 1407 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 1452 1637 gene locus_tag LOCUS_00270 1452 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 1615 5112 gene locus_tag LOCUS_00280 1615 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 5211 6167 gene locus_tag LOCUS_00290 5211 6167 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_00290 6169 7041 gene locus_tag LOCUS_00300 6169 7041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_00300 7060 9273 gene locus_tag LOCUS_00310 7060 9273 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_00310 9296 15088 gene locus_tag LOCUS_00320 9296 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 15127 16107 gene locus_tag LOCUS_00330 15127 16107 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_00330 16128 17219 gene locus_tag LOCUS_00340 16128 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence004 <1 6693 gene locus_tag LOCUS_00350 <1 6693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_140224017.1:S8 family serine peptidase 6771 7946 gene locus_tag LOCUS_00360 6771 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 8042 10711 gene locus_tag LOCUS_00370 8042 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 10845 12302 gene locus_tag LOCUS_00380 10845 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 12314 13420 gene locus_tag LOCUS_00390 12314 13420 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 protein_id gnl|my_center|LOCUS_00390 13427 14722 gene locus_tag LOCUS_00400 13427 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 14726 15862 gene locus_tag LOCUS_00410 14726 15862 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427052.1 protein_id gnl|my_center|LOCUS_00410 >Feature sequence005 830 468 gene locus_tag LOCUS_tm00010 830 468 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1438 935 gene locus_tag LOCUS_00420 gene smpB 1438 935 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_00420 1862 1503 gene locus_tag LOCUS_00430 1862 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 2394 1891 gene locus_tag LOCUS_00440 2394 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2748 2416 gene locus_tag LOCUS_00450 2748 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 3142 2900 gene locus_tag LOCUS_00460 3142 2900 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_00460 3416 3144 gene locus_tag LOCUS_00470 gene hbs 3416 3144 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_00470 5311 3638 gene locus_tag LOCUS_00480 5311 3638 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_00480 9034 5333 gene locus_tag LOCUS_00490 9034 5333 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390101.1 protein_id gnl|my_center|LOCUS_00490 10327 9038 gene locus_tag LOCUS_00500 gene purD 10327 9038 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_00500 11530 10346 gene locus_tag LOCUS_00510 11530 10346 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_00510 12277 11558 gene locus_tag LOCUS_00520 12277 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 12941 12264 gene locus_tag LOCUS_00530 gene purN 12941 12264 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_00530 13608 12970 gene locus_tag LOCUS_00540 13608 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 14648 13602 gene locus_tag LOCUS_00550 gene purM 14648 13602 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_00550 15238 14738 gene locus_tag LOCUS_00560 gene purE 15238 14738 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_00560 15670 16068 gene locus_tag LOCUS_00570 gene stsR 15670 16068 CDS product GntR family transcriptional regulator StsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262158.1 protein_id gnl|my_center|LOCUS_00570 16084 16833 gene locus_tag LOCUS_00580 16084 16833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054202.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence006 <1 2113 gene locus_tag LOCUS_00590 <1 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965561.1:helicase-exonuclease AddAB subunit AddB 2131 5871 gene locus_tag LOCUS_00600 gene addA 2131 5871 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_00600 5926 7488 gene locus_tag LOCUS_00610 5926 7488 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_00610 8648 7560 gene locus_tag LOCUS_00620 8648 7560 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_00620 11242 8723 gene locus_tag LOCUS_00630 11242 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 12276 11377 gene locus_tag LOCUS_00640 gene rsmA 12276 11377 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_00640 14211 12343 gene locus_tag LOCUS_00650 14211 12343 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_00650 12364 12373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14878 14276 gene locus_tag LOCUS_00660 14878 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 15535 14891 gene locus_tag LOCUS_00670 15535 14891 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_00670 16488 15532 gene locus_tag LOCUS_00680 16488 15532 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence007 2110 485 gene locus_tag LOCUS_00690 gene lnt 2110 485 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141729.1 protein_id gnl|my_center|LOCUS_00690 3111 2107 gene locus_tag LOCUS_00700 3111 2107 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_00700 3843 3214 gene locus_tag LOCUS_00710 gene upp 3843 3214 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_00710 4093 5418 gene locus_tag LOCUS_00720 gene mtaB 4093 5418 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_00720 5478 7007 gene locus_tag LOCUS_00730 5478 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7644 6976 gene locus_tag LOCUS_00740 7644 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 7847 8446 gene locus_tag LOCUS_00750 7847 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8457 9017 gene locus_tag LOCUS_00760 8457 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9326 10372 gene locus_tag LOCUS_00770 9326 10372 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_00770 10369 12159 gene locus_tag LOCUS_00780 10369 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12232 13872 gene locus_tag LOCUS_00790 12232 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence008 2071 98 gene locus_tag LOCUS_00800 2071 98 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_00800 3821 2061 gene locus_tag LOCUS_00810 3821 2061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_00810 4132 6150 gene locus_tag LOCUS_00820 gene uvrB 4132 6150 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_00820 6252 7658 gene locus_tag LOCUS_00830 6252 7658 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_00830 7733 10672 gene locus_tag LOCUS_00840 7733 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10689 11342 gene locus_tag LOCUS_00850 10689 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 12406 11420 gene locus_tag LOCUS_00860 12406 11420 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_00860 12999 12631 gene locus_tag LOCUS_00870 12999 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 13568 13059 gene locus_tag LOCUS_00880 13568 13059 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_00880 13998 13561 gene locus_tag LOCUS_00890 13998 13561 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_00890 14369 13995 gene locus_tag LOCUS_00900 14369 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 15816 14458 gene locus_tag LOCUS_00910 15816 14458 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_00910 16103 15834 gene locus_tag LOCUS_00920 16103 15834 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence009 61 1206 gene locus_tag LOCUS_00930 61 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 1510 2499 gene locus_tag LOCUS_00940 1510 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2546 3802 gene locus_tag LOCUS_00950 2546 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 3821 4159 gene locus_tag LOCUS_00960 3821 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4236 5048 gene locus_tag LOCUS_00970 4236 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 5078 5950 gene locus_tag LOCUS_00980 5078 5950 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_00980 5871 5880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6096 6722 gene locus_tag LOCUS_00990 6096 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 6858 7628 gene locus_tag LOCUS_01000 gene cysE 6858 7628 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_01000 8681 7653 gene locus_tag LOCUS_01010 8681 7653 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107870.1 protein_id gnl|my_center|LOCUS_01010 9708 8929 gene locus_tag LOCUS_01020 9708 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 10287 9751 gene locus_tag LOCUS_01030 10287 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 10619 10332 gene locus_tag LOCUS_01040 10619 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10987 11853 gene locus_tag LOCUS_01050 gene prmC 10987 11853 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_01050 11923 12969 gene locus_tag LOCUS_01060 11923 12969 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_01060 13074 14132 gene locus_tag LOCUS_01070 13074 14132 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence010 2657 1257 gene locus_tag LOCUS_01080 2657 1257 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_01080 3916 2696 gene locus_tag LOCUS_01090 3916 2696 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_01090 4365 3991 gene locus_tag LOCUS_01100 4365 3991 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392669.1 protein_id gnl|my_center|LOCUS_01100 4848 4420 gene locus_tag LOCUS_01110 4848 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6218 4863 gene locus_tag LOCUS_01120 6218 4863 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_01120 6496 7431 gene locus_tag LOCUS_01130 gene truB 6496 7431 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_01130 7523 8197 gene locus_tag LOCUS_01140 7523 8197 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_01140 8194 8580 gene locus_tag LOCUS_01150 8194 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9283 8702 gene locus_tag LOCUS_01160 9283 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 9989 9273 gene locus_tag LOCUS_01170 9989 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 10507 10016 gene locus_tag LOCUS_01180 10507 10016 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_01180 10956 10558 gene locus_tag LOCUS_01190 10956 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 11761 11084 gene locus_tag LOCUS_01200 gene yqeK 11761 11084 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_01200 12383 11739 gene locus_tag LOCUS_01210 gene nadD 12383 11739 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_01210 13080 12388 gene locus_tag LOCUS_01220 13080 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 13424 13077 gene locus_tag LOCUS_01230 gene yhbY 13424 13077 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_01230 14070 13444 gene locus_tag LOCUS_01240 14070 13444 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_01240 <14601 14074 gene locus_tag LOCUS_01250 <14601 14074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723863.1:signal recognition particle-docking protein FtsY >Feature sequence011 2327 243 gene locus_tag LOCUS_01260 2327 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2553 5300 gene locus_tag LOCUS_01270 2553 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 5748 9566 gene locus_tag LOCUS_01280 5748 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9569 10435 gene locus_tag LOCUS_01290 9569 10435 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_01290 10476 11237 gene locus_tag LOCUS_01300 10476 11237 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_01300 11324 12523 gene locus_tag LOCUS_01310 11324 12523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_01310 12685 13422 gene locus_tag LOCUS_01320 12685 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 13718 14236 gene locus_tag LOCUS_01330 13718 14236 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701450.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence012 1805 882 gene locus_tag LOCUS_01340 1805 882 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_01340 2708 1830 gene locus_tag LOCUS_01350 2708 1830 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01350 3223 2723 gene locus_tag LOCUS_01360 gene ruvC 3223 2723 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_01360 4201 3413 gene locus_tag LOCUS_01370 4201 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5176 4505 gene locus_tag LOCUS_01380 gene rpe 5176 4505 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_01380 5973 5494 gene locus_tag LOCUS_01390 gene ispF 5973 5494 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_01390 6845 5970 gene locus_tag LOCUS_01400 6845 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7341 6871 gene locus_tag LOCUS_01410 gene rpiB 7341 6871 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_01410 8106 7348 gene locus_tag LOCUS_01420 gene tsaB 8106 7348 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_01420 8837 8100 gene locus_tag LOCUS_01430 8837 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10057 8837 gene locus_tag LOCUS_01440 gene tyrS 10057 8837 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_01440 10493 13201 gene locus_tag LOCUS_01450 10493 13201 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_01450 <13991 13373 gene locus_tag LOCUS_01460 <13991 13373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966511.1:PucR family transcriptional regulator >Feature sequence013 285 1151 gene locus_tag LOCUS_01470 285 1151 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_01470 1315 2070 gene locus_tag LOCUS_01480 1315 2070 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_01480 2663 3346 gene locus_tag LOCUS_01490 2663 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4244 3489 gene locus_tag LOCUS_01500 4244 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 7620 4246 gene locus_tag LOCUS_01510 7620 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 8327 7683 gene locus_tag LOCUS_01520 8327 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 12849 8392 gene locus_tag LOCUS_01530 12849 8392 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence014 449 1177 gene locus_tag LOCUS_01540 gene sigE 449 1177 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_01540 1323 1535 gene locus_tag LOCUS_01550 1323 1535 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_01550 1572 4655 gene locus_tag LOCUS_01560 1572 4655 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476159.1 protein_id gnl|my_center|LOCUS_01560 4733 5371 gene locus_tag LOCUS_01570 gene ruvA 4733 5371 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_01570 5387 6586 gene locus_tag LOCUS_01580 gene ruvB 5387 6586 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01580 6863 8221 gene locus_tag LOCUS_01590 6863 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 8276 9349 gene locus_tag LOCUS_01600 8276 9349 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_01600 10204 9431 gene locus_tag LOCUS_01610 10204 9431 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_01610 11142 10201 gene locus_tag LOCUS_01620 11142 10201 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902204.1 protein_id gnl|my_center|LOCUS_01620 12133 11159 gene locus_tag LOCUS_01630 gene trpX 12133 11159 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775251.1 protein_id gnl|my_center|LOCUS_01630 12526 12239 gene locus_tag LOCUS_01640 12526 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 >Feature sequence015 8160 2848 gene locus_tag LOCUS_01650 8160 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8462 8157 gene locus_tag LOCUS_01660 8462 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 8794 8399 gene locus_tag LOCUS_01670 8794 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 9110 10441 gene locus_tag LOCUS_01680 9110 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 10455 12134 gene locus_tag LOCUS_01690 10455 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12443 12258 gene locus_tag LOCUS_01700 gene rpmB 12443 12258 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence016 18 356 gene locus_tag LOCUS_01710 18 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 359 1033 gene locus_tag LOCUS_01720 359 1033 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 protein_id gnl|my_center|LOCUS_01720 1088 1837 gene locus_tag LOCUS_01730 1088 1837 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_01730 1879 4734 gene locus_tag LOCUS_01740 1879 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4731 5909 gene locus_tag LOCUS_01750 4731 5909 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_01750 5949 7724 gene locus_tag LOCUS_01760 5949 7724 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_01760 7729 9216 gene locus_tag LOCUS_01770 7729 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 9218 10153 gene locus_tag LOCUS_01780 9218 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 10186 10758 gene locus_tag LOCUS_01790 10186 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10967 11662 gene locus_tag LOCUS_01800 10967 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 11912 12406 gene locus_tag LOCUS_01810 gene nuoE 11912 12406 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence017 1503 529 gene locus_tag LOCUS_01820 1503 529 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_01820 2313 1687 gene locus_tag LOCUS_01830 gene rpsD 2313 1687 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_01830 3126 2341 gene locus_tag LOCUS_01840 3126 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 3614 3366 gene locus_tag LOCUS_01850 gene infA 3614 3366 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_01850 4409 3648 gene locus_tag LOCUS_01860 gene map 4409 3648 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 protein_id gnl|my_center|LOCUS_01860 5081 4446 gene locus_tag LOCUS_01870 5081 4446 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01870 6567 5191 gene locus_tag LOCUS_01880 gene secY 6567 5191 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_01880 7014 6571 gene locus_tag LOCUS_01890 gene rplO 7014 6571 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 protein_id gnl|my_center|LOCUS_01890 7212 7033 gene locus_tag LOCUS_01900 gene rpmD 7212 7033 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986624.1 protein_id gnl|my_center|LOCUS_01900 7731 7228 gene locus_tag LOCUS_01910 gene rpsE 7731 7228 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_01910 8174 7815 gene locus_tag LOCUS_01920 gene rplR 8174 7815 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_01920 8817 8194 gene locus_tag LOCUS_01930 gene rplF 8817 8194 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_01930 9235 8837 gene locus_tag LOCUS_01940 gene rpsH 9235 8837 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01940 9664 9479 gene locus_tag LOCUS_01950 9664 9479 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_01950 10222 9680 gene locus_tag LOCUS_01960 gene rplE 10222 9680 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_01960 10572 10237 gene locus_tag LOCUS_01970 gene rplX 10572 10237 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_01970 10955 10587 gene locus_tag LOCUS_01980 gene rplN 10955 10587 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_01980 11328 11068 gene locus_tag LOCUS_01990 gene rpsQ 11328 11068 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_01990 11532 11344 gene locus_tag LOCUS_02000 gene rpmC 11532 11344 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_02000 11955 11536 gene locus_tag LOCUS_02010 gene rplP 11955 11536 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence018 213 812 gene locus_tag LOCUS_02020 gene recR 213 812 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_02020 937 2157 gene locus_tag LOCUS_02030 937 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2276 2749 gene locus_tag LOCUS_02040 2276 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3312 2926 gene locus_tag LOCUS_02050 3312 2926 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_02050 5015 3384 gene locus_tag LOCUS_02060 5015 3384 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_02060 5578 5015 gene locus_tag LOCUS_02070 gene ahpC 5578 5015 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_02070 6079 5681 gene locus_tag LOCUS_02080 6079 5681 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_02080 10334 6411 gene locus_tag LOCUS_02090 10334 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 11582 10386 gene locus_tag LOCUS_02100 11582 10386 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence019 <1 793 gene locus_tag LOCUS_02110 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966273.1:methionine--tRNA ligase 1126 905 gene locus_tag LOCUS_02120 1126 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1413 1195 gene locus_tag LOCUS_02130 1413 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2510 1419 gene locus_tag LOCUS_02140 2510 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2926 2804 gene locus_tag LOCUS_02150 2926 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3165 2923 gene locus_tag LOCUS_02160 3165 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3432 4946 gene locus_tag LOCUS_02170 3432 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5074 5475 gene locus_tag LOCUS_02180 5074 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6105 5482 gene locus_tag LOCUS_02190 gene spoIIR 6105 5482 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768304.1 protein_id gnl|my_center|LOCUS_02190 6384 7658 gene locus_tag LOCUS_02200 6384 7658 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_02200 7707 9206 gene locus_tag LOCUS_02210 7707 9206 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680081.1 protein_id gnl|my_center|LOCUS_02210 9631 10254 gene locus_tag LOCUS_02220 9631 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 10904 10828 gene locus_tag LOCUS_t00020 10904 10828 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11625 11071 gene locus_tag LOCUS_02230 11625 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence020 1203 1835 gene locus_tag LOCUS_02240 1203 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 1894 3294 gene locus_tag LOCUS_02250 1894 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 3402 6134 gene locus_tag LOCUS_02260 3402 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 6189 7850 gene locus_tag LOCUS_02270 6189 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7931 9247 gene locus_tag LOCUS_02280 gene dacF 7931 9247 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_02280 9161 9170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11405 9234 gene locus_tag LOCUS_02290 11405 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence021 2186 1194 gene locus_tag LOCUS_02300 2186 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2810 2190 gene locus_tag LOCUS_02310 2810 2190 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704295.1 protein_id gnl|my_center|LOCUS_02310 3654 2821 gene locus_tag LOCUS_02320 3654 2821 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_02320 4764 3712 gene locus_tag LOCUS_02330 gene uxuA 4764 3712 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_02330 6135 4783 gene locus_tag LOCUS_02340 gene uxaC 6135 4783 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190176.1 protein_id gnl|my_center|LOCUS_02340 6564 6950 gene locus_tag LOCUS_02350 6564 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6928 8865 gene locus_tag LOCUS_02360 6928 8865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_02360 8862 10814 gene locus_tag LOCUS_02370 8862 10814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence022 <1 2080 gene locus_tag LOCUS_02380 <1 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582581.1:glycosyl hydrolase 2112 2846 gene locus_tag LOCUS_02390 gene ugpQ 2112 2846 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703700.1 protein_id gnl|my_center|LOCUS_02390 3006 3644 gene locus_tag LOCUS_02400 3006 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 3937 5271 gene locus_tag LOCUS_02410 3937 5271 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_02410 5283 7211 gene locus_tag LOCUS_02420 5283 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8108 7302 gene locus_tag LOCUS_02430 gene proC 8108 7302 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_02430 9405 8131 gene locus_tag LOCUS_02440 9405 8131 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922104.1 protein_id gnl|my_center|LOCUS_02440 10184 9402 gene locus_tag LOCUS_02450 gene proB 10184 9402 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_02450 11232 10267 gene locus_tag LOCUS_02460 11232 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence023 <1 1316 gene locus_tag LOCUS_02470 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256428.1:AAA family ATPase 1316 2971 gene locus_tag LOCUS_02480 1316 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3029 5380 gene locus_tag LOCUS_02490 3029 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5509 6066 gene locus_tag LOCUS_02500 5509 6066 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_02500 6089 7024 gene locus_tag LOCUS_02510 6089 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7678 7163 gene locus_tag LOCUS_02520 7678 7163 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_02520 9914 7719 gene locus_tag LOCUS_02530 9914 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 10347 9934 gene locus_tag LOCUS_02540 10347 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence024 2628 292 gene locus_tag LOCUS_02550 2628 292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_02550 3341 4540 gene locus_tag LOCUS_02560 3341 4540 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_02560 4705 6294 gene locus_tag LOCUS_02570 4705 6294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_02570 6287 7417 gene locus_tag LOCUS_02580 6287 7417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_02580 7418 8419 gene locus_tag LOCUS_02590 7418 8419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_02590 8741 9076 gene locus_tag LOCUS_02600 8741 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 <10235 9215 gene locus_tag LOCUS_02610 <10235 9215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391810.1:phosphopyruvate hydratase >Feature sequence025 445 191 gene locus_tag LOCUS_02620 445 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1347 673 gene locus_tag LOCUS_02630 1347 673 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_02630 2987 1344 gene locus_tag LOCUS_02640 2987 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3841 2960 gene locus_tag LOCUS_02650 3841 2960 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_02650 4392 3838 gene locus_tag LOCUS_02660 4392 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6410 4539 gene locus_tag LOCUS_02670 6410 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7866 6403 gene locus_tag LOCUS_02680 7866 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10228 7958 gene locus_tag LOCUS_02690 10228 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence026 272 703 gene locus_tag LOCUS_02700 272 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 770 2056 gene locus_tag LOCUS_02710 770 2056 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_02710 2053 2394 gene locus_tag LOCUS_02720 2053 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2391 3143 gene locus_tag LOCUS_02730 2391 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3154 3726 gene locus_tag LOCUS_02740 3154 3726 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_02740 3760 4134 gene locus_tag LOCUS_02750 3760 4134 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_02750 4159 5985 gene locus_tag LOCUS_02760 4159 5985 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_02760 6006 7754 gene locus_tag LOCUS_02770 6006 7754 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_02770 8077 7865 gene locus_tag LOCUS_02780 8077 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8457 8618 gene locus_tag LOCUS_02790 8457 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 9163 10026 gene locus_tag LOCUS_02800 9163 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 >Feature sequence027 4529 2703 gene locus_tag LOCUS_02810 gene lepA 4529 2703 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_02810 4839 5378 gene locus_tag LOCUS_02820 4839 5378 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_02820 5552 6118 gene locus_tag LOCUS_02830 5552 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6296 6544 gene locus_tag LOCUS_02840 6296 6544 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_02840 6615 8936 gene locus_tag LOCUS_02850 6615 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 9001 9732 gene locus_tag LOCUS_02860 gene fabG 9001 9732 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence028 3385 614 gene locus_tag LOCUS_02870 gene secA 3385 614 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_02870 3593 4105 gene locus_tag LOCUS_02880 3593 4105 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_02880 4102 5184 gene locus_tag LOCUS_02890 gene mnmA 4102 5184 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_02890 5372 6883 gene locus_tag LOCUS_02900 5372 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9748 6983 gene locus_tag LOCUS_02910 9748 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence029 <1 2623 gene locus_tag LOCUS_02920 <1 2623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein 2627 2890 gene locus_tag LOCUS_02930 2627 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2799 7817 gene locus_tag LOCUS_02940 2799 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 <9857 7940 gene locus_tag LOCUS_02950 <9857 7940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011862003.1:carbamoyl-phosphate synthase large subunit >Feature sequence030 1426 695 gene locus_tag LOCUS_02960 1426 695 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_02960 2415 1471 gene locus_tag LOCUS_02970 gene fmt 2415 1471 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_02970 3053 2604 gene locus_tag LOCUS_02980 gene def 3053 2604 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_02980 5516 3072 gene locus_tag LOCUS_02990 5516 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7325 5565 gene locus_tag LOCUS_03000 7325 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 8919 7411 gene locus_tag LOCUS_03010 8919 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9688 8942 gene locus_tag LOCUS_03020 9688 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence031 648 1517 gene locus_tag LOCUS_03030 648 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1784 2938 gene locus_tag LOCUS_03040 1784 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 2943 5810 gene locus_tag LOCUS_03050 2943 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8745 5857 gene locus_tag LOCUS_03060 8745 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8906 9151 gene locus_tag LOCUS_03070 8906 9151 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_03070 9355 9262 gene locus_tag LOCUS_t00030 9355 9262 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 3626 2391 gene locus_tag LOCUS_03080 gene pepT 3626 2391 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_03080 3878 6889 gene locus_tag LOCUS_03090 3878 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5940 5949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9458 7059 gene locus_tag LOCUS_03100 gene leuS 9458 7059 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence033 911 1063 gene locus_tag LOCUS_03110 911 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1260 1949 gene locus_tag LOCUS_03120 1260 1949 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_03120 1994 3679 gene locus_tag LOCUS_03130 1994 3679 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_03130 4151 5326 gene locus_tag LOCUS_03140 4151 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5329 6138 gene locus_tag LOCUS_03150 5329 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 6193 7050 gene locus_tag LOCUS_03160 6193 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7047 7796 gene locus_tag LOCUS_03170 7047 7796 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_03170 7863 9125 gene locus_tag LOCUS_03180 7863 9125 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence034 462 2705 gene locus_tag LOCUS_03190 462 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3022 4062 gene locus_tag LOCUS_03200 3022 4062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_03200 4075 6144 gene locus_tag LOCUS_03210 4075 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 6160 7179 gene locus_tag LOCUS_03220 6160 7179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_03220 7139 8737 gene locus_tag LOCUS_03230 7139 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8767 8961 gene locus_tag LOCUS_03240 8767 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence035 21 256 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagagtagtgtaattttatagggtactaaaacg 2572 395 gene locus_tag LOCUS_03250 2572 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4129 2660 gene locus_tag LOCUS_03260 4129 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4811 4224 gene locus_tag LOCUS_03270 4811 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5883 4801 gene locus_tag LOCUS_03280 5883 4801 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_03280 7138 5927 gene locus_tag LOCUS_03290 7138 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7834 7148 gene locus_tag LOCUS_03300 7834 7148 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_03300 8865 7966 gene locus_tag LOCUS_03310 8865 7966 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence036 1500 2477 gene locus_tag LOCUS_03320 1500 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3487 2582 gene locus_tag LOCUS_03330 3487 2582 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 protein_id gnl|my_center|LOCUS_03330 3686 4375 gene locus_tag LOCUS_03340 3686 4375 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_03340 4441 5409 gene locus_tag LOCUS_03350 gene murB 4441 5409 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_03350 5413 6354 gene locus_tag LOCUS_03360 gene whiA 5413 6354 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541095.1 protein_id gnl|my_center|LOCUS_03360 6635 6901 gene locus_tag LOCUS_03370 6635 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6898 7449 gene locus_tag LOCUS_03380 6898 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7468 7719 gene locus_tag LOCUS_03390 7468 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 9062 7605 gene locus_tag LOCUS_03400 9062 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence037 13 684 gene locus_tag LOCUS_03410 13 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 705 1292 gene locus_tag LOCUS_03420 705 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1509 1775 gene locus_tag LOCUS_03430 1509 1775 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_03430 1967 3829 gene locus_tag LOCUS_03440 gene uvrC 1967 3829 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_03440 3896 4498 gene locus_tag LOCUS_03450 gene rsmD 3896 4498 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101663.1 protein_id gnl|my_center|LOCUS_03450 4495 5004 gene locus_tag LOCUS_03460 gene coaD 4495 5004 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_03460 5038 5733 gene locus_tag LOCUS_03470 5038 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5913 6716 gene locus_tag LOCUS_03480 5913 6716 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_03480 6959 7885 gene locus_tag LOCUS_03490 6959 7885 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_03490 7900 9054 gene locus_tag LOCUS_03500 7900 9054 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence038 582 1601 gene locus_tag LOCUS_03510 582 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1598 2113 gene locus_tag LOCUS_03520 gene tadA 1598 2113 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_03520 2368 2144 gene locus_tag LOCUS_03530 2368 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2351 3736 gene locus_tag LOCUS_03540 2351 3736 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_03540 4963 3764 gene locus_tag LOCUS_03550 4963 3764 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_03550 5216 4977 gene locus_tag LOCUS_03560 5216 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5696 5418 gene locus_tag LOCUS_03570 5696 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 6459 6629 gene locus_tag LOCUS_03580 6459 6629 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_03580 6823 7611 gene locus_tag LOCUS_03590 6823 7611 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_03590 7645 8493 gene locus_tag LOCUS_03600 7645 8493 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence039 171 1271 gene locus_tag LOCUS_03610 171 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1432 2718 gene locus_tag LOCUS_03620 gene hisS 1432 2718 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_03620 2733 3932 gene locus_tag LOCUS_03630 2733 3932 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_03630 4027 6672 gene locus_tag LOCUS_03640 4027 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6802 8349 gene locus_tag LOCUS_03650 gene cls 6802 8349 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence040 177 1130 gene locus_tag LOCUS_03660 177 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1175 2188 gene locus_tag LOCUS_03670 1175 2188 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_03670 2291 2839 gene locus_tag LOCUS_03680 gene ybeY 2291 2839 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_03680 2836 3300 gene locus_tag LOCUS_03690 2836 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3333 4229 gene locus_tag LOCUS_03700 gene era 3333 4229 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131632.1 protein_id gnl|my_center|LOCUS_03700 4239 5213 gene locus_tag LOCUS_03710 4239 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5144 7567 gene locus_tag LOCUS_03720 5144 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence041 463 1392 gene locus_tag LOCUS_03730 463 1392 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355143.1 protein_id gnl|my_center|LOCUS_03730 1389 2291 gene locus_tag LOCUS_03740 1389 2291 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_03740 2288 3913 gene locus_tag LOCUS_03750 2288 3913 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_03750 4594 4022 gene locus_tag LOCUS_03760 4594 4022 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_03760 6192 4645 gene locus_tag LOCUS_03770 6192 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6917 6378 gene locus_tag LOCUS_03780 6917 6378 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223119.1 protein_id gnl|my_center|LOCUS_03780 7471 7304 gene locus_tag LOCUS_03790 7471 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8088 8306 gene locus_tag LOCUS_03800 8088 8306 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence042 1163 900 gene locus_tag LOCUS_03810 1163 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 2236 1085 gene locus_tag LOCUS_03820 2236 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 3646 2240 gene locus_tag LOCUS_03830 3646 2240 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_03830 4500 3643 gene locus_tag LOCUS_03840 gene mazG 4500 3643 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_03840 6145 4490 gene locus_tag LOCUS_03850 6145 4490 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_03850 7202 6228 gene locus_tag LOCUS_03860 7202 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 8784 7249 gene locus_tag LOCUS_03870 8784 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence043 340 1476 gene locus_tag LOCUS_03880 340 1476 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202611.1 protein_id gnl|my_center|LOCUS_03880 1562 2857 gene locus_tag LOCUS_03890 gene aepX 1562 2857 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_03890 2869 3975 gene locus_tag LOCUS_03900 gene aepY 2869 3975 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817136.1 protein_id gnl|my_center|LOCUS_03900 3996 4709 gene locus_tag LOCUS_03910 3996 4709 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389336.1 protein_id gnl|my_center|LOCUS_03910 5815 4844 gene locus_tag LOCUS_03920 5815 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5988 5791 gene locus_tag LOCUS_03930 5988 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6210 7859 gene locus_tag LOCUS_03940 6210 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7902 8501 gene locus_tag LOCUS_03950 gene thrH 7902 8501 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence044 <1 910 gene locus_tag LOCUS_03960 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048012.1:DUF1538 domain-containing protein 926 1357 gene locus_tag LOCUS_03970 926 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1388 1738 gene locus_tag LOCUS_03980 1388 1738 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809294.1 protein_id gnl|my_center|LOCUS_03980 1919 3043 gene locus_tag LOCUS_03990 1919 3043 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_03990 3080 3667 gene locus_tag LOCUS_04000 3080 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3660 4079 gene locus_tag LOCUS_04010 3660 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4500 5654 gene locus_tag LOCUS_04020 4500 5654 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_04020 5651 6319 gene locus_tag LOCUS_04030 5651 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6340 7227 gene locus_tag LOCUS_04040 6340 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7989 7387 gene locus_tag LOCUS_04050 7989 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence045 642 4664 gene locus_tag LOCUS_04060 642 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5494 4760 gene locus_tag LOCUS_04070 5494 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6160 5540 gene locus_tag LOCUS_04080 6160 5540 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 protein_id gnl|my_center|LOCUS_04080 7321 6227 gene locus_tag LOCUS_04090 7321 6227 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_04090 <8449 7549 gene locus_tag LOCUS_04100 <8449 7549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798895.1:class II fructose-1,6-bisphosphate aldolase >Feature sequence046 1896 76 gene locus_tag LOCUS_04110 1896 76 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 protein_id gnl|my_center|LOCUS_04110 2864 1893 gene locus_tag LOCUS_04120 2864 1893 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_04120 5089 3011 gene locus_tag LOCUS_04130 5089 3011 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_04130 5886 5086 gene locus_tag LOCUS_04140 5886 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7076 5883 gene locus_tag LOCUS_04150 gene nagA 7076 5883 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704755.1 protein_id gnl|my_center|LOCUS_04150 7382 8197 gene locus_tag LOCUS_04160 7382 8197 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence047 <1 1660 gene locus_tag LOCUS_04170 <1 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460242.1:ferrous iron transport protein B 1795 2052 gene locus_tag LOCUS_04180 1795 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2335 2426 gene locus_tag LOCUS_t00040 2335 2426 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2747 3226 gene locus_tag LOCUS_04190 2747 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3735 3355 gene locus_tag LOCUS_04200 3735 3355 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_04200 4077 4403 gene locus_tag LOCUS_04210 4077 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4880 7231 gene locus_tag LOCUS_04220 4880 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence048 <1 797 gene locus_tag LOCUS_04230 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426959.1:ribosome biogenesis GTPase Der 794 2077 gene locus_tag LOCUS_04240 gene obgE 794 2077 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_04240 2141 2692 gene locus_tag LOCUS_04250 2141 2692 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_04250 2689 4614 gene locus_tag LOCUS_04260 2689 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 4669 5196 gene locus_tag LOCUS_04270 4669 5196 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_04270 5272 6639 gene locus_tag LOCUS_04280 gene fumC 5272 6639 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_04280 6861 7532 gene locus_tag LOCUS_04290 6861 7532 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence049 2058 604 gene locus_tag LOCUS_04300 2058 604 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_04300 3082 2075 gene locus_tag LOCUS_04310 3082 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3663 3079 gene locus_tag LOCUS_04320 3663 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3998 5113 gene locus_tag LOCUS_04330 gene ychF 3998 5113 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_04330 5131 5790 gene locus_tag LOCUS_04340 gene trmB 5131 5790 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 protein_id gnl|my_center|LOCUS_04340 5958 5874 gene locus_tag LOCUS_t00050 5958 5874 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7477 6008 gene locus_tag LOCUS_04350 7477 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 <8218 7519 gene locus_tag LOCUS_04360 <8218 7519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048386.1:HAMP domain-containing sensor histidine kinase >Feature sequence050 1068 265 gene locus_tag LOCUS_04370 gene spo0A 1068 265 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_04370 1472 2221 gene locus_tag LOCUS_04380 1472 2221 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_04380 2214 3149 gene locus_tag LOCUS_04390 2214 3149 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_04390 3235 4326 gene locus_tag LOCUS_04400 3235 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4625 5596 gene locus_tag LOCUS_04410 4625 5596 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_04410 5611 6813 gene locus_tag LOCUS_04420 5611 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence051 <1 2738 gene locus_tag LOCUS_04430 <1 2738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392586.1:DNA translocase FtsK 2751 3923 gene locus_tag LOCUS_04440 2751 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3920 4750 gene locus_tag LOCUS_04450 3920 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 4790 5332 gene locus_tag LOCUS_04460 4790 5332 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_04460 5338 6039 gene locus_tag LOCUS_04470 5338 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6011 7027 gene locus_tag LOCUS_04480 6011 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence052 159 2585 gene locus_tag LOCUS_04490 gene glgP 159 2585 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494076.1 protein_id gnl|my_center|LOCUS_04490 2737 4731 gene locus_tag LOCUS_04500 2737 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4974 7169 gene locus_tag LOCUS_04510 4974 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7166 7639 gene locus_tag LOCUS_04520 7166 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence053 397 1941 gene locus_tag LOCUS_04530 397 1941 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_04530 1987 2214 gene locus_tag LOCUS_04540 1987 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2224 3834 gene locus_tag LOCUS_04550 2224 3834 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_04550 3847 4920 gene locus_tag LOCUS_04560 3847 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5028 5510 gene locus_tag LOCUS_04570 5028 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 6293 5583 gene locus_tag LOCUS_04580 gene deoD 6293 5583 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence054 2953 1253 gene locus_tag LOCUS_04590 2953 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3596 2967 gene locus_tag LOCUS_04600 3596 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4459 3593 gene locus_tag LOCUS_04610 4459 3593 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_04610 5481 4456 gene locus_tag LOCUS_04620 5481 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6568 5423 gene locus_tag LOCUS_04630 6568 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence055 84 761 gene locus_tag LOCUS_04640 84 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 834 3464 gene locus_tag LOCUS_04650 gene clpB 834 3464 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_04650 3822 4244 gene locus_tag LOCUS_04660 gene mraZ 3822 4244 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_04660 4241 5212 gene locus_tag LOCUS_04670 gene rsmH 4241 5212 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_04670 5306 6316 gene locus_tag LOCUS_04680 5306 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence056 1296 460 gene locus_tag LOCUS_04690 1296 460 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986031.1 protein_id gnl|my_center|LOCUS_04690 2626 1346 gene locus_tag LOCUS_04700 2626 1346 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_04700 3864 2719 gene locus_tag LOCUS_04710 3864 2719 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_04710 5105 3921 gene locus_tag LOCUS_04720 5105 3921 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_04720 5860 5102 gene locus_tag LOCUS_04730 5860 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 7038 6169 gene locus_tag LOCUS_04740 7038 6169 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence057 705 1025 gene locus_tag LOCUS_04750 705 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1150 2163 gene locus_tag LOCUS_04760 1150 2163 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_04760 2190 3116 gene locus_tag LOCUS_04770 2190 3116 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966220.1 protein_id gnl|my_center|LOCUS_04770 3405 4205 gene locus_tag LOCUS_04780 gene radC 3405 4205 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_04780 4202 4864 gene locus_tag LOCUS_04790 gene tmk 4202 4864 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_04790 4996 6144 gene locus_tag LOCUS_04800 4996 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6144 6395 gene locus_tag LOCUS_04810 6144 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 7071 6517 gene locus_tag LOCUS_04820 7071 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence058 <1 800 gene locus_tag LOCUS_04830 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989893.1:argininosuccinate lyase 797 1726 gene locus_tag LOCUS_04840 gene argC 797 1726 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_04840 1736 2947 gene locus_tag LOCUS_04850 gene argJ 1736 2947 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_04850 2960 3847 gene locus_tag LOCUS_04860 gene argB 2960 3847 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_04860 3847 5031 gene locus_tag LOCUS_04870 3847 5031 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04870 5028 6032 gene locus_tag LOCUS_04880 gene argF 5028 6032 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_04880 6029 7084 gene locus_tag LOCUS_04890 gene carA 6029 7084 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence059 2213 717 gene locus_tag LOCUS_04900 2213 717 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_04900 2616 2924 gene locus_tag LOCUS_04910 gene rplU 2616 2924 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_04910 2961 3338 gene locus_tag LOCUS_04920 2961 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3416 3694 gene locus_tag LOCUS_04930 gene rpmA 3416 3694 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_04930 4357 7014 gene locus_tag LOCUS_04940 4357 7014 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence060 2568 1093 gene locus_tag LOCUS_04950 2568 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3428 2694 gene locus_tag LOCUS_04960 3428 2694 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_04960 5255 3501 gene locus_tag LOCUS_04970 gene argS 5255 3501 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_04970 5869 5360 gene locus_tag LOCUS_04980 gene ybaK 5869 5360 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_04980 <7277 5898 gene locus_tag LOCUS_04990 <7277 5898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393016.1:DNA repair protein RecN >Feature sequence061 1250 501 gene locus_tag LOCUS_05000 1250 501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895525.1 protein_id gnl|my_center|LOCUS_05000 3623 1263 gene locus_tag LOCUS_05010 3623 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3927 5429 gene locus_tag LOCUS_05020 3927 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence062 778 320 gene locus_tag LOCUS_05030 778 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2156 771 gene locus_tag LOCUS_05040 2156 771 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_05040 5283 2149 gene locus_tag LOCUS_05050 5283 2149 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_05050 6362 5466 gene locus_tag LOCUS_05060 gene hslO 6362 5466 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_05060 <7103 6359 gene locus_tag LOCUS_05070 <7103 6359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965668.1:class I SAM-dependent methyltransferase >Feature sequence063 293 874 gene locus_tag LOCUS_05080 293 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2299 902 gene locus_tag LOCUS_05090 gene radA 2299 902 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_05090 2838 2296 gene locus_tag LOCUS_05100 2838 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2991 3716 gene locus_tag LOCUS_05110 2991 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3782 4342 gene locus_tag LOCUS_05120 3782 4342 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_05120 4383 5177 gene locus_tag LOCUS_05130 4383 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5420 5178 gene locus_tag LOCUS_05140 5420 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence064 <1 818 gene locus_tag LOCUS_05150 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965023.1:YicC family protein 846 1136 gene locus_tag LOCUS_05160 846 1136 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_05160 1254 1832 gene locus_tag LOCUS_05170 1254 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1882 4443 gene locus_tag LOCUS_05180 gene priA 1882 4443 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_05180 4504 5340 gene locus_tag LOCUS_05190 4504 5340 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_05190 5363 6997 gene locus_tag LOCUS_05200 5363 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence065 913 131 gene locus_tag LOCUS_05210 gene ymdB 913 131 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_05210 1556 954 gene locus_tag LOCUS_05220 1556 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1729 2583 gene locus_tag LOCUS_05230 1729 2583 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_05230 2573 4357 gene locus_tag LOCUS_05240 2573 4357 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_05240 7077 4441 gene locus_tag LOCUS_05250 7077 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence066 632 1063 gene locus_tag LOCUS_05260 632 1063 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_05260 1501 3435 gene locus_tag LOCUS_05270 gene thrS 1501 3435 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_05270 3480 5264 gene locus_tag LOCUS_05280 3480 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6884 5364 gene locus_tag LOCUS_05290 6884 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence067 1368 529 gene locus_tag LOCUS_05300 1368 529 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_05300 2667 1468 gene locus_tag LOCUS_05310 2667 1468 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_05310 4123 3161 gene locus_tag LOCUS_05320 4123 3161 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_05320 4513 5439 gene locus_tag LOCUS_05330 4513 5439 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_05330 5436 6332 gene locus_tag LOCUS_05340 5436 6332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence068 494 105 gene locus_tag LOCUS_05350 494 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1286 513 gene locus_tag LOCUS_05360 1286 513 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_05360 2813 1311 gene locus_tag LOCUS_05370 2813 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3778 2909 gene locus_tag LOCUS_05380 3778 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4120 3788 gene locus_tag LOCUS_05390 4120 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6290 4179 gene locus_tag LOCUS_05400 6290 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence069 69 1361 gene locus_tag LOCUS_05410 69 1361 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_05410 1554 1817 gene locus_tag LOCUS_05420 gene rpsO 1554 1817 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_05420 2119 4236 gene locus_tag LOCUS_05430 gene pnp 2119 4236 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_05430 4315 5436 gene locus_tag LOCUS_05440 4315 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5659 6615 gene locus_tag LOCUS_05450 5659 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence070 1615 368 gene locus_tag LOCUS_05460 1615 368 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_05460 2468 1644 gene locus_tag LOCUS_05470 2468 1644 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_05470 4736 2484 gene locus_tag LOCUS_05480 4736 2484 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_05480 5133 6725 gene locus_tag LOCUS_05490 gene murD 5133 6725 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence071 4072 1940 gene locus_tag LOCUS_05500 4072 1940 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_05500 4719 4078 gene locus_tag LOCUS_05510 4719 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 5047 6162 gene locus_tag LOCUS_05520 5047 6162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051205.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence072 112 1446 gene locus_tag LOCUS_05530 112 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1515 3641 gene locus_tag LOCUS_05540 1515 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2709 2718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3680 4123 gene locus_tag LOCUS_05550 gene rplI 3680 4123 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_05550 4138 5532 gene locus_tag LOCUS_05560 4138 5532 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence073 1795 59 gene locus_tag LOCUS_05570 1795 59 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_05570 2903 1947 gene locus_tag LOCUS_05580 2903 1947 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_05580 3063 5798 gene locus_tag LOCUS_05590 3063 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence074 950 228 gene locus_tag LOCUS_05600 gene sigK 950 228 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810876.1 protein_id gnl|my_center|LOCUS_05600 2033 1206 gene locus_tag LOCUS_05610 2033 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2810 2097 gene locus_tag LOCUS_05620 2810 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3331 2924 gene locus_tag LOCUS_05630 3331 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4011 3511 gene locus_tag LOCUS_05640 gene greA 4011 3511 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082222.1 protein_id gnl|my_center|LOCUS_05640 4716 4087 gene locus_tag LOCUS_05650 4716 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_05650 <6509 4764 gene locus_tag LOCUS_05660 <6509 4764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080136.1:alpha-galactosidase >Feature sequence075 501 2297 gene locus_tag LOCUS_05670 501 2297 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_05670 2523 3113 gene locus_tag LOCUS_05680 2523 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3146 4543 gene locus_tag LOCUS_05690 3146 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05690 4568 5098 gene locus_tag LOCUS_05700 4568 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6381 5182 gene locus_tag LOCUS_05710 6381 5182 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence076 8 1384 gene locus_tag LOCUS_05720 8 1384 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_05720 1435 3786 gene locus_tag LOCUS_05730 1435 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3808 4479 gene locus_tag LOCUS_05740 3808 4479 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_05740 4863 6134 gene locus_tag LOCUS_05750 4863 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence077 932 561 gene locus_tag LOCUS_05760 932 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1195 1725 gene locus_tag LOCUS_05770 1195 1725 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_05770 1859 2053 gene locus_tag LOCUS_05780 gene rpmF 1859 2053 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670496.1 protein_id gnl|my_center|LOCUS_05780 2966 2175 gene locus_tag LOCUS_05790 2966 2175 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_05790 4088 3003 gene locus_tag LOCUS_05800 4088 3003 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_05800 4777 4085 gene locus_tag LOCUS_05810 4777 4085 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_05810 5545 4949 gene locus_tag LOCUS_05820 5545 4949 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922059.1 protein_id gnl|my_center|LOCUS_05820 6256 5702 gene locus_tag LOCUS_05830 6256 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence078 609 2006 gene locus_tag LOCUS_05840 609 2006 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_05840 2445 2209 gene locus_tag LOCUS_05850 2445 2209 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_05850 2707 2465 gene locus_tag LOCUS_05860 gene rpsP 2707 2465 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 protein_id gnl|my_center|LOCUS_05860 4145 2790 gene locus_tag LOCUS_05870 gene ffh 4145 2790 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05870 4555 4211 gene locus_tag LOCUS_05880 4555 4211 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723862.1 protein_id gnl|my_center|LOCUS_05880 6098 4776 gene locus_tag LOCUS_05890 6098 4776 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence079 3 875 gene locus_tag LOCUS_05900 3 875 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869096.1 protein_id gnl|my_center|LOCUS_05900 881 1486 gene locus_tag LOCUS_05910 881 1486 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_05910 1483 2316 gene locus_tag LOCUS_05920 1483 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2313 2897 gene locus_tag LOCUS_05930 gene rsxA 2313 2897 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_05930 2911 3744 gene locus_tag LOCUS_05940 2911 3744 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_05940 3830 4948 gene locus_tag LOCUS_05950 3830 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4965 5381 gene locus_tag LOCUS_05960 4965 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5378 5905 gene locus_tag LOCUS_05970 5378 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6269 6051 gene locus_tag LOCUS_05980 6269 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence080 132 2693 gene locus_tag LOCUS_05990 132 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2871 3371 gene locus_tag LOCUS_06000 2871 3371 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_06000 3371 4225 gene locus_tag LOCUS_06010 3371 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4940 4302 gene locus_tag LOCUS_06020 4940 4302 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_06020 5500 4937 gene locus_tag LOCUS_06030 5500 4937 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_06030 <6213 5503 gene locus_tag LOCUS_06040 <6213 5503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531499.1:GTPase HflX >Feature sequence081 3474 52 gene locus_tag LOCUS_06050 3474 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4103 4540 gene locus_tag LOCUS_06060 gene infC 4103 4540 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_06060 4771 4965 gene locus_tag LOCUS_06070 gene rpmI 4771 4965 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_06070 5009 5362 gene locus_tag LOCUS_06080 gene rplT 5009 5362 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence082 <1 1193 gene locus_tag LOCUS_06090 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141278.1:ATP-dependent DNA helicase RecG 1310 2227 gene locus_tag LOCUS_06100 1310 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2391 4535 gene locus_tag LOCUS_06110 2391 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4550 4924 gene locus_tag LOCUS_06120 4550 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4952 5899 gene locus_tag LOCUS_06130 gene rbsK 4952 5899 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence083 <1 1046 gene locus_tag LOCUS_06140 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860980.1:MBL fold metallo-hydrolase 1293 1108 gene locus_tag LOCUS_06150 1293 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06150 2435 1278 gene locus_tag LOCUS_06160 2435 1278 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_06160 4664 2562 gene locus_tag LOCUS_06170 4664 2562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence084 756 148 gene locus_tag LOCUS_06180 756 148 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_06180 1281 907 gene locus_tag LOCUS_06190 1281 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1880 1323 gene locus_tag LOCUS_06200 1880 1323 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_06200 2522 1950 gene locus_tag LOCUS_06210 2522 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3558 2620 gene locus_tag LOCUS_06220 gene hprK 3558 2620 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722615.1 protein_id gnl|my_center|LOCUS_06220 5596 3575 gene locus_tag LOCUS_06230 5596 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence085 1231 182 gene locus_tag LOCUS_06240 1231 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 1637 1954 gene locus_tag LOCUS_06250 1637 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2072 3175 gene locus_tag LOCUS_06260 2072 3175 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963505.1 protein_id gnl|my_center|LOCUS_06260 4333 3185 gene locus_tag LOCUS_06270 4333 3185 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_06270 4391 4609 gene locus_tag LOCUS_06280 4391 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5329 4646 gene locus_tag LOCUS_06290 gene nth 5329 4646 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773154.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence086 1371 2090 gene locus_tag LOCUS_06300 gene pyrH 1371 2090 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_06300 2155 2709 gene locus_tag LOCUS_06310 gene frr 2155 2709 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_06310 2804 3526 gene locus_tag LOCUS_06320 2804 3526 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_06320 3558 4409 gene locus_tag LOCUS_06330 3558 4409 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 protein_id gnl|my_center|LOCUS_06330 4466 5677 gene locus_tag LOCUS_06340 4466 5677 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460412.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence087 449 4396 gene locus_tag LOCUS_06350 449 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4778 5098 gene locus_tag LOCUS_06360 4778 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence088 680 1396 gene locus_tag LOCUS_06370 680 1396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_06370 1393 3378 gene locus_tag LOCUS_06380 1393 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3539 4801 gene locus_tag LOCUS_06390 3539 4801 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_06390 >Feature sequence089 <1 885 gene locus_tag LOCUS_06400 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768329.1:homoserine dehydrogenase 898 1737 gene locus_tag LOCUS_06410 898 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1952 2905 gene locus_tag LOCUS_06420 gene spoIIIAA 1952 2905 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_06420 2988 3479 gene locus_tag LOCUS_06430 2988 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3484 3678 gene locus_tag LOCUS_06440 3484 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3705 4064 gene locus_tag LOCUS_06450 gene spoIIIAD 3705 4064 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_06450 4082 5269 gene locus_tag LOCUS_06460 4082 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5282 5815 gene locus_tag LOCUS_06470 5282 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence090 1340 534 gene locus_tag LOCUS_06480 gene sigG 1340 534 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_06480 2169 1441 gene locus_tag LOCUS_06490 gene nagB 2169 1441 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_06490 3442 2261 gene locus_tag LOCUS_06500 3442 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3766 5190 gene locus_tag LOCUS_06510 3766 5190 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence091 65 1567 gene locus_tag LOCUS_06520 65 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1599 2108 gene locus_tag LOCUS_06530 1599 2108 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 protein_id gnl|my_center|LOCUS_06530 2224 4191 gene locus_tag LOCUS_06540 2224 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4213 4782 gene locus_tag LOCUS_06550 4213 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4705 4714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4742 5740 gene locus_tag LOCUS_06560 4742 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence092 5073 1078 gene locus_tag LOCUS_06570 gene rpoB 5073 1078 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_06570 5430 5439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence093 343 1983 gene locus_tag LOCUS_06580 gene groL 343 1983 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_06580 2261 3172 gene locus_tag LOCUS_06590 2261 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3274 4092 gene locus_tag LOCUS_06600 3274 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 <5766 4221 gene locus_tag LOCUS_06610 <5766 4221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964991.1:translational GTPase TypA >Feature sequence094 587 45 gene locus_tag LOCUS_06620 587 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 894 1685 gene locus_tag LOCUS_06630 894 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2063 4519 gene locus_tag LOCUS_06640 2063 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4536 5438 gene locus_tag LOCUS_06650 4536 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence095 757 188 gene locus_tag LOCUS_06660 757 188 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_06660 917 1675 gene locus_tag LOCUS_06670 917 1675 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_06670 1672 2613 gene locus_tag LOCUS_06680 1672 2613 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_06680 2831 4165 gene locus_tag LOCUS_06690 gene gdhA 2831 4165 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_06690 5449 4316 gene locus_tag LOCUS_06700 5449 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence096 2573 1095 gene locus_tag LOCUS_06710 gene spoIVA 2573 1095 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_06710 2894 3754 gene locus_tag LOCUS_06720 2894 3754 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_06720 3789 4646 gene locus_tag LOCUS_06730 3789 4646 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_06730 5194 4979 gene locus_tag LOCUS_06740 5194 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5497 5225 gene locus_tag LOCUS_06750 5497 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence097 1176 673 gene locus_tag LOCUS_06760 1176 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1999 1604 gene locus_tag LOCUS_06770 gene rbfA 1999 1604 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392565.1 protein_id gnl|my_center|LOCUS_06770 2880 2116 gene locus_tag LOCUS_06780 gene tpiA 2880 2116 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964030.1 protein_id gnl|my_center|LOCUS_06780 4319 3006 gene locus_tag LOCUS_06790 4319 3006 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_06790 4607 5257 gene locus_tag LOCUS_06800 4607 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence098 154 654 gene locus_tag LOCUS_06810 154 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1030 827 gene locus_tag LOCUS_06820 1030 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2042 1056 gene locus_tag LOCUS_06830 2042 1056 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_06830 2962 2207 gene locus_tag LOCUS_06840 2962 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3288 3854 gene locus_tag LOCUS_06850 3288 3854 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 protein_id gnl|my_center|LOCUS_06850 <5572 3989 gene locus_tag LOCUS_06860 <5572 3989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943948.1:ABC transporter permease >Feature sequence099 <1 2470 gene locus_tag LOCUS_06870 <1 2470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388658.1:glycyl radical protein 2566 3360 gene locus_tag LOCUS_06880 2566 3360 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_06880 3427 3795 gene locus_tag LOCUS_06890 3427 3795 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_06890 3813 4325 gene locus_tag LOCUS_06900 3813 4325 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 protein_id gnl|my_center|LOCUS_06900 4318 5145 gene locus_tag LOCUS_06910 gene soj 4318 5145 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence100 289 537 gene locus_tag LOCUS_06920 289 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 551 2797 gene locus_tag LOCUS_06930 551 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3323 5296 gene locus_tag LOCUS_06940 3323 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence101 >Feature sequence102 341 769 gene locus_tag LOCUS_06950 341 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1844 867 gene locus_tag LOCUS_06960 1844 867 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_06960 2689 1916 gene locus_tag LOCUS_06970 2689 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3273 2773 gene locus_tag LOCUS_06980 gene greA 3273 2773 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_06980 4797 3352 gene locus_tag LOCUS_06990 4797 3352 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence103 138 941 gene locus_tag LOCUS_07000 138 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2561 834 gene locus_tag LOCUS_07010 2561 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2709 3902 gene locus_tag LOCUS_07020 2709 3902 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_07020 3975 4169 gene locus_tag LOCUS_07030 3975 4169 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_07030 4356 5396 gene locus_tag LOCUS_07040 4356 5396 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence104 682 1011 gene locus_tag LOCUS_07050 gene spoVG 682 1011 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_07050 1701 1192 gene locus_tag LOCUS_07060 1701 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3106 1709 gene locus_tag LOCUS_07070 3106 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5267 3660 gene locus_tag LOCUS_07080 gene rny 5267 3660 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence105 1497 337 gene locus_tag LOCUS_07090 1497 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1894 1819 gene locus_tag LOCUS_t00060 1894 1819 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2504 2193 gene locus_tag LOCUS_07100 2504 2193 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_07100 3860 2796 gene locus_tag LOCUS_07110 3860 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4120 5259 gene locus_tag LOCUS_07120 gene murG 4120 5259 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640857.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence106 1683 562 gene locus_tag LOCUS_07130 1683 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1931 1680 gene locus_tag LOCUS_07140 1931 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2490 1957 gene locus_tag LOCUS_07150 2490 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4917 2863 gene locus_tag LOCUS_07160 4917 2863 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_07160 5281 4949 gene locus_tag LOCUS_07170 5281 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence107 1322 129 gene locus_tag LOCUS_07180 1322 129 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_07180 1825 1322 gene locus_tag LOCUS_07190 1825 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 2322 1762 gene locus_tag LOCUS_07200 2322 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07200 1834 1843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3702 2401 gene locus_tag LOCUS_07210 3702 2401 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_07210 4162 3677 gene locus_tag LOCUS_07220 4162 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 <5328 4198 gene locus_tag LOCUS_07230 <5328 4198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902758.1:glycosyltransferase family 4 protein >Feature sequence108 705 1583 gene locus_tag LOCUS_07240 705 1583 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_07240 1586 2623 gene locus_tag LOCUS_07250 1586 2623 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_07250 2620 3504 gene locus_tag LOCUS_07260 2620 3504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_07260 3501 4202 gene locus_tag LOCUS_07270 3501 4202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence109 1988 1131 gene locus_tag LOCUS_07280 1988 1131 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_07280 2661 2065 gene locus_tag LOCUS_07290 2661 2065 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 protein_id gnl|my_center|LOCUS_07290 3449 2658 gene locus_tag LOCUS_07300 3449 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3907 3470 gene locus_tag LOCUS_07310 3907 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5147 4065 gene locus_tag LOCUS_07320 5147 4065 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722481.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence110 125 1603 gene locus_tag LOCUS_07330 gene glpK 125 1603 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655029.1 protein_id gnl|my_center|LOCUS_07330 1679 2647 gene locus_tag LOCUS_07340 1679 2647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_07340 2688 3569 gene locus_tag LOCUS_07350 2688 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 3526 3535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3562 4077 gene locus_tag LOCUS_07360 3562 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07360 4084 5112 gene locus_tag LOCUS_07370 4084 5112 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101704.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence111 350 994 gene locus_tag LOCUS_07380 350 994 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_07380 1152 2258 gene locus_tag LOCUS_07390 1152 2258 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_07390 2331 3449 gene locus_tag LOCUS_07400 2331 3449 CDS product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202151.1 protein_id gnl|my_center|LOCUS_07400 3519 4571 gene locus_tag LOCUS_07410 3519 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence112 374 1093 gene locus_tag LOCUS_07420 374 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1184 1348 gene locus_tag LOCUS_07430 1184 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2724 1372 gene locus_tag LOCUS_07440 2724 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3260 2721 gene locus_tag LOCUS_07450 3260 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3334 3534 gene locus_tag LOCUS_07460 3334 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence113 2611 1883 gene locus_tag LOCUS_07470 2611 1883 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_07470 3167 2841 gene locus_tag LOCUS_07480 3167 2841 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_07480 3896 3303 gene locus_tag LOCUS_07490 3896 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5042 4188 gene locus_tag LOCUS_07500 5042 4188 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence114 <1 1951 gene locus_tag LOCUS_07510 <1 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein >Feature sequence115 488 2500 gene locus_tag LOCUS_07520 gene ligA 488 2500 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_07520 2554 3039 gene locus_tag LOCUS_07530 2554 3039 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_07530 3199 3591 gene locus_tag LOCUS_07540 3199 3591 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_07540 4338 3766 gene locus_tag LOCUS_07550 4338 3766 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_07550 5111 4758 gene locus_tag LOCUS_07560 5111 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence116 109 951 gene locus_tag LOCUS_07570 109 951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_07570 948 2918 gene locus_tag LOCUS_07580 948 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence117 200 364 gene locus_tag LOCUS_07590 200 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2359 659 gene locus_tag LOCUS_07600 gene phoR 2359 659 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_07600 3041 2370 gene locus_tag LOCUS_07610 3041 2370 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_07610 3691 3035 gene locus_tag LOCUS_07620 gene phoU 3691 3035 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_07620 4721 3933 gene locus_tag LOCUS_07630 gene pstB 4721 3933 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_07630 5080 4721 gene locus_tag LOCUS_07640 5080 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence118 3226 17 gene locus_tag LOCUS_07650 3226 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4044 3250 gene locus_tag LOCUS_07660 4044 3250 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_07660 4492 4067 gene locus_tag LOCUS_07670 4492 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 <5050 4521 gene locus_tag LOCUS_07680 <5050 4521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257471.1:insulinase family protein >Feature sequence119 <1 3216 gene locus_tag LOCUS_07690 <1 3216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263553.1:ATP-binding cassette domain-containing protein 3335 4210 gene locus_tag LOCUS_07700 gene truA 3335 4210 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence120 173 1747 gene locus_tag LOCUS_07710 173 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1798 2790 gene locus_tag LOCUS_07720 1798 2790 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_07720 2910 3806 gene locus_tag LOCUS_07730 2910 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3823 4596 gene locus_tag LOCUS_07740 3823 4596 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_07740 4719 4922 gene locus_tag LOCUS_07750 4719 4922 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence121 1086 193 gene locus_tag LOCUS_07760 gene rsmI 1086 193 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_07760 1201 1761 gene locus_tag LOCUS_07770 1201 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1905 2417 gene locus_tag LOCUS_07780 1905 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2550 2969 gene locus_tag LOCUS_07790 2550 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3183 4097 gene locus_tag LOCUS_07800 3183 4097 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_07800 <4899 4206 gene locus_tag LOCUS_07810 <4899 4206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230471.1:spore germination protein SpoVAF >Feature sequence122 594 1382 gene locus_tag LOCUS_07820 594 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1528 3042 gene locus_tag LOCUS_07830 1528 3042 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_07830 3227 3562 gene locus_tag LOCUS_07840 3227 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence123 1 1032 gene locus_tag LOCUS_07850 1 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1787 1176 gene locus_tag LOCUS_07860 1787 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2632 1766 gene locus_tag LOCUS_07870 2632 1766 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_07870 3720 2632 gene locus_tag LOCUS_07880 3720 2632 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_07880 4435 3758 gene locus_tag LOCUS_07890 4435 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3795 3804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence124 <1 796 gene locus_tag LOCUS_07900 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989775.1:TIGR01212 family radical SAM protein 818 3052 gene locus_tag LOCUS_07910 818 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3238 4842 gene locus_tag LOCUS_07920 3238 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence125 242 1330 gene locus_tag LOCUS_07930 242 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1482 2687 gene locus_tag LOCUS_07940 1482 2687 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_07940 2723 3517 gene locus_tag LOCUS_07950 2723 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3574 4314 gene locus_tag LOCUS_07960 3574 4314 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence126 965 234 gene locus_tag LOCUS_07970 965 234 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_07970 1751 1116 gene locus_tag LOCUS_07980 1751 1116 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_07980 2409 1834 gene locus_tag LOCUS_07990 2409 1834 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868832.1 protein_id gnl|my_center|LOCUS_07990 2750 2986 gene locus_tag LOCUS_08000 2750 2986 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105788.1 protein_id gnl|my_center|LOCUS_08000 4334 3096 gene locus_tag LOCUS_08010 4334 3096 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence127 <1 870 gene locus_tag LOCUS_08020 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860930.1:endonuclease MutS2 940 1650 gene locus_tag LOCUS_08030 940 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1671 2981 gene locus_tag LOCUS_08040 1671 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2996 4483 gene locus_tag LOCUS_08050 2996 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence128 2930 69 gene locus_tag LOCUS_08060 2930 69 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence129 1862 522 gene locus_tag LOCUS_08070 1862 522 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_08070 2709 2718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence130 965 87 gene locus_tag LOCUS_08080 965 87 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_08080 1753 962 gene locus_tag LOCUS_08090 1753 962 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_08090 2866 1835 gene locus_tag LOCUS_08100 2866 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3299 2850 gene locus_tag LOCUS_08110 3299 2850 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_08110 3580 3589 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence131 1401 706 gene locus_tag LOCUS_08120 1401 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2219 1398 gene locus_tag LOCUS_08130 2219 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3035 2259 gene locus_tag LOCUS_08140 3035 2259 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_08140 4373 3069 gene locus_tag LOCUS_08150 gene lysA 4373 3069 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence132 1262 2059 gene locus_tag LOCUS_08160 1262 2059 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_08160 2079 2771 gene locus_tag LOCUS_08170 2079 2771 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811435.1 protein_id gnl|my_center|LOCUS_08170 2822 3595 gene locus_tag LOCUS_08180 2822 3595 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_08180 4275 3652 gene locus_tag LOCUS_08190 4275 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_08190 4475 4278 gene locus_tag LOCUS_08200 4475 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence133 132 1487 gene locus_tag LOCUS_08210 132 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 1411 2244 gene locus_tag LOCUS_08220 1411 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 2249 3433 gene locus_tag LOCUS_08230 2249 3433 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626354.1 protein_id gnl|my_center|LOCUS_08230 3447 4577 gene locus_tag LOCUS_08240 gene glgD 3447 4577 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence134 1819 656 gene locus_tag LOCUS_08250 gene recA 1819 656 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_08250 2467 2102 gene locus_tag LOCUS_08260 2467 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4599 2482 gene locus_tag LOCUS_08270 4599 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence135 1410 2150 gene locus_tag LOCUS_08280 1410 2150 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_08280 2199 3044 gene locus_tag LOCUS_08290 2199 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3092 3370 gene locus_tag LOCUS_08300 3092 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3370 4242 gene locus_tag LOCUS_08310 3370 4242 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence136 653 728 gene locus_tag LOCUS_t00070 653 728 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2262 868 gene locus_tag LOCUS_08320 2262 868 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_08320 3435 2491 gene locus_tag LOCUS_08330 3435 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence137 <1 1865 gene locus_tag LOCUS_08340 <1 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814523.1:carbohydrate-binding domain-containing protein 2669 1920 gene locus_tag LOCUS_08350 2669 1920 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_08350 4507 2648 gene locus_tag LOCUS_08360 4507 2648 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence138 172 417 gene locus_tag LOCUS_08370 172 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1638 784 gene locus_tag LOCUS_08380 1638 784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_08380 1794 2648 gene locus_tag LOCUS_08390 1794 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2923 3168 gene locus_tag LOCUS_08400 2923 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3634 3260 gene locus_tag LOCUS_08410 3634 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08410 <4582 3612 gene locus_tag LOCUS_08420 <4582 3612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438014.1:ABC transporter ATP-binding protein note possible pseudo, frameshifted 3697 3706 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence139 <1 1072 gene locus_tag LOCUS_08430 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012028400.1:alpha-galactosidase >Feature sequence140 2750 1869 gene locus_tag LOCUS_08440 2750 1869 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_08440 3894 2821 gene locus_tag LOCUS_08450 3894 2821 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence141 <1 1382 gene locus_tag LOCUS_08460 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:PBP1A family penicillin-binding protein 3121 1478 gene locus_tag LOCUS_08470 gene glmM 3121 1478 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_08470 4512 3577 gene locus_tag LOCUS_08480 4512 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence142 <4527 2149 gene locus_tag LOCUS_08490 <4527 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918459.1:glycoside hydrolase family 28 protein >Feature sequence143 <1 889 gene locus_tag LOCUS_08500 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964158.1:ABC transporter ATP-binding protein 886 1746 gene locus_tag LOCUS_08510 886 1746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_08510 1743 2564 gene locus_tag LOCUS_08520 1743 2564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_08520 2561 3832 gene locus_tag LOCUS_08530 2561 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4043 4339 gene locus_tag LOCUS_08540 4043 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence144 169 1626 gene locus_tag LOCUS_08550 169 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1748 1903 gene locus_tag LOCUS_08560 1748 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence145 <1 826 gene locus_tag LOCUS_08570 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000435928.1:uracil permease 931 1401 gene locus_tag LOCUS_08580 931 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1549 2946 gene locus_tag LOCUS_08590 1549 2946 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_08590 2943 4226 gene locus_tag LOCUS_08600 2943 4226 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678843.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence146 1384 2538 gene locus_tag LOCUS_08610 gene pheA 1384 2538 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_08610 2627 3652 gene locus_tag LOCUS_08620 gene aroB 2627 3652 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence147 2558 3853 gene locus_tag LOCUS_08630 2558 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence148 1529 480 gene locus_tag LOCUS_08640 1529 480 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_08640 1858 4296 gene locus_tag LOCUS_08650 1858 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence149 390 2051 gene locus_tag LOCUS_08660 390 2051 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_08660 4049 2367 gene locus_tag LOCUS_08670 4049 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence150 1174 191 gene locus_tag LOCUS_08680 1174 191 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_08680 2382 1195 gene locus_tag LOCUS_08690 2382 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3145 2411 gene locus_tag LOCUS_08700 3145 2411 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_08700 4144 3182 gene locus_tag LOCUS_08710 gene tsaD 4144 3182 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence151 >Feature sequence152 209 1594 gene locus_tag LOCUS_08720 209 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1284 1293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1579 1917 gene locus_tag LOCUS_08730 1579 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2042 3295 gene locus_tag LOCUS_08740 2042 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3315 4265 gene locus_tag LOCUS_08750 3315 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence153 1307 315 gene locus_tag LOCUS_08760 gene plsX 1307 315 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_08760 2067 1300 gene locus_tag LOCUS_08770 2067 1300 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 protein_id gnl|my_center|LOCUS_08770 2953 2057 gene locus_tag LOCUS_08780 2953 2057 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_08780 3779 2967 gene locus_tag LOCUS_08790 gene accD 3779 2967 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905556.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence154 1992 1300 gene locus_tag LOCUS_08800 1992 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2681 2046 gene locus_tag LOCUS_08810 2681 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3171 2698 gene locus_tag LOCUS_08820 3171 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 2712 2721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3689 3558 gene locus_tag LOCUS_08830 3689 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3682 4269 gene locus_tag LOCUS_08840 3682 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence155 899 195 gene locus_tag LOCUS_08850 gene pyrF 899 195 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_08850 1921 992 gene locus_tag LOCUS_08860 1921 992 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_08860 2673 1909 gene locus_tag LOCUS_08870 2673 1909 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_08870 3980 2670 gene locus_tag LOCUS_08880 3980 2670 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485025.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence156 121 630 gene locus_tag LOCUS_08890 121 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 539 548 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 674 4018 gene locus_tag LOCUS_08900 674 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence157 559 473 gene locus_tag LOCUS_t00080 559 473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 789 2591 gene locus_tag LOCUS_08910 789 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 2527 2536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2563 2895 gene locus_tag LOCUS_08920 2563 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 2918 3841 gene locus_tag LOCUS_08930 2918 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence158 <1 549 gene locus_tag LOCUS_08940 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048204.1:trigger factor 726 1346 gene locus_tag LOCUS_08950 gene clpP 726 1346 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_08950 1377 2804 gene locus_tag LOCUS_08960 gene clpX 1377 2804 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417105.1 protein_id gnl|my_center|LOCUS_08960 2842 4044 gene locus_tag LOCUS_08970 2842 4044 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_08970 3762 3771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence159 <1 1115 gene locus_tag LOCUS_08980 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867316.1:PLP-dependent aminotransferase family protein 1112 2104 gene locus_tag LOCUS_08990 1112 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence160 746 165 gene locus_tag LOCUS_09000 746 165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_09000 1537 800 gene locus_tag LOCUS_09010 1537 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2451 1555 gene locus_tag LOCUS_09020 gene rlmA 2451 1555 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705931.1 protein_id gnl|my_center|LOCUS_09020 <4089 2585 gene locus_tag LOCUS_09030 <4089 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459501.1:HAMP domain-containing sensor histidine kinase >Feature sequence161 12 2522 gene locus_tag LOCUS_09040 gene alaS 12 2522 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_09040 3065 2580 gene locus_tag LOCUS_09050 3065 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence162 3 161 gene locus_tag LOCUS_09060 3 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 154 1185 gene locus_tag LOCUS_09070 154 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1182 2726 gene locus_tag LOCUS_09080 1182 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2738 3691 gene locus_tag LOCUS_09090 2738 3691 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence163 450 115 gene locus_tag LOCUS_09100 gene rplV 450 115 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_09100 742 467 gene locus_tag LOCUS_09110 gene rpsS 742 467 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_09110 1590 757 gene locus_tag LOCUS_09120 gene rplB 1590 757 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_09120 1920 1609 gene locus_tag LOCUS_09130 1920 1609 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894481.1 protein_id gnl|my_center|LOCUS_09130 2543 1917 gene locus_tag LOCUS_09140 gene rplD 2543 1917 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_09140 3197 2565 gene locus_tag LOCUS_09150 gene rplC 3197 2565 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_09150 3725 3414 gene locus_tag LOCUS_09160 gene rpsJ 3725 3414 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence164 1717 455 gene locus_tag LOCUS_09170 1717 455 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460292.1 protein_id gnl|my_center|LOCUS_09170 2753 1725 gene locus_tag LOCUS_09180 2753 1725 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_09180 3880 2792 gene locus_tag LOCUS_09190 3880 2792 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence165 3474 871 gene locus_tag LOCUS_09200 gene mutS 3474 871 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_09200 3958 3530 gene locus_tag LOCUS_09210 3958 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence166 3794 147 gene locus_tag LOCUS_09220 gene nifJ 3794 147 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence167 2223 622 gene locus_tag LOCUS_09230 2223 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3792 2257 gene locus_tag LOCUS_09240 3792 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence168 900 415 gene locus_tag LOCUS_09250 900 415 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_09250 1869 931 gene locus_tag LOCUS_09260 1869 931 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792441.1 protein_id gnl|my_center|LOCUS_09260 2224 1874 gene locus_tag LOCUS_09270 2224 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3510 2221 gene locus_tag LOCUS_09280 gene xseA 3510 2221 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence169 2053 368 gene locus_tag LOCUS_09290 2053 368 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_09290 2324 2058 gene locus_tag LOCUS_09300 2324 2058 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_09300 2609 2367 gene locus_tag LOCUS_09310 2609 2367 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_09310 3394 2645 gene locus_tag LOCUS_09320 3394 2645 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_09320 <3908 3409 gene locus_tag LOCUS_09330 <3908 3409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861762.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase >Feature sequence170 305 1648 gene locus_tag LOCUS_09340 305 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1690 2106 gene locus_tag LOCUS_09350 1690 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2152 3165 gene locus_tag LOCUS_09360 2152 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence171 217 226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 228 1631 gene locus_tag LOCUS_09370 228 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 1679 2197 gene locus_tag LOCUS_09380 1679 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 3886 2327 gene locus_tag LOCUS_09390 3886 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence172 185 1285 gene locus_tag LOCUS_09400 185 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1801 1349 gene locus_tag LOCUS_09410 gene spoVAC 1801 1349 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_09410 3121 1871 gene locus_tag LOCUS_09420 3121 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3870 3151 gene locus_tag LOCUS_09430 3870 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence173 <1 887 gene locus_tag LOCUS_09440 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896360.1:polysaccharide deacetylase family protein 1074 2102 gene locus_tag LOCUS_09450 1074 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2108 2371 gene locus_tag LOCUS_09460 2108 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence174 1203 763 gene locus_tag LOCUS_09470 gene dut 1203 763 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_09470 3768 1213 gene locus_tag LOCUS_09480 3768 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence175 1100 84 gene locus_tag LOCUS_09490 1100 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1642 1097 gene locus_tag LOCUS_09500 1642 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3819 1780 gene locus_tag LOCUS_09510 gene lysS 3819 1780 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558598.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence176 204 1067 gene locus_tag LOCUS_09520 204 1067 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_09520 1239 2396 gene locus_tag LOCUS_09530 1239 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2894 2424 gene locus_tag LOCUS_09540 2894 2424 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence177 73 834 gene locus_tag LOCUS_09550 gene soj 73 834 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_09550 849 1742 gene locus_tag LOCUS_09560 849 1742 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_09560 1794 3077 gene locus_tag LOCUS_09570 gene serS 1794 3077 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_09570 3105 3818 gene locus_tag LOCUS_09580 3105 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence178 >Feature sequence179 1280 174 gene locus_tag LOCUS_09590 gene spoVAD 1280 174 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence180 582 286 gene locus_tag LOCUS_09600 582 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3491 657 gene locus_tag LOCUS_09610 3491 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence181 >Feature sequence182 351 2444 gene locus_tag LOCUS_09620 351 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2991 2581 gene locus_tag LOCUS_09630 2991 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3766 3035 gene locus_tag LOCUS_09640 3766 3035 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence183 >Feature sequence184 640 1890 gene locus_tag LOCUS_09650 640 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1903 2442 gene locus_tag LOCUS_09660 1903 2442 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_09660 3695 2568 gene locus_tag LOCUS_09670 3695 2568 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence185 <1 500 gene locus_tag LOCUS_09680 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004117534.1:cysteine synthase A 565 990 gene locus_tag LOCUS_09690 gene iscR 565 990 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_09690 1155 2645 gene locus_tag LOCUS_09700 1155 2645 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_09700 3209 2808 gene locus_tag LOCUS_09710 gene rpsI 3209 2808 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_09710 3629 3234 gene locus_tag LOCUS_09720 gene rplM 3629 3234 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210132.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence186 <1 3056 gene locus_tag LOCUS_09730 <1 3056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721731.1:chitinase ChiB >Feature sequence187 52 285 gene locus_tag LOCUS_09740 52 285 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_09740 1134 403 gene locus_tag LOCUS_09750 1134 403 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_09750 2107 1181 gene locus_tag LOCUS_09760 2107 1181 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_09760 3341 2256 gene locus_tag LOCUS_09770 3341 2256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_09770 3343 3352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence188 287 898 gene locus_tag LOCUS_09780 287 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1068 1475 gene locus_tag LOCUS_09790 1068 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2337 1681 gene locus_tag LOCUS_09800 2337 1681 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_09800 2813 2400 gene locus_tag LOCUS_09810 2813 2400 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence189 <1 3246 gene locus_tag LOCUS_09820 <1 3246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975735.1:tetratricopeptide repeat protein >Feature sequence190 1739 75 gene locus_tag LOCUS_09830 gene topA 1739 75 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_09830 3198 1861 gene locus_tag LOCUS_09840 3198 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3578 3297 gene locus_tag LOCUS_09850 3578 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence191 1578 2006 gene locus_tag LOCUS_09860 1578 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2196 2654 gene locus_tag LOCUS_09870 gene ssb 2196 2654 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_09870 2731 2988 gene locus_tag LOCUS_09880 gene rpsR 2731 2988 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence192 1759 401 gene locus_tag LOCUS_09890 gene brnQ 1759 401 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_09890 2610 1804 gene locus_tag LOCUS_09900 2610 1804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_09900 1983 1992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3367 2612 gene locus_tag LOCUS_09910 3367 2612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_09910 3543 3364 gene locus_tag LOCUS_09920 3543 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence193 681 160 gene locus_tag LOCUS_09930 681 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3514 800 gene locus_tag LOCUS_09940 gene gyrA 3514 800 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence194 677 1567 gene locus_tag LOCUS_09950 677 1567 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931017.1 protein_id gnl|my_center|LOCUS_09950 1564 2031 gene locus_tag LOCUS_09960 1564 2031 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_09960 2297 3409 gene locus_tag LOCUS_09970 gene ugpC 2297 3409 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence195 <1 1412 gene locus_tag LOCUS_09980 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861666.1:thioether cross-link-forming SCIFF peptide maturase 1416 2777 gene locus_tag LOCUS_09990 1416 2777 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391589.1 protein_id gnl|my_center|LOCUS_09990 <3545 2858 gene locus_tag LOCUS_10000 <3545 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000490229.1:3-phosphoglycerate dehydrogenase family protein >Feature sequence196 503 2425 gene locus_tag LOCUS_10010 503 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2685 2761 gene locus_tag LOCUS_t00090 2685 2761 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence197 150 1655 gene locus_tag LOCUS_10020 150 1655 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_10020 1820 3223 gene locus_tag LOCUS_10030 1820 3223 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence198 756 2069 gene locus_tag LOCUS_10040 756 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence199 696 148 gene locus_tag LOCUS_10050 696 148 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_10050 2046 736 gene locus_tag LOCUS_10060 2046 736 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868840.1 protein_id gnl|my_center|LOCUS_10060 2556 2293 gene locus_tag LOCUS_10070 2556 2293 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815267.1 protein_id gnl|my_center|LOCUS_10070 3249 2587 gene locus_tag LOCUS_10080 3249 2587 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence200 1927 26 gene locus_tag LOCUS_10090 1927 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3357 1969 gene locus_tag LOCUS_10100 3357 1969 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence201 1587 157 gene locus_tag LOCUS_10110 1587 157 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262594.1 protein_id gnl|my_center|LOCUS_10110 2745 1624 gene locus_tag LOCUS_10120 gene nahK 2745 1624 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_10120 3428 2760 gene locus_tag LOCUS_10130 3428 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence202 189 1157 gene locus_tag LOCUS_10140 189 1157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114911.1 protein_id gnl|my_center|LOCUS_10140 1154 2083 gene locus_tag LOCUS_10150 1154 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2023 2032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence203 90 875 gene locus_tag LOCUS_10160 90 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1094 1270 gene locus_tag LOCUS_10170 1094 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1339 2706 gene locus_tag LOCUS_10180 1339 2706 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence204 601 915 gene locus_tag LOCUS_10190 gene trxA 601 915 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_10190 945 2642 gene locus_tag LOCUS_10200 gene glaB 945 2642 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_10200 <3453 2730 gene locus_tag LOCUS_10210 <3453 2730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228057.1:excinuclease ABC subunit UvrA >Feature sequence205 226 301 gene locus_tag LOCUS_t00100 226 301 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 347 448 gene locus_tag LOCUS_r00010 347 448 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 495 570 gene locus_tag LOCUS_t00110 495 570 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 786 2714 gene locus_tag LOCUS_10220 786 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2738 3370 gene locus_tag LOCUS_10230 2738 3370 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence206 968 1297 gene locus_tag LOCUS_10240 968 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1294 3180 gene locus_tag LOCUS_10250 1294 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence207 398 1489 gene locus_tag LOCUS_10260 gene queA 398 1489 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_10260 1528 2376 gene locus_tag LOCUS_10270 1528 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2373 3332 gene locus_tag LOCUS_10280 gene miaA 2373 3332 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence208 1105 2 gene locus_tag LOCUS_10290 1105 2 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830071.1 protein_id gnl|my_center|LOCUS_10290 2114 1269 gene locus_tag LOCUS_10300 gene dapF 2114 1269 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765061.1 protein_id gnl|my_center|LOCUS_10300 3316 2105 gene locus_tag LOCUS_10310 gene guaA 3316 2105 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence209 1669 494 gene locus_tag LOCUS_10320 1669 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence210 587 1915 gene locus_tag LOCUS_10330 587 1915 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_10330 1949 2635 gene locus_tag LOCUS_10340 1949 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence211 1866 451 gene locus_tag LOCUS_10350 gene glmM 1866 451 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521461.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence212 22 972 gene locus_tag LOCUS_10360 22 972 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_10360 999 2492 gene locus_tag LOCUS_10370 gene thrC 999 2492 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_10370 2748 2563 gene locus_tag LOCUS_10380 2748 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence213 321 1481 gene locus_tag LOCUS_10390 321 1481 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence214 1 3066 gene locus_tag LOCUS_10400 1 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence215 1724 231 gene locus_tag LOCUS_10410 1724 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2714 1920 gene locus_tag LOCUS_10420 2714 1920 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_10420 3045 2821 gene locus_tag LOCUS_10430 3045 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence216 196 789 gene locus_tag LOCUS_10440 196 789 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_10440 913 1437 gene locus_tag LOCUS_10450 gene raiA 913 1437 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_10450 <3190 1539 gene locus_tag LOCUS_10460 <3190 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582581.1:glycosyl hydrolase >Feature sequence217 1574 801 gene locus_tag LOCUS_10470 1574 801 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002916109.1 protein_id gnl|my_center|LOCUS_10470 2313 1621 gene locus_tag LOCUS_10480 2313 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3133 2369 gene locus_tag LOCUS_10490 3133 2369 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922726.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence218 58 798 gene locus_tag LOCUS_10500 58 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 865 2088 gene locus_tag LOCUS_10510 865 2088 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015646101.1 protein_id gnl|my_center|LOCUS_10510 2107 2457 gene locus_tag LOCUS_10520 2107 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2508 2783 gene locus_tag LOCUS_10530 gene pduA 2508 2783 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence219 166 2958 gene locus_tag LOCUS_10540 166 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence220 <1 968 gene locus_tag LOCUS_10550 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392455.1:sporulation integral membrane protein YlbJ <3146 889 gene locus_tag LOCUS_10560 <3146 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776802.1:alpha-L-rhamnosidase >Feature sequence221 3 1073 gene locus_tag LOCUS_10570 3 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2006 2015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2063 2854 gene locus_tag LOCUS_10580 2063 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10580 >Feature sequence222 1 531 gene locus_tag LOCUS_10590 1 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 739 3102 gene locus_tag LOCUS_10600 gene lon 739 3102 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097310.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence223 2554 1460 gene locus_tag LOCUS_10610 2554 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3135 2821 gene locus_tag LOCUS_10620 3135 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence224 187 2151 gene locus_tag LOCUS_10630 187 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 <3134 2244 gene locus_tag LOCUS_10640 <3134 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057081.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence225 348 509 gene locus_tag LOCUS_10650 gene rpmG 348 509 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_10650 532 1104 gene locus_tag LOCUS_10660 532 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1137 1676 gene locus_tag LOCUS_10670 gene nusG 1137 1676 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_10670 1913 2338 gene locus_tag LOCUS_10680 gene rplK 1913 2338 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_10680 2358 3053 gene locus_tag LOCUS_10690 gene rplA 2358 3053 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence226 366 908 gene locus_tag LOCUS_10700 366 908 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_10700 954 1979 gene locus_tag LOCUS_10710 gene nusA 954 1979 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_10710 2029 2361 gene locus_tag LOCUS_10720 2029 2361 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_10720 2351 2704 gene locus_tag LOCUS_10730 2351 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence227 155 1318 gene locus_tag LOCUS_10740 gene rodA 155 1318 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_10740 3022 1394 gene locus_tag LOCUS_10750 3022 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence228 <3085 1359 gene locus_tag LOCUS_10760 <3085 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000681739.1:ABC transporter ATP-binding protein >Feature sequence229 2588 144 gene locus_tag LOCUS_10770 gene pheT 2588 144 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705112.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence230 <3078 2323 gene locus_tag LOCUS_10780 <3078 2323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase >Feature sequence231 <3054 974 gene locus_tag LOCUS_10790 <3054 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964990.1:ribonuclease J >Feature sequence232 256 1731 gene locus_tag LOCUS_10800 256 1731 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_10800 2352 1843 gene locus_tag LOCUS_10810 2352 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence233 154 2115 gene locus_tag LOCUS_10820 154 2115 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989588.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence234 173 844 gene locus_tag LOCUS_10830 173 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 883 1923 gene locus_tag LOCUS_10840 883 1923 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250551.1 protein_id gnl|my_center|LOCUS_10840 1916 2242 gene locus_tag LOCUS_10850 1916 2242 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence235 <1 2253 gene locus_tag LOCUS_10860 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225596.1:glycoside hydrolase family 2 protein 2753 2379 gene locus_tag LOCUS_10870 2753 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2952 2767 gene locus_tag LOCUS_10880 2952 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence236 1634 2326 gene locus_tag LOCUS_10890 1634 2326 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence237 79 1803 gene locus_tag LOCUS_10900 79 1803 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_10900 1947 2183 gene locus_tag LOCUS_10910 1947 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2180 2656 gene locus_tag LOCUS_10920 2180 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence238 92 1411 gene locus_tag LOCUS_10930 gene arsB 92 1411 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186433708.1 protein_id gnl|my_center|LOCUS_10930 1568 2608 gene locus_tag LOCUS_10940 gene ansA 1568 2608 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_10940 2653 2913 gene locus_tag LOCUS_10950 2653 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence239 1361 3 gene locus_tag LOCUS_10960 1361 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2341 1433 gene locus_tag LOCUS_10970 2341 1433 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_10970 2865 2338 gene locus_tag LOCUS_10980 2865 2338 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence240 176 427 gene locus_tag LOCUS_10990 176 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 913 1956 gene locus_tag LOCUS_11000 913 1956 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 protein_id gnl|my_center|LOCUS_11000 2597 2052 gene locus_tag LOCUS_11010 2597 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11010 2598 2607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence241 1256 144 gene locus_tag LOCUS_11020 gene pfkA 1256 144 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_11020 2649 1309 gene locus_tag LOCUS_11030 2649 1309 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_11030 2285 2294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence242 650 1207 gene locus_tag LOCUS_11040 650 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1901 1302 gene locus_tag LOCUS_11050 1901 1302 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 protein_id gnl|my_center|LOCUS_11050 2165 2737 gene locus_tag LOCUS_11060 2165 2737 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence243 1984 35 gene locus_tag LOCUS_11070 1984 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2752 2027 gene locus_tag LOCUS_11080 gene trmD 2752 2027 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence244 1700 1134 gene locus_tag LOCUS_11090 1700 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2581 1715 gene locus_tag LOCUS_11100 2581 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence245 1398 868 gene locus_tag LOCUS_11110 1398 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2017 1445 gene locus_tag LOCUS_11120 2017 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence246 428 437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1273 1109 gene locus_tag LOCUS_11130 1273 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2375 1329 gene locus_tag LOCUS_11140 2375 1329 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence247 604 1473 gene locus_tag LOCUS_11150 604 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1791 1540 gene locus_tag LOCUS_11160 1791 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2342 1764 gene locus_tag LOCUS_11170 2342 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 1812 1821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2784 2356 gene locus_tag LOCUS_11180 2784 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence248 199 1167 gene locus_tag LOCUS_11190 199 1167 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_11190 1211 2125 gene locus_tag LOCUS_11200 1211 2125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940642.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence249 >Feature sequence250 143 937 gene locus_tag LOCUS_11210 143 937 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352228.1 protein_id gnl|my_center|LOCUS_11210 1034 2338 gene locus_tag LOCUS_11220 1034 2338 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_11220 2410 2419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence251 282 461 gene locus_tag LOCUS_11230 282 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 530 1039 gene locus_tag LOCUS_11240 530 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1005 1706 gene locus_tag LOCUS_11250 1005 1706 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence252 1059 316 gene locus_tag LOCUS_11260 1059 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence253 8 1123 gene locus_tag LOCUS_11270 gene dnaN 8 1123 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_11270 1133 2275 gene locus_tag LOCUS_11280 gene recF 1133 2275 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775113.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence254 905 108 gene locus_tag LOCUS_11290 905 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1534 917 gene locus_tag LOCUS_11300 1534 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 <2711 1628 gene locus_tag LOCUS_11310 <2711 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494943.1:MATE family efflux transporter >Feature sequence255 1033 425 gene locus_tag LOCUS_11320 1033 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence256 865 335 gene locus_tag LOCUS_11330 865 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 424 433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1233 889 gene locus_tag LOCUS_11340 1233 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2495 1317 gene locus_tag LOCUS_11350 gene metK 2495 1317 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence257 112 1296 gene locus_tag LOCUS_11360 112 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence258 >Feature sequence259 372 1598 gene locus_tag LOCUS_11370 gene aroA 372 1598 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_11370 1602 2522 gene locus_tag LOCUS_11380 1602 2522 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence260 1680 367 gene locus_tag LOCUS_11390 1680 367 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_11390 2567 1677 gene locus_tag LOCUS_11400 2567 1677 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence261 >Feature sequence262 <1 2191 gene locus_tag LOCUS_11410 <1 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228485.1:phosphodiester glycosidase family protein >Feature sequence263 >Feature sequence264 588 1550 gene locus_tag LOCUS_11420 588 1550 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_11420 2638 1616 gene locus_tag LOCUS_11430 gene galE 2638 1616 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence265 <1 1926 gene locus_tag LOCUS_11440 <1 1926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695108.1:alpha-L-rhamnosidase C-terminal domain-containing protein <2658 2074 gene locus_tag LOCUS_11450 <2658 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002358973.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence266 54 2462 gene locus_tag LOCUS_11460 54 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence267 <1 2544 gene locus_tag LOCUS_11470 <1 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080411.1:alpha-L-rhamnosidase >Feature sequence268 862 140 gene locus_tag LOCUS_11480 862 140 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_11480 1616 849 gene locus_tag LOCUS_11490 1616 849 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966321.1 protein_id gnl|my_center|LOCUS_11490 2373 1570 gene locus_tag LOCUS_11500 2373 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence269 2117 849 gene locus_tag LOCUS_11510 2117 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence270 <1 1545 gene locus_tag LOCUS_11520 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435963.1:molecular chaperone HtpG >Feature sequence271 >Feature sequence272 <1 2432 gene locus_tag LOCUS_11530 <1 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392674.1:fibronectin type III domain-containing protein >Feature sequence273 2591 39 gene locus_tag LOCUS_11540 gene ileS 2591 39 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence274 736 38 gene locus_tag LOCUS_11550 gene pgmB 736 38 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_11550 1971 733 gene locus_tag LOCUS_11560 1971 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 <2592 1893 gene locus_tag LOCUS_11570 <2592 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548204.1:glycoside hydrolase family 78 protein note possible pseudo, frameshifted 1992 2001 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence275 1980 559 gene locus_tag LOCUS_11580 1980 559 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_11580 2564 1995 gene locus_tag LOCUS_11590 2564 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence276 <1 655 gene locus_tag LOCUS_11600 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048248.1:NADPH-dependent glutamate synthase 669 1835 gene locus_tag LOCUS_11610 669 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1871 2119 gene locus_tag LOCUS_11620 1871 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence277 498 761 gene locus_tag LOCUS_11630 gene spoIIID 498 761 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_11630 1370 774 gene locus_tag LOCUS_11640 1370 774 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_11640 2455 1376 gene locus_tag LOCUS_11650 2455 1376 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence278 1395 1604 gene locus_tag LOCUS_11660 gene rpmE 1395 1604 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence279 <1 866 gene locus_tag LOCUS_11670 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902958.1:MATE family efflux transporter 2343 967 gene locus_tag LOCUS_11680 gene asnS 2343 967 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence280 1871 318 gene locus_tag LOCUS_11690 1871 318 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_11690 <2527 1945 gene locus_tag LOCUS_11700 <2527 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162496171.1:1-phosphofructokinase family hexose kinase note possible pseudo, frameshifted >Feature sequence281 >Feature sequence282 1107 157 gene locus_tag LOCUS_11710 1107 157 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_11710 1794 1360 gene locus_tag LOCUS_11720 1794 1360 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_11720 <2484 1791 gene locus_tag LOCUS_11730 <2484 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965942.1:aspartate carbamoyltransferase >Feature sequence283 <1 687 gene locus_tag LOCUS_11740 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869374.1:molecular chaperone DnaK note possible pseudo, frameshifted 673 682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 726 1841 gene locus_tag LOCUS_11750 726 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 >Feature sequence284 742 1635 gene locus_tag LOCUS_11760 742 1635 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_11760 1765 2451 gene locus_tag LOCUS_11770 1765 2451 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence285 <2458 1622 gene locus_tag LOCUS_11780 <2458 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051462.1:type II CAAX endopeptidase family protein >Feature sequence286 349 738 gene locus_tag LOCUS_11790 349 738 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986887.1 protein_id gnl|my_center|LOCUS_11790 772 993 gene locus_tag LOCUS_11800 772 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11800 >Feature sequence287 285 1661 gene locus_tag LOCUS_11810 285 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1654 1998 gene locus_tag LOCUS_11820 1654 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence288 582 169 gene locus_tag LOCUS_11830 582 169 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_11830 <2428 649 gene locus_tag LOCUS_11840 <2428 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460393.1:translation initiation factor IF-2 1754 1763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence289 <1 2026 gene locus_tag LOCUS_11850 <1 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020587.1:DUF3656 domain-containing protein >Feature sequence290 1271 2164 gene locus_tag LOCUS_11860 gene gpr 1271 2164 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence291 140 889 gene locus_tag LOCUS_11870 140 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1061 2056 gene locus_tag LOCUS_11880 1061 2056 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence292 1944 91 gene locus_tag LOCUS_11890 1944 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence293 898 2256 gene locus_tag LOCUS_11900 898 2256 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence294 1997 336 gene locus_tag LOCUS_11910 gene gpmI 1997 336 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence295 887 375 gene locus_tag LOCUS_11920 887 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2338 884 gene locus_tag LOCUS_11930 2338 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence296 324 73 gene locus_tag LOCUS_11940 324 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 667 329 gene locus_tag LOCUS_11950 667 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1050 784 gene locus_tag LOCUS_11960 1050 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence297 25 1302 gene locus_tag LOCUS_11970 25 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1295 2155 gene locus_tag LOCUS_11980 1295 2155 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence298 143 1486 gene locus_tag LOCUS_11990 143 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1518 2360 gene locus_tag LOCUS_12000 1518 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence299 196 462 gene locus_tag LOCUS_12010 gene rpsT 196 462 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358111.1 protein_id gnl|my_center|LOCUS_12010 760 2262 gene locus_tag LOCUS_12020 760 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence300 797 1399 gene locus_tag LOCUS_12030 797 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1399 1644 gene locus_tag LOCUS_12040 1399 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1613 2314 gene locus_tag LOCUS_12050 1613 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence301 797 1399 gene locus_tag LOCUS_12060 797 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1399 1644 gene locus_tag LOCUS_12070 1399 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1613 2314 gene locus_tag LOCUS_12080 1613 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence302 332 1480 gene locus_tag LOCUS_12090 332 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 <2355 1573 gene locus_tag LOCUS_12100 <2355 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389613.1:ABC transporter ATP-binding protein >Feature sequence303 1648 563 gene locus_tag LOCUS_12110 1648 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence304 213 572 gene locus_tag LOCUS_12120 213 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence305 502 182 gene locus_tag LOCUS_12130 502 182 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_12130 <2317 850 gene locus_tag LOCUS_12140 <2317 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680769.1:magnesium transporter >Feature sequence306 275 1591 gene locus_tag LOCUS_12150 275 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2225 1689 gene locus_tag LOCUS_12160 2225 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence307 >Feature sequence308 3 479 gene locus_tag LOCUS_12170 3 479 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_12170 479 1657 gene locus_tag LOCUS_12180 479 1657 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_12180 <2278 1711 gene locus_tag LOCUS_12190 <2278 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065092.1:3-oxoacyl-ACP reductase FabG >Feature sequence309 2 610 gene locus_tag LOCUS_12200 2 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 613 1290 gene locus_tag LOCUS_12210 613 1290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_12210 1370 2206 gene locus_tag LOCUS_12220 1370 2206 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence310 146 1351 gene locus_tag LOCUS_12230 gene tuf 146 1351 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence311 >Feature sequence312 385 912 gene locus_tag LOCUS_12240 385 912 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_12240 923 1357 gene locus_tag LOCUS_12250 923 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence313 1471 410 gene locus_tag LOCUS_12260 gene rlmN 1471 410 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_12260 <2255 1543 gene locus_tag LOCUS_12270 <2255 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232068.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence314 1271 507 gene locus_tag LOCUS_12280 1271 507 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_12280 2162 1392 gene locus_tag LOCUS_12290 2162 1392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence315 1528 80 gene locus_tag LOCUS_12300 1528 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1730 2182 gene locus_tag LOCUS_12310 1730 2182 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816073.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence316 237 782 gene locus_tag LOCUS_12320 237 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence317 81 1352 gene locus_tag LOCUS_12330 81 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence318 <2220 1069 gene locus_tag LOCUS_12340 <2220 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723607.1:CTP synthase >Feature sequence319 527 1060 gene locus_tag LOCUS_12350 527 1060 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_12350 1062 2081 gene locus_tag LOCUS_12360 1062 2081 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050828.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence320 <2213 676 gene locus_tag LOCUS_12370 <2213 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459229.1:BREX system P-loop protein BrxC >Feature sequence321 <1 1370 gene locus_tag LOCUS_12380 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921991.1:chromosome segregation protein SMC >Feature sequence322 1206 772 gene locus_tag LOCUS_12390 gene rpsG 1206 772 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_12390 1903 1484 gene locus_tag LOCUS_12400 gene rpsL 1903 1484 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence323 2129 1122 gene locus_tag LOCUS_12410 gene mraY 2129 1122 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence324 190 624 gene locus_tag LOCUS_12420 190 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 621 1097 gene locus_tag LOCUS_12430 gene spoIIAB 621 1097 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_12430 1147 1953 gene locus_tag LOCUS_12440 gene sigF 1147 1953 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence325 1815 145 gene locus_tag LOCUS_12450 1815 145 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence326 1039 1048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence327 289 1239 gene locus_tag LOCUS_12460 289 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1363 1848 gene locus_tag LOCUS_12470 1363 1848 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence328 132 1625 gene locus_tag LOCUS_12480 132 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence329 >Feature sequence330 1321 455 gene locus_tag LOCUS_12490 1321 455 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence331 1491 1500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence332 82 155 gene locus_tag LOCUS_t00120 82 155 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <2114 279 gene locus_tag LOCUS_12500 <2114 279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102176.1:alpha-L-rhamnosidase >Feature sequence333 239 850 gene locus_tag LOCUS_12510 239 850 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence334 29 670 gene locus_tag LOCUS_12520 29 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 667 2010 gene locus_tag LOCUS_12530 gene trmFO 667 2010 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645028.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence335 >Feature sequence336 255 713 gene locus_tag LOCUS_12540 255 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 726 1622 gene locus_tag LOCUS_12550 726 1622 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence337 84 1799 gene locus_tag LOCUS_12560 84 1799 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence338 567 1991 gene locus_tag LOCUS_12570 gene proS 567 1991 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence339 297 1307 gene locus_tag LOCUS_12580 297 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 <2024 1359 gene locus_tag LOCUS_12590 <2024 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369100.1:N-acetylmuramic acid 6-phosphate etherase >Feature sequence340 633 187 gene locus_tag LOCUS_12600 gene nifU 633 187 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_12600 1897 674 gene locus_tag LOCUS_12610 gene nifS 1897 674 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence341 <1 747 gene locus_tag LOCUS_12620 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723950.1:choloylglycine hydrolase <2015 898 gene locus_tag LOCUS_12630 <2015 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404857.1:stage 0 sporulation family protein >Feature sequence342 354 91 gene locus_tag LOCUS_12640 354 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1989 535 gene locus_tag LOCUS_12650 1989 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence343 71 907 gene locus_tag LOCUS_12660 71 907 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_12660 922 1914 gene locus_tag LOCUS_12670 922 1914 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence344 1806 304 gene locus_tag LOCUS_12680 1806 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 655 664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence345 338 1225 gene locus_tag LOCUS_12690 338 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1222 1800 gene locus_tag LOCUS_12700 1222 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence346 <1 1835 gene locus_tag LOCUS_12710 <1 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812354.1:glutamine synthetase III >Feature sequence347 194 886 gene locus_tag LOCUS_12720 194 886 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_12720 1579 989 gene locus_tag LOCUS_12730 gene thiT 1579 989 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence348 <1976 1037 gene locus_tag LOCUS_12740 <1976 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082981.1:L-arabinose isomerase >Feature sequence349 >Feature sequence350 154 80 gene locus_tag LOCUS_t00130 154 80 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1126 329 gene locus_tag LOCUS_12750 1126 329 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721880.1 protein_id gnl|my_center|LOCUS_12750 1698 1144 gene locus_tag LOCUS_12760 1698 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence351 1827 130 gene locus_tag LOCUS_12770 1827 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence352 1176 67 gene locus_tag LOCUS_12780 1176 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1448 1173 gene locus_tag LOCUS_12790 1448 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence353 1192 536 gene locus_tag LOCUS_12800 gene pgsA 1192 536 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 protein_id gnl|my_center|LOCUS_12800 <1949 1208 gene locus_tag LOCUS_12810 <1949 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943823.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence354 310 1305 gene locus_tag LOCUS_12820 gene dpsA 310 1305 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_12820 1302 1868 gene locus_tag LOCUS_12830 1302 1868 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence355 1613 894 gene locus_tag LOCUS_12840 1613 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence356 1881 7 gene locus_tag LOCUS_12850 1881 7 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992484.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence357 104 496 gene locus_tag LOCUS_12860 104 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1755 574 gene locus_tag LOCUS_12870 1755 574 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence358 1217 843 gene locus_tag LOCUS_12880 1217 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1648 1409 gene locus_tag LOCUS_12890 1648 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence359 >Feature sequence360 1581 316 gene locus_tag LOCUS_12900 1581 316 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280808.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence361 >Feature sequence362 288 1553 gene locus_tag LOCUS_12910 288 1553 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205037.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence363 1670 579 gene locus_tag LOCUS_12920 1670 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence364 <1 678 gene locus_tag LOCUS_12930 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030308.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 1149 817 gene locus_tag LOCUS_12940 1149 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1489 1573 gene locus_tag LOCUS_t00140 1489 1573 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1609 1695 gene locus_tag LOCUS_t00150 1609 1695 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence365 1740 1138 gene locus_tag LOCUS_12950 1740 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence366 981 262 gene locus_tag LOCUS_12960 981 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1807 1235 gene locus_tag LOCUS_12970 1807 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence367 355 29 gene locus_tag LOCUS_12980 355 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 566 348 gene locus_tag LOCUS_12990 566 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 777 628 gene locus_tag LOCUS_13000 777 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1249 770 gene locus_tag LOCUS_13010 1249 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1563 1249 gene locus_tag LOCUS_13020 1563 1249 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047617.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence368 >Feature sequence369 <1856 182 gene locus_tag LOCUS_13030 <1856 182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110443.1:glycogen synthase GlgA >Feature sequence370 <1856 78 gene locus_tag LOCUS_13040 <1856 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965946.1:glutamine synthetase III >Feature sequence371 375 500 gene locus_tag LOCUS_13050 375 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1350 595 gene locus_tag LOCUS_13060 1350 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1820 1449 gene locus_tag LOCUS_13070 1820 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence372 1729 836 gene locus_tag LOCUS_13080 1729 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence373 >Feature sequence374 34 672 gene locus_tag LOCUS_13090 34 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 669 1775 gene locus_tag LOCUS_13100 669 1775 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence375 >Feature sequence376 173 1798 gene locus_tag LOCUS_13110 173 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence377 125 745 gene locus_tag LOCUS_13120 125 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence378 1087 113 gene locus_tag LOCUS_13130 1087 113 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_13130 1259 1113 gene locus_tag LOCUS_13140 1259 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence379 1748 975 gene locus_tag LOCUS_13150 1748 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence380 >Feature sequence381 <1 1140 gene locus_tag LOCUS_13160 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257126.1:DNA gyrase subunit A 1163 1297 gene locus_tag LOCUS_13170 1163 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence382 >Feature sequence383 379 591 gene locus_tag LOCUS_13180 379 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 632 853 gene locus_tag LOCUS_13190 632 853 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence384 347 1405 gene locus_tag LOCUS_13200 347 1405 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_13200 1764 1522 gene locus_tag LOCUS_13210 1764 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence385 1443 226 gene locus_tag LOCUS_13220 1443 226 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence386 <1 1166 gene locus_tag LOCUS_13230 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986938.1:V-type ATP synthase subunit I >Feature sequence387 >Feature sequence388 1726 1391 gene locus_tag LOCUS_13240 1726 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence389 <1725 975 gene locus_tag LOCUS_13250 <1725 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_087915427.1:sugar phosphate isomerase/epimerase >Feature sequence390 1008 100 gene locus_tag LOCUS_13260 gene ylqF 1008 100 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460442.1 protein_id gnl|my_center|LOCUS_13260 <1719 1021 gene locus_tag LOCUS_13270 <1719 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047862.1:signal peptidase I >Feature sequence391 <1709 924 gene locus_tag LOCUS_13280 <1709 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986397.1:SpoIIE family protein phosphatase >Feature sequence392 1674 46 gene locus_tag LOCUS_13290 1674 46 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence393 1482 259 gene locus_tag LOCUS_13300 gene glnA 1482 259 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence394 >Feature sequence395 <1660 694 gene locus_tag LOCUS_13310 <1660 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667252.1:aminopeptidase >Feature sequence396 1612 779 gene locus_tag LOCUS_13320 1612 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence397 1550 762 gene locus_tag LOCUS_13330 1550 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence398 1183 197 gene locus_tag LOCUS_13340 gene prmA 1183 197 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence399 1087 374 gene locus_tag LOCUS_13350 1087 374 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_13350 <1653 1122 gene locus_tag LOCUS_13360 <1653 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000879029.1:amidophosphoribosyltransferase >Feature sequence400 >Feature sequence401 1037 300 gene locus_tag LOCUS_13370 1037 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1650 1039 gene locus_tag LOCUS_13380 1650 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence402 >Feature sequence403 >Feature sequence404 1549 509 gene locus_tag LOCUS_13390 1549 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1411 1420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence405 654 172 gene locus_tag LOCUS_13400 gene ruvX 654 172 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171591.1 protein_id gnl|my_center|LOCUS_13400 1062 697 gene locus_tag LOCUS_13410 1062 697 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_13410 <1632 1068 gene locus_tag LOCUS_13420 <1632 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081264.1:penicillin-binding transpeptidase domain-containing protein >Feature sequence406 >Feature sequence407 <1618 465 gene locus_tag LOCUS_13430 <1618 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000520822.1:transglutaminase domain-containing protein >Feature sequence408 91 750 gene locus_tag LOCUS_13440 91 750 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence409 >Feature sequence410 <1 1293 gene locus_tag LOCUS_13450 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868079.1:aspartate--tRNA(Asn) ligase >Feature sequence411 <1587 256 gene locus_tag LOCUS_13460 <1587 256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393940.1:elongation factor G >Feature sequence412 44 709 gene locus_tag LOCUS_13470 44 709 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence413 389 1294 gene locus_tag LOCUS_13480 389 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence414 >Feature sequence415 <1 1444 gene locus_tag LOCUS_13490 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861199.1:glycerophosphodiester phosphodiesterase >Feature sequence416 1305 223 gene locus_tag LOCUS_13500 1305 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence417 <1 1491 gene locus_tag LOCUS_13510 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262192.1:Na+/H+ antiporter NhaC family protein >Feature sequence418 56 1303 gene locus_tag LOCUS_13520 gene rhaA 56 1303 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence419 <1 1017 gene locus_tag LOCUS_13530 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433873.1:AI-2E family transporter >Feature sequence420 861 292 gene locus_tag LOCUS_13540 861 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1324 878 gene locus_tag LOCUS_13550 gene rnhA 1324 878 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence421 >Feature sequence422 698 823 gene locus_tag LOCUS_13560 698 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 836 1102 gene locus_tag LOCUS_13570 836 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 1211 1390 gene locus_tag LOCUS_13580 1211 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence423 >Feature sequence424 >Feature sequence425 <1 929 gene locus_tag LOCUS_13590 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948929.1:Trk system potassium transporter TrkA >Feature sequence426 >Feature sequence427 <1490 625 gene locus_tag LOCUS_13600 <1490 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018307263.1:cation diffusion facilitator family transporter >Feature sequence428 77 1360 gene locus_tag LOCUS_13610 77 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence429 1444 269 gene locus_tag LOCUS_13620 1444 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence430 >Feature sequence431 57 371 gene locus_tag LOCUS_13630 gene yajC 57 371 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_13630 482 997 gene locus_tag LOCUS_13640 482 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 551 560 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1031 1234 gene locus_tag LOCUS_13650 1031 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence432 215 140 gene locus_tag LOCUS_t00160 215 140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 947 366 gene locus_tag LOCUS_13660 947 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence433 1420 443 gene locus_tag LOCUS_13670 1420 443 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence434 371 380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence435 >Feature sequence436 1289 531 gene locus_tag LOCUS_13680 1289 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence437 >Feature sequence438 176 598 gene locus_tag LOCUS_13690 176 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence439 >Feature sequence440 >Feature sequence441 >Feature sequence442 1358 27 gene locus_tag LOCUS_13700 1358 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence443 <1354 186 gene locus_tag LOCUS_13710 <1354 186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262036.1:oleate hydratase >Feature sequence444 <1 1292 gene locus_tag LOCUS_13720 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459887.1:ATP-dependent DNA helicase >Feature sequence445 >Feature sequence446 896 18 gene locus_tag LOCUS_13730 gene pdaA 896 18 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence447 <1 1150 gene locus_tag LOCUS_13740 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009887791.1:elongation factor G >Feature sequence448 <1 1145 gene locus_tag LOCUS_13750 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869095.1:electron transport complex subunit RsxC >Feature sequence449 61 1233 gene locus_tag LOCUS_13760 61 1233 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence450 1169 510 gene locus_tag LOCUS_13770 1169 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence451 >Feature sequence452 1213 38 gene locus_tag LOCUS_13780 1213 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence453 1160 90 gene locus_tag LOCUS_13790 gene gap 1160 90 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence454 >Feature sequence455 208 1056 gene locus_tag LOCUS_13800 208 1056 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence456 <1 536 gene locus_tag LOCUS_13810 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393027.1:sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein >Feature sequence457 <1252 246 gene locus_tag LOCUS_13820 <1252 246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965053.1:phosphate acyltransferase PlsX >Feature sequence458 139 1155 gene locus_tag LOCUS_13830 139 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence459 1054 383 gene locus_tag LOCUS_13840 1054 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence460 <1217 46 gene locus_tag LOCUS_13850 <1217 46 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246696.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence461 >Feature sequence462 >Feature sequence463 >Feature sequence464 >Feature sequence465 >Feature sequence466 <1169 96 gene locus_tag LOCUS_13860 <1169 96 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000714091.1:peptide ABC transporter substrate-binding protein >Feature sequence467 <1161 17 gene locus_tag LOCUS_13870 <1161 17 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033047490.1:V-type ATP synthase subunit A >Feature sequence468 >Feature sequence469 >Feature sequence470 >Feature sequence471 >Feature sequence472 >Feature sequence473 >Feature sequence474 >Feature sequence475 >Feature sequence476 >Feature sequence477 <1074 253 gene locus_tag LOCUS_13880 <1074 253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391651.1:SpoIIE family protein phosphatase >Feature sequence478 978 277 gene locus_tag LOCUS_13890 978 277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence479 >Feature sequence480 >Feature sequence481 115 768 gene locus_tag LOCUS_13900 115 768 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence482 947 216 gene locus_tag LOCUS_13910 947 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence483 >Feature sequence484 888 478 gene locus_tag LOCUS_13920 gene ytfJ 888 478 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence485