>Feature sequence001 257 3817 gene locus_tag LOCUS_00010 gene nifJ 257 3817 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_00010 3936 3778 gene locus_tag LOCUS_00020 3936 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5514 4327 gene locus_tag LOCUS_00030 5514 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5691 6215 gene locus_tag LOCUS_00040 5691 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6335 6826 gene locus_tag LOCUS_00050 6335 6826 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_00050 7093 9330 gene locus_tag LOCUS_00060 gene pflB 7093 9330 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_00060 9330 10085 gene locus_tag LOCUS_00070 gene pflA 9330 10085 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_00070 10434 12287 gene locus_tag LOCUS_00080 10434 12287 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_00080 12420 12638 gene locus_tag LOCUS_00090 12420 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13362 12859 gene locus_tag LOCUS_00100 13362 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14560 13556 gene locus_tag LOCUS_00110 14560 13556 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 14695 14704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16519 14756 gene locus_tag LOCUS_00120 16519 14756 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_00120 17374 16535 gene locus_tag LOCUS_00130 17374 16535 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_00130 18455 17376 gene locus_tag LOCUS_00140 18455 17376 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_00140 19369 18455 gene locus_tag LOCUS_00150 19369 18455 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_00150 20937 19393 gene locus_tag LOCUS_00160 20937 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21785 20961 gene locus_tag LOCUS_00170 21785 20961 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_00170 >Feature sequence002 1137 127 gene locus_tag LOCUS_00180 1137 127 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_00180 1688 1248 gene locus_tag LOCUS_00190 gene dut 1688 1248 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951049.1 protein_id gnl|my_center|LOCUS_00190 3921 1858 gene locus_tag LOCUS_00200 3921 1858 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_00200 4562 3918 gene locus_tag LOCUS_00210 4562 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 4876 6750 gene locus_tag LOCUS_00220 4876 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 8599 6857 gene locus_tag LOCUS_00230 8599 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 8867 11680 gene locus_tag LOCUS_00240 8867 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 12514 11759 gene locus_tag LOCUS_00250 12514 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 15163 12584 gene locus_tag LOCUS_00260 gene gyrA 15163 12584 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_00260 15309 15318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16023 15592 gene locus_tag LOCUS_00270 16023 15592 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_00270 18152 16065 gene locus_tag LOCUS_00280 gene gyrB 18152 16065 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_00280 19296 18565 gene locus_tag LOCUS_00290 19296 18565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 19595 19323 gene locus_tag LOCUS_00300 19595 19323 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_00300 19789 19595 gene locus_tag LOCUS_00310 19789 19595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 >Feature sequence003 <1 655 gene locus_tag LOCUS_00320 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459775.1:M23 family metallopeptidase 982 2376 gene locus_tag LOCUS_00330 982 2376 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_00330 2416 3573 gene locus_tag LOCUS_00340 2416 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 4319 3804 gene locus_tag LOCUS_00350 4319 3804 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582462.1 protein_id gnl|my_center|LOCUS_00350 4831 5142 gene locus_tag LOCUS_00360 gene rpsJ 4831 5142 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_00360 5216 5848 gene locus_tag LOCUS_00370 gene rplC 5216 5848 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_00370 5865 6488 gene locus_tag LOCUS_00380 gene rplD 5865 6488 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_00380 6485 6778 gene locus_tag LOCUS_00390 gene rplW 6485 6778 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_00390 6881 7714 gene locus_tag LOCUS_00400 gene rplB 6881 7714 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_00400 7734 8006 gene locus_tag LOCUS_00410 gene rpsS 7734 8006 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_00410 8027 8368 gene locus_tag LOCUS_00420 gene rplV 8027 8368 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_00420 8383 9054 gene locus_tag LOCUS_00430 gene rpsC 8383 9054 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_00430 9054 9473 gene locus_tag LOCUS_00440 gene rplP 9054 9473 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_00440 9473 9676 gene locus_tag LOCUS_00450 gene rpmC 9473 9676 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_00450 9694 9951 gene locus_tag LOCUS_00460 gene rpsQ 9694 9951 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_00460 9991 10359 gene locus_tag LOCUS_00470 gene rplN 9991 10359 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_00470 10374 10691 gene locus_tag LOCUS_00480 gene rplX 10374 10691 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_00480 10706 11245 gene locus_tag LOCUS_00490 gene rplE 10706 11245 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_00490 11258 11443 gene locus_tag LOCUS_00500 11258 11443 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_00500 11463 11861 gene locus_tag LOCUS_00510 gene rpsH 11463 11861 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_00510 11877 12419 gene locus_tag LOCUS_00520 gene rplF 11877 12419 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_00520 12438 12797 gene locus_tag LOCUS_00530 gene rplR 12438 12797 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_00530 12815 13312 gene locus_tag LOCUS_00540 gene rpsE 12815 13312 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_00540 13330 13500 gene locus_tag LOCUS_00550 gene rpmD 13330 13500 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_00550 13519 13962 gene locus_tag LOCUS_00560 gene rplO 13519 13962 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_00560 13963 15273 gene locus_tag LOCUS_00570 gene secY 13963 15273 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_00570 15297 15929 gene locus_tag LOCUS_00580 15297 15929 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_00580 15933 16685 gene locus_tag LOCUS_00590 gene map 15933 16685 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_00590 16696 16941 gene locus_tag LOCUS_00600 16696 16941 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 protein_id gnl|my_center|LOCUS_00600 16946 17164 gene locus_tag LOCUS_00610 gene infA 16946 17164 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421127.1 protein_id gnl|my_center|LOCUS_00610 17374 17742 gene locus_tag LOCUS_00620 gene rpsM 17374 17742 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_00620 17758 18159 gene locus_tag LOCUS_00630 gene rpsK 17758 18159 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence004 432 235 gene locus_tag LOCUS_00640 432 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 560 1195 gene locus_tag LOCUS_00650 560 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 1382 1188 gene locus_tag LOCUS_00660 1382 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00660 1720 1331 gene locus_tag LOCUS_00670 1720 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00670 2590 1841 gene locus_tag LOCUS_00680 2590 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2621 2630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3662 2871 gene locus_tag LOCUS_00690 3662 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4694 3696 gene locus_tag LOCUS_00700 4694 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 5360 4977 gene locus_tag LOCUS_00710 5360 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5580 5380 gene locus_tag LOCUS_00720 5580 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 7438 5750 gene locus_tag LOCUS_00730 7438 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 8337 7438 gene locus_tag LOCUS_00740 gene cysD 8337 7438 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_00740 8693 8379 gene locus_tag LOCUS_00750 8693 8379 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_00750 10359 8677 gene locus_tag LOCUS_00760 10359 8677 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_00760 11291 10380 gene locus_tag LOCUS_00770 gene trxB 11291 10380 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 protein_id gnl|my_center|LOCUS_00770 11714 11304 gene locus_tag LOCUS_00780 11714 11304 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_00780 12523 11711 gene locus_tag LOCUS_00790 gene moeB 12523 11711 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_00790 12729 12523 gene locus_tag LOCUS_00800 gene thiS 12729 12523 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_00800 13058 12735 gene locus_tag LOCUS_00810 gene trxA 13058 12735 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_00810 13304 13059 gene locus_tag LOCUS_00820 13304 13059 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_00820 14157 13297 gene locus_tag LOCUS_00830 14157 13297 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_00830 14459 14163 gene locus_tag LOCUS_00840 14459 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00840 15429 14413 gene locus_tag LOCUS_00850 15429 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 14487 14496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15722 16174 gene locus_tag LOCUS_00860 15722 16174 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_00860 17499 16237 gene locus_tag LOCUS_00870 gene hemL 17499 16237 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_00870 <18478 17512 gene locus_tag LOCUS_00880 <18478 17512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948609.1:porphobilinogen synthase >Feature sequence005 637 3096 gene locus_tag LOCUS_00890 637 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3136 4497 gene locus_tag LOCUS_00900 gene pepV 3136 4497 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_00900 4540 5328 gene locus_tag LOCUS_00910 4540 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 5322 6401 gene locus_tag LOCUS_00920 5322 6401 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 protein_id gnl|my_center|LOCUS_00920 6452 7327 gene locus_tag LOCUS_00930 6452 7327 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379609.1 protein_id gnl|my_center|LOCUS_00930 7337 8062 gene locus_tag LOCUS_00940 7337 8062 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861305.1 protein_id gnl|my_center|LOCUS_00940 8326 8988 gene locus_tag LOCUS_00950 8326 8988 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_00950 9248 9820 gene locus_tag LOCUS_00960 9248 9820 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_00960 11540 10113 gene locus_tag LOCUS_00970 gene glgA 11540 10113 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_00970 12681 11569 gene locus_tag LOCUS_00980 gene glgD 12681 11569 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_00980 13180 12671 gene locus_tag LOCUS_00990 13180 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00990 13869 13081 gene locus_tag LOCUS_01000 13869 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 13218 13227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15864 13942 gene locus_tag LOCUS_01010 gene glgB 15864 13942 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_01010 17158 16127 gene locus_tag LOCUS_01020 gene gap 17158 16127 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence006 1148 375 gene locus_tag LOCUS_01030 1148 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 2574 1138 gene locus_tag LOCUS_01040 2574 1138 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_01040 3245 2592 gene locus_tag LOCUS_01050 3245 2592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_01050 3475 4374 gene locus_tag LOCUS_01060 3475 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4636 5961 gene locus_tag LOCUS_01070 4636 5961 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_01070 6004 7155 gene locus_tag LOCUS_01080 6004 7155 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_01080 7244 8047 gene locus_tag LOCUS_01090 7244 8047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_01090 8044 8886 gene locus_tag LOCUS_01100 8044 8886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964708.1 protein_id gnl|my_center|LOCUS_01100 8887 9723 gene locus_tag LOCUS_01110 8887 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 9776 10912 gene locus_tag LOCUS_01120 9776 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 10990 12357 gene locus_tag LOCUS_01130 gene hydA 10990 12357 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_01130 12539 13891 gene locus_tag LOCUS_01140 gene preA 12539 13891 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_01140 13941 15200 gene locus_tag LOCUS_01150 13941 15200 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_01150 15226 15852 gene locus_tag LOCUS_01160 15226 15852 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_01160 15880 17028 gene locus_tag LOCUS_01170 15880 17028 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 protein_id gnl|my_center|LOCUS_01170 17316 17232 gene locus_tag LOCUS_t00010 17316 17232 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 <1 754 gene locus_tag LOCUS_01180 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434033.1:thioredoxin-disulfide reductase 821 1744 gene locus_tag LOCUS_01190 821 1744 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_01190 1741 2391 gene locus_tag LOCUS_01200 1741 2391 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_01200 2473 3900 gene locus_tag LOCUS_01210 2473 3900 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_01210 3957 4553 gene locus_tag LOCUS_01220 3957 4553 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_01220 4726 6384 gene locus_tag LOCUS_01230 gene ilvD 4726 6384 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_01230 6703 8775 gene locus_tag LOCUS_01240 gene fusA 6703 8775 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01240 8908 9804 gene locus_tag LOCUS_01250 8908 9804 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727465.1 protein_id gnl|my_center|LOCUS_01250 9828 11000 gene locus_tag LOCUS_01260 9828 11000 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_01260 12919 11171 gene locus_tag LOCUS_01270 12919 11171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_01270 14655 12916 gene locus_tag LOCUS_01280 14655 12916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_01280 16361 14850 gene locus_tag LOCUS_01290 gene gpmI 16361 14850 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_01290 <17183 16488 gene locus_tag LOCUS_01300 <17183 16488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948028.1:triose-phosphate isomerase >Feature sequence008 71 1600 gene locus_tag LOCUS_01310 71 1600 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_01310 1721 1915 gene locus_tag LOCUS_01320 1721 1915 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_01320 1915 2580 gene locus_tag LOCUS_01330 1915 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 2577 3335 gene locus_tag LOCUS_01340 2577 3335 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_01340 3454 4122 gene locus_tag LOCUS_01350 gene trmB 3454 4122 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_01350 4155 5492 gene locus_tag LOCUS_01360 4155 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 5515 6222 gene locus_tag LOCUS_01370 5515 6222 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142165.1 protein_id gnl|my_center|LOCUS_01370 6280 7755 gene locus_tag LOCUS_01380 6280 7755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_01380 7797 8780 gene locus_tag LOCUS_01390 7797 8780 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_01390 8780 9622 gene locus_tag LOCUS_01400 gene prmC 8780 9622 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_01400 9781 10902 gene locus_tag LOCUS_01410 gene recA 9781 10902 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_01410 10902 11366 gene locus_tag LOCUS_01420 10902 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 11293 11520 gene locus_tag LOCUS_01430 11293 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11341 11350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11523 12863 gene locus_tag LOCUS_01440 gene rimO 11523 12863 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_01440 12917 13501 gene locus_tag LOCUS_01450 gene pgsA 12917 13501 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_01450 13539 14192 gene locus_tag LOCUS_01460 gene cysE 13539 14192 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_01460 14196 15602 gene locus_tag LOCUS_01470 14196 15602 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_01470 15697 16482 gene locus_tag LOCUS_01480 gene pdaB 15697 16482 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence009 <1 645 gene locus_tag LOCUS_01490 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947982.1:peptide chain release factor 1 659 1693 gene locus_tag LOCUS_01500 659 1693 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_01500 1680 2291 gene locus_tag LOCUS_01510 gene coaE 1680 2291 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_01510 2296 2916 gene locus_tag LOCUS_01520 2296 2916 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 protein_id gnl|my_center|LOCUS_01520 2962 4101 gene locus_tag LOCUS_01530 2962 4101 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01530 3002 3011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4156 4284 gene locus_tag LOCUS_01540 4156 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01540 4368 4444 gene locus_tag LOCUS_t00020 4368 4444 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4727 5938 gene locus_tag LOCUS_01550 4727 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7198 6056 gene locus_tag LOCUS_01560 7198 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 7434 7252 gene locus_tag LOCUS_01570 7434 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 7255 7264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8122 7391 gene locus_tag LOCUS_01580 8122 7391 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_01580 8356 8859 gene locus_tag LOCUS_01590 8356 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10061 9114 gene locus_tag LOCUS_01600 10061 9114 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_01600 10174 10884 gene locus_tag LOCUS_01610 10174 10884 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_01610 11088 14855 gene locus_tag LOCUS_01620 11088 14855 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_01620 <16204 15208 gene locus_tag LOCUS_01630 <16204 15208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948775.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence010 918 166 gene locus_tag LOCUS_01640 918 166 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719095.1 protein_id gnl|my_center|LOCUS_01640 2052 1060 gene locus_tag LOCUS_01650 gene ydjG 2052 1060 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723719.1 protein_id gnl|my_center|LOCUS_01650 3115 2144 gene locus_tag LOCUS_01660 3115 2144 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 protein_id gnl|my_center|LOCUS_01660 3956 3117 gene locus_tag LOCUS_01670 3956 3117 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 protein_id gnl|my_center|LOCUS_01670 5056 4001 gene locus_tag LOCUS_01680 5056 4001 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_01680 6702 5314 gene locus_tag LOCUS_01690 6702 5314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435315.1 protein_id gnl|my_center|LOCUS_01690 7446 6745 gene locus_tag LOCUS_01700 gene alsE 7446 6745 CDS product D-allulose 6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185669695.1 protein_id gnl|my_center|LOCUS_01700 8580 7480 gene locus_tag LOCUS_01710 8580 7480 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 protein_id gnl|my_center|LOCUS_01710 11931 9238 gene locus_tag LOCUS_01720 11931 9238 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01720 12155 12517 gene locus_tag LOCUS_01730 12155 12517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 12979 12641 gene locus_tag LOCUS_01740 12979 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 13094 13270 gene locus_tag LOCUS_01750 13094 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 13921 13367 gene locus_tag LOCUS_01760 13921 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 14150 15685 gene locus_tag LOCUS_01770 14150 15685 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence011 155 625 gene locus_tag LOCUS_01780 155 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 603 1874 gene locus_tag LOCUS_01790 603 1874 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_01790 1871 3025 gene locus_tag LOCUS_01800 1871 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3015 4010 gene locus_tag LOCUS_01810 3015 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4024 4359 gene locus_tag LOCUS_01820 4024 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4378 5385 gene locus_tag LOCUS_01830 4378 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5398 5751 gene locus_tag LOCUS_01840 5398 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 5751 6107 gene locus_tag LOCUS_01850 5751 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6094 6525 gene locus_tag LOCUS_01860 6094 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 6526 6669 gene locus_tag LOCUS_01870 6526 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 6562 6571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6666 6854 gene locus_tag LOCUS_01880 6666 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6851 7000 gene locus_tag LOCUS_01890 6851 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 6997 7512 gene locus_tag LOCUS_01900 6997 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 7506 8462 gene locus_tag LOCUS_01910 7506 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8437 8766 gene locus_tag LOCUS_01920 8437 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 8768 9097 gene locus_tag LOCUS_01930 8768 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9084 10142 gene locus_tag LOCUS_01940 9084 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 10142 10633 gene locus_tag LOCUS_01950 10142 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10505 10514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12331 10880 gene locus_tag LOCUS_01960 12331 10880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_01960 15216 12589 gene locus_tag LOCUS_01970 gene ppdK 15216 12589 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_01970 >Feature sequence012 591 1841 gene locus_tag LOCUS_01980 591 1841 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_01980 1857 2243 gene locus_tag LOCUS_01990 1857 2243 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_01990 2759 2316 gene locus_tag LOCUS_02000 2759 2316 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_02000 4456 2795 gene locus_tag LOCUS_02010 4456 2795 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_02010 5768 4542 gene locus_tag LOCUS_02020 gene fabF 5768 4542 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_02020 5972 6883 gene locus_tag LOCUS_02030 5972 6883 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267910.1 protein_id gnl|my_center|LOCUS_02030 7050 8261 gene locus_tag LOCUS_02040 7050 8261 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_02040 8430 9173 gene locus_tag LOCUS_02050 8430 9173 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_02050 9095 9104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9146 10429 gene locus_tag LOCUS_02060 9146 10429 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_02060 11888 10638 gene locus_tag LOCUS_02070 11888 10638 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 protein_id gnl|my_center|LOCUS_02070 13517 12066 gene locus_tag LOCUS_02080 13517 12066 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence013 324 1547 gene locus_tag LOCUS_02090 324 1547 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_02090 2006 3382 gene locus_tag LOCUS_02100 gene argH 2006 3382 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_02100 3731 4768 gene locus_tag LOCUS_02110 gene argC 3731 4768 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861435.1 protein_id gnl|my_center|LOCUS_02110 4781 6007 gene locus_tag LOCUS_02120 gene argJ 4781 6007 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_02120 6060 6911 gene locus_tag LOCUS_02130 gene argB 6060 6911 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_02130 6927 7460 gene locus_tag LOCUS_02140 6927 7460 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_02140 7802 8224 gene locus_tag LOCUS_02150 7802 8224 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_02150 8240 9412 gene locus_tag LOCUS_02160 8240 9412 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_02160 9412 10341 gene locus_tag LOCUS_02170 gene argF 9412 10341 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_02170 10546 11250 gene locus_tag LOCUS_02180 10546 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 12080 11319 gene locus_tag LOCUS_02190 12080 11319 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_02190 12827 12081 gene locus_tag LOCUS_02200 12827 12081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_02200 13555 12827 gene locus_tag LOCUS_02210 13555 12827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_02210 >Feature sequence014 304 228 gene locus_tag LOCUS_t00030 304 228 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1538 459 gene locus_tag LOCUS_02220 1538 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4374 1741 gene locus_tag LOCUS_02230 gene alaS 4374 1741 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_02230 5997 4768 gene locus_tag LOCUS_02240 5997 4768 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_02240 7315 5987 gene locus_tag LOCUS_02250 7315 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7337 7346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8031 7429 gene locus_tag LOCUS_02260 8031 7429 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_02260 8561 8022 gene locus_tag LOCUS_02270 8561 8022 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_02270 9363 8575 gene locus_tag LOCUS_02280 9363 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10250 9360 gene locus_tag LOCUS_02290 10250 9360 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_02290 10911 10237 gene locus_tag LOCUS_02300 10911 10237 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_02300 11670 10921 gene locus_tag LOCUS_02310 gene thyX 11670 10921 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099542.1 protein_id gnl|my_center|LOCUS_02310 11679 11688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <13477 11862 gene locus_tag LOCUS_02320 <13477 11862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126140198.1:pectinesterase family protein >Feature sequence015 168 3029 gene locus_tag LOCUS_02330 168 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3097 6276 gene locus_tag LOCUS_02340 3097 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7048 6416 gene locus_tag LOCUS_02350 7048 6416 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_02350 8285 7077 gene locus_tag LOCUS_02360 8285 7077 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_02360 10218 8287 gene locus_tag LOCUS_02370 10218 8287 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_02370 10524 12344 gene locus_tag LOCUS_02380 gene typA 10524 12344 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence016 225 974 gene locus_tag LOCUS_02390 225 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1037 1996 gene locus_tag LOCUS_02400 1037 1996 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_02400 2115 3395 gene locus_tag LOCUS_02410 2115 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3441 4034 gene locus_tag LOCUS_02420 gene pth 3441 4034 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_02420 4049 7507 gene locus_tag LOCUS_02430 gene mfd 4049 7507 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_02430 7557 7566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7710 8906 gene locus_tag LOCUS_02440 7710 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 8964 9833 gene locus_tag LOCUS_02450 8964 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 10275 9883 gene locus_tag LOCUS_02460 10275 9883 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_02460 10540 10316 gene locus_tag LOCUS_02470 10540 10316 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 protein_id gnl|my_center|LOCUS_02470 10711 12432 gene locus_tag LOCUS_02480 10711 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence017 29 769 gene locus_tag LOCUS_02490 gene minD 29 769 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_02490 842 1237 gene locus_tag LOCUS_02500 gene mgsA 842 1237 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_02500 1354 2646 gene locus_tag LOCUS_02510 gene hisS 1354 2646 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_02510 2715 4493 gene locus_tag LOCUS_02520 gene aspS 2715 4493 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_02520 4510 5295 gene locus_tag LOCUS_02530 4510 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5513 6754 gene locus_tag LOCUS_02540 5513 6754 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_02540 6832 7956 gene locus_tag LOCUS_02550 6832 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_02550 7953 8771 gene locus_tag LOCUS_02560 7953 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8897 9910 gene locus_tag LOCUS_02570 gene hydE 8897 9910 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433972.1 protein_id gnl|my_center|LOCUS_02570 9927 11354 gene locus_tag LOCUS_02580 gene hydG 9927 11354 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence018 1873 227 gene locus_tag LOCUS_02590 1873 227 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680894.1 protein_id gnl|my_center|LOCUS_02590 2334 3401 gene locus_tag LOCUS_02600 2334 3401 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_02600 3414 4766 gene locus_tag LOCUS_02610 gene murF 3414 4766 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 protein_id gnl|my_center|LOCUS_02610 5135 6595 gene locus_tag LOCUS_02620 gene trpE 5135 6595 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_02620 6592 7164 gene locus_tag LOCUS_02630 gene pabA 6592 7164 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243797.1 protein_id gnl|my_center|LOCUS_02630 7186 8196 gene locus_tag LOCUS_02640 gene trpD 7186 8196 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_02640 8207 8989 gene locus_tag LOCUS_02650 gene trpC 8207 8989 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_02650 9106 10290 gene locus_tag LOCUS_02660 gene trpB 9106 10290 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_02660 10283 11053 gene locus_tag LOCUS_02670 gene trpA 10283 11053 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_02670 11050 11775 gene locus_tag LOCUS_02680 11050 11775 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence019 27 554 gene locus_tag LOCUS_02690 27 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 560 1081 gene locus_tag LOCUS_02700 560 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 1166 2425 gene locus_tag LOCUS_02710 1166 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 2507 3280 gene locus_tag LOCUS_02720 2507 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3352 4407 gene locus_tag LOCUS_02730 3352 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5557 4625 gene locus_tag LOCUS_02740 5557 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6030 5857 gene locus_tag LOCUS_02750 6030 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6847 6047 gene locus_tag LOCUS_02760 6847 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 8170 6875 gene locus_tag LOCUS_02770 8170 6875 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_02770 8520 8173 gene locus_tag LOCUS_02780 8520 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8998 8744 gene locus_tag LOCUS_02790 8998 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 9988 9065 gene locus_tag LOCUS_02800 9988 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 10304 11806 gene locus_tag LOCUS_02810 10304 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence020 184 1326 gene locus_tag LOCUS_02820 184 1326 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_02820 1323 2672 gene locus_tag LOCUS_02830 1323 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2966 4420 gene locus_tag LOCUS_02840 gene gltX 2966 4420 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_02840 4446 6137 gene locus_tag LOCUS_02850 4446 6137 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_02850 6309 7049 gene locus_tag LOCUS_02860 6309 7049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_02860 8593 7127 gene locus_tag LOCUS_02870 8593 7127 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_02870 9118 10455 gene locus_tag LOCUS_02880 9118 10455 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382263.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence021 359 2203 gene locus_tag LOCUS_02890 gene uvrC 359 2203 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02890 2341 2898 gene locus_tag LOCUS_02900 gene rsmD 2341 2898 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_02900 2895 3380 gene locus_tag LOCUS_02910 gene coaD 2895 3380 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_02910 3438 3899 gene locus_tag LOCUS_02920 3438 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4345 4764 gene locus_tag LOCUS_02930 gene mraZ 4345 4764 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_02930 4775 5698 gene locus_tag LOCUS_02940 gene rsmH 4775 5698 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_02940 5971 6492 gene locus_tag LOCUS_02950 5971 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6652 8922 gene locus_tag LOCUS_02960 6652 8922 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_02960 8958 9983 gene locus_tag LOCUS_02970 gene mraY 8958 9983 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_02970 10034 11290 gene locus_tag LOCUS_02980 gene spoVE 10034 11290 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence022 622 263 gene locus_tag LOCUS_02990 622 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1791 697 gene locus_tag LOCUS_03000 1791 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3345 1804 gene locus_tag LOCUS_03010 3345 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3943 3359 gene locus_tag LOCUS_03020 3943 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 4346 3960 gene locus_tag LOCUS_03030 4346 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4941 4540 gene locus_tag LOCUS_03040 4941 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5765 5127 gene locus_tag LOCUS_03050 5765 5127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 protein_id gnl|my_center|LOCUS_03050 7050 5743 gene locus_tag LOCUS_03060 7050 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8642 7047 gene locus_tag LOCUS_03070 8642 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9072 10028 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttactaccttatagatttacactattctcaaac 11025 10234 gene locus_tag LOCUS_03080 11025 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence023 1299 40 gene locus_tag LOCUS_03090 1299 40 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_03090 2078 1305 gene locus_tag LOCUS_03100 2078 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3128 2079 gene locus_tag LOCUS_03110 3128 2079 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_03110 4149 3121 gene locus_tag LOCUS_03120 4149 3121 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_03120 5549 4158 gene locus_tag LOCUS_03130 gene murD 5549 4158 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_03130 5702 7066 gene locus_tag LOCUS_03140 5702 7066 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 protein_id gnl|my_center|LOCUS_03140 7970 7110 gene locus_tag LOCUS_03150 7970 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_03150 9278 8067 gene locus_tag LOCUS_03160 9278 8067 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_03160 <10879 9289 gene locus_tag LOCUS_03170 <10879 9289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357577.1:DNA helicase PcrA >Feature sequence024 1152 25 gene locus_tag LOCUS_03180 1152 25 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_03180 1302 1757 gene locus_tag LOCUS_03190 gene spoVAC 1302 1757 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_03190 3344 2142 gene locus_tag LOCUS_03200 gene tuf 3344 2142 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_03200 5559 3460 gene locus_tag LOCUS_03210 gene fusA 5559 3460 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_03210 6061 5591 gene locus_tag LOCUS_03220 gene rpsG 6061 5591 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_03220 6638 6219 gene locus_tag LOCUS_03230 gene rpsL 6638 6219 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_03230 9119 7464 gene locus_tag LOCUS_03240 9119 7464 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_03240 10054 9191 gene locus_tag LOCUS_03250 10054 9191 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262978.1 protein_id gnl|my_center|LOCUS_03250 <10805 10051 gene locus_tag LOCUS_03260 <10805 10051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837035.1:sugar ABC transporter permease >Feature sequence025 19 1395 gene locus_tag LOCUS_03270 19 1395 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_03270 2914 1724 gene locus_tag LOCUS_03280 2914 1724 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_03280 4580 2958 gene locus_tag LOCUS_03290 4580 2958 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_03290 8635 4583 gene locus_tag LOCUS_03300 gene carB 8635 4583 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_03300 9788 8706 gene locus_tag LOCUS_03310 gene carA 9788 8706 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_03310 10396 9827 gene locus_tag LOCUS_03320 10396 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence026 1174 677 gene locus_tag LOCUS_03330 gene ybaK 1174 677 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_03330 1764 2075 gene locus_tag LOCUS_03340 1764 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2110 4098 gene locus_tag LOCUS_03350 2110 4098 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_03350 4095 4568 gene locus_tag LOCUS_03360 4095 4568 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_03360 4610 5191 gene locus_tag LOCUS_03370 4610 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5203 6174 gene locus_tag LOCUS_03380 5203 6174 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_03380 6167 6490 gene locus_tag LOCUS_03390 6167 6490 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_03390 6502 8268 gene locus_tag LOCUS_03400 6502 8268 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_03400 8268 9641 gene locus_tag LOCUS_03410 8268 9641 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_03410 9663 10325 gene locus_tag LOCUS_03420 9663 10325 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_03420 10497 10422 gene locus_tag LOCUS_t00040 10497 10422 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 5205 4162 gene locus_tag LOCUS_03430 gene ispG 5205 4162 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_03430 6393 5224 gene locus_tag LOCUS_03440 6393 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 7822 6677 gene locus_tag LOCUS_03450 7822 6677 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241803.1 protein_id gnl|my_center|LOCUS_03450 8533 7829 gene locus_tag LOCUS_03460 8533 7829 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_03460 9422 8676 gene locus_tag LOCUS_03470 9422 8676 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_03470 9978 9424 gene locus_tag LOCUS_03480 gene frr 9978 9424 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_03480 <10546 10032 gene locus_tag LOCUS_03490 <10546 10032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003362575.1:UMP kinase >Feature sequence028 305 4846 gene locus_tag LOCUS_03500 gene gltB 305 4846 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_03500 4860 6344 gene locus_tag LOCUS_03510 4860 6344 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_03510 6528 7703 gene locus_tag LOCUS_03520 gene rlmD 6528 7703 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_03520 10461 8647 gene locus_tag LOCUS_03530 10461 8647 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence029 204 2096 gene locus_tag LOCUS_03540 204 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2150 2329 gene locus_tag LOCUS_03550 2150 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2362 2955 gene locus_tag LOCUS_03560 2362 2955 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_03560 2966 3625 gene locus_tag LOCUS_03570 2966 3625 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_03570 3630 4259 gene locus_tag LOCUS_03580 3630 4259 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_03580 6061 4361 gene locus_tag LOCUS_03590 gene ptsP 6061 4361 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_03590 6360 6097 gene locus_tag LOCUS_03600 6360 6097 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 protein_id gnl|my_center|LOCUS_03600 8432 6507 gene locus_tag LOCUS_03610 8432 6507 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_03610 9353 8448 gene locus_tag LOCUS_03620 gene pfkB 9353 8448 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_03620 10099 9350 gene locus_tag LOCUS_03630 10099 9350 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence030 883 461 gene locus_tag LOCUS_03640 883 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2325 913 gene locus_tag LOCUS_03650 gene gatB 2325 913 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_03650 3776 2322 gene locus_tag LOCUS_03660 gene gatA 3776 2322 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_03660 4067 3789 gene locus_tag LOCUS_03670 gene gatC 4067 3789 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034582121.1 protein_id gnl|my_center|LOCUS_03670 5905 4157 gene locus_tag LOCUS_03680 gene aspS 5905 4157 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_03680 8500 6041 gene locus_tag LOCUS_03690 8500 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 9479 8403 gene locus_tag LOCUS_03700 9479 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03700 8436 8445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <10196 9502 gene locus_tag LOCUS_03710 <10196 9502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774180.1:ATP-binding cassette domain-containing protein >Feature sequence031 72 593 gene locus_tag LOCUS_03720 72 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 590 784 gene locus_tag LOCUS_03730 590 784 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262994.1 protein_id gnl|my_center|LOCUS_03730 998 1690 gene locus_tag LOCUS_03740 998 1690 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_03740 1712 2716 gene locus_tag LOCUS_03750 1712 2716 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_03750 3700 3002 gene locus_tag LOCUS_03760 3700 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3893 4498 gene locus_tag LOCUS_03770 3893 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4784 7687 gene locus_tag LOCUS_03780 4784 7687 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_03780 7705 9021 gene locus_tag LOCUS_03790 7705 9021 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_03790 9165 9962 gene locus_tag LOCUS_03800 9165 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence032 190 657 gene locus_tag LOCUS_03810 190 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 772 1155 gene locus_tag LOCUS_03820 772 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1167 3188 gene locus_tag LOCUS_03830 1167 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3175 3345 gene locus_tag LOCUS_03840 3175 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3345 4154 gene locus_tag LOCUS_03850 3345 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4165 5403 gene locus_tag LOCUS_03860 4165 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 5415 5555 gene locus_tag LOCUS_03870 5415 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence033 466 1494 gene locus_tag LOCUS_03880 gene hrcA 466 1494 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_03880 1524 2081 gene locus_tag LOCUS_03890 gene grpE 1524 2081 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_03890 2153 4009 gene locus_tag LOCUS_03900 gene dnaK 2153 4009 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_03900 4132 5274 gene locus_tag LOCUS_03910 gene dnaJ 4132 5274 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_03910 5476 6411 gene locus_tag LOCUS_03920 gene prmA 5476 6411 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_03920 7425 6715 gene locus_tag LOCUS_03930 7425 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7822 7481 gene locus_tag LOCUS_03940 7822 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8724 7900 gene locus_tag LOCUS_03950 8724 7900 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence034 1320 25 gene locus_tag LOCUS_03960 1320 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1846 1313 gene locus_tag LOCUS_03970 1846 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 1850 1859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2933 2121 gene locus_tag LOCUS_03980 2933 2121 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03980 3796 2927 gene locus_tag LOCUS_03990 3796 2927 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_03990 4638 3793 gene locus_tag LOCUS_04000 4638 3793 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_04000 5505 4642 gene locus_tag LOCUS_04010 5505 4642 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_04010 6854 5505 gene locus_tag LOCUS_04020 gene glmM 6854 5505 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_04020 8062 6974 gene locus_tag LOCUS_04030 gene ruvB 8062 6974 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_04030 8668 8066 gene locus_tag LOCUS_04040 gene ruvA 8668 8066 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804997.1 protein_id gnl|my_center|LOCUS_04040 9177 8671 gene locus_tag LOCUS_04050 gene ruvC 9177 8671 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence035 99 671 gene locus_tag LOCUS_04060 99 671 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_04060 690 2030 gene locus_tag LOCUS_04070 gene rsmB 690 2030 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_04070 2027 3070 gene locus_tag LOCUS_04080 gene rlmN 2027 3070 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_04080 3072 3797 gene locus_tag LOCUS_04090 3072 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3816 5921 gene locus_tag LOCUS_04100 gene pknB 3816 5921 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_04100 5956 6819 gene locus_tag LOCUS_04110 gene rsgA 5956 6819 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 protein_id gnl|my_center|LOCUS_04110 6822 7451 gene locus_tag LOCUS_04120 6822 7451 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_04120 7517 7592 gene locus_tag LOCUS_t00050 7517 7592 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence036 2000 462 gene locus_tag LOCUS_04130 2000 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3607 2000 gene locus_tag LOCUS_04140 3607 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4325 3621 gene locus_tag LOCUS_04150 gene gldF 4325 3621 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_04150 5281 4325 gene locus_tag LOCUS_04160 5281 4325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_04160 5528 5881 gene locus_tag LOCUS_04170 gene spoVAE 5528 5881 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_04170 8739 6001 gene locus_tag LOCUS_04180 8739 6001 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence037 55 2226 gene locus_tag LOCUS_04190 gene nrdD 55 2226 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_04190 2223 2762 gene locus_tag LOCUS_04200 gene nrdG 2223 2762 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_04200 2901 3614 gene locus_tag LOCUS_04210 2901 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4947 3742 gene locus_tag LOCUS_04220 4947 3742 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_04220 6207 4972 gene locus_tag LOCUS_04230 6207 4972 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986436.1 protein_id gnl|my_center|LOCUS_04230 8703 6253 gene locus_tag LOCUS_04240 8703 6253 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence038 94 939 gene locus_tag LOCUS_04250 gene aroE 94 939 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_04250 958 1494 gene locus_tag LOCUS_04260 958 1494 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_04260 1605 2621 gene locus_tag LOCUS_04270 gene aroF 1605 2621 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_04270 2711 3541 gene locus_tag LOCUS_04280 2711 3541 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_04280 3560 4609 gene locus_tag LOCUS_04290 gene aroB 3560 4609 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_04290 4646 5944 gene locus_tag LOCUS_04300 gene aroA 4646 5944 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_04300 5088 5097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5925 6995 gene locus_tag LOCUS_04310 gene aroC 5925 6995 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_04310 7003 8145 gene locus_tag LOCUS_04320 gene pheA 7003 8145 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_04320 8640 8347 gene locus_tag LOCUS_04330 8640 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence039 463 86 gene locus_tag LOCUS_04340 gene rplL 463 86 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_04340 1077 517 gene locus_tag LOCUS_04350 gene rplJ 1077 517 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567140.1 protein_id gnl|my_center|LOCUS_04350 1970 1275 gene locus_tag LOCUS_04360 gene rplA 1970 1275 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_04360 2452 2027 gene locus_tag LOCUS_04370 gene rplK 2452 2027 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_04370 3093 2566 gene locus_tag LOCUS_04380 gene nusG 3093 2566 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_04380 3395 3138 gene locus_tag LOCUS_04390 3395 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3557 3408 gene locus_tag LOCUS_04400 gene rpmG 3557 3408 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_04400 4556 3768 gene locus_tag LOCUS_04410 4556 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4695 5513 gene locus_tag LOCUS_04420 gene murI 4695 5513 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_04420 5525 5989 gene locus_tag LOCUS_04430 5525 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5991 7727 gene locus_tag LOCUS_04440 gene argS 5991 7727 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_04440 8346 8026 gene locus_tag LOCUS_04450 8346 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence040 688 1137 gene locus_tag LOCUS_04460 gene ctsR 688 1137 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_04460 1159 1662 gene locus_tag LOCUS_04470 1159 1662 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_04470 1665 2654 gene locus_tag LOCUS_04480 1665 2654 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_04480 2701 5184 gene locus_tag LOCUS_04490 gene clpC 2701 5184 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_04490 5144 5153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5305 5799 gene locus_tag LOCUS_04500 5305 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6316 6083 gene locus_tag LOCUS_04510 6316 6083 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870157.1 protein_id gnl|my_center|LOCUS_04510 6485 6348 gene locus_tag LOCUS_04520 6485 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6359 6368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6752 6507 gene locus_tag LOCUS_04530 gene rpsP 6752 6507 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_04530 8247 6838 gene locus_tag LOCUS_04540 gene ffh 8247 6838 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_04540 8608 8258 gene locus_tag LOCUS_04550 8608 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence041 826 975 gene locus_tag LOCUS_04560 826 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 1798 977 gene locus_tag LOCUS_04570 gene noc 1798 977 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_04570 2672 1959 gene locus_tag LOCUS_04580 gene rsmG 2672 1959 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_04580 3100 2672 gene locus_tag LOCUS_04590 3100 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04590 4563 3097 gene locus_tag LOCUS_04600 gene mnmG 4563 3097 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04600 3160 3169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5939 4572 gene locus_tag LOCUS_04610 gene mnmE 5939 4572 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_04610 6791 5982 gene locus_tag LOCUS_04620 6791 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7803 6796 gene locus_tag LOCUS_04630 7803 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8052 7813 gene locus_tag LOCUS_04640 gene yidD 8052 7813 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_04640 8398 8057 gene locus_tag LOCUS_04650 8398 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8599 8465 gene locus_tag LOCUS_04660 8599 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence042 1504 131 gene locus_tag LOCUS_04670 1504 131 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_04670 1787 2704 gene locus_tag LOCUS_04680 1787 2704 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_04680 2701 3570 gene locus_tag LOCUS_04690 gene pstC 2701 3570 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_04690 3563 4489 gene locus_tag LOCUS_04700 gene pstA 3563 4489 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_04700 4513 5262 gene locus_tag LOCUS_04710 gene pstB 4513 5262 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_04710 5262 5909 gene locus_tag LOCUS_04720 gene phoU 5262 5909 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_04720 6084 6755 gene locus_tag LOCUS_04730 6084 6755 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_04730 6757 8412 gene locus_tag LOCUS_04740 6757 8412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence043 181 4188 gene locus_tag LOCUS_04750 181 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4192 5163 gene locus_tag LOCUS_04760 4192 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 5177 6070 gene locus_tag LOCUS_04770 gene isdE 5177 6070 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_04770 6098 7087 gene locus_tag LOCUS_04780 6098 7087 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036855.1 protein_id gnl|my_center|LOCUS_04780 7080 7856 gene locus_tag LOCUS_04790 7080 7856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403758.1 protein_id gnl|my_center|LOCUS_04790 7872 8246 gene locus_tag LOCUS_04800 7872 8246 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence044 1317 139 gene locus_tag LOCUS_04810 1317 139 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_04810 2060 1344 gene locus_tag LOCUS_04820 2060 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2684 2073 gene locus_tag LOCUS_04830 gene purN 2684 2073 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_04830 2431 2440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3721 2684 gene locus_tag LOCUS_04840 gene purM 3721 2684 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 protein_id gnl|my_center|LOCUS_04840 5199 3820 gene locus_tag LOCUS_04850 gene purF 5199 3820 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_04850 3827 3836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5693 5196 gene locus_tag LOCUS_04860 gene purE 5693 5196 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817242.1 protein_id gnl|my_center|LOCUS_04860 7433 5922 gene locus_tag LOCUS_04870 7433 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 <8273 7513 gene locus_tag LOCUS_04880 <8273 7513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015666.1:SPFH domain-containing protein >Feature sequence045 33 494 gene locus_tag LOCUS_04890 33 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4330 734 gene locus_tag LOCUS_04900 gene rpoC 4330 734 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_04900 8068 4343 gene locus_tag LOCUS_04910 gene rpoB 8068 4343 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence046 1614 175 gene locus_tag LOCUS_04920 1614 175 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_04920 2242 1616 gene locus_tag LOCUS_04930 2242 1616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454137.1 protein_id gnl|my_center|LOCUS_04930 2694 2239 gene locus_tag LOCUS_04940 gene dtd 2694 2239 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_04940 4908 2710 gene locus_tag LOCUS_04950 4908 2710 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_04950 5702 4908 gene locus_tag LOCUS_04960 5702 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6961 5942 gene locus_tag LOCUS_04970 6961 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 5995 6004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7516 6998 gene locus_tag LOCUS_04980 7516 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04980 <8232 7523 gene locus_tag LOCUS_04990 <8232 7523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583410.1:DNA repair protein RecN note possible pseudo, internal stop codon >Feature sequence047 1186 302 gene locus_tag LOCUS_05000 1186 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1188 1409 gene locus_tag LOCUS_05010 1188 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3255 1756 gene locus_tag LOCUS_05020 3255 1756 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_05020 7883 3444 gene locus_tag LOCUS_05030 7883 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence048 2093 1206 gene locus_tag LOCUS_05040 2093 1206 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795345.1 protein_id gnl|my_center|LOCUS_05040 3257 2124 gene locus_tag LOCUS_05050 3257 2124 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_05050 4260 3271 gene locus_tag LOCUS_05060 4260 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4862 4290 gene locus_tag LOCUS_05070 gene rfbC 4862 4290 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_05070 5807 4887 gene locus_tag LOCUS_05080 gene rfbB 5807 4887 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877832.1 protein_id gnl|my_center|LOCUS_05080 6882 5839 gene locus_tag LOCUS_05090 gene rfbG 6882 5839 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_05090 7661 6882 gene locus_tag LOCUS_05100 gene rfbF 7661 6882 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_05100 8054 7674 gene locus_tag LOCUS_05110 8054 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence049 214 223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 234 2021 gene locus_tag LOCUS_05120 234 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2031 3035 gene locus_tag LOCUS_05130 2031 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3067 4998 gene locus_tag LOCUS_05140 3067 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence050 903 37 gene locus_tag LOCUS_05150 903 37 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_05150 1754 891 gene locus_tag LOCUS_05160 1754 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2287 1817 gene locus_tag LOCUS_05170 2287 1817 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_05170 2345 2581 gene locus_tag LOCUS_05180 2345 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2583 2936 gene locus_tag LOCUS_05190 2583 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2951 3235 gene locus_tag LOCUS_05200 2951 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4480 3236 gene locus_tag LOCUS_05210 4480 3236 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_05210 5279 4494 gene locus_tag LOCUS_05220 gene proB 5279 4494 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_05220 6363 5431 gene locus_tag LOCUS_05230 gene metA 6363 5431 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_05230 6624 6436 gene locus_tag LOCUS_05240 6624 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 <7962 6665 gene locus_tag LOCUS_05250 <7962 6665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004450718.1:proline--tRNA ligase >Feature sequence051 171 1469 gene locus_tag LOCUS_05260 171 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1509 2204 gene locus_tag LOCUS_05270 1509 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2648 3229 gene locus_tag LOCUS_05280 2648 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3360 4118 gene locus_tag LOCUS_05290 gene rlmB 3360 4118 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_05290 4171 4180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4355 7015 gene locus_tag LOCUS_05300 4355 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 7031 7678 gene locus_tag LOCUS_05310 gene rpe 7031 7678 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence052 1285 1007 gene locus_tag LOCUS_05320 1285 1007 CDS product RyR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764012.1 protein_id gnl|my_center|LOCUS_05320 5530 1310 gene locus_tag LOCUS_05330 5530 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7530 5608 gene locus_tag LOCUS_05340 7530 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence053 1313 384 gene locus_tag LOCUS_05350 1313 384 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_05350 1869 1306 gene locus_tag LOCUS_05360 1869 1306 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_05360 2087 3370 gene locus_tag LOCUS_05370 2087 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3877 3488 gene locus_tag LOCUS_05380 3877 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4846 4049 gene locus_tag LOCUS_05390 4846 4049 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_05390 5509 4859 gene locus_tag LOCUS_05400 5509 4859 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_05400 6464 5652 gene locus_tag LOCUS_05410 6464 5652 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence054 <1 913 gene locus_tag LOCUS_05420 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433873.1:AI-2E family transporter 1011 2177 gene locus_tag LOCUS_05430 1011 2177 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_05430 2202 2831 gene locus_tag LOCUS_05440 gene hisG 2202 2831 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_05440 2828 3010 gene locus_tag LOCUS_05450 2828 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2994 3003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3168 4118 gene locus_tag LOCUS_05460 3168 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 4135 5187 gene locus_tag LOCUS_05470 gene hisC 4135 5187 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_05470 5192 5770 gene locus_tag LOCUS_05480 gene hisB 5192 5770 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674505.1 protein_id gnl|my_center|LOCUS_05480 5770 6489 gene locus_tag LOCUS_05490 gene hisA 5770 6489 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_05490 6497 6811 gene locus_tag LOCUS_05500 gene hisI 6497 6811 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397763.1 protein_id gnl|my_center|LOCUS_05500 6825 7157 gene locus_tag LOCUS_05510 gene hisE 6825 7157 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949117.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence055 771 313 gene locus_tag LOCUS_05520 gene nrdR 771 313 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_05520 2223 871 gene locus_tag LOCUS_05530 2223 871 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_05530 4296 2251 gene locus_tag LOCUS_05540 gene recG 4296 2251 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_05540 6017 4371 gene locus_tag LOCUS_05550 6017 4371 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_05550 7012 6239 gene locus_tag LOCUS_05560 gene ymdB 7012 6239 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence056 1365 160 gene locus_tag LOCUS_05570 1365 160 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_05570 1820 1548 gene locus_tag LOCUS_05580 gene spoIIID 1820 1548 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_05580 2108 3637 gene locus_tag LOCUS_05590 2108 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4044 5228 gene locus_tag LOCUS_05600 gene alr 4044 5228 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457107.1 protein_id gnl|my_center|LOCUS_05600 5230 6258 gene locus_tag LOCUS_05610 5230 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6978 6478 gene locus_tag LOCUS_05620 6978 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence057 1905 184 gene locus_tag LOCUS_05630 gene ade 1905 184 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_05630 2142 3266 gene locus_tag LOCUS_05640 2142 3266 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263718.1 protein_id gnl|my_center|LOCUS_05640 4914 3544 gene locus_tag LOCUS_05650 4914 3544 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387350.1 protein_id gnl|my_center|LOCUS_05650 6498 4927 gene locus_tag LOCUS_05660 6498 4927 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_05660 6816 6508 gene locus_tag LOCUS_05670 6816 6508 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence058 1455 2342 gene locus_tag LOCUS_05680 1455 2342 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_05680 2713 2459 gene locus_tag LOCUS_05690 gene cotJB 2713 2459 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_05690 2906 2706 gene locus_tag LOCUS_05700 2906 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3894 3061 gene locus_tag LOCUS_05710 3894 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4322 5164 gene locus_tag LOCUS_05720 4322 5164 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_05720 5349 5954 gene locus_tag LOCUS_05730 5349 5954 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 protein_id gnl|my_center|LOCUS_05730 5947 6843 gene locus_tag LOCUS_05740 5947 6843 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence059 <1 6723 gene locus_tag LOCUS_05750 <1 6723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886402.1:surfactin non-ribosomal peptide synthetase SrfAA >Feature sequence060 2137 1103 gene locus_tag LOCUS_05760 2137 1103 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_05760 3360 2668 gene locus_tag LOCUS_05770 3360 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4219 3422 gene locus_tag LOCUS_05780 4219 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4547 4221 gene locus_tag LOCUS_05790 4547 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4401 4410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5151 4612 gene locus_tag LOCUS_05800 5151 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5625 5227 gene locus_tag LOCUS_05810 5625 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5931 5644 gene locus_tag LOCUS_05820 5931 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6128 5925 gene locus_tag LOCUS_05830 6128 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence061 137 763 gene locus_tag LOCUS_05840 137 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 777 1610 gene locus_tag LOCUS_05850 777 1610 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986912.1 protein_id gnl|my_center|LOCUS_05850 2122 1709 gene locus_tag LOCUS_05860 2122 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3920 2109 gene locus_tag LOCUS_05870 gene lepA 3920 2109 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_05870 4451 4906 gene locus_tag LOCUS_05880 4451 4906 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence062 795 4 gene locus_tag LOCUS_05890 795 4 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_05890 2223 799 gene locus_tag LOCUS_05900 2223 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2781 5969 gene locus_tag LOCUS_05910 2781 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6144 6713 gene locus_tag LOCUS_05920 6144 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence063 2401 1028 gene locus_tag LOCUS_05930 gene dnaB 2401 1028 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_05930 2863 2417 gene locus_tag LOCUS_05940 gene rplI 2863 2417 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_05940 4835 2880 gene locus_tag LOCUS_05950 4835 2880 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 protein_id gnl|my_center|LOCUS_05950 6792 4888 gene locus_tag LOCUS_05960 6792 4888 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence064 1406 132 gene locus_tag LOCUS_05970 1406 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2253 1411 gene locus_tag LOCUS_05980 2253 1411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_05980 2418 3059 gene locus_tag LOCUS_05990 2418 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3059 3529 gene locus_tag LOCUS_06000 3059 3529 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_06000 5163 3937 gene locus_tag LOCUS_06010 5163 3937 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_06010 <6827 5171 gene locus_tag LOCUS_06020 <6827 5171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964698.1:Ig-like domain-containing protein >Feature sequence065 2117 1227 gene locus_tag LOCUS_06030 2117 1227 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_06030 3055 2120 gene locus_tag LOCUS_06040 3055 2120 CDS product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812448.1 protein_id gnl|my_center|LOCUS_06040 4965 3076 gene locus_tag LOCUS_06050 4965 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5432 5668 gene locus_tag LOCUS_06060 5432 5668 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356943.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence066 <1 568 gene locus_tag LOCUS_06070 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965420.1:YggS family pyridoxal phosphate-dependent enzyme 587 1054 gene locus_tag LOCUS_06080 gene sepF 587 1054 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640853.1 protein_id gnl|my_center|LOCUS_06080 1038 1787 gene locus_tag LOCUS_06090 1038 1787 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_06090 1801 2475 gene locus_tag LOCUS_06100 1801 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2513 5278 gene locus_tag LOCUS_06110 gene ileS 2513 5278 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_06110 5341 5823 gene locus_tag LOCUS_06120 gene lspA 5341 5823 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_06120 5816 6403 gene locus_tag LOCUS_06130 5816 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 6374 6383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence067 2744 2391 gene locus_tag LOCUS_06140 gene rsfS 2744 2391 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_06140 3328 2741 gene locus_tag LOCUS_06150 gene yqeK 3328 2741 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_06150 3936 3334 gene locus_tag LOCUS_06160 gene nadD 3936 3334 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016925.1 protein_id gnl|my_center|LOCUS_06160 4241 3939 gene locus_tag LOCUS_06170 gene yhbY 4241 3939 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_06170 4865 4260 gene locus_tag LOCUS_06180 4865 4260 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_06180 5776 4862 gene locus_tag LOCUS_06190 gene ftsY 5776 4862 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_06190 <6655 5796 gene locus_tag LOCUS_06200 <6655 5796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989816.1:chromosome segregation protein SMC >Feature sequence068 2084 102 gene locus_tag LOCUS_06210 2084 102 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_06210 4220 2340 gene locus_tag LOCUS_06220 gene htpG 4220 2340 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_06220 4466 6562 gene locus_tag LOCUS_06230 4466 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence069 122 1300 gene locus_tag LOCUS_06240 122 1300 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154559.1 protein_id gnl|my_center|LOCUS_06240 1323 1625 gene locus_tag LOCUS_06250 1323 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1609 1959 gene locus_tag LOCUS_06260 1609 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1949 2284 gene locus_tag LOCUS_06270 1949 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2277 2720 gene locus_tag LOCUS_06280 2277 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905718.1 protein_id gnl|my_center|LOCUS_06280 2743 3360 gene locus_tag LOCUS_06290 2743 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3360 3698 gene locus_tag LOCUS_06300 3360 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3797 3997 gene locus_tag LOCUS_06310 3797 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence070 1285 77 gene locus_tag LOCUS_06320 gene ackA 1285 77 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_06320 1490 2626 gene locus_tag LOCUS_06330 1490 2626 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_06330 2906 3718 gene locus_tag LOCUS_06340 2906 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3608 3617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3795 6416 gene locus_tag LOCUS_06350 gene adhE 3795 6416 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence071 477 1286 gene locus_tag LOCUS_06360 477 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1632 2033 gene locus_tag LOCUS_06370 1632 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2046 6128 gene locus_tag LOCUS_06380 2046 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence072 102 296 gene locus_tag LOCUS_06390 102 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 534 1859 gene locus_tag LOCUS_06400 534 1859 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_06400 1862 2584 gene locus_tag LOCUS_06410 1862 2584 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832482.1 protein_id gnl|my_center|LOCUS_06410 2591 4804 gene locus_tag LOCUS_06420 2591 4804 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_06420 4788 5450 gene locus_tag LOCUS_06430 4788 5450 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_06430 5467 6483 gene locus_tag LOCUS_06440 5467 6483 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence073 144 1130 gene locus_tag LOCUS_06450 144 1130 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_06450 1130 1876 gene locus_tag LOCUS_06460 1130 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1869 2705 gene locus_tag LOCUS_06470 1869 2705 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_06470 3089 2709 gene locus_tag LOCUS_06480 3089 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3699 3094 gene locus_tag LOCUS_06490 3699 3094 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_06490 3844 4461 gene locus_tag LOCUS_06500 3844 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06500 4436 4445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4641 4507 gene locus_tag LOCUS_06510 4641 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4601 5317 gene locus_tag LOCUS_06520 4601 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 5984 5703 gene locus_tag LOCUS_06530 5984 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence074 1804 47 gene locus_tag LOCUS_06540 1804 47 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 protein_id gnl|my_center|LOCUS_06540 3115 2126 gene locus_tag LOCUS_06550 3115 2126 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965181.1 protein_id gnl|my_center|LOCUS_06550 3525 3313 gene locus_tag LOCUS_06560 3525 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3838 3506 gene locus_tag LOCUS_06570 3838 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 6246 3835 gene locus_tag LOCUS_06580 6246 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence075 362 1837 gene locus_tag LOCUS_06590 362 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1914 2663 gene locus_tag LOCUS_06600 1914 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2680 3825 gene locus_tag LOCUS_06610 2680 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3836 5164 gene locus_tag LOCUS_06620 3836 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6194 5418 gene locus_tag LOCUS_06630 6194 5418 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence076 <1 2054 gene locus_tag LOCUS_06640 <1 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476308.1:SMC family ATPase 2161 2943 gene locus_tag LOCUS_06650 2161 2943 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_06650 3009 3018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3107 3364 gene locus_tag LOCUS_06660 3107 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3364 5490 gene locus_tag LOCUS_06670 3364 5490 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_06670 6238 5570 gene locus_tag LOCUS_06680 6238 5570 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694124.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence077 973 371 gene locus_tag LOCUS_06690 gene recR 973 371 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_06690 1326 976 gene locus_tag LOCUS_06700 1326 976 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_06700 3100 1346 gene locus_tag LOCUS_06710 3100 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5088 3706 gene locus_tag LOCUS_06720 5088 3706 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_06720 6100 5426 gene locus_tag LOCUS_06730 6100 5426 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence078 50 265 gene locus_tag LOCUS_06740 50 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 428 1234 gene locus_tag LOCUS_06750 428 1234 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_06750 3281 1542 gene locus_tag LOCUS_06760 3281 1542 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_06760 3781 3296 gene locus_tag LOCUS_06770 gene rlmH 3781 3296 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643636.1 protein_id gnl|my_center|LOCUS_06770 4600 3803 gene locus_tag LOCUS_06780 4600 3803 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_06780 6006 4714 gene locus_tag LOCUS_06790 6006 4714 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence079 439 975 gene locus_tag LOCUS_06800 gene raiA 439 975 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_06800 1073 2188 gene locus_tag LOCUS_06810 1073 2188 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_06810 2285 3235 gene locus_tag LOCUS_06820 2285 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3319 3897 gene locus_tag LOCUS_06830 3319 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3960 4667 gene locus_tag LOCUS_06840 3960 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06840 4619 4628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4657 5955 gene locus_tag LOCUS_06850 4657 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06850 >Feature sequence080 189 614 gene locus_tag LOCUS_06860 189 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 651 959 gene locus_tag LOCUS_06870 651 959 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_06870 999 1421 gene locus_tag LOCUS_06880 999 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1377 1386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1534 3288 gene locus_tag LOCUS_06890 1534 3288 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_06890 3307 4686 gene locus_tag LOCUS_06900 3307 4686 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_06900 4715 5377 gene locus_tag LOCUS_06910 4715 5377 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_06910 5813 5490 gene locus_tag LOCUS_06920 5813 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6026 5895 gene locus_tag LOCUS_06930 6026 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence081 124 1146 gene locus_tag LOCUS_06940 124 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 464 473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1799 1308 gene locus_tag LOCUS_06950 1799 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1970 2302 gene locus_tag LOCUS_06960 1970 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 2245 2254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2256 3065 gene locus_tag LOCUS_06970 2256 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 3034 3043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3245 3643 gene locus_tag LOCUS_06980 3245 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3860 5944 gene locus_tag LOCUS_06990 gene glgX 3860 5944 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence082 <1 1213 gene locus_tag LOCUS_07000 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948259.1:serine--tRNA ligase 1351 1704 gene locus_tag LOCUS_07010 1351 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1864 2106 gene locus_tag LOCUS_07020 1864 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3037 2222 gene locus_tag LOCUS_07030 3037 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3273 4751 gene locus_tag LOCUS_07040 gene guaB 3273 4751 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_07040 4807 4986 gene locus_tag LOCUS_07050 4807 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 4949 5713 gene locus_tag LOCUS_07060 gene glcK 4949 5713 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_07060 4952 4961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence083 <1 593 gene locus_tag LOCUS_07070 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454668.1:quinolinate synthase NadA 633 1706 gene locus_tag LOCUS_07080 gene mnmA 633 1706 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_07080 5691 1990 gene locus_tag LOCUS_07090 5691 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence084 2188 653 gene locus_tag LOCUS_07100 2188 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3154 2411 gene locus_tag LOCUS_07110 3154 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4042 3218 gene locus_tag LOCUS_07120 4042 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4964 4158 gene locus_tag LOCUS_07130 4964 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence085 1273 77 gene locus_tag LOCUS_07140 gene cytX 1273 77 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_07140 2088 1270 gene locus_tag LOCUS_07150 gene thiD 2088 1270 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_07150 2777 2115 gene locus_tag LOCUS_07160 2777 2115 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_07160 3414 2770 gene locus_tag LOCUS_07170 gene thiE 3414 2770 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_07170 4222 3401 gene locus_tag LOCUS_07180 gene thiM 4222 3401 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_07180 4664 5470 gene locus_tag LOCUS_07190 4664 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5802 5727 gene locus_tag LOCUS_t00060 5802 5727 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 600 142 gene locus_tag LOCUS_07200 600 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1761 613 gene locus_tag LOCUS_07210 1761 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3415 1772 gene locus_tag LOCUS_07220 3415 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 5418 3826 gene locus_tag LOCUS_07230 5418 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence087 348 572 gene locus_tag LOCUS_07240 348 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 565 1440 gene locus_tag LOCUS_07250 565 1440 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_07250 1480 3351 gene locus_tag LOCUS_07260 gene dxs 1480 3351 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_07260 3353 4159 gene locus_tag LOCUS_07270 3353 4159 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_07270 4172 5029 gene locus_tag LOCUS_07280 4172 5029 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_07280 5029 5475 gene locus_tag LOCUS_07290 5029 5475 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence088 254 790 gene locus_tag LOCUS_07300 254 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 877 2892 gene locus_tag LOCUS_07310 877 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence089 56 973 gene locus_tag LOCUS_07320 gene era 56 973 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_07320 1077 1250 gene locus_tag LOCUS_07330 1077 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1201 1947 gene locus_tag LOCUS_07340 gene recO 1201 1947 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_07340 2105 4468 gene locus_tag LOCUS_07350 2105 4468 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_07350 4507 5022 gene locus_tag LOCUS_07360 gene rimM 4507 5022 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_07360 5012 5704 gene locus_tag LOCUS_07370 gene trmD 5012 5704 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence090 103 1665 gene locus_tag LOCUS_07380 103 1665 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_07380 2551 1712 gene locus_tag LOCUS_07390 2551 1712 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062005.1 protein_id gnl|my_center|LOCUS_07390 2791 2669 gene locus_tag LOCUS_07400 2791 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3827 2808 gene locus_tag LOCUS_07410 gene rfbB 3827 2808 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_07410 4722 3829 gene locus_tag LOCUS_07420 gene rfbA 4722 3829 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_07420 <5792 4742 gene locus_tag LOCUS_07430 <5792 4742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986574.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence091 239 1942 gene locus_tag LOCUS_07440 239 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1995 2004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3489 2104 gene locus_tag LOCUS_07450 gene murC 3489 2104 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_07450 3790 5160 gene locus_tag LOCUS_07460 gene rlmD 3790 5160 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485149.1 protein_id gnl|my_center|LOCUS_07460 5165 5602 gene locus_tag LOCUS_07470 5165 5602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922703.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence092 280 2460 gene locus_tag LOCUS_07480 280 2460 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_07480 2457 3533 gene locus_tag LOCUS_07490 2457 3533 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_07490 3636 4043 gene locus_tag LOCUS_07500 3636 4043 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_07500 4214 4732 gene locus_tag LOCUS_07510 4214 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4742 5728 gene locus_tag LOCUS_07520 gene dusB 4742 5728 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence093 138 2117 gene locus_tag LOCUS_07530 138 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2143 3408 gene locus_tag LOCUS_07540 2143 3408 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_07540 3606 4586 gene locus_tag LOCUS_07550 3606 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4653 5588 gene locus_tag LOCUS_07560 gene pyrF 4653 5588 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence094 237 908 gene locus_tag LOCUS_07570 237 908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_07570 911 3556 gene locus_tag LOCUS_07580 911 3556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_07580 3728 4375 gene locus_tag LOCUS_07590 3728 4375 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_07590 4375 5589 gene locus_tag LOCUS_07600 4375 5589 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861225.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence095 106 672 gene locus_tag LOCUS_07610 106 672 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_07610 932 3025 gene locus_tag LOCUS_07620 932 3025 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_07620 3025 5454 gene locus_tag LOCUS_07630 3025 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence096 424 32 gene locus_tag LOCUS_07640 424 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 911 489 gene locus_tag LOCUS_07650 911 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1564 995 gene locus_tag LOCUS_07660 1564 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 2132 1587 gene locus_tag LOCUS_07670 2132 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 1594 1603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3175 2150 gene locus_tag LOCUS_07680 gene queA 3175 2150 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_07680 3430 4515 gene locus_tag LOCUS_07690 gene asd 3430 4515 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_07690 4535 5437 gene locus_tag LOCUS_07700 gene dapA 4535 5437 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence097 3644 1659 gene locus_tag LOCUS_07710 gene gyrB 3644 1659 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_07710 3839 3660 gene locus_tag LOCUS_07720 3839 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 <5544 3817 gene locus_tag LOCUS_07730 <5544 3817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891935.1:excinuclease ABC subunit UvrB 3821 3830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence098 3001 134 gene locus_tag LOCUS_07740 gene secA 3001 134 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_07740 4466 3069 gene locus_tag LOCUS_07750 4466 3069 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222005.1 protein_id gnl|my_center|LOCUS_07750 <5539 4594 gene locus_tag LOCUS_07760 <5539 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357478.1:FtsW/RodA/SpoVE family cell cycle protein >Feature sequence099 <1 706 gene locus_tag LOCUS_07770 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435147.1:pseudouridine synthase 936 2249 gene locus_tag LOCUS_07780 gene mmdA 936 2249 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_07780 2288 2653 gene locus_tag LOCUS_07790 2288 2653 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_07790 2684 4087 gene locus_tag LOCUS_07800 2684 4087 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_07800 4242 5195 gene locus_tag LOCUS_07810 4242 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence100 <1 1076 gene locus_tag LOCUS_07820 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001227915.1:bifunctional glycosyltransferase family 2/GtrA family protein 2021 1128 gene locus_tag LOCUS_07830 2021 1128 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_07830 2427 2026 gene locus_tag LOCUS_07840 2427 2026 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_07840 3721 2450 gene locus_tag LOCUS_07850 gene obgE 3721 2450 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_07850 4140 3856 gene locus_tag LOCUS_07860 gene rpmA 4140 3856 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_07860 4462 4145 gene locus_tag LOCUS_07870 4462 4145 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_07870 4773 4465 gene locus_tag LOCUS_07880 gene rplU 4773 4465 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_07880 <5532 4909 gene locus_tag LOCUS_07890 <5532 4909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230259.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence101 1628 411 gene locus_tag LOCUS_07900 1628 411 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_07900 2694 1609 gene locus_tag LOCUS_07910 gene sufD 2694 1609 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_07910 4111 2705 gene locus_tag LOCUS_07920 gene sufB 4111 2705 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_07920 4886 4125 gene locus_tag LOCUS_07930 gene sufC 4886 4125 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_07930 5070 5477 gene locus_tag LOCUS_07940 gene iscR 5070 5477 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688879.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence102 121 1476 gene locus_tag LOCUS_07950 gene trkA 121 1476 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07950 1487 2932 gene locus_tag LOCUS_07960 1487 2932 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07960 4232 3132 gene locus_tag LOCUS_07970 4232 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5201 4326 gene locus_tag LOCUS_07980 gene gpr 5201 4326 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence103 495 1535 gene locus_tag LOCUS_07990 495 1535 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_07990 1621 2469 gene locus_tag LOCUS_08000 gene cysT 1621 2469 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227884.1 protein_id gnl|my_center|LOCUS_08000 2471 3292 gene locus_tag LOCUS_08010 gene cysW 2471 3292 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_08010 3292 4350 gene locus_tag LOCUS_08020 3292 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5201 4449 gene locus_tag LOCUS_08030 5201 4449 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence104 535 56 gene locus_tag LOCUS_08040 gene leuD 535 56 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_08040 1820 555 gene locus_tag LOCUS_08050 gene leuC 1820 555 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_08050 1929 2582 gene locus_tag LOCUS_08060 1929 2582 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519103.1 protein_id gnl|my_center|LOCUS_08060 2671 3600 gene locus_tag LOCUS_08070 2671 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3615 4463 gene locus_tag LOCUS_08080 3615 4463 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_08080 5365 4529 gene locus_tag LOCUS_08090 5365 4529 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence105 150 1448 gene locus_tag LOCUS_08100 gene eno 150 1448 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_08100 2049 3413 gene locus_tag LOCUS_08110 2049 3413 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_08110 3466 4032 gene locus_tag LOCUS_08120 3466 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5197 4094 gene locus_tag LOCUS_08130 5197 4094 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence106 158 412 gene locus_tag LOCUS_08140 158 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1000 488 gene locus_tag LOCUS_08150 1000 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1472 1038 gene locus_tag LOCUS_08160 1472 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1727 2062 gene locus_tag LOCUS_08170 1727 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3326 2118 gene locus_tag LOCUS_08180 3326 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 4746 3295 gene locus_tag LOCUS_08190 4746 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 3344 3353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5257 4781 gene locus_tag LOCUS_08200 5257 4781 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence107 <1 669 gene locus_tag LOCUS_08210 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209612097.1:DNA translocase FtsK 674 856 gene locus_tag LOCUS_08220 674 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 933 2198 gene locus_tag LOCUS_08230 933 2198 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358446.1 protein_id gnl|my_center|LOCUS_08230 2326 2251 gene locus_tag LOCUS_t00070 2326 2251 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2700 2494 gene locus_tag LOCUS_08240 2700 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2811 3596 gene locus_tag LOCUS_08250 2811 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3586 4995 gene locus_tag LOCUS_08260 3586 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5264 5097 gene locus_tag LOCUS_08270 5264 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence108 130 402 gene locus_tag LOCUS_08280 130 402 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_08280 903 598 gene locus_tag LOCUS_08290 903 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1165 920 gene locus_tag LOCUS_08300 1165 920 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_08300 3737 1368 gene locus_tag LOCUS_08310 gene pheT 3737 1368 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_08310 4805 3753 gene locus_tag LOCUS_08320 gene pheS 4805 3753 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence109 651 1301 gene locus_tag LOCUS_08330 651 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1294 2721 gene locus_tag LOCUS_08340 1294 2721 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_08340 2736 4688 gene locus_tag LOCUS_08350 2736 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4685 5002 gene locus_tag LOCUS_08360 4685 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence110 6 770 gene locus_tag LOCUS_08370 6 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 798 3371 gene locus_tag LOCUS_08380 798 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_08380 4065 5006 gene locus_tag LOCUS_08390 4065 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797800.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence111 20 745 gene locus_tag LOCUS_08400 20 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 969 1451 gene locus_tag LOCUS_08410 969 1451 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_08410 1469 3217 gene locus_tag LOCUS_08420 1469 3217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence112 841 218 gene locus_tag LOCUS_08430 gene hisH 841 218 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_08430 1052 1948 gene locus_tag LOCUS_08440 1052 1948 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_08440 1935 3176 gene locus_tag LOCUS_08450 1935 3176 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_08450 3218 3886 gene locus_tag LOCUS_08460 gene cmk 3218 3886 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_08460 3886 4521 gene locus_tag LOCUS_08470 3886 4521 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence113 <1 684 gene locus_tag LOCUS_08480 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776686.1:lysophospholipid acyltransferase family protein 725 967 gene locus_tag LOCUS_08490 725 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 969 3167 gene locus_tag LOCUS_08500 969 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3183 3917 gene locus_tag LOCUS_08510 gene fabG 3183 3917 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_08510 3914 4369 gene locus_tag LOCUS_08520 gene fabZ 3914 4369 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420731.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence114 2153 276 gene locus_tag LOCUS_08530 2153 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3247 2153 gene locus_tag LOCUS_08540 3247 2153 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_08540 4065 3319 gene locus_tag LOCUS_08550 4065 3319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_08550 4899 4078 gene locus_tag LOCUS_08560 4899 4078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389753.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence115 2716 350 gene locus_tag LOCUS_08570 2716 350 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_08570 4208 2721 gene locus_tag LOCUS_08580 gene malQ 4208 2721 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_08580 4895 4350 gene locus_tag LOCUS_08590 4895 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence116 599 608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1010 855 gene locus_tag LOCUS_08600 1010 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1916 2506 gene locus_tag LOCUS_08610 gene lexA 1916 2506 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_08610 2518 2919 gene locus_tag LOCUS_08620 2518 2919 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_08620 2972 3208 gene locus_tag LOCUS_08630 2972 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3879 3328 gene locus_tag LOCUS_08640 3879 3328 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_08640 4743 3892 gene locus_tag LOCUS_08650 4743 3892 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence117 902 57 gene locus_tag LOCUS_08660 902 57 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_08660 1143 3020 gene locus_tag LOCUS_08670 1143 3020 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_08670 3039 4868 gene locus_tag LOCUS_08680 gene glmS 3039 4868 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence118 1622 1149 gene locus_tag LOCUS_08690 gene ispF 1622 1149 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_08690 2340 1642 gene locus_tag LOCUS_08700 gene ispD 2340 1642 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_08700 3668 2397 gene locus_tag LOCUS_08710 3668 2397 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_08710 4284 3754 gene locus_tag LOCUS_08720 4284 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence119 1149 247 gene locus_tag LOCUS_08730 1149 247 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_08730 2037 1366 gene locus_tag LOCUS_08740 2037 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1588 1597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2180 2046 gene locus_tag LOCUS_08750 2180 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2706 2188 gene locus_tag LOCUS_08760 2706 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 2218 2227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4537 2681 gene locus_tag LOCUS_08770 4537 2681 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_08770 4747 4550 gene locus_tag LOCUS_08780 4747 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence120 77 937 gene locus_tag LOCUS_08790 gene metF 77 937 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_08790 934 1578 gene locus_tag LOCUS_08800 934 1578 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_08800 1571 3970 gene locus_tag LOCUS_08810 1571 3970 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_08810 4080 4496 gene locus_tag LOCUS_08820 4080 4496 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_08820 4530 4763 gene locus_tag LOCUS_08830 4530 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence121 1867 200 gene locus_tag LOCUS_08840 gene ilvB 1867 200 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_08840 2629 2039 gene locus_tag LOCUS_08850 2629 2039 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 protein_id gnl|my_center|LOCUS_08850 3001 2642 gene locus_tag LOCUS_08860 3001 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3794 3099 gene locus_tag LOCUS_08870 3794 3099 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_08870 4724 3990 gene locus_tag LOCUS_08880 4724 3990 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence122 231 1532 gene locus_tag LOCUS_08890 231 1532 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_08890 1569 2501 gene locus_tag LOCUS_08900 gene cysK 1569 2501 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_08900 2509 3225 gene locus_tag LOCUS_08910 2509 3225 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_08910 3347 3643 gene locus_tag LOCUS_08920 gene rpsF 3347 3643 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_08920 3683 4183 gene locus_tag LOCUS_08930 gene ssb 3683 4183 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_08930 4229 4468 gene locus_tag LOCUS_08940 gene rpsR 4229 4468 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence123 1280 3 gene locus_tag LOCUS_08950 1280 3 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921827.1 protein_id gnl|my_center|LOCUS_08950 2801 1365 gene locus_tag LOCUS_08960 gene purB 2801 1365 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_08960 4285 2819 gene locus_tag LOCUS_08970 gene purF 4285 2819 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_08970 4515 4524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence124 469 478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1011 502 gene locus_tag LOCUS_08980 1011 502 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_08980 2455 1013 gene locus_tag LOCUS_08990 gene pyk 2455 1013 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_08990 4606 2663 gene locus_tag LOCUS_09000 4606 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence125 4098 61 gene locus_tag LOCUS_09010 4098 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence126 487 2109 gene locus_tag LOCUS_09020 487 2109 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_09020 2122 2613 gene locus_tag LOCUS_09030 gene ilvN 2122 2613 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_09030 2674 3714 gene locus_tag LOCUS_09040 gene ilvC 2674 3714 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence127 115 324 gene locus_tag LOCUS_09050 115 324 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_09050 399 656 gene locus_tag LOCUS_09060 399 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1371 601 gene locus_tag LOCUS_09070 1371 601 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_09070 2935 1394 gene locus_tag LOCUS_09080 2935 1394 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_09080 3314 3739 gene locus_tag LOCUS_09090 3314 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3879 4589 gene locus_tag LOCUS_09100 3879 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence128 203 451 gene locus_tag LOCUS_09110 203 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 473 3616 gene locus_tag LOCUS_09120 473 3616 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_09120 3613 4344 gene locus_tag LOCUS_09130 3613 4344 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence129 476 147 gene locus_tag LOCUS_09140 gene trxA 476 147 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_09140 1537 704 gene locus_tag LOCUS_09150 1537 704 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_09150 2913 1708 gene locus_tag LOCUS_09160 2913 1708 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_09160 3177 3001 gene locus_tag LOCUS_09170 3177 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3608 3174 gene locus_tag LOCUS_09180 3608 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4059 3601 gene locus_tag LOCUS_09190 4059 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence130 335 682 gene locus_tag LOCUS_09200 335 682 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_09200 1534 866 gene locus_tag LOCUS_09210 1534 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1733 2359 gene locus_tag LOCUS_09220 1733 2359 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836545.1 protein_id gnl|my_center|LOCUS_09220 2461 3531 gene locus_tag LOCUS_09230 gene leuB 2461 3531 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_09230 3535 4266 gene locus_tag LOCUS_09240 3535 4266 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence131 51 623 gene locus_tag LOCUS_09250 51 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 697 2370 gene locus_tag LOCUS_09260 gene hcp 697 2370 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_09260 3669 2521 gene locus_tag LOCUS_09270 3669 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence132 <1 506 gene locus_tag LOCUS_09280 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404734.1:inorganic diphosphatase 840 634 gene locus_tag LOCUS_09290 840 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 975 1805 gene locus_tag LOCUS_09300 gene pgeF 975 1805 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_09300 2819 1854 gene locus_tag LOCUS_09310 2819 1854 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence133 365 2458 gene locus_tag LOCUS_09320 365 2458 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_09320 2592 4292 gene locus_tag LOCUS_09330 2592 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence134 <1 837 gene locus_tag LOCUS_09340 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047861.1:ribosome biogenesis GTPase YlqF 840 1445 gene locus_tag LOCUS_09350 840 1445 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_09350 1442 1804 gene locus_tag LOCUS_09360 1442 1804 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965070.1 protein_id gnl|my_center|LOCUS_09360 1817 2755 gene locus_tag LOCUS_09370 1817 2755 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_09370 2798 4306 gene locus_tag LOCUS_09380 gene thrC 2798 4306 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence135 1936 290 gene locus_tag LOCUS_09390 1936 290 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286533.1 protein_id gnl|my_center|LOCUS_09390 2237 1923 gene locus_tag LOCUS_09400 2237 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2686 2366 gene locus_tag LOCUS_09410 2686 2366 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286540.1 protein_id gnl|my_center|LOCUS_09410 3098 2649 gene locus_tag LOCUS_09420 3098 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3832 3095 gene locus_tag LOCUS_09430 3832 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4330 4169 gene locus_tag LOCUS_09440 4330 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence136 <1 1403 gene locus_tag LOCUS_09450 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811135.1:bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 1471 2796 gene locus_tag LOCUS_09460 1471 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2922 3509 gene locus_tag LOCUS_09470 2922 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4369 3635 gene locus_tag LOCUS_09480 4369 3635 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence137 149 832 gene locus_tag LOCUS_09490 149 832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723595.1 protein_id gnl|my_center|LOCUS_09490 909 2390 gene locus_tag LOCUS_09500 909 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3475 2432 gene locus_tag LOCUS_09510 3475 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3777 3466 gene locus_tag LOCUS_09520 3777 3466 CDS product Nif11-like leader peptide family natural product precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439731.1 protein_id gnl|my_center|LOCUS_09520 3993 3838 gene locus_tag LOCUS_09530 3993 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence138 1669 1064 gene locus_tag LOCUS_09540 1669 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2239 1796 gene locus_tag LOCUS_09550 2239 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 3021 2239 gene locus_tag LOCUS_09560 3021 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 <4310 3024 gene locus_tag LOCUS_09570 <4310 3024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989949.1:tape measure protein >Feature sequence139 114 1040 gene locus_tag LOCUS_09580 114 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1109 2278 gene locus_tag LOCUS_09590 gene rmuC 1109 2278 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_09590 2641 2336 gene locus_tag LOCUS_09600 2641 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3841 2645 gene locus_tag LOCUS_09610 3841 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4282 3902 gene locus_tag LOCUS_09620 4282 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence140 1131 76 gene locus_tag LOCUS_09630 1131 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1495 2142 gene locus_tag LOCUS_09640 1495 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2209 2772 gene locus_tag LOCUS_09650 2209 2772 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_09650 4035 3076 gene locus_tag LOCUS_09660 4035 3076 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence141 50 126 gene locus_tag LOCUS_t00080 50 126 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 132 206 gene locus_tag LOCUS_t00090 132 206 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 216 303 gene locus_tag LOCUS_t00100 216 303 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 372 381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1090 677 gene locus_tag LOCUS_09670 1090 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2147 1035 gene locus_tag LOCUS_09680 2147 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2497 2186 gene locus_tag LOCUS_09690 2497 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3879 2518 gene locus_tag LOCUS_09700 3879 2518 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_09700 4182 3913 gene locus_tag LOCUS_09710 4182 3913 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416152.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence142 1390 470 gene locus_tag LOCUS_09720 1390 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1423 1432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3224 1548 gene locus_tag LOCUS_09730 gene leuA 3224 1548 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence143 1538 564 gene locus_tag LOCUS_09740 1538 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3185 1551 gene locus_tag LOCUS_09750 3185 1551 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_09750 3417 3187 gene locus_tag LOCUS_09760 3417 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3544 3419 gene locus_tag LOCUS_09770 3544 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4244 3528 gene locus_tag LOCUS_09780 4244 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3567 3576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence144 105 1193 gene locus_tag LOCUS_09790 105 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09790 1190 3463 gene locus_tag LOCUS_09800 1190 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09800 1210 1219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence145 1209 67 gene locus_tag LOCUS_09810 1209 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1883 1206 gene locus_tag LOCUS_09820 1883 1206 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_09820 2490 3155 gene locus_tag LOCUS_09830 2490 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3161 4138 gene locus_tag LOCUS_09840 3161 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3774 3783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence146 <1 1686 gene locus_tag LOCUS_09850 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898459.1:Na/Pi cotransporter family protein 2449 1802 gene locus_tag LOCUS_09860 2449 1802 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_09860 2693 3406 gene locus_tag LOCUS_09870 2693 3406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence147 151 1062 gene locus_tag LOCUS_09880 151 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1081 1428 gene locus_tag LOCUS_tm00010 1081 1428 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2805 1477 gene locus_tag LOCUS_09890 2805 1477 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_09890 3500 2820 gene locus_tag LOCUS_09900 3500 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3811 4065 gene locus_tag LOCUS_09910 3811 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence148 44 1156 gene locus_tag LOCUS_09920 44 1156 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_09920 2144 1212 gene locus_tag LOCUS_09930 2144 1212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_09930 3057 2146 gene locus_tag LOCUS_09940 3057 2146 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_09940 3619 3173 gene locus_tag LOCUS_09950 3619 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4069 3629 gene locus_tag LOCUS_09960 4069 3629 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722849.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence149 333 812 gene locus_tag LOCUS_09970 333 812 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_09970 898 2058 gene locus_tag LOCUS_09980 gene nusA 898 2058 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_09980 2083 2391 gene locus_tag LOCUS_09990 2083 2391 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_09990 2407 2739 gene locus_tag LOCUS_10000 2407 2739 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence150 3953 216 gene locus_tag LOCUS_10010 3953 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence151 <1 1240 gene locus_tag LOCUS_10020 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965142.1:DNA mismatch repair protein MutS 1259 3376 gene locus_tag LOCUS_10030 gene mutL 1259 3376 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047674.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence152 2239 95 gene locus_tag LOCUS_10040 2239 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3198 2236 gene locus_tag LOCUS_10050 3198 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 <4113 3201 gene locus_tag LOCUS_10060 <4113 3201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250797.1:MoxR family ATPase >Feature sequence153 161 1708 gene locus_tag LOCUS_10070 161 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1962 1780 gene locus_tag LOCUS_10080 1962 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2121 2462 gene locus_tag LOCUS_10090 2121 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10090 2322 2331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2462 2641 gene locus_tag LOCUS_10100 2462 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10100 2828 4036 gene locus_tag LOCUS_10110 2828 4036 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence154 796 14 gene locus_tag LOCUS_10120 gene accA 796 14 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818794.1 protein_id gnl|my_center|LOCUS_10120 1662 799 gene locus_tag LOCUS_10130 gene accD 1662 799 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_10130 3026 1668 gene locus_tag LOCUS_10140 3026 1668 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_10140 3503 3045 gene locus_tag LOCUS_10150 3503 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3088 3097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3989 3516 gene locus_tag LOCUS_10160 gene accB 3989 3516 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831211.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence155 277 2223 gene locus_tag LOCUS_10170 gene thrS 277 2223 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_10170 2251 3045 gene locus_tag LOCUS_10180 2251 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3135 3338 gene locus_tag LOCUS_10190 gene rpmE 3135 3338 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_10190 3441 4070 gene locus_tag LOCUS_10200 3441 4070 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence156 <1 1066 gene locus_tag LOCUS_10210 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869638.1:glutamyl-tRNA reductase 1066 1680 gene locus_tag LOCUS_10220 1066 1680 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_10220 1144 1153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1677 2537 gene locus_tag LOCUS_10230 gene hemC 1677 2537 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870073.1 protein_id gnl|my_center|LOCUS_10230 2530 3492 gene locus_tag LOCUS_10240 2530 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3504 3513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 60 2333 gene locus_tag LOCUS_10250 60 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2334 2678 gene locus_tag LOCUS_10260 2334 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 2641 2650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2657 3196 gene locus_tag LOCUS_10270 2657 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 3396 3836 gene locus_tag LOCUS_10280 3396 3836 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence158 2065 683 gene locus_tag LOCUS_10290 gene clpX 2065 683 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965927.1 protein_id gnl|my_center|LOCUS_10290 744 753 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2662 2081 gene locus_tag LOCUS_10300 gene clpP 2662 2081 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_10300 3997 2717 gene locus_tag LOCUS_10310 gene tig 3997 2717 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence159 1452 271 gene locus_tag LOCUS_10320 gene metK 1452 271 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_10320 1760 2248 gene locus_tag LOCUS_10330 1760 2248 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_10330 2279 2611 gene locus_tag LOCUS_10340 2279 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2694 2915 gene locus_tag LOCUS_10350 2694 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3407 2964 gene locus_tag LOCUS_10360 3407 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3632 3763 gene locus_tag LOCUS_10370 3632 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence160 <1 521 gene locus_tag LOCUS_10380 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393885.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein 612 1463 gene locus_tag LOCUS_10390 612 1463 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_10390 2439 1600 gene locus_tag LOCUS_10400 gene nadC 2439 1600 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454666.1 protein_id gnl|my_center|LOCUS_10400 3905 2439 gene locus_tag LOCUS_10410 gene nadB 3905 2439 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence161 61 1359 gene locus_tag LOCUS_10420 61 1359 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_10420 2444 1866 gene locus_tag LOCUS_10430 2444 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3487 2444 gene locus_tag LOCUS_10440 gene holA 3487 2444 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583467.1 protein_id gnl|my_center|LOCUS_10440 3980 3489 gene locus_tag LOCUS_10450 3980 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence162 <1 524 gene locus_tag LOCUS_10460 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107164.1:NAD(+) synthase 550 1050 gene locus_tag LOCUS_10470 550 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1241 1723 gene locus_tag LOCUS_10480 1241 1723 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_10480 1720 2898 gene locus_tag LOCUS_10490 1720 2898 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_10490 2902 3771 gene locus_tag LOCUS_10500 gene ispE 2902 3771 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence163 1405 605 gene locus_tag LOCUS_10510 gene proC 1405 605 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_10510 3887 1434 gene locus_tag LOCUS_10520 3887 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence164 1487 96 gene locus_tag LOCUS_10530 1487 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2816 1563 gene locus_tag LOCUS_10540 gene murA 2816 1563 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_10540 <3934 2879 gene locus_tag LOCUS_10550 <3934 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286637.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence165 485 153 gene locus_tag LOCUS_10560 485 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 606 788 gene locus_tag LOCUS_10570 606 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 876 1784 gene locus_tag LOCUS_10580 876 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1846 2385 gene locus_tag LOCUS_10590 1846 2385 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_10590 2398 2919 gene locus_tag LOCUS_10600 2398 2919 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_10600 2951 3847 gene locus_tag LOCUS_10610 2951 3847 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence166 2493 136 gene locus_tag LOCUS_10620 2493 136 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_10620 2391 2490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2890 2573 gene locus_tag LOCUS_10630 2890 2573 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_10630 3809 3093 gene locus_tag LOCUS_10640 3809 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence167 397 209 gene locus_tag LOCUS_10650 397 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1602 415 gene locus_tag LOCUS_10660 gene gltS 1602 415 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_10660 2580 1624 gene locus_tag LOCUS_10670 2580 1624 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_10670 3853 2747 gene locus_tag LOCUS_10680 gene ftsZ 3853 2747 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence168 89 1801 gene locus_tag LOCUS_10690 89 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1875 2885 gene locus_tag LOCUS_10700 gene spoVAD 1875 2885 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_10700 3028 3576 gene locus_tag LOCUS_10710 3028 3576 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965733.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence169 943 770 gene locus_tag LOCUS_10720 943 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3469 977 gene locus_tag LOCUS_10730 3469 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3779 3558 gene locus_tag LOCUS_10740 3779 3558 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence170 2 1156 gene locus_tag LOCUS_10750 2 1156 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_10750 2796 1468 gene locus_tag LOCUS_10760 gene cdeA 2796 1468 CDS product multidrug efflux MATE transporter CdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902537.1 protein_id gnl|my_center|LOCUS_10760 2942 3583 gene locus_tag LOCUS_10770 2942 3583 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263756.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence171 89 862 gene locus_tag LOCUS_10780 89 862 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_10780 2026 1196 gene locus_tag LOCUS_10790 2026 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2604 2026 gene locus_tag LOCUS_10800 2604 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3347 2757 gene locus_tag LOCUS_10810 3347 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence172 <1 808 gene locus_tag LOCUS_10820 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965382.1:exodeoxyribonuclease VII large subunit 810 2489 gene locus_tag LOCUS_10830 810 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10830 2459 2468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence173 1136 168 gene locus_tag LOCUS_10840 gene ansA 1136 168 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_10840 1646 1182 gene locus_tag LOCUS_10850 1646 1182 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_10850 2935 1646 gene locus_tag LOCUS_10860 2935 1646 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_10860 3185 3261 gene locus_tag LOCUS_t00110 3185 3261 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3745 3422 gene locus_tag LOCUS_10870 3745 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence174 673 68 gene locus_tag LOCUS_10880 673 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1686 778 gene locus_tag LOCUS_10890 1686 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3419 1701 gene locus_tag LOCUS_10900 3419 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence175 1239 10 gene locus_tag LOCUS_10910 gene fabF 1239 10 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_10910 2000 1257 gene locus_tag LOCUS_10920 gene fabG 2000 1257 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_10920 2925 2023 gene locus_tag LOCUS_10930 gene fabD 2925 2023 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10930 <3751 2913 gene locus_tag LOCUS_10940 <3751 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966839.1:enoyl-[acyl-carrier-protein] reductase FabK >Feature sequence176 68 931 gene locus_tag LOCUS_10950 68 931 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_10950 2539 935 gene locus_tag LOCUS_10960 2539 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2845 3495 gene locus_tag LOCUS_10970 2845 3495 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence177 46 1401 gene locus_tag LOCUS_10980 46 1401 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930606.1 protein_id gnl|my_center|LOCUS_10980 1597 3543 gene locus_tag LOCUS_10990 gene metG 1597 3543 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence178 572 159 gene locus_tag LOCUS_11000 572 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2533 584 gene locus_tag LOCUS_11010 2533 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <3693 2559 gene locus_tag LOCUS_11020 <3693 2559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391742.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence179 118 774 gene locus_tag LOCUS_11030 118 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 777 1460 gene locus_tag LOCUS_11040 777 1460 CDS product DUF5343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018604446.1 protein_id gnl|my_center|LOCUS_11040 3010 2204 gene locus_tag LOCUS_11050 3010 2204 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244218.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence180 1217 9 gene locus_tag LOCUS_11060 1217 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2233 1235 gene locus_tag LOCUS_11070 gene trpS 2233 1235 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_11070 3433 2249 gene locus_tag LOCUS_11080 3433 2249 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence181 827 1309 gene locus_tag LOCUS_11090 gene greA 827 1309 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_11090 1398 3311 gene locus_tag LOCUS_11100 gene lysS 1398 3311 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence182 1331 75 gene locus_tag LOCUS_11110 gene eno 1331 75 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_11110 1510 1815 gene locus_tag LOCUS_11120 1510 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2241 1870 gene locus_tag LOCUS_11130 2241 1870 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_11130 3354 2251 gene locus_tag LOCUS_11140 gene rpoD 3354 2251 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence183 186 1148 gene locus_tag LOCUS_11150 186 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1368 2090 gene locus_tag LOCUS_11160 gene rpsB 1368 2090 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_11160 2147 3058 gene locus_tag LOCUS_11170 gene tsf 2147 3058 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence184 2237 1071 gene locus_tag LOCUS_11180 2237 1071 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_11180 2629 2324 gene locus_tag LOCUS_11190 2629 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3362 2619 gene locus_tag LOCUS_11200 3362 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence185 9 875 gene locus_tag LOCUS_11210 9 875 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_11210 2579 897 gene locus_tag LOCUS_11220 2579 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476406.1 protein_id gnl|my_center|LOCUS_11220 3560 2598 gene locus_tag LOCUS_11230 3560 2598 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence186 266 1216 gene locus_tag LOCUS_11240 gene spoIIIAA 266 1216 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_11240 1093 1102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1329 1700 gene locus_tag LOCUS_11250 1329 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1709 1903 gene locus_tag LOCUS_11260 1709 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1905 2294 gene locus_tag LOCUS_11270 1905 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2304 3422 gene locus_tag LOCUS_11280 2304 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence187 2263 242 gene locus_tag LOCUS_11290 2263 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2790 2287 gene locus_tag LOCUS_11300 2790 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 <3556 2787 gene locus_tag LOCUS_11310 <3556 2787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945174.1:rod shape-determining protein MreC >Feature sequence188 1192 278 gene locus_tag LOCUS_11320 gene truB 1192 278 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_11320 2127 1189 gene locus_tag LOCUS_11330 2127 1189 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_11330 2491 2114 gene locus_tag LOCUS_11340 2491 2114 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_11340 <3550 2571 gene locus_tag LOCUS_11350 <3550 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003388357.1:translation initiation factor IF-2 >Feature sequence189 317 144 gene locus_tag LOCUS_11360 317 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 903 310 gene locus_tag LOCUS_11370 903 310 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208152.1 protein_id gnl|my_center|LOCUS_11370 1152 2561 gene locus_tag LOCUS_11380 1152 2561 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_11380 2608 3423 gene locus_tag LOCUS_11390 2608 3423 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349559.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence190 1923 616 gene locus_tag LOCUS_11400 1923 616 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_11400 2268 2080 gene locus_tag LOCUS_11410 gene rpmF 2268 2080 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_11410 2790 2296 gene locus_tag LOCUS_11420 2790 2296 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence191 <1 524 gene locus_tag LOCUS_11430 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393868.1:TIGR01440 family protein 706 3420 gene locus_tag LOCUS_11440 706 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence192 58 1422 gene locus_tag LOCUS_11450 58 1422 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_11450 2156 1716 gene locus_tag LOCUS_11460 2156 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2454 3392 gene locus_tag LOCUS_11470 2454 3392 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence193 852 70 gene locus_tag LOCUS_11480 gene sigG 852 70 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_11480 1065 1442 gene locus_tag LOCUS_11490 1065 1442 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548042.1 protein_id gnl|my_center|LOCUS_11490 1435 2331 gene locus_tag LOCUS_11500 1435 2331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence194 1193 783 gene locus_tag LOCUS_11510 1193 783 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_11510 1964 1254 gene locus_tag LOCUS_11520 1964 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2439 1957 gene locus_tag LOCUS_11530 2439 1957 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_11530 2578 2769 gene locus_tag LOCUS_11540 2578 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3285 2836 gene locus_tag LOCUS_11550 3285 2836 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence195 675 2879 gene locus_tag LOCUS_11560 675 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 <3463 2963 gene locus_tag LOCUS_11570 <3463 2963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880065.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence196 349 62 gene locus_tag LOCUS_11580 349 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 479 1351 gene locus_tag LOCUS_11590 479 1351 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_11590 1618 2421 gene locus_tag LOCUS_11600 1618 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2432 3133 gene locus_tag LOCUS_11610 gene sigE 2432 3133 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_11610 3455 3216 gene locus_tag LOCUS_11620 3455 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence197 120 308 gene locus_tag LOCUS_11630 gene rpmB 120 308 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_11630 2058 454 gene locus_tag LOCUS_11640 2058 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3403 2333 gene locus_tag LOCUS_11650 3403 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence198 50 766 gene locus_tag LOCUS_11660 50 766 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_11660 759 1454 gene locus_tag LOCUS_11670 759 1454 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_11670 1444 3306 gene locus_tag LOCUS_11680 1444 3306 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence199 556 50 gene locus_tag LOCUS_11690 556 50 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360775.1 protein_id gnl|my_center|LOCUS_11690 1084 1839 gene locus_tag LOCUS_11700 1084 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1829 2551 gene locus_tag LOCUS_11710 1829 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2902 3372 gene locus_tag LOCUS_11720 2902 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence200 650 324 gene locus_tag LOCUS_11730 650 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1014 643 gene locus_tag LOCUS_11740 1014 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1096 2373 gene locus_tag LOCUS_11750 1096 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2580 2392 gene locus_tag LOCUS_11760 2580 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2706 2948 gene locus_tag LOCUS_11770 2706 2948 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_11770 2945 3322 gene locus_tag LOCUS_11780 2945 3322 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence201 434 1141 gene locus_tag LOCUS_11790 434 1141 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_11790 1099 1108 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1167 2393 gene locus_tag LOCUS_11800 gene tyrS 1167 2393 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_11800 2462 2863 gene locus_tag LOCUS_11810 gene mscL 2462 2863 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence202 2057 780 gene locus_tag LOCUS_11820 2057 780 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_11820 3337 2072 gene locus_tag LOCUS_11830 3337 2072 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence203 3027 2746 gene locus_tag LOCUS_11840 3027 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence204 121 513 gene locus_tag LOCUS_11850 121 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 653 916 gene locus_tag LOCUS_11860 gene rpsO 653 916 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_11860 1143 3362 gene locus_tag LOCUS_11870 gene pnp 1143 3362 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence205 1779 1225 gene locus_tag LOCUS_11880 1779 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3082 2507 gene locus_tag LOCUS_11890 3082 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence206 113 283 gene locus_tag LOCUS_11900 113 283 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_11900 360 1100 gene locus_tag LOCUS_11910 360 1100 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_11910 1097 1921 gene locus_tag LOCUS_11920 gene rsmI 1097 1921 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_11920 1922 3232 gene locus_tag LOCUS_11930 1922 3232 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence207 376 843 gene locus_tag LOCUS_11940 376 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 386 395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 912 1817 gene locus_tag LOCUS_11950 gene murB 912 1817 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_11950 1838 2701 gene locus_tag LOCUS_11960 gene rapZ 1838 2701 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence208 >Feature sequence209 123 932 gene locus_tag LOCUS_11970 123 932 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_11970 1078 2037 gene locus_tag LOCUS_11980 1078 2037 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence210 57 641 gene locus_tag LOCUS_11990 57 641 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_11990 658 1170 gene locus_tag LOCUS_12000 658 1170 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_12000 2449 1229 gene locus_tag LOCUS_12010 2449 1229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence211 1083 151 gene locus_tag LOCUS_12020 1083 151 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_12020 1649 1104 gene locus_tag LOCUS_12030 1649 1104 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_12030 1701 2594 gene locus_tag LOCUS_12040 1701 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence212 1409 708 gene locus_tag LOCUS_12050 1409 708 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_12050 2545 2066 gene locus_tag LOCUS_12060 2545 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence213 <3218 1678 gene locus_tag LOCUS_12070 <3218 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272342.1:DNA translocase FtsK >Feature sequence214 809 1168 gene locus_tag LOCUS_12080 809 1168 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_12080 1165 1308 gene locus_tag LOCUS_12090 1165 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1301 1477 gene locus_tag LOCUS_12100 1301 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence215 <1 689 gene locus_tag LOCUS_12110 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439379.1:ferrous iron transport protein B 255 264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1490 681 gene locus_tag LOCUS_12120 1490 681 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_12120 2928 1555 gene locus_tag LOCUS_12130 gene scfB 2928 1555 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence216 1991 159 gene locus_tag LOCUS_12140 gene asnB 1991 159 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_12140 3075 2005 gene locus_tag LOCUS_12150 gene ylbJ 3075 2005 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965047.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence217 213 222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 297 1163 gene locus_tag LOCUS_12160 gene fba 297 1163 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_12160 1412 1957 gene locus_tag LOCUS_12170 1412 1957 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_12170 1935 2345 gene locus_tag LOCUS_12180 1935 2345 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_12180 2879 3004 gene locus_tag LOCUS_12190 2879 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence218 123 389 gene locus_tag LOCUS_12200 123 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 600 896 gene locus_tag LOCUS_12210 600 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 989 1411 gene locus_tag LOCUS_12220 989 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence219 1685 918 gene locus_tag LOCUS_12230 1685 918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_12230 2329 1685 gene locus_tag LOCUS_12240 2329 1685 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_12240 3055 2372 gene locus_tag LOCUS_12250 3055 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence220 1416 13 gene locus_tag LOCUS_12260 1416 13 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_12260 3026 1440 gene locus_tag LOCUS_12270 3026 1440 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence221 2578 2273 gene locus_tag LOCUS_12280 2578 2273 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_12280 2786 3055 gene locus_tag LOCUS_12290 2786 3055 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence222 452 2482 gene locus_tag LOCUS_12300 452 2482 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859398.1 protein_id gnl|my_center|LOCUS_12300 2501 3046 gene locus_tag LOCUS_12310 2501 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence223 801 181 gene locus_tag LOCUS_12320 801 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1435 821 gene locus_tag LOCUS_12330 gene scpB 1435 821 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_12330 2208 1435 gene locus_tag LOCUS_12340 2208 1435 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_12340 2951 2253 gene locus_tag LOCUS_12350 2951 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence224 970 74 gene locus_tag LOCUS_12360 gene ftsX 970 74 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_12360 1773 1009 gene locus_tag LOCUS_12370 gene ftsE 1773 1009 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_12370 2959 1874 gene locus_tag LOCUS_12380 2959 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence225 37 1539 gene locus_tag LOCUS_12390 37 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence226 2458 1286 gene locus_tag LOCUS_12400 2458 1286 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence227 <1 2799 gene locus_tag LOCUS_12410 <1 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965560.1:helicase-exonuclease AddAB subunit AddA >Feature sequence228 120 2444 gene locus_tag LOCUS_12420 gene spoIIE 120 2444 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence229 438 310 gene locus_tag LOCUS_12430 438 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1646 552 gene locus_tag LOCUS_12440 gene ychF 1646 552 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_12440 1812 2201 gene locus_tag LOCUS_12450 1812 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2191 2856 gene locus_tag LOCUS_12460 2191 2856 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence230 1405 83 gene locus_tag LOCUS_12470 1405 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2186 1389 gene locus_tag LOCUS_12480 2186 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2879 2379 gene locus_tag LOCUS_12490 2879 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence231 1038 1583 gene locus_tag LOCUS_12500 1038 1583 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_12500 2897 1734 gene locus_tag LOCUS_12510 2897 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence232 286 495 gene locus_tag LOCUS_12520 286 495 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_12520 1111 539 gene locus_tag LOCUS_12530 1111 539 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_12530 1983 1108 gene locus_tag LOCUS_12540 gene dpaA 1983 1108 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 protein_id gnl|my_center|LOCUS_12540 2764 2093 gene locus_tag LOCUS_12550 2764 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence233 <1 519 gene locus_tag LOCUS_12560 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358905.1:elongation factor P 540 1028 gene locus_tag LOCUS_12570 540 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_12570 1076 1729 gene locus_tag LOCUS_12580 1076 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence234 240 872 gene locus_tag LOCUS_12590 240 872 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_12590 1892 1164 gene locus_tag LOCUS_12600 1892 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2429 2013 gene locus_tag LOCUS_12610 2429 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence235 51 1286 gene locus_tag LOCUS_12620 51 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1472 2707 gene locus_tag LOCUS_12630 1472 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence236 1401 4 gene locus_tag LOCUS_12640 1401 4 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_12640 1764 1970 gene locus_tag LOCUS_12650 1764 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1975 2274 gene locus_tag LOCUS_12660 1975 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2879 2271 gene locus_tag LOCUS_12670 2879 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence237 >Feature sequence238 18 432 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaataaccctatataatttctactattgtagat 1050 1274 gene locus_tag LOCUS_12680 1050 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1300 1980 gene locus_tag LOCUS_12690 1300 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1999 2295 gene locus_tag LOCUS_12700 1999 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2285 2476 gene locus_tag LOCUS_12710 2285 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2561 2764 gene locus_tag LOCUS_12720 2561 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence239 1 138 gene locus_tag LOCUS_12730 1 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 162 359 gene locus_tag LOCUS_12740 gene rpmI 162 359 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_12740 402 752 gene locus_tag LOCUS_12750 gene rplT 402 752 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_12750 942 1541 gene locus_tag LOCUS_12760 942 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 1529 1538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence240 117 2717 gene locus_tag LOCUS_12770 117 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence241 <1 708 gene locus_tag LOCUS_12780 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922420.1:HAD family hydrolase 811 1197 gene locus_tag LOCUS_12790 811 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1254 1463 gene locus_tag LOCUS_12800 1254 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2600 1674 gene locus_tag LOCUS_12810 2600 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence242 <1 2130 gene locus_tag LOCUS_12820 <1 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895217.1:Tex family protein >Feature sequence243 54 1058 gene locus_tag LOCUS_12830 54 1058 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_12830 1135 2100 gene locus_tag LOCUS_12840 1135 2100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563799.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence244 154 1083 gene locus_tag LOCUS_12850 154 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1778 1437 gene locus_tag LOCUS_12860 gene rplQ 1778 1437 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_12860 2678 1851 gene locus_tag LOCUS_12870 2678 1851 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence245 1357 95 gene locus_tag LOCUS_12880 1357 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2610 1375 gene locus_tag LOCUS_12890 2610 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence246 2653 2036 gene locus_tag LOCUS_12900 2653 2036 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence247 >Feature sequence248 28 1008 gene locus_tag LOCUS_12910 gene plsX 28 1008 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_12910 1043 1720 gene locus_tag LOCUS_12920 gene rnc 1043 1720 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_12920 1767 2708 gene locus_tag LOCUS_12930 1767 2708 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence249 1672 191 gene locus_tag LOCUS_12940 1672 191 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_12940 1866 2492 gene locus_tag LOCUS_12950 gene upp 1866 2492 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence250 627 636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 645 1322 gene locus_tag LOCUS_12960 645 1322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_12960 1315 2541 gene locus_tag LOCUS_12970 1315 2541 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence251 1045 1176 gene locus_tag LOCUS_12980 1045 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1245 1460 gene locus_tag LOCUS_12990 1245 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence252 159 716 gene locus_tag LOCUS_13000 159 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 703 1458 gene locus_tag LOCUS_13010 703 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1445 2137 gene locus_tag LOCUS_13020 1445 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence253 93 530 gene locus_tag LOCUS_13030 93 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13030 1761 883 gene locus_tag LOCUS_13040 1761 883 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_13040 <2627 1761 gene locus_tag LOCUS_13050 <2627 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004112931.1:sugar ABC transporter permease >Feature sequence254 2302 707 gene locus_tag LOCUS_13060 2302 707 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence255 121 1395 gene locus_tag LOCUS_13070 121 1395 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_13070 1459 1692 gene locus_tag LOCUS_13080 1459 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1705 2577 gene locus_tag LOCUS_13090 1705 2577 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence256 166 1668 gene locus_tag LOCUS_13100 166 1668 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence257 930 610 gene locus_tag LOCUS_13110 930 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1253 933 gene locus_tag LOCUS_13120 1253 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1667 1371 gene locus_tag LOCUS_13130 1667 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1929 1738 gene locus_tag LOCUS_13140 1929 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2144 1956 gene locus_tag LOCUS_13150 2144 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2362 2162 gene locus_tag LOCUS_13160 2362 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence258 1858 140 gene locus_tag LOCUS_13170 1858 140 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460335.1 protein_id gnl|my_center|LOCUS_13170 <2587 1855 gene locus_tag LOCUS_13180 <2587 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460336.1:response regulator transcription factor >Feature sequence259 289 2115 gene locus_tag LOCUS_13190 gene recQ 289 2115 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence260 380 664 gene locus_tag LOCUS_13200 380 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2449 941 gene locus_tag LOCUS_13210 2449 941 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence261 835 2520 gene locus_tag LOCUS_13220 835 2520 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence262 <1 974 gene locus_tag LOCUS_13230 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963814.1:alanine racemase >Feature sequence263 158 1150 gene locus_tag LOCUS_13240 gene galE 158 1150 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence264 152 1345 gene locus_tag LOCUS_13250 152 1345 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_13250 1356 1577 gene locus_tag LOCUS_13260 1356 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence265 2186 765 gene locus_tag LOCUS_13270 2186 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 >Feature sequence266 4 1737 gene locus_tag LOCUS_13280 4 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2466 1894 gene locus_tag LOCUS_13290 2466 1894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_13290