>Feature sequence01 3757 611 gene locus_tag LOCUS_00010 3757 611 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_00010 5341 3812 gene locus_tag LOCUS_00020 5341 3812 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211645.1 protein_id gnl|my_center|LOCUS_00020 7597 6137 gene locus_tag LOCUS_00030 7597 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8266 7670 gene locus_tag LOCUS_00040 8266 7670 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_00040 8423 8755 gene locus_tag LOCUS_00050 8423 8755 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983741.1 protein_id gnl|my_center|LOCUS_00050 9433 8822 gene locus_tag LOCUS_00060 9433 8822 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_00060 10186 9488 gene locus_tag LOCUS_00070 10186 9488 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_00070 10288 10950 gene locus_tag LOCUS_00080 10288 10950 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_00080 12000 10999 gene locus_tag LOCUS_00090 12000 10999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_00090 12273 13778 gene locus_tag LOCUS_00100 gene glpK 12273 13778 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_00100 13852 15021 gene locus_tag LOCUS_00110 13852 15021 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_00110 15672 15022 gene locus_tag LOCUS_00120 15672 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15784 16422 gene locus_tag LOCUS_00130 15784 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16443 17063 gene locus_tag LOCUS_00140 16443 17063 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_00140 17076 17723 gene locus_tag LOCUS_00150 17076 17723 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_00150 19284 17827 gene locus_tag LOCUS_00160 19284 17827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_00160 19496 20533 gene locus_tag LOCUS_00170 19496 20533 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_00170 20553 22199 gene locus_tag LOCUS_00180 gene ilvB 20553 22199 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_00180 22212 22709 gene locus_tag LOCUS_00190 gene ilvN 22212 22709 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_00190 22726 24306 gene locus_tag LOCUS_00200 gene cimA 22726 24306 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_00200 24414 25103 gene locus_tag LOCUS_00210 24414 25103 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_00210 25110 26651 gene locus_tag LOCUS_00220 25110 26651 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_00220 26801 28303 gene locus_tag LOCUS_00230 26801 28303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28349 28498 gene locus_tag LOCUS_00240 28349 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29263 28559 gene locus_tag LOCUS_00250 29263 28559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_00250 30264 29266 gene locus_tag LOCUS_00260 30264 29266 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_00260 31209 30355 gene locus_tag LOCUS_00270 31209 30355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32103 31672 gene locus_tag LOCUS_00280 32103 31672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32696 32100 gene locus_tag LOCUS_00290 gene rdgB 32696 32100 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066929.1 protein_id gnl|my_center|LOCUS_00290 33643 32696 gene locus_tag LOCUS_00300 33643 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34877 33663 gene locus_tag LOCUS_00310 34877 33663 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_00310 35725 34874 gene locus_tag LOCUS_00320 gene dapF 35725 34874 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_00320 36283 35744 gene locus_tag LOCUS_00330 36283 35744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37661 36324 gene locus_tag LOCUS_00340 gene dnaA 37661 36324 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00340 37913 38047 gene locus_tag LOCUS_00350 gene rpmH 37913 38047 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_00350 38111 38473 gene locus_tag LOCUS_00360 gene rnpA 38111 38473 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_00360 38470 38724 gene locus_tag LOCUS_00370 gene yidD 38470 38724 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718107.1 protein_id gnl|my_center|LOCUS_00370 38724 39674 gene locus_tag LOCUS_00380 38724 39674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39699 40532 gene locus_tag LOCUS_00390 39699 40532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41630 40641 gene locus_tag LOCUS_00400 41630 40641 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129898.1 protein_id gnl|my_center|LOCUS_00400 41890 43023 gene locus_tag LOCUS_00410 41890 43023 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_00410 43039 44223 gene locus_tag LOCUS_00420 gene thiI 43039 44223 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_00420 44226 45470 gene locus_tag LOCUS_00430 44226 45470 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_00430 45491 46954 gene locus_tag LOCUS_00440 45491 46954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46967 49249 gene locus_tag LOCUS_00450 46967 49249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50392 49301 gene locus_tag LOCUS_00460 50392 49301 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881385.1 protein_id gnl|my_center|LOCUS_00460 51169 50821 gene locus_tag LOCUS_tm00010 51169 50821 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 51656 51198 gene locus_tag LOCUS_00470 gene smpB 51656 51198 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_00470 52741 51740 gene locus_tag LOCUS_00480 52741 51740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53624 52752 gene locus_tag LOCUS_00490 53624 52752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53879 54571 gene locus_tag LOCUS_00500 53879 54571 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_00500 54731 57109 gene locus_tag LOCUS_00510 54731 57109 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_00510 57217 58128 gene locus_tag LOCUS_00520 gene trxB 57217 58128 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_00520 58819 59328 gene locus_tag LOCUS_00530 58819 59328 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721853.1 protein_id gnl|my_center|LOCUS_00530 59425 59736 gene locus_tag LOCUS_00540 59425 59736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59822 60172 gene locus_tag LOCUS_00550 59822 60172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 61291 60443 gene locus_tag LOCUS_00560 61291 60443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62538 61288 gene locus_tag LOCUS_00570 62538 61288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 62673 64070 gene locus_tag LOCUS_00580 gene uxaC 62673 64070 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_00580 64067 64456 gene locus_tag LOCUS_00590 gene gcvH 64067 64456 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_00590 65105 64509 gene locus_tag LOCUS_00600 65105 64509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65970 65122 gene locus_tag LOCUS_00610 65970 65122 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_00610 66332 67381 gene locus_tag LOCUS_00620 gene mnmA 66332 67381 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460325.1 protein_id gnl|my_center|LOCUS_00620 67426 67989 gene locus_tag LOCUS_00630 gene dhaS 67426 67989 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 protein_id gnl|my_center|LOCUS_00630 69037 68189 gene locus_tag LOCUS_00640 69037 68189 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 protein_id gnl|my_center|LOCUS_00640 70113 69040 gene locus_tag LOCUS_00650 gene uxuA 70113 69040 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_00650 71138 70134 gene locus_tag LOCUS_00660 71138 70134 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_00660 73197 71161 gene locus_tag LOCUS_00670 73197 71161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74932 73358 gene locus_tag LOCUS_00680 74932 73358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76549 74960 gene locus_tag LOCUS_00690 76549 74960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 76716 77210 gene locus_tag LOCUS_00700 76716 77210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77503 77261 gene locus_tag LOCUS_00710 77503 77261 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_00710 78262 77519 gene locus_tag LOCUS_00720 gene recO 78262 77519 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518908.1 protein_id gnl|my_center|LOCUS_00720 79363 78464 gene locus_tag LOCUS_00730 gene era 79363 78464 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_00730 79904 79416 gene locus_tag LOCUS_00740 79904 79416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 80411 79905 gene locus_tag LOCUS_00750 gene ybeY 80411 79905 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_00750 81373 80408 gene locus_tag LOCUS_00760 81373 80408 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_00760 81705 82769 gene locus_tag LOCUS_00770 81705 82769 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_00770 82782 83171 gene locus_tag LOCUS_00780 82782 83171 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461457.1 protein_id gnl|my_center|LOCUS_00780 83168 83713 gene locus_tag LOCUS_00790 83168 83713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 83710 85065 gene locus_tag LOCUS_00800 gene rsxC 83710 85065 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869095.1 protein_id gnl|my_center|LOCUS_00800 85058 86050 gene locus_tag LOCUS_00810 85058 86050 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_00810 86047 86610 gene locus_tag LOCUS_00820 86047 86610 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_00820 86614 87333 gene locus_tag LOCUS_00830 86614 87333 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_00830 87330 87920 gene locus_tag LOCUS_00840 gene rsxA 87330 87920 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_00840 87937 88767 gene locus_tag LOCUS_00850 87937 88767 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_00850 88971 89585 gene locus_tag LOCUS_00860 88971 89585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 90764 89847 gene locus_tag LOCUS_00870 90764 89847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 91489 90911 gene locus_tag LOCUS_00880 91489 90911 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_00880 91696 91983 gene locus_tag LOCUS_00890 gene rpsF 91696 91983 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_00890 91994 92437 gene locus_tag LOCUS_00900 gene ssb 91994 92437 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272405.1 protein_id gnl|my_center|LOCUS_00900 92532 92777 gene locus_tag LOCUS_00910 gene rpsR 92532 92777 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_00910 92910 95309 gene locus_tag LOCUS_00920 92910 95309 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_00920 95590 95952 gene locus_tag LOCUS_00930 95590 95952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 protein_id gnl|my_center|LOCUS_00930 96630 97973 gene locus_tag LOCUS_00940 gene ffh 96630 97973 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_00940 98055 98300 gene locus_tag LOCUS_00950 gene rpsP 98055 98300 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_00950 98373 98606 gene locus_tag LOCUS_00960 98373 98606 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_00960 98606 99124 gene locus_tag LOCUS_00970 gene rimM 98606 99124 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_00970 99114 99848 gene locus_tag LOCUS_00980 gene trmD 99114 99848 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_00980 100077 100340 gene locus_tag LOCUS_00990 100077 100340 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_00990 100487 101254 gene locus_tag LOCUS_01000 100487 101254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 101359 101841 gene locus_tag LOCUS_01010 gene greA 101359 101841 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_01010 101879 103825 gene locus_tag LOCUS_01020 gene lysS 101879 103825 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_01020 103829 104530 gene locus_tag LOCUS_01030 103829 104530 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_01030 104573 105331 gene locus_tag LOCUS_01040 104573 105331 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_01040 105337 106149 gene locus_tag LOCUS_01050 105337 106149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025301480.1 protein_id gnl|my_center|LOCUS_01050 106165 106911 gene locus_tag LOCUS_01060 106165 106911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_01060 106930 107646 gene locus_tag LOCUS_01070 106930 107646 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_01070 107643 108668 gene locus_tag LOCUS_01080 107643 108668 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 protein_id gnl|my_center|LOCUS_01080 108749 109792 gene locus_tag LOCUS_01090 108749 109792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 109897 110637 gene locus_tag LOCUS_01100 109897 110637 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_01100 112192 111329 gene locus_tag LOCUS_01110 gene gpr 112192 111329 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_01110 112310 112567 gene locus_tag LOCUS_01120 gene rpsT 112310 112567 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726526.1 protein_id gnl|my_center|LOCUS_01120 112748 112927 gene locus_tag LOCUS_01130 112748 112927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113346 112981 gene locus_tag LOCUS_01140 gene spoVAE 113346 112981 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_01140 113585 113815 gene locus_tag LOCUS_01150 113585 113815 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615098.1 protein_id gnl|my_center|LOCUS_01150 113901 115019 gene locus_tag LOCUS_01160 gene nagA 113901 115019 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_01160 115087 117651 gene locus_tag LOCUS_01170 gene polA 115087 117651 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_01170 117667 118095 gene locus_tag LOCUS_01180 117667 118095 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_01180 118095 118550 gene locus_tag LOCUS_01190 gene rimI 118095 118550 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_01190 118563 119597 gene locus_tag LOCUS_01200 gene tsaD 118563 119597 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_01200 119703 121487 gene locus_tag LOCUS_01210 119703 121487 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_01210 123256 121664 gene locus_tag LOCUS_01220 123256 121664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_01220 123963 123250 gene locus_tag LOCUS_01230 123963 123250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_01230 125914 124178 gene locus_tag LOCUS_01240 125914 124178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_01240 127632 125911 gene locus_tag LOCUS_01250 127632 125911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_01250 127801 128526 gene locus_tag LOCUS_01260 127801 128526 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 protein_id gnl|my_center|LOCUS_01260 130070 128688 gene locus_tag LOCUS_01270 130070 128688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 130810 130067 gene locus_tag LOCUS_01280 130810 130067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 132032 130830 gene locus_tag LOCUS_01290 132032 130830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 132309 133520 gene locus_tag LOCUS_01300 132309 133520 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_01300 133539 134813 gene locus_tag LOCUS_01310 133539 134813 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_01310 135721 135194 gene locus_tag LOCUS_01320 135721 135194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 135966 135754 gene locus_tag LOCUS_01330 135966 135754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 136230 136658 gene locus_tag LOCUS_01340 gene rplM 136230 136658 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_01340 136679 137077 gene locus_tag LOCUS_01350 gene rpsI 136679 137077 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_01350 137463 138734 gene locus_tag LOCUS_01360 137463 138734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 138837 139856 gene locus_tag LOCUS_01370 138837 139856 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_01370 139919 140018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 141900 140158 gene locus_tag LOCUS_01380 141900 140158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 142212 142658 gene locus_tag LOCUS_01390 142212 142658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 143663 142782 gene locus_tag LOCUS_01400 gene ispE 143663 142782 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_01400 144489 143680 gene locus_tag LOCUS_01410 144489 143680 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_01410 144684 144953 gene locus_tag LOCUS_01420 144684 144953 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 protein_id gnl|my_center|LOCUS_01420 144984 146339 gene locus_tag LOCUS_01430 144984 146339 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_01430 146359 147204 gene locus_tag LOCUS_01440 gene rfbD 146359 147204 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_01440 147272 147628 gene locus_tag LOCUS_01450 147272 147628 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 protein_id gnl|my_center|LOCUS_01450 147681 149324 gene locus_tag LOCUS_01460 147681 149324 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_01460 149326 151368 gene locus_tag LOCUS_01470 gene recG 149326 151368 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_01470 153305 152073 gene locus_tag LOCUS_01480 153305 152073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 154446 153307 gene locus_tag LOCUS_01490 gene pheA 154446 153307 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_01490 155544 154468 gene locus_tag LOCUS_01500 gene aroC 155544 154468 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_01500 156727 155534 gene locus_tag LOCUS_01510 gene aroA 156727 155534 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_01510 157785 156739 gene locus_tag LOCUS_01520 gene aroB 157785 156739 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_01520 158632 157802 gene locus_tag LOCUS_01530 158632 157802 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_01530 159684 158668 gene locus_tag LOCUS_01540 gene aroF 159684 158668 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_01540 160097 160816 gene locus_tag LOCUS_01550 160097 160816 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_01550 160813 161322 gene locus_tag LOCUS_01560 160813 161322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 161416 161589 gene locus_tag LOCUS_01570 161416 161589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 163110 161962 gene locus_tag LOCUS_01580 gene metK 163110 161962 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_01580 163605 163955 gene locus_tag LOCUS_01590 gene rplS 163605 163955 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_01590 164024 164644 gene locus_tag LOCUS_01600 gene lepB 164024 164644 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_01600 164678 165319 gene locus_tag LOCUS_01610 164678 165319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 165472 166326 gene locus_tag LOCUS_01620 gene ylqF 165472 166326 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_01620 166350 167516 gene locus_tag LOCUS_01630 166350 167516 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_01630 167518 168132 gene locus_tag LOCUS_01640 167518 168132 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_01640 168134 168505 gene locus_tag LOCUS_01650 168134 168505 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_01650 168550 169470 gene locus_tag LOCUS_01660 168550 169470 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_01660 169503 170999 gene locus_tag LOCUS_01670 gene thrC 169503 170999 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_01670 171194 171018 gene locus_tag LOCUS_01680 171194 171018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 171288 171983 gene locus_tag LOCUS_01690 171288 171983 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_01690 172123 173676 gene locus_tag LOCUS_01700 gene tig 172123 173676 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_01700 173787 174368 gene locus_tag LOCUS_01710 gene clpP 173787 174368 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_01710 174383 175663 gene locus_tag LOCUS_01720 gene clpX 174383 175663 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_01720 176389 175724 gene locus_tag LOCUS_01730 gene plsY 176389 175724 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081723.1 protein_id gnl|my_center|LOCUS_01730 177386 176835 gene locus_tag LOCUS_01740 gene rfbC 177386 176835 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_01740 178370 177423 gene locus_tag LOCUS_01750 gene rfbA 178370 177423 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_01750 178628 178861 gene locus_tag LOCUS_01760 178628 178861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 178858 180825 gene locus_tag LOCUS_01770 gene feoB 178858 180825 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_01770 180842 182038 gene locus_tag LOCUS_01780 180842 182038 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_01780 182051 183652 gene locus_tag LOCUS_01790 182051 183652 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_01790 183803 184297 gene locus_tag LOCUS_01800 183803 184297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 184327 184866 gene locus_tag LOCUS_01810 184327 184866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 184969 186012 gene locus_tag LOCUS_01820 184969 186012 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_01820 186507 186061 gene locus_tag LOCUS_01830 186507 186061 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403162.1 protein_id gnl|my_center|LOCUS_01830 187553 186696 gene locus_tag LOCUS_01840 187553 186696 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_01840 188031 191804 gene locus_tag LOCUS_01850 gene rpoB 188031 191804 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_01850 191850 195476 gene locus_tag LOCUS_01860 gene rpoC 191850 195476 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_01860 195733 196155 gene locus_tag LOCUS_01870 gene rpsL 195733 196155 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_01870 196310 196780 gene locus_tag LOCUS_01880 gene rpsG 196310 196780 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_01880 196828 198894 gene locus_tag LOCUS_01890 gene fusA 196828 198894 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01890 198994 200196 gene locus_tag LOCUS_01900 gene tuf 198994 200196 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357263.1 protein_id gnl|my_center|LOCUS_01900 200357 200905 gene locus_tag LOCUS_01910 200357 200905 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 protein_id gnl|my_center|LOCUS_01910 201986 201003 gene locus_tag LOCUS_01920 201986 201003 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894804.1 protein_id gnl|my_center|LOCUS_01920 202296 202829 gene locus_tag LOCUS_01930 gene pyrR 202296 202829 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_01930 202902 204314 gene locus_tag LOCUS_01940 202902 204314 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 protein_id gnl|my_center|LOCUS_01940 204986 208078 gene locus_tag LOCUS_01950 204986 208078 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_01950 208099 210216 gene locus_tag LOCUS_01960 208099 210216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 211566 210370 gene locus_tag LOCUS_01970 211566 210370 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_01970 212593 211772 gene locus_tag LOCUS_01980 gene mscS 212593 211772 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_01980 212896 213204 gene locus_tag LOCUS_01990 212896 213204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 213247 215247 gene locus_tag LOCUS_02000 213247 215247 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_02000 215247 215741 gene locus_tag LOCUS_02010 215247 215741 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_02010 215789 216373 gene locus_tag LOCUS_02020 215789 216373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 216389 217360 gene locus_tag LOCUS_02030 216389 217360 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_02030 217353 217667 gene locus_tag LOCUS_02040 217353 217667 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_02040 217699 219471 gene locus_tag LOCUS_02050 217699 219471 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_02050 219471 220844 gene locus_tag LOCUS_02060 219471 220844 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_02060 220871 221542 gene locus_tag LOCUS_02070 220871 221542 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_02070 221622 221708 gene locus_tag LOCUS_t00010 221622 221708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 225107 222651 gene locus_tag LOCUS_02080 225107 222651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 225386 225204 gene locus_tag LOCUS_02090 225386 225204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 227123 225624 gene locus_tag LOCUS_02100 227123 225624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 228403 227591 gene locus_tag LOCUS_02110 228403 227591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 229429 228422 gene locus_tag LOCUS_02120 229429 228422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 230418 229453 gene locus_tag LOCUS_02130 230418 229453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_02130 230811 230560 gene locus_tag LOCUS_02140 230811 230560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 232284 230812 gene locus_tag LOCUS_02150 232284 230812 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_02150 233274 232330 gene locus_tag LOCUS_02160 233274 232330 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 protein_id gnl|my_center|LOCUS_02160 233547 234914 gene locus_tag LOCUS_02170 233547 234914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 235761 234901 gene locus_tag LOCUS_02180 235761 234901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 235843 238161 gene locus_tag LOCUS_02190 235843 238161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 238629 238547 gene locus_tag LOCUS_t00020 238629 238547 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 238797 238985 gene locus_tag LOCUS_02200 gene rpmB 238797 238985 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_02200 239242 239526 gene locus_tag LOCUS_02210 gene groES 239242 239526 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_02210 239543 241186 gene locus_tag LOCUS_02220 gene groL 239543 241186 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_02220 241518 241309 gene locus_tag LOCUS_02230 241518 241309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 243230 241920 gene locus_tag LOCUS_02240 243230 241920 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_02240 243548 245005 gene locus_tag LOCUS_02250 gene pdaC 243548 245005 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_02250 245181 245465 gene locus_tag LOCUS_02260 245181 245465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 245770 247770 gene locus_tag LOCUS_02270 245770 247770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 247802 251251 gene locus_tag LOCUS_02280 247802 251251 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175155.1 protein_id gnl|my_center|LOCUS_02280 251276 253237 gene locus_tag LOCUS_02290 251276 253237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 254445 257645 gene locus_tag LOCUS_02300 254445 257645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 258031 258564 gene locus_tag LOCUS_02310 258031 258564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 258807 260930 gene locus_tag LOCUS_02320 258807 260930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 260965 261546 gene locus_tag LOCUS_02330 260965 261546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 261585 264194 gene locus_tag LOCUS_02340 261585 264194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 264411 266771 gene locus_tag LOCUS_02350 264411 266771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 266822 270259 gene locus_tag LOCUS_02360 266822 270259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 270468 271718 gene locus_tag LOCUS_02370 270468 271718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 271968 272444 gene locus_tag LOCUS_02380 271968 272444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 272861 274162 gene locus_tag LOCUS_02390 272861 274162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 274646 275563 gene locus_tag LOCUS_02400 274646 275563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_02400 275585 276625 gene locus_tag LOCUS_02410 275585 276625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_02410 276643 277647 gene locus_tag LOCUS_02420 276643 277647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_02420 277640 278638 gene locus_tag LOCUS_02430 277640 278638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_02430 278734 280419 gene locus_tag LOCUS_02440 278734 280419 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_02440 280845 281138 gene locus_tag LOCUS_02450 280845 281138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 281386 282057 gene locus_tag LOCUS_02460 281386 282057 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_02460 282072 283058 gene locus_tag LOCUS_02470 282072 283058 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_02470 283169 283933 gene locus_tag LOCUS_02480 283169 283933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_02480 283930 285990 gene locus_tag LOCUS_02490 283930 285990 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_02490 285990 286466 gene locus_tag LOCUS_02500 285990 286466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 287076 287216 gene locus_tag LOCUS_02510 287076 287216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 287235 287576 gene locus_tag LOCUS_02520 287235 287576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 287577 289781 gene locus_tag LOCUS_02530 287577 289781 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_02530 289778 290509 gene locus_tag LOCUS_02540 289778 290509 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_02540 290485 291519 gene locus_tag LOCUS_02550 290485 291519 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_02550 291683 293104 gene locus_tag LOCUS_02560 291683 293104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 293200 293832 gene locus_tag LOCUS_02570 293200 293832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 293993 295069 gene locus_tag LOCUS_02580 293993 295069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964158.1 protein_id gnl|my_center|LOCUS_02580 295062 295874 gene locus_tag LOCUS_02590 295062 295874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_02590 295868 296668 gene locus_tag LOCUS_02600 295868 296668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_02600 296682 297773 gene locus_tag LOCUS_02610 296682 297773 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964155.1 protein_id gnl|my_center|LOCUS_02610 297835 298929 gene locus_tag LOCUS_02620 297835 298929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 299097 300437 gene locus_tag LOCUS_02630 299097 300437 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 protein_id gnl|my_center|LOCUS_02630 300450 300866 gene locus_tag LOCUS_02640 300450 300866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_02640 300966 301460 gene locus_tag LOCUS_02650 300966 301460 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_02650 301509 301691 gene locus_tag LOCUS_02660 gene rpmF 301509 301691 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_02660 301941 303269 gene locus_tag LOCUS_02670 gene der 301941 303269 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_02670 303266 303766 gene locus_tag LOCUS_02680 gene ruvC 303266 303766 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_02680 303778 304383 gene locus_tag LOCUS_02690 gene ruvA 303778 304383 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_02690 304405 305433 gene locus_tag LOCUS_02700 gene ruvB 304405 305433 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_02700 305453 306802 gene locus_tag LOCUS_02710 gene glmM 305453 306802 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_02710 306839 307702 gene locus_tag LOCUS_02720 306839 307702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_02720 307705 308568 gene locus_tag LOCUS_02730 307705 308568 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_02730 308565 309428 gene locus_tag LOCUS_02740 308565 309428 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_02740 309425 310240 gene locus_tag LOCUS_02750 309425 310240 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_02750 310255 311001 gene locus_tag LOCUS_02760 gene truA 310255 311001 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_02760 311019 312248 gene locus_tag LOCUS_02770 311019 312248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 312353 313036 gene locus_tag LOCUS_02780 312353 313036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 313082 313717 gene locus_tag LOCUS_02790 313082 313717 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_02790 313771 316110 gene locus_tag LOCUS_02800 313771 316110 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_02800 316238 317785 gene locus_tag LOCUS_02810 316238 317785 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_02810 317806 318324 gene locus_tag LOCUS_02820 317806 318324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 318448 318804 gene locus_tag LOCUS_02830 318448 318804 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_02830 319086 320051 gene locus_tag LOCUS_02840 gene hprK 319086 320051 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_02840 320097 321044 gene locus_tag LOCUS_02850 gene glcK 320097 321044 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_02850 321083 321988 gene locus_tag LOCUS_02860 gene murB 321083 321988 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_02860 322021 322878 gene locus_tag LOCUS_02870 gene rapZ 322021 322878 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_02870 322891 323784 gene locus_tag LOCUS_02880 gene whiA 322891 323784 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_02880 323803 327327 gene locus_tag LOCUS_02890 323803 327327 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_02890 327543 328505 gene locus_tag LOCUS_02900 gene pfkA 327543 328505 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_02900 328515 330956 gene locus_tag LOCUS_02910 gene pcrA 328515 330956 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_02910 331244 332509 gene locus_tag LOCUS_02920 331244 332509 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_02920 332573 333352 gene locus_tag LOCUS_02930 332573 333352 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_02930 333370 334662 gene locus_tag LOCUS_02940 333370 334662 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_02940 336200 334767 gene locus_tag LOCUS_02950 336200 334767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 336434 336604 gene locus_tag LOCUS_02960 336434 336604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 336805 336730 gene locus_tag LOCUS_t00030 336805 336730 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 337026 337976 gene locus_tag LOCUS_02970 337026 337976 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_02970 338752 338063 gene locus_tag LOCUS_02980 gene sigK 338752 338063 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_02980 338891 339667 gene locus_tag LOCUS_02990 338891 339667 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_02990 339691 340263 gene locus_tag LOCUS_03000 339691 340263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 340626 340336 gene locus_tag LOCUS_03010 340626 340336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 340805 343054 gene locus_tag LOCUS_03020 340805 343054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 343134 343559 gene locus_tag LOCUS_03030 gene ruvX 343134 343559 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_03030 343893 343543 gene locus_tag LOCUS_03040 343893 343543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 344240 343890 gene locus_tag LOCUS_03050 344240 343890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03050 344326 345078 gene locus_tag LOCUS_03060 gene cwlD 344326 345078 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_03060 345080 346450 gene locus_tag LOCUS_03070 gene radA 345080 346450 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_03070 346461 347195 gene locus_tag LOCUS_03080 346461 347195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_03080 347287 348237 gene locus_tag LOCUS_03090 347287 348237 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_03090 348400 350388 gene locus_tag LOCUS_03100 gene gyrB 348400 350388 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_03100 350418 352676 gene locus_tag LOCUS_03110 gene gyrA 350418 352676 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_03110 352904 353152 gene locus_tag LOCUS_03120 352904 353152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 355839 353302 gene locus_tag LOCUS_03130 355839 353302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 358404 355906 gene locus_tag LOCUS_03140 358404 355906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 359332 358415 gene locus_tag LOCUS_03150 359332 358415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_03150 359703 359329 gene locus_tag LOCUS_03160 359703 359329 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_03160 359882 360079 gene locus_tag LOCUS_03170 359882 360079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 360159 360494 gene locus_tag LOCUS_03180 360159 360494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 360487 360696 gene locus_tag LOCUS_03190 360487 360696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 360785 361096 gene locus_tag LOCUS_03200 360785 361096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 361223 361507 gene locus_tag LOCUS_03210 361223 361507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 361701 361626 gene locus_tag LOCUS_t00040 361701 361626 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 361899 362894 gene locus_tag LOCUS_03220 361899 362894 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222131.1 protein_id gnl|my_center|LOCUS_03220 363025 363327 gene locus_tag LOCUS_03230 363025 363327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 363339 363803 gene locus_tag LOCUS_03240 363339 363803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 363987 364346 gene locus_tag LOCUS_03250 363987 364346 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918377.1 protein_id gnl|my_center|LOCUS_03250 364330 364551 gene locus_tag LOCUS_03260 364330 364551 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_03260 364566 366443 gene locus_tag LOCUS_03270 364566 366443 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 367578 366490 gene locus_tag LOCUS_03280 367578 366490 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_03280 367670 368251 gene locus_tag LOCUS_03290 367670 368251 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 protein_id gnl|my_center|LOCUS_03290 368396 369130 gene locus_tag LOCUS_03300 gene rpsB 368396 369130 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_03300 369130 370233 gene locus_tag LOCUS_03310 369130 370233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 371716 370325 gene locus_tag LOCUS_03320 371716 370325 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_03320 374062 371825 gene locus_tag LOCUS_03330 374062 371825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 374853 374059 gene locus_tag LOCUS_03340 374853 374059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 375010 375786 gene locus_tag LOCUS_03350 gene sigG 375010 375786 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_03350 375783 376385 gene locus_tag LOCUS_03360 375783 376385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 376574 378607 gene locus_tag LOCUS_03370 376574 378607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 378672 379763 gene locus_tag LOCUS_03380 378672 379763 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_03380 382105 380036 gene locus_tag LOCUS_03390 382105 380036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 384035 382317 gene locus_tag LOCUS_03400 384035 382317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 386520 384163 gene locus_tag LOCUS_03410 386520 384163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 387394 386495 gene locus_tag LOCUS_03420 387394 386495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657068.1 protein_id gnl|my_center|LOCUS_03420 387785 387417 gene locus_tag LOCUS_03430 gene ytrA 387785 387417 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_03430 388548 388060 gene locus_tag LOCUS_03440 gene dfrA 388548 388060 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_03440 389388 388558 gene locus_tag LOCUS_03450 389388 388558 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_03450 390261 389410 gene locus_tag LOCUS_03460 390261 389410 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_03460 391235 390267 gene locus_tag LOCUS_03470 391235 390267 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948422.1 protein_id gnl|my_center|LOCUS_03470 394782 391360 gene locus_tag LOCUS_03480 394782 391360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 396106 394808 gene locus_tag LOCUS_03490 396106 394808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 396849 396103 gene locus_tag LOCUS_03500 396849 396103 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_03500 397204 396992 gene locus_tag LOCUS_03510 397204 396992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 397384 398709 gene locus_tag LOCUS_03520 397384 398709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 398794 400035 gene locus_tag LOCUS_03530 398794 400035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 401851 400109 gene locus_tag LOCUS_03540 401851 400109 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196523.1 protein_id gnl|my_center|LOCUS_03540 402163 401939 gene locus_tag LOCUS_03550 402163 401939 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_03550 402243 402365 gene locus_tag LOCUS_03560 402243 402365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 402680 403519 gene locus_tag LOCUS_03570 402680 403519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 404964 404101 gene locus_tag LOCUS_03580 gene fba 404964 404101 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_03580 406004 405024 gene locus_tag LOCUS_03590 406004 405024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_03590 407110 406004 gene locus_tag LOCUS_03600 407110 406004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03600 408632 407103 gene locus_tag LOCUS_03610 408632 407103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_03610 409973 408780 gene locus_tag LOCUS_03620 409973 408780 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_03620 410618 410037 gene locus_tag LOCUS_03630 410618 410037 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_03630 411522 410782 gene locus_tag LOCUS_03640 411522 410782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 412464 411700 gene locus_tag LOCUS_03650 412464 411700 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475684.1 protein_id gnl|my_center|LOCUS_03650 413394 412699 gene locus_tag LOCUS_03660 413394 412699 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762118.1 protein_id gnl|my_center|LOCUS_03660 414469 413405 gene locus_tag LOCUS_03670 414469 413405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 417026 414480 gene locus_tag LOCUS_03680 417026 414480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 417319 418095 gene locus_tag LOCUS_03690 417319 418095 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_03690 419807 418467 gene locus_tag LOCUS_03700 gene murD 419807 418467 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460698.1 protein_id gnl|my_center|LOCUS_03700 420993 419824 gene locus_tag LOCUS_03710 420993 419824 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876001.1 protein_id gnl|my_center|LOCUS_03710 421453 421001 gene locus_tag LOCUS_03720 gene rnhA 421453 421001 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_03720 421620 422774 gene locus_tag LOCUS_03730 421620 422774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 423061 424836 gene locus_tag LOCUS_03740 423061 424836 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_03740 424840 426837 gene locus_tag LOCUS_03750 424840 426837 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 protein_id gnl|my_center|LOCUS_03750 426960 427403 gene locus_tag LOCUS_03760 gene rplI 426960 427403 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_03760 427432 428823 gene locus_tag LOCUS_03770 427432 428823 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_03770 428816 430165 gene locus_tag LOCUS_03780 gene tilS 428816 430165 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_03780 430162 430704 gene locus_tag LOCUS_03790 gene hpt 430162 430704 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_03790 430750 432732 gene locus_tag LOCUS_03800 gene ftsH 430750 432732 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_03800 432713 433429 gene locus_tag LOCUS_03810 432713 433429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 433495 433989 gene locus_tag LOCUS_03820 433495 433989 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948046.1 protein_id gnl|my_center|LOCUS_03820 435867 434527 gene locus_tag LOCUS_03830 435867 434527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 436587 435901 gene locus_tag LOCUS_03840 436587 435901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 437191 436880 gene locus_tag LOCUS_03850 437191 436880 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583235.1 protein_id gnl|my_center|LOCUS_03850 439074 438184 gene locus_tag LOCUS_03860 439074 438184 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_03860 440516 439257 gene locus_tag LOCUS_03870 440516 439257 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_03870 440807 441037 gene locus_tag LOCUS_03880 440807 441037 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890776.1 protein_id gnl|my_center|LOCUS_03880 441034 441873 gene locus_tag LOCUS_03890 441034 441873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_03890 441870 442517 gene locus_tag LOCUS_03900 441870 442517 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_03900 442874 443419 gene locus_tag LOCUS_03910 442874 443419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 443469 443894 gene locus_tag LOCUS_03920 443469 443894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 444041 446080 gene locus_tag LOCUS_03930 444041 446080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 446110 448371 gene locus_tag LOCUS_03940 446110 448371 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_03940 448390 448851 gene locus_tag LOCUS_03950 gene dtd 448390 448851 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_03950 448848 449501 gene locus_tag LOCUS_03960 448848 449501 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_03960 449511 451010 gene locus_tag LOCUS_03970 449511 451010 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_03970 451020 451931 gene locus_tag LOCUS_03980 451020 451931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 452058 453866 gene locus_tag LOCUS_03990 452058 453866 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949020.1 protein_id gnl|my_center|LOCUS_03990 453903 454709 gene locus_tag LOCUS_04000 453903 454709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 454778 455053 gene locus_tag LOCUS_04010 454778 455053 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_04010 455119 455373 gene locus_tag LOCUS_04020 455119 455373 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_04020 455430 455711 gene locus_tag LOCUS_04030 455430 455711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 456001 455867 gene locus_tag LOCUS_04040 456001 455867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 456246 456554 gene locus_tag LOCUS_04050 456246 456554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 456577 457089 gene locus_tag LOCUS_04060 456577 457089 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723740.1 protein_id gnl|my_center|LOCUS_04060 457147 458286 gene locus_tag LOCUS_04070 457147 458286 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461367.1 protein_id gnl|my_center|LOCUS_04070 458279 459121 gene locus_tag LOCUS_04080 458279 459121 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_04080 459251 459778 gene locus_tag LOCUS_04090 gene raiA 459251 459778 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_04090 459854 460969 gene locus_tag LOCUS_04100 459854 460969 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_04100 461000 461944 gene locus_tag LOCUS_04110 461000 461944 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_04110 462683 461997 gene locus_tag LOCUS_04120 462683 461997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 462769 463401 gene locus_tag LOCUS_04130 462769 463401 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_04130 464172 463498 gene locus_tag LOCUS_04140 gene hypB 464172 463498 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_04140 465728 464310 gene locus_tag LOCUS_04150 465728 464310 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_04150 466912 465740 gene locus_tag LOCUS_04160 466912 465740 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_04160 468578 466905 gene locus_tag LOCUS_04170 468578 466905 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_04170 468843 468583 gene locus_tag LOCUS_04180 468843 468583 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_04180 469088 468849 gene locus_tag LOCUS_04190 469088 468849 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_04190 469852 469103 gene locus_tag LOCUS_04200 469852 469103 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_04200 472579 469865 gene locus_tag LOCUS_04210 gene adhE 472579 469865 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_04210 473213 472602 gene locus_tag LOCUS_04220 473213 472602 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_04220 473934 473389 gene locus_tag LOCUS_04230 gene yfcE 473934 473389 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_04230 474874 473948 gene locus_tag LOCUS_04240 474874 473948 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_04240 476026 475055 gene locus_tag LOCUS_04250 476026 475055 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_04250 476202 476900 gene locus_tag LOCUS_04260 476202 476900 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_04260 478957 476879 gene locus_tag LOCUS_04270 gene feoB 478957 476879 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_04270 479209 478976 gene locus_tag LOCUS_04280 479209 478976 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_04280 479298 479717 gene locus_tag LOCUS_04290 479298 479717 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_04290 479855 481387 gene locus_tag LOCUS_04300 479855 481387 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_04300 481536 481847 gene locus_tag LOCUS_04310 481536 481847 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_04310 481862 484408 gene locus_tag LOCUS_04320 481862 484408 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04320 484495 484568 gene locus_tag LOCUS_t00050 484495 484568 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 484573 484649 gene locus_tag LOCUS_t00060 484573 484649 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 484694 484770 gene locus_tag LOCUS_t00070 484694 484770 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 484825 484899 gene locus_tag LOCUS_t00080 484825 484899 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 485627 486115 gene locus_tag LOCUS_04330 485627 486115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 487197 486193 gene locus_tag LOCUS_04340 487197 486193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 487531 487455 gene locus_tag LOCUS_t00090 487531 487455 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 489023 487662 gene locus_tag LOCUS_04350 489023 487662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038047495.1 protein_id gnl|my_center|LOCUS_04350 489825 489034 gene locus_tag LOCUS_04360 489825 489034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 491180 489822 gene locus_tag LOCUS_04370 491180 489822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_04370 492467 491355 gene locus_tag LOCUS_04380 492467 491355 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 protein_id gnl|my_center|LOCUS_04380 493556 492486 gene locus_tag LOCUS_04390 493556 492486 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 protein_id gnl|my_center|LOCUS_04390 494135 494896 gene locus_tag LOCUS_04400 494135 494896 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_04400 494922 495101 gene locus_tag LOCUS_04410 494922 495101 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_04410 495269 495144 gene locus_tag LOCUS_04420 495269 495144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 495740 495357 gene locus_tag LOCUS_04430 495740 495357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 496533 495757 gene locus_tag LOCUS_04440 496533 495757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 497628 497020 gene locus_tag LOCUS_04450 497628 497020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 497941 497950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 498312 497959 gene locus_tag LOCUS_04460 498312 497959 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_04460 498725 499468 gene locus_tag LOCUS_04470 gene gpmA 498725 499468 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_04470 499685 500494 gene locus_tag LOCUS_04480 499685 500494 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_04480 500614 501261 gene locus_tag LOCUS_04490 500614 501261 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_04490 501264 502046 gene locus_tag LOCUS_04500 501264 502046 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_04500 502511 502762 gene locus_tag LOCUS_04510 502511 502762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_04510 502865 503671 gene locus_tag LOCUS_04520 502865 503671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 503671 504276 gene locus_tag LOCUS_04530 503671 504276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 505744 504368 gene locus_tag LOCUS_04540 505744 504368 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 protein_id gnl|my_center|LOCUS_04540 505941 506903 gene locus_tag LOCUS_04550 505941 506903 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 protein_id gnl|my_center|LOCUS_04550 506963 507166 gene locus_tag LOCUS_04560 506963 507166 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_04560 507206 507856 gene locus_tag LOCUS_04570 507206 507856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 507856 508617 gene locus_tag LOCUS_04580 507856 508617 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 protein_id gnl|my_center|LOCUS_04580 508642 510399 gene locus_tag LOCUS_04590 508642 510399 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_04590 510721 510389 gene locus_tag LOCUS_04600 510721 510389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 511938 510763 gene locus_tag LOCUS_04610 511938 510763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 512500 513711 gene locus_tag LOCUS_04620 512500 513711 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_04620 513825 514400 gene locus_tag LOCUS_04630 513825 514400 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_04630 514532 514795 gene locus_tag LOCUS_04640 514532 514795 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_04640 515681 514884 gene locus_tag LOCUS_04650 515681 514884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 517379 515691 gene locus_tag LOCUS_04660 gene leuA 517379 515691 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence02 923 81 gene locus_tag LOCUS_04670 923 81 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869770.1 protein_id gnl|my_center|LOCUS_04670 3816 1396 gene locus_tag LOCUS_04680 3816 1396 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021036893.1 protein_id gnl|my_center|LOCUS_04680 4104 3862 gene locus_tag LOCUS_04690 4104 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 5050 4974 gene locus_tag LOCUS_t00100 5050 4974 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5200 5275 gene locus_tag LOCUS_t00110 5200 5275 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7448 5565 gene locus_tag LOCUS_04700 7448 5565 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_04700 7573 8424 gene locus_tag LOCUS_04710 7573 8424 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_04710 8492 9085 gene locus_tag LOCUS_04720 8492 9085 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_04720 9714 9124 gene locus_tag LOCUS_04730 9714 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 10006 9803 gene locus_tag LOCUS_04740 10006 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 10437 10141 gene locus_tag LOCUS_04750 10437 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 11271 11582 gene locus_tag LOCUS_04760 gene rpsJ 11271 11582 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_04760 11686 12321 gene locus_tag LOCUS_04770 gene rplC 11686 12321 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_04770 12339 12962 gene locus_tag LOCUS_04780 gene rplD 12339 12962 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_04780 12959 13255 gene locus_tag LOCUS_04790 gene rplW 12959 13255 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_04790 13333 14166 gene locus_tag LOCUS_04800 gene rplB 13333 14166 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_04800 14188 14469 gene locus_tag LOCUS_04810 gene rpsS 14188 14469 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966408.1 protein_id gnl|my_center|LOCUS_04810 14493 14843 gene locus_tag LOCUS_04820 gene rplV 14493 14843 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_04820 14863 15552 gene locus_tag LOCUS_04830 gene rpsC 14863 15552 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_04830 15552 15980 gene locus_tag LOCUS_04840 gene rplP 15552 15980 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_04840 15977 16180 gene locus_tag LOCUS_04850 gene rpmC 15977 16180 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_04850 16201 16455 gene locus_tag LOCUS_04860 gene rpsQ 16201 16455 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_04860 16486 16854 gene locus_tag LOCUS_04870 gene rplN 16486 16854 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_04870 16870 17199 gene locus_tag LOCUS_04880 gene rplX 16870 17199 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258242.1 protein_id gnl|my_center|LOCUS_04880 17216 17758 gene locus_tag LOCUS_04890 gene rplE 17216 17758 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_04890 17771 17956 gene locus_tag LOCUS_04900 17771 17956 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_04900 17987 18385 gene locus_tag LOCUS_04910 gene rpsH 17987 18385 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_04910 18399 18944 gene locus_tag LOCUS_04920 gene rplF 18399 18944 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_04920 18969 19328 gene locus_tag LOCUS_04930 gene rplR 18969 19328 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_04930 19346 19846 gene locus_tag LOCUS_04940 gene rpsE 19346 19846 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_04940 19862 20059 gene locus_tag LOCUS_04950 gene rpmD 19862 20059 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393919.1 protein_id gnl|my_center|LOCUS_04950 20056 20502 gene locus_tag LOCUS_04960 gene rplO 20056 20502 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_04960 20504 21868 gene locus_tag LOCUS_04970 gene secY 20504 21868 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_04970 21905 22654 gene locus_tag LOCUS_04980 gene map 21905 22654 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_04980 22669 22923 gene locus_tag LOCUS_04990 22669 22923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 22936 23154 gene locus_tag LOCUS_05000 gene infA 22936 23154 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_05000 23319 23687 gene locus_tag LOCUS_05010 gene rpsM 23319 23687 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_05010 23703 24110 gene locus_tag LOCUS_05020 gene rpsK 23703 24110 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_05020 24135 24761 gene locus_tag LOCUS_05030 gene rpsD 24135 24761 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05030 24838 25788 gene locus_tag LOCUS_05040 24838 25788 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_05040 25819 26160 gene locus_tag LOCUS_05050 gene rplQ 25819 26160 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_05050 26315 26731 gene locus_tag LOCUS_05060 26315 26731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 27753 26779 gene locus_tag LOCUS_05070 27753 26779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 29253 27829 gene locus_tag LOCUS_05080 gene glgA 29253 27829 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_05080 30394 29273 gene locus_tag LOCUS_05090 gene glgD 30394 29273 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_05090 31608 30391 gene locus_tag LOCUS_05100 gene glgC 31608 30391 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057619.1 protein_id gnl|my_center|LOCUS_05100 33491 31611 gene locus_tag LOCUS_05110 gene glgB 33491 31611 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_05110 34287 33748 gene locus_tag LOCUS_05120 34287 33748 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_05120 34986 34375 gene locus_tag LOCUS_05130 34986 34375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 35818 34979 gene locus_tag LOCUS_05140 gene rsmI 35818 34979 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_05140 36579 35818 gene locus_tag LOCUS_05150 36579 35818 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_05150 36969 36589 gene locus_tag LOCUS_05160 36969 36589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 37245 38033 gene locus_tag LOCUS_05170 37245 38033 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_05170 38134 38646 gene locus_tag LOCUS_05180 38134 38646 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_05180 39860 38958 gene locus_tag LOCUS_05190 39860 38958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 40043 42265 gene locus_tag LOCUS_05200 40043 42265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 43127 42678 gene locus_tag LOCUS_05210 43127 42678 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389910.1 protein_id gnl|my_center|LOCUS_05210 43676 43413 gene locus_tag LOCUS_05220 43676 43413 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_05220 43911 44867 gene locus_tag LOCUS_05230 43911 44867 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_05230 46427 44910 gene locus_tag LOCUS_05240 gene gpmI 46427 44910 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_05240 47258 46488 gene locus_tag LOCUS_05250 gene tpiA 47258 46488 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_05250 48517 47327 gene locus_tag LOCUS_05260 48517 47327 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_05260 48733 48807 gene locus_tag LOCUS_t00120 48733 48807 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 49500 49868 gene locus_tag LOCUS_05270 49500 49868 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860888.1 protein_id gnl|my_center|LOCUS_05270 52046 50439 gene locus_tag LOCUS_05280 gene asnB 52046 50439 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_05280 54395 52299 gene locus_tag LOCUS_05290 54395 52299 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_05290 55010 56620 gene locus_tag LOCUS_05300 55010 56620 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_05300 56627 58051 gene locus_tag LOCUS_05310 gene purF 56627 58051 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_05310 58081 58782 gene locus_tag LOCUS_05320 58081 58782 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_05320 58806 59900 gene locus_tag LOCUS_05330 58806 59900 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830071.1 protein_id gnl|my_center|LOCUS_05330 59893 63090 gene locus_tag LOCUS_05340 gene carB 59893 63090 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126116.1 protein_id gnl|my_center|LOCUS_05340 63350 63934 gene locus_tag LOCUS_05350 63350 63934 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_05350 65164 64043 gene locus_tag LOCUS_05360 65164 64043 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 protein_id gnl|my_center|LOCUS_05360 65703 65167 gene locus_tag LOCUS_05370 65703 65167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 67201 65921 gene locus_tag LOCUS_05380 gene serS 67201 65921 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_05380 68045 67488 gene locus_tag LOCUS_05390 68045 67488 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_05390 68616 68212 gene locus_tag LOCUS_05400 68616 68212 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810723.1 protein_id gnl|my_center|LOCUS_05400 69118 68630 gene locus_tag LOCUS_05410 69118 68630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 69272 70711 gene locus_tag LOCUS_05420 69272 70711 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_05420 71089 72405 gene locus_tag LOCUS_05430 71089 72405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 72508 73560 gene locus_tag LOCUS_05440 72508 73560 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_05440 74536 73937 gene locus_tag LOCUS_05450 74536 73937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_05450 75917 74538 gene locus_tag LOCUS_05460 75917 74538 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_05460 76815 76039 gene locus_tag LOCUS_05470 76815 76039 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_05470 77249 76821 gene locus_tag LOCUS_05480 77249 76821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 78013 77429 gene locus_tag LOCUS_05490 78013 77429 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_05490 78324 79700 gene locus_tag LOCUS_05500 gene murL 78324 79700 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_05500 79681 80991 gene locus_tag LOCUS_05510 gene murD 79681 80991 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_05510 80988 81488 gene locus_tag LOCUS_05520 80988 81488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 81511 82551 gene locus_tag LOCUS_05530 81511 82551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 82577 83059 gene locus_tag LOCUS_05540 82577 83059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 protein_id gnl|my_center|LOCUS_05540 83863 84462 gene locus_tag LOCUS_05550 83863 84462 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045715.1 protein_id gnl|my_center|LOCUS_05550 85367 84465 gene locus_tag LOCUS_05560 85367 84465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 85435 85980 gene locus_tag LOCUS_05570 85435 85980 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_05570 85977 86540 gene locus_tag LOCUS_05580 85977 86540 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_05580 86537 87430 gene locus_tag LOCUS_05590 86537 87430 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_05590 87539 88057 gene locus_tag LOCUS_05600 87539 88057 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986765.1 protein_id gnl|my_center|LOCUS_05600 88054 88500 gene locus_tag LOCUS_05610 88054 88500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 88484 89047 gene locus_tag LOCUS_05620 88484 89047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986764.1 protein_id gnl|my_center|LOCUS_05620 89049 89354 gene locus_tag LOCUS_05630 89049 89354 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986763.1 protein_id gnl|my_center|LOCUS_05630 89367 90233 gene locus_tag LOCUS_05640 89367 90233 CDS product D-Ala-D-Ala carboxypeptidase VanY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759406.1 protein_id gnl|my_center|LOCUS_05640 91525 90407 gene locus_tag LOCUS_05650 91525 90407 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_05650 92355 91648 gene locus_tag LOCUS_05660 92355 91648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 93485 92478 gene locus_tag LOCUS_05670 93485 92478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 94354 93596 gene locus_tag LOCUS_05680 94354 93596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 94560 95675 gene locus_tag LOCUS_05690 gene prfB 94560 95675 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_05690 95680 96282 gene locus_tag LOCUS_05700 95680 96282 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404252.1 protein_id gnl|my_center|LOCUS_05700 96326 96913 gene locus_tag LOCUS_05710 96326 96913 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_05710 98044 97172 gene locus_tag LOCUS_05720 98044 97172 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986511.1 protein_id gnl|my_center|LOCUS_05720 98159 99400 gene locus_tag LOCUS_05730 98159 99400 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878082.1 protein_id gnl|my_center|LOCUS_05730 99594 100439 gene locus_tag LOCUS_05740 99594 100439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 100510 102048 gene locus_tag LOCUS_05750 100510 102048 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_05750 102493 103470 gene locus_tag LOCUS_05760 102493 103470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 103492 104373 gene locus_tag LOCUS_05770 gene galU 103492 104373 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097988.1 protein_id gnl|my_center|LOCUS_05770 104765 104481 gene locus_tag LOCUS_05780 104765 104481 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285944.1 protein_id gnl|my_center|LOCUS_05780 105642 104779 gene locus_tag LOCUS_05790 gene rsmA 105642 104779 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_05790 106305 105655 gene locus_tag LOCUS_05800 106305 105655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 107060 106401 gene locus_tag LOCUS_05810 107060 106401 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_05810 107173 108189 gene locus_tag LOCUS_05820 gene galE 107173 108189 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_05820 108211 109461 gene locus_tag LOCUS_05830 gene hflX 108211 109461 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_05830 110543 109863 gene locus_tag LOCUS_05840 110543 109863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 110749 111345 gene locus_tag LOCUS_05850 110749 111345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 111329 112177 gene locus_tag LOCUS_05860 111329 112177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 112772 112308 gene locus_tag LOCUS_05870 112772 112308 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_05870 113550 112786 gene locus_tag LOCUS_05880 113550 112786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 114044 113547 gene locus_tag LOCUS_05890 gene coaD 114044 113547 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_05890 114589 114041 gene locus_tag LOCUS_05900 gene rsmD 114589 114041 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_05900 116522 114678 gene locus_tag LOCUS_05910 gene uvrC 116522 114678 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_05910 116693 117058 gene locus_tag LOCUS_05920 116693 117058 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_05920 117062 117703 gene locus_tag LOCUS_05930 117062 117703 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886565.1 protein_id gnl|my_center|LOCUS_05930 119302 117956 gene locus_tag LOCUS_05940 119302 117956 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_05940 119415 120398 gene locus_tag LOCUS_05950 119415 120398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 120531 121202 gene locus_tag LOCUS_05960 120531 121202 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_05960 122448 121450 gene locus_tag LOCUS_05970 122448 121450 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_05970 123155 122463 gene locus_tag LOCUS_05980 123155 122463 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_05980 123381 123872 gene locus_tag LOCUS_05990 123381 123872 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242923.1 protein_id gnl|my_center|LOCUS_05990 123883 124710 gene locus_tag LOCUS_06000 123883 124710 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_06000 124725 125243 gene locus_tag LOCUS_06010 124725 125243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 128293 125609 gene locus_tag LOCUS_06020 128293 125609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 130321 128990 gene locus_tag LOCUS_06030 gene gdhA 130321 128990 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_06030 131468 130803 gene locus_tag LOCUS_06040 131468 130803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 133078 131465 gene locus_tag LOCUS_06050 133078 131465 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_06050 133306 133503 gene locus_tag LOCUS_06060 133306 133503 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_06060 134489 133563 gene locus_tag LOCUS_06070 gene prmA 134489 133563 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_06070 135475 134501 gene locus_tag LOCUS_06080 135475 134501 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_06080 135889 136407 gene locus_tag LOCUS_06090 135889 136407 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_06090 138605 136878 gene locus_tag LOCUS_06100 138605 136878 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_06100 138985 138635 gene locus_tag LOCUS_06110 138985 138635 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681000.1 protein_id gnl|my_center|LOCUS_06110 140330 139071 gene locus_tag LOCUS_06120 140330 139071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680998.1 protein_id gnl|my_center|LOCUS_06120 142038 140323 gene locus_tag LOCUS_06130 142038 140323 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_06130 142252 142956 gene locus_tag LOCUS_06140 142252 142956 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_06140 143036 144121 gene locus_tag LOCUS_06150 143036 144121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 144178 144627 gene locus_tag LOCUS_06160 144178 144627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 144793 144942 gene locus_tag LOCUS_06170 gene rpmG 144793 144942 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_06170 144959 145387 gene locus_tag LOCUS_06180 144959 145387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 145402 145956 gene locus_tag LOCUS_06190 gene nusG 145402 145956 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_06190 146080 146505 gene locus_tag LOCUS_06200 gene rplK 146080 146505 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_06200 146561 147271 gene locus_tag LOCUS_06210 gene rplA 146561 147271 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_06210 147502 148035 gene locus_tag LOCUS_06220 gene rplJ 147502 148035 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_06220 148072 148449 gene locus_tag LOCUS_06230 gene rplL 148072 148449 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_06230 148719 151196 gene locus_tag LOCUS_06240 148719 151196 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_06240 151272 151946 gene locus_tag LOCUS_06250 151272 151946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 152061 152564 gene locus_tag LOCUS_06260 152061 152564 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_06260 152554 153123 gene locus_tag LOCUS_06270 152554 153123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 153216 155393 gene locus_tag LOCUS_06280 153216 155393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 155689 156735 gene locus_tag LOCUS_06290 155689 156735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 156751 157203 gene locus_tag LOCUS_06300 gene tadA 156751 157203 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_06300 157226 158182 gene locus_tag LOCUS_06310 157226 158182 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_06310 159411 158404 gene locus_tag LOCUS_06320 159411 158404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 160428 159484 gene locus_tag LOCUS_06330 160428 159484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 160673 160936 gene locus_tag LOCUS_06340 gene rpsO 160673 160936 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_06340 161098 163323 gene locus_tag LOCUS_06350 gene pnp 161098 163323 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06350 163901 163419 gene locus_tag LOCUS_06360 gene rlmH 163901 163419 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 protein_id gnl|my_center|LOCUS_06360 164699 163914 gene locus_tag LOCUS_06370 164699 163914 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_06370 166052 164763 gene locus_tag LOCUS_06380 166052 164763 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_06380 166463 166885 gene locus_tag LOCUS_06390 166463 166885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 167020 167742 gene locus_tag LOCUS_06400 167020 167742 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_06400 167790 168938 gene locus_tag LOCUS_06410 167790 168938 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_06410 169461 169117 gene locus_tag LOCUS_06420 169461 169117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06420 169702 169571 gene locus_tag LOCUS_06430 169702 169571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 170427 169708 gene locus_tag LOCUS_06440 170427 169708 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016912.1 protein_id gnl|my_center|LOCUS_06440 171886 170705 gene locus_tag LOCUS_06450 171886 170705 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816363.1 protein_id gnl|my_center|LOCUS_06450 175622 172080 gene locus_tag LOCUS_06460 gene nifJ 175622 172080 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_06460 176089 177516 gene locus_tag LOCUS_06470 176089 177516 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_06470 177960 177616 gene locus_tag LOCUS_06480 177960 177616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 178063 178354 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtatcaattccctaaatgggaaaggtaaag 178418 178517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 178579 178933 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attccctaaatgggaaaggtaaag 180159 179170 gene locus_tag LOCUS_06490 180159 179170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 180610 180161 gene locus_tag LOCUS_06500 180610 180161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 181373 180588 gene locus_tag LOCUS_06510 gene cmr4 181373 180588 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_06510 182562 181378 gene locus_tag LOCUS_06520 182562 181378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 184214 182571 gene locus_tag LOCUS_06530 gene cas10 184214 182571 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_06530 185428 184211 gene locus_tag LOCUS_06540 185428 184211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_06540 185987 185430 gene locus_tag LOCUS_06550 185987 185430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 187663 185987 gene locus_tag LOCUS_06560 187663 185987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986676.1 protein_id gnl|my_center|LOCUS_06560 188401 187664 gene locus_tag LOCUS_06570 gene cas6 188401 187664 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272867.1 protein_id gnl|my_center|LOCUS_06570 188473 188622 gene locus_tag LOCUS_06580 188473 188622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 189416 189039 gene locus_tag LOCUS_06590 189416 189039 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_06590 190796 189591 gene locus_tag LOCUS_06600 190796 189591 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_06600 191146 190919 gene locus_tag LOCUS_06610 191146 190919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 192232 191168 gene locus_tag LOCUS_06620 gene ylbJ 192232 191168 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_06620 192320 192613 gene locus_tag LOCUS_06630 192320 192613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 192634 193773 gene locus_tag LOCUS_06640 192634 193773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 193830 194045 gene locus_tag LOCUS_06650 193830 194045 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_06650 194901 194077 gene locus_tag LOCUS_06660 194901 194077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 195578 195030 gene locus_tag LOCUS_06670 195578 195030 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_06670 196020 195619 gene locus_tag LOCUS_06680 196020 195619 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_06680 196970 196110 gene locus_tag LOCUS_06690 196970 196110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 197233 196967 gene locus_tag LOCUS_06700 197233 196967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 197391 198203 gene locus_tag LOCUS_06710 197391 198203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 198311 199651 gene locus_tag LOCUS_06720 198311 199651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_06720 199648 201558 gene locus_tag LOCUS_06730 199648 201558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 202499 201606 gene locus_tag LOCUS_06740 gene truB 202499 201606 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_06740 205155 202477 gene locus_tag LOCUS_06750 gene ggaB 205155 202477 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_06750 206937 205252 gene locus_tag LOCUS_06760 206937 205252 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_06760 207159 207234 gene locus_tag LOCUS_t00130 207159 207234 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 207820 207293 gene locus_tag LOCUS_06770 207820 207293 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679290.1 protein_id gnl|my_center|LOCUS_06770 208842 207976 gene locus_tag LOCUS_06780 208842 207976 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_06780 209132 209701 gene locus_tag LOCUS_06790 209132 209701 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_06790 209815 211485 gene locus_tag LOCUS_06800 209815 211485 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_06800 211511 212314 gene locus_tag LOCUS_06810 211511 212314 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_06810 213968 213006 gene locus_tag LOCUS_06820 213968 213006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 215310 213970 gene locus_tag LOCUS_06830 215310 213970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 216186 215323 gene locus_tag LOCUS_06840 216186 215323 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_06840 216985 216308 gene locus_tag LOCUS_06850 216985 216308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 217958 217275 gene locus_tag LOCUS_06860 217958 217275 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_06860 218187 218690 gene locus_tag LOCUS_06870 218187 218690 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_06870 218794 218903 gene locus_tag LOCUS_r00010 218794 218903 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 219033 219341 gene locus_tag LOCUS_06880 219033 219341 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_06880 220259 219369 gene locus_tag LOCUS_06890 220259 219369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 220437 221756 gene locus_tag LOCUS_06900 220437 221756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 221804 223756 gene locus_tag LOCUS_06910 221804 223756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 223827 225761 gene locus_tag LOCUS_06920 223827 225761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 227158 225851 gene locus_tag LOCUS_06930 gene argH 227158 225851 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_06930 228384 227155 gene locus_tag LOCUS_06940 228384 227155 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_06940 229538 228528 gene locus_tag LOCUS_06950 gene trpS 229538 228528 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070666.1 protein_id gnl|my_center|LOCUS_06950 230735 229542 gene locus_tag LOCUS_06960 230735 229542 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_06960 230872 231522 gene locus_tag LOCUS_06970 230872 231522 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_06970 232318 231524 gene locus_tag LOCUS_06980 232318 231524 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_06980 232454 233785 gene locus_tag LOCUS_06990 gene glnA 232454 233785 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_06990 233943 234419 gene locus_tag LOCUS_07000 gene rimP 233943 234419 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732818.1 protein_id gnl|my_center|LOCUS_07000 235260 236360 gene locus_tag LOCUS_07010 gene nusA 235260 236360 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_07010 236394 236666 gene locus_tag LOCUS_07020 236394 236666 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_07020 236656 236988 gene locus_tag LOCUS_07030 236656 236988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 236985 239417 gene locus_tag LOCUS_07040 236985 239417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 239419 239778 gene locus_tag LOCUS_07050 gene rbfA 239419 239778 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893555.1 protein_id gnl|my_center|LOCUS_07050 239768 240733 gene locus_tag LOCUS_07060 239768 240733 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_07060 241349 240789 gene locus_tag LOCUS_07070 241349 240789 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_07070 242125 241346 gene locus_tag LOCUS_07080 242125 241346 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_07080 243116 242100 gene locus_tag LOCUS_07090 243116 242100 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_07090 243863 243252 gene locus_tag LOCUS_07100 243863 243252 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812251.1 protein_id gnl|my_center|LOCUS_07100 244030 244614 gene locus_tag LOCUS_07110 gene yfbR 244030 244614 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_07110 244797 246047 gene locus_tag LOCUS_07120 244797 246047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 246235 246825 gene locus_tag LOCUS_07130 246235 246825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 247834 246905 gene locus_tag LOCUS_07140 247834 246905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 247977 248165 gene locus_tag LOCUS_07150 247977 248165 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_07150 248225 249298 gene locus_tag LOCUS_07160 gene prfA 248225 249298 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_07160 249316 250338 gene locus_tag LOCUS_07170 249316 250338 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_07170 250335 250943 gene locus_tag LOCUS_07180 gene coaE 250335 250943 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_07180 250940 251506 gene locus_tag LOCUS_07190 250940 251506 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_07190 251519 252925 gene locus_tag LOCUS_07200 251519 252925 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_07200 253190 252966 gene locus_tag LOCUS_07210 253190 252966 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_07210 254511 253972 gene locus_tag LOCUS_07220 254511 253972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 254639 255166 gene locus_tag LOCUS_07230 254639 255166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 255299 255757 gene locus_tag LOCUS_07240 255299 255757 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986719.1 protein_id gnl|my_center|LOCUS_07240 255773 257524 gene locus_tag LOCUS_07250 255773 257524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681349.1 protein_id gnl|my_center|LOCUS_07250 257517 259454 gene locus_tag LOCUS_07260 257517 259454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_07260 261575 259953 gene locus_tag LOCUS_07270 261575 259953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 262227 261562 gene locus_tag LOCUS_07280 262227 261562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_07280 262785 262471 gene locus_tag LOCUS_07290 262785 262471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 263546 262815 gene locus_tag LOCUS_07300 263546 262815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 265160 263547 gene locus_tag LOCUS_07310 265160 263547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 265417 266007 gene locus_tag LOCUS_07320 gene lexA 265417 266007 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_07320 266181 267437 gene locus_tag LOCUS_07330 gene estB 266181 267437 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986581.1 protein_id gnl|my_center|LOCUS_07330 267624 268598 gene locus_tag LOCUS_07340 gene bsh 267624 268598 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355428.1 protein_id gnl|my_center|LOCUS_07340 268798 269604 gene locus_tag LOCUS_07350 268798 269604 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_07350 269690 270208 gene locus_tag LOCUS_07360 269690 270208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 270221 270478 gene locus_tag LOCUS_07370 270221 270478 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_07370 270633 271358 gene locus_tag LOCUS_07380 270633 271358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 271773 271420 gene locus_tag LOCUS_07390 271773 271420 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_07390 274636 271778 gene locus_tag LOCUS_07400 274636 271778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_07400 276029 274653 gene locus_tag LOCUS_07410 276029 274653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 276315 276500 gene locus_tag LOCUS_07420 276315 276500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 277557 276562 gene locus_tag LOCUS_07430 gene argF 277557 276562 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_07430 278735 277560 gene locus_tag LOCUS_07440 278735 277560 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_07440 279603 278749 gene locus_tag LOCUS_07450 gene argB 279603 278749 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_07450 280837 279626 gene locus_tag LOCUS_07460 gene argJ 280837 279626 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_07460 281776 280853 gene locus_tag LOCUS_07470 gene argC 281776 280853 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_07470 282834 282094 gene locus_tag LOCUS_07480 282834 282094 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 protein_id gnl|my_center|LOCUS_07480 283643 282834 gene locus_tag LOCUS_07490 283643 282834 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_07490 284526 283675 gene locus_tag LOCUS_07500 284526 283675 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814503.1 protein_id gnl|my_center|LOCUS_07500 286491 284983 gene locus_tag LOCUS_07510 286491 284983 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_07510 288235 286559 gene locus_tag LOCUS_07520 288235 286559 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_07520 291943 288254 gene locus_tag LOCUS_07530 291943 288254 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_07530 293215 291944 gene locus_tag LOCUS_07540 gene purD 293215 291944 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_07540 294413 293229 gene locus_tag LOCUS_07550 294413 293229 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_07550 295147 294428 gene locus_tag LOCUS_07560 295147 294428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 295773 295147 gene locus_tag LOCUS_07570 gene purN 295773 295147 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_07570 296891 295848 gene locus_tag LOCUS_07580 gene purM 296891 295848 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_07580 297395 296895 gene locus_tag LOCUS_07590 297395 296895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 298684 297596 gene locus_tag LOCUS_07600 gene pyrB 298684 297596 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_07600 299328 298681 gene locus_tag LOCUS_07610 gene pyrE 299328 298681 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_07610 300039 299341 gene locus_tag LOCUS_07620 gene pyrF 300039 299341 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_07620 300949 300032 gene locus_tag LOCUS_07630 300949 300032 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_07630 301674 300937 gene locus_tag LOCUS_07640 301674 300937 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_07640 302876 301671 gene locus_tag LOCUS_07650 gene pyrC 302876 301671 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_07650 303216 304052 gene locus_tag LOCUS_07660 303216 304052 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219939.1 protein_id gnl|my_center|LOCUS_07660 304994 304485 gene locus_tag LOCUS_07670 gene mscL 304994 304485 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_07670 305082 305570 gene locus_tag LOCUS_07680 305082 305570 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_07680 306396 310538 gene locus_tag LOCUS_07690 306396 310538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 310571 310720 gene locus_tag LOCUS_07700 310571 310720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 310761 311078 gene locus_tag LOCUS_07710 310761 311078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 311292 311807 gene locus_tag LOCUS_07720 311292 311807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 311818 312087 gene locus_tag LOCUS_07730 311818 312087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 312089 312520 gene locus_tag LOCUS_07740 312089 312520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 312856 312665 gene locus_tag LOCUS_07750 312856 312665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 313977 312853 gene locus_tag LOCUS_07760 313977 312853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 314288 314085 gene locus_tag LOCUS_07770 314288 314085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 314920 315495 gene locus_tag LOCUS_07780 314920 315495 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_07780 315482 316060 gene locus_tag LOCUS_07790 315482 316060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 316337 316615 gene locus_tag LOCUS_07800 316337 316615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 316833 316699 gene locus_tag LOCUS_07810 316833 316699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 316996 317187 gene locus_tag LOCUS_07820 316996 317187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 317300 317758 gene locus_tag LOCUS_07830 317300 317758 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371678.1 protein_id gnl|my_center|LOCUS_07830 317773 318291 gene locus_tag LOCUS_07840 317773 318291 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_07840 318284 319294 gene locus_tag LOCUS_07850 318284 319294 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_07850 319397 321871 gene locus_tag LOCUS_07860 gene clpC 319397 321871 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_07860 322794 321928 gene locus_tag LOCUS_07870 322794 321928 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_07870 323645 322806 gene locus_tag LOCUS_07880 323645 322806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 324281 323802 gene locus_tag LOCUS_07890 324281 323802 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_07890 325062 324292 gene locus_tag LOCUS_07900 325062 324292 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_07900 326806 325253 gene locus_tag LOCUS_07910 gene rny 326806 325253 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_07910 327350 329263 gene locus_tag LOCUS_07920 gene thrS 327350 329263 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_07920 329503 329943 gene locus_tag LOCUS_07930 gene mraZ 329503 329943 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_07930 329962 330891 gene locus_tag LOCUS_07940 gene rsmH 329962 330891 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_07940 330937 331422 gene locus_tag LOCUS_07950 330937 331422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 331542 333875 gene locus_tag LOCUS_07960 331542 333875 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_07960 333891 335351 gene locus_tag LOCUS_07970 333891 335351 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_07970 335348 336391 gene locus_tag LOCUS_07980 gene mraY 335348 336391 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_07980 336422 337687 gene locus_tag LOCUS_07990 gene spoVE 336422 337687 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_07990 337706 338833 gene locus_tag LOCUS_08000 gene murG 337706 338833 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_08000 338815 339003 gene locus_tag LOCUS_08010 338815 339003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 338942 340153 gene locus_tag LOCUS_08020 gene murA 338942 340153 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_08020 340171 341052 gene locus_tag LOCUS_08030 340171 341052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 341160 342338 gene locus_tag LOCUS_08040 gene ftsZ 341160 342338 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_08040 343562 342594 gene locus_tag LOCUS_08050 gene dusB 343562 342594 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_08050 344915 343821 gene locus_tag LOCUS_08060 344915 343821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 345812 345072 gene locus_tag LOCUS_08070 345812 345072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_08070 346693 345809 gene locus_tag LOCUS_08080 346693 345809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 346872 347660 gene locus_tag LOCUS_08090 346872 347660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 347657 348910 gene locus_tag LOCUS_08100 347657 348910 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_08100 348932 350299 gene locus_tag LOCUS_08110 348932 350299 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_08110 350478 350987 gene locus_tag LOCUS_08120 350478 350987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 351997 351038 gene locus_tag LOCUS_08130 gene spoIID 351997 351038 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_08130 352106 353521 gene locus_tag LOCUS_08140 352106 353521 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_08140 353555 354469 gene locus_tag LOCUS_08150 353555 354469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 354469 355410 gene locus_tag LOCUS_08160 354469 355410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 356122 355928 gene locus_tag LOCUS_08170 356122 355928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 356178 359543 gene locus_tag LOCUS_08180 356178 359543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 359560 359718 gene locus_tag LOCUS_08190 359560 359718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 359736 360059 gene locus_tag LOCUS_08200 359736 360059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 360059 360781 gene locus_tag LOCUS_08210 360059 360781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 362204 360921 gene locus_tag LOCUS_08220 362204 360921 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_08220 363175 362312 gene locus_tag LOCUS_08230 363175 362312 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_08230 363322 366663 gene locus_tag LOCUS_08240 gene addB 363322 366663 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_08240 366624 370178 gene locus_tag LOCUS_08250 gene addA 366624 370178 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_08250 370285 370497 gene locus_tag LOCUS_08260 gene rpmE 370285 370497 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_08260 370679 372760 gene locus_tag LOCUS_08270 370679 372760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 374160 373093 gene locus_tag LOCUS_08280 374160 373093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 375558 374290 gene locus_tag LOCUS_08290 375558 374290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 376861 375692 gene locus_tag LOCUS_08300 376861 375692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 377141 378622 gene locus_tag LOCUS_08310 377141 378622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 378643 379986 gene locus_tag LOCUS_08320 378643 379986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 380244 380558 gene locus_tag LOCUS_08330 380244 380558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 380588 381625 gene locus_tag LOCUS_08340 380588 381625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 381662 383644 gene locus_tag LOCUS_08350 381662 383644 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_08350 383661 384155 gene locus_tag LOCUS_08360 383661 384155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 384225 384530 gene locus_tag LOCUS_08370 384225 384530 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_08370 384543 385142 gene locus_tag LOCUS_08380 384543 385142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 385161 386918 gene locus_tag LOCUS_08390 385161 386918 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_08390 386958 388334 gene locus_tag LOCUS_08400 386958 388334 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_08400 388353 388967 gene locus_tag LOCUS_08410 388353 388967 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence03 1849 125 gene locus_tag LOCUS_08420 gene proS 1849 125 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_08420 2267 3670 gene locus_tag LOCUS_08430 2267 3670 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_08430 3751 5145 gene locus_tag LOCUS_08440 gene asnS 3751 5145 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_08440 6649 5234 gene locus_tag LOCUS_08450 gene pyk 6649 5234 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_08450 6889 6980 gene locus_tag LOCUS_t00140 6889 6980 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7090 7680 gene locus_tag LOCUS_08460 7090 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7935 8306 gene locus_tag LOCUS_08470 7935 8306 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_08470 9511 9071 gene locus_tag LOCUS_08480 9511 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 9797 10717 gene locus_tag LOCUS_08490 9797 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11920 11054 gene locus_tag LOCUS_08500 11920 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 12344 15427 gene locus_tag LOCUS_08510 12344 15427 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_08510 16109 15438 gene locus_tag LOCUS_08520 16109 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 16373 17218 gene locus_tag LOCUS_08530 16373 17218 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_08530 17327 18352 gene locus_tag LOCUS_08540 17327 18352 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_08540 18604 18966 gene locus_tag LOCUS_08550 18604 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 18963 19226 gene locus_tag LOCUS_08560 18963 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 19373 19582 gene locus_tag LOCUS_08570 19373 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 19933 20154 gene locus_tag LOCUS_08580 19933 20154 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_08580 20144 21892 gene locus_tag LOCUS_08590 20144 21892 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_08590 21897 23051 gene locus_tag LOCUS_08600 21897 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 23060 24643 gene locus_tag LOCUS_08610 23060 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 24664 27846 gene locus_tag LOCUS_08620 24664 27846 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_08620 28714 29076 gene locus_tag LOCUS_08630 28714 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 29066 30784 gene locus_tag LOCUS_08640 gene tndX 29066 30784 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_08640 32535 30910 gene locus_tag LOCUS_08650 32535 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 33702 32572 gene locus_tag LOCUS_08660 33702 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 34376 33699 gene locus_tag LOCUS_08670 34376 33699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_08670 34526 34672 gene locus_tag LOCUS_08680 34526 34672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 34686 35696 gene locus_tag LOCUS_08690 34686 35696 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_08690 35796 36710 gene locus_tag LOCUS_08700 35796 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 36764 37858 gene locus_tag LOCUS_08710 gene msrB 36764 37858 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108316.1 protein_id gnl|my_center|LOCUS_08710 37906 38370 gene locus_tag LOCUS_08720 37906 38370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 38562 38756 gene locus_tag LOCUS_08730 38562 38756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 38906 40225 gene locus_tag LOCUS_08740 gene melA 38906 40225 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_08740 43029 40270 gene locus_tag LOCUS_08750 43029 40270 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053741.1 protein_id gnl|my_center|LOCUS_08750 44790 43042 gene locus_tag LOCUS_08760 gene nuoF 44790 43042 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_08760 45277 44783 gene locus_tag LOCUS_08770 gene nuoE 45277 44783 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_08770 45593 46570 gene locus_tag LOCUS_08780 45593 46570 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_08780 46801 46938 gene locus_tag LOCUS_08790 46801 46938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 48455 47157 gene locus_tag LOCUS_08800 48455 47157 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_08800 49854 48472 gene locus_tag LOCUS_08810 49854 48472 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_08810 50027 50830 gene locus_tag LOCUS_08820 50027 50830 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_08820 50945 52216 gene locus_tag LOCUS_08830 50945 52216 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_08830 52213 53151 gene locus_tag LOCUS_08840 52213 53151 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_08840 53180 54481 gene locus_tag LOCUS_08850 gene celF 53180 54481 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145749.1 protein_id gnl|my_center|LOCUS_08850 54777 56174 gene locus_tag LOCUS_08860 54777 56174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 56204 58057 gene locus_tag LOCUS_08870 56204 58057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 58129 59067 gene locus_tag LOCUS_08880 58129 59067 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_08880 59209 59284 gene locus_tag LOCUS_t00150 59209 59284 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 61216 59444 gene locus_tag LOCUS_08890 61216 59444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 62691 61234 gene locus_tag LOCUS_08900 62691 61234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 62968 63984 gene locus_tag LOCUS_08910 62968 63984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 63999 64994 gene locus_tag LOCUS_08920 63999 64994 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_08920 65005 67185 gene locus_tag LOCUS_08930 65005 67185 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_08930 67188 68546 gene locus_tag LOCUS_08940 67188 68546 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_08940 68641 69660 gene locus_tag LOCUS_08950 gene rfbB 68641 69660 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_08950 69793 70455 gene locus_tag LOCUS_08960 69793 70455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 70452 71957 gene locus_tag LOCUS_08970 gene hemL 70452 71957 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846220.1 protein_id gnl|my_center|LOCUS_08970 72111 72794 gene locus_tag LOCUS_08980 gene radC 72111 72794 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_08980 72806 74767 gene locus_tag LOCUS_08990 gene uvrB 72806 74767 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_08990 74783 77620 gene locus_tag LOCUS_09000 gene uvrA 74783 77620 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_09000 77624 79243 gene locus_tag LOCUS_09010 77624 79243 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_09010 79462 80586 gene locus_tag LOCUS_09020 79462 80586 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_09020 81328 80630 gene locus_tag LOCUS_09030 81328 80630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 82396 81425 gene locus_tag LOCUS_09040 82396 81425 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253312.1 protein_id gnl|my_center|LOCUS_09040 83441 82389 gene locus_tag LOCUS_09050 83441 82389 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389750.1 protein_id gnl|my_center|LOCUS_09050 83590 85191 gene locus_tag LOCUS_09060 83590 85191 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_09060 85316 86293 gene locus_tag LOCUS_09070 85316 86293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 86202 86912 gene locus_tag LOCUS_09080 gene sigE 86202 86912 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_09080 86959 87258 gene locus_tag LOCUS_09090 86959 87258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 87370 88890 gene locus_tag LOCUS_09100 87370 88890 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_09100 88953 90257 gene locus_tag LOCUS_09110 88953 90257 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_09110 90273 92006 gene locus_tag LOCUS_09120 gene iorA 90273 92006 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_09120 92023 92607 gene locus_tag LOCUS_09130 92023 92607 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_09130 92651 93952 gene locus_tag LOCUS_09140 92651 93952 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_09140 93967 94398 gene locus_tag LOCUS_09150 93967 94398 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_09150 94461 95240 gene locus_tag LOCUS_09160 94461 95240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 95337 95966 gene locus_tag LOCUS_09170 95337 95966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 96970 95963 gene locus_tag LOCUS_09180 96970 95963 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_09180 97877 97092 gene locus_tag LOCUS_09190 97877 97092 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_09190 99811 97874 gene locus_tag LOCUS_09200 gene metG 99811 97874 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_09200 100311 99901 gene locus_tag LOCUS_09210 100311 99901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 100837 100373 gene locus_tag LOCUS_09220 100837 100373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 101488 100910 gene locus_tag LOCUS_09230 101488 100910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 103053 101488 gene locus_tag LOCUS_09240 103053 101488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 103282 103085 gene locus_tag LOCUS_09250 103282 103085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 104634 103177 gene locus_tag LOCUS_09260 104634 103177 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_09260 106017 104650 gene locus_tag LOCUS_09270 gene trkA 106017 104650 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_09270 107339 106113 gene locus_tag LOCUS_09280 gene tyrS 107339 106113 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_09280 107772 108989 gene locus_tag LOCUS_09290 107772 108989 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 protein_id gnl|my_center|LOCUS_09290 109003 111837 gene locus_tag LOCUS_09300 109003 111837 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_09300 111896 113008 gene locus_tag LOCUS_09310 111896 113008 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_09310 113791 113048 gene locus_tag LOCUS_09320 113791 113048 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_09320 114043 114690 gene locus_tag LOCUS_09330 114043 114690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 114719 117295 gene locus_tag LOCUS_09340 gene clpB 114719 117295 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_09340 117397 118056 gene locus_tag LOCUS_09350 117397 118056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 120794 118302 gene locus_tag LOCUS_09360 120794 118302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 121886 120831 gene locus_tag LOCUS_09370 121886 120831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 122303 122112 gene locus_tag LOCUS_09380 122303 122112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 122870 122325 gene locus_tag LOCUS_09390 122870 122325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 123563 122895 gene locus_tag LOCUS_09400 123563 122895 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_09400 124780 123581 gene locus_tag LOCUS_09410 124780 123581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 125712 124798 gene locus_tag LOCUS_09420 gene metA 125712 124798 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_09420 125926 126810 gene locus_tag LOCUS_09430 125926 126810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 127079 126792 gene locus_tag LOCUS_09440 127079 126792 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_09440 127404 128657 gene locus_tag LOCUS_09450 127404 128657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 129952 128693 gene locus_tag LOCUS_09460 129952 128693 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_09460 130114 131457 gene locus_tag LOCUS_09470 130114 131457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 131557 132021 gene locus_tag LOCUS_09480 131557 132021 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_09480 133668 132013 gene locus_tag LOCUS_09490 133668 132013 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_09490 134279 133701 gene locus_tag LOCUS_09500 134279 133701 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939526.1 protein_id gnl|my_center|LOCUS_09500 135155 134625 gene locus_tag LOCUS_09510 135155 134625 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_09510 136051 135155 gene locus_tag LOCUS_09520 136051 135155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 137889 136072 gene locus_tag LOCUS_09530 137889 136072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 138868 137912 gene locus_tag LOCUS_09540 138868 137912 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_09540 139738 138893 gene locus_tag LOCUS_09550 139738 138893 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_09550 140598 139765 gene locus_tag LOCUS_09560 140598 139765 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948820.1 protein_id gnl|my_center|LOCUS_09560 141533 140595 gene locus_tag LOCUS_09570 141533 140595 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005831.1 protein_id gnl|my_center|LOCUS_09570 142044 141526 gene locus_tag LOCUS_09580 gene lspA 142044 141526 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745389.1 protein_id gnl|my_center|LOCUS_09580 143283 142060 gene locus_tag LOCUS_09590 143283 142060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 143805 143314 gene locus_tag LOCUS_09600 gene sepF 143805 143314 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_09600 144561 143836 gene locus_tag LOCUS_09610 144561 143836 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_09610 145792 144539 gene locus_tag LOCUS_09620 145792 144539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 146736 145789 gene locus_tag LOCUS_09630 gene miaA 146736 145789 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_09630 148693 146723 gene locus_tag LOCUS_09640 gene mutL 148693 146723 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_09640 151324 148706 gene locus_tag LOCUS_09650 gene mutS 151324 148706 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_09650 151819 151412 gene locus_tag LOCUS_09660 151819 151412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 153309 151879 gene locus_tag LOCUS_09670 gene miaB 153309 151879 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_09670 153605 154567 gene locus_tag LOCUS_09680 153605 154567 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_09680 154692 156383 gene locus_tag LOCUS_09690 154692 156383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 157843 156479 gene locus_tag LOCUS_09700 gene scfB 157843 156479 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_09700 158098 157961 gene locus_tag LOCUS_09710 gene scfA 158098 157961 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_09710 158792 158163 gene locus_tag LOCUS_09720 gene upp 158792 158163 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_09720 159291 158839 gene locus_tag LOCUS_09730 gene rpiB 159291 158839 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_09730 160015 159311 gene locus_tag LOCUS_09740 gene tsaB 160015 159311 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_09740 160442 159996 gene locus_tag LOCUS_09750 gene tsaE 160442 159996 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_09750 160573 161757 gene locus_tag LOCUS_09760 gene rodA 160573 161757 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_09760 161833 163452 gene locus_tag LOCUS_09770 161833 163452 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392674.1 protein_id gnl|my_center|LOCUS_09770 164744 163854 gene locus_tag LOCUS_09780 gene rsgA 164744 163854 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_09780 166941 164755 gene locus_tag LOCUS_09790 gene pknB 166941 164755 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_09790 167702 166974 gene locus_tag LOCUS_09800 167702 166974 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_09800 168777 167740 gene locus_tag LOCUS_09810 gene rlmN 168777 167740 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_09810 170107 168782 gene locus_tag LOCUS_09820 gene rsmB 170107 168782 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_09820 170826 170125 gene locus_tag LOCUS_09830 170826 170125 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_09830 171770 170844 gene locus_tag LOCUS_09840 gene fmt 171770 170844 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_09840 172231 171767 gene locus_tag LOCUS_09850 gene def 172231 171767 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_09850 174695 172251 gene locus_tag LOCUS_09860 gene priA 174695 172251 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_09860 174930 174721 gene locus_tag LOCUS_09870 174930 174721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 175540 174923 gene locus_tag LOCUS_09880 gene gmk 175540 174923 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_09880 175808 175533 gene locus_tag LOCUS_09890 175808 175533 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_09890 176706 175825 gene locus_tag LOCUS_09900 176706 175825 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_09900 177135 176797 gene locus_tag LOCUS_09910 177135 176797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 177892 177137 gene locus_tag LOCUS_09920 177892 177137 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_09920 179007 177898 gene locus_tag LOCUS_09930 179007 177898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 179539 179126 gene locus_tag LOCUS_09940 gene ytfJ 179539 179126 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350003.1 protein_id gnl|my_center|LOCUS_09940 180258 179566 gene locus_tag LOCUS_09950 180258 179566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 180945 180274 gene locus_tag LOCUS_09960 180945 180274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 181677 180967 gene locus_tag LOCUS_09970 181677 180967 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_09970 182398 181685 gene locus_tag LOCUS_09980 182398 181685 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_09980 183262 182420 gene locus_tag LOCUS_09990 gene prmC 183262 182420 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546726.1 protein_id gnl|my_center|LOCUS_09990 184336 183305 gene locus_tag LOCUS_10000 184336 183305 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_10000 185783 184311 gene locus_tag LOCUS_10010 185783 184311 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_10010 186519 185818 gene locus_tag LOCUS_10020 186519 185818 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142165.1 protein_id gnl|my_center|LOCUS_10020 187844 186516 gene locus_tag LOCUS_10030 187844 186516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 188214 188723 gene locus_tag LOCUS_10040 188214 188723 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_10040 188737 189342 gene locus_tag LOCUS_10050 188737 189342 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_10050 191069 189396 gene locus_tag LOCUS_10060 gene malL 191069 189396 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_10060 191922 191095 gene locus_tag LOCUS_10070 191922 191095 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_10070 192771 191968 gene locus_tag LOCUS_10080 gene proC 192771 191968 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_10080 193682 192804 gene locus_tag LOCUS_10090 193682 192804 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_10090 193824 194594 gene locus_tag LOCUS_10100 193824 194594 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_10100 194685 195314 gene locus_tag LOCUS_10110 194685 195314 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_10110 195521 196480 gene locus_tag LOCUS_10120 195521 196480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 197262 196537 gene locus_tag LOCUS_10130 gene nagB 197262 196537 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166981.1 protein_id gnl|my_center|LOCUS_10130 197429 198931 gene locus_tag LOCUS_10140 197429 198931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 199123 200535 gene locus_tag LOCUS_10150 199123 200535 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_10150 200553 201896 gene locus_tag LOCUS_10160 200553 201896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 202058 203176 gene locus_tag LOCUS_10170 202058 203176 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678891.1 protein_id gnl|my_center|LOCUS_10170 203287 203961 gene locus_tag LOCUS_10180 203287 203961 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_10180 203954 204850 gene locus_tag LOCUS_10190 203954 204850 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691258.1 protein_id gnl|my_center|LOCUS_10190 205765 204890 gene locus_tag LOCUS_10200 205765 204890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 205997 207283 gene locus_tag LOCUS_10210 205997 207283 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_10210 207285 207728 gene locus_tag LOCUS_10220 207285 207728 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_10220 209124 207784 gene locus_tag LOCUS_10230 209124 207784 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_10230 210865 209342 gene locus_tag LOCUS_10240 210865 209342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 211735 210878 gene locus_tag LOCUS_10250 211735 210878 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_10250 213089 211728 gene locus_tag LOCUS_10260 213089 211728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038047495.1 protein_id gnl|my_center|LOCUS_10260 213330 214157 gene locus_tag LOCUS_10270 213330 214157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 216183 214195 gene locus_tag LOCUS_10280 gene ligA 216183 214195 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_10280 216917 216264 gene locus_tag LOCUS_10290 gene yunB 216917 216264 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_10290 217194 218630 gene locus_tag LOCUS_10300 217194 218630 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_10300 218667 219923 gene locus_tag LOCUS_10310 218667 219923 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_10310 219926 220291 gene locus_tag LOCUS_10320 219926 220291 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_10320 221166 220369 gene locus_tag LOCUS_10330 221166 220369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 221460 221290 gene locus_tag LOCUS_10340 221460 221290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 221383 223590 gene locus_tag LOCUS_10350 221383 223590 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_10350 223897 223643 gene locus_tag LOCUS_10360 223897 223643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 224799 223897 gene locus_tag LOCUS_10370 224799 223897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 226195 225029 gene locus_tag LOCUS_10380 gene alr 226195 225029 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_10380 226980 226213 gene locus_tag LOCUS_10390 226980 226213 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_10390 227780 226995 gene locus_tag LOCUS_10400 227780 226995 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_10400 228782 227796 gene locus_tag LOCUS_10410 228782 227796 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_10410 229515 228784 gene locus_tag LOCUS_10420 gene pxpB 229515 228784 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_10420 230604 229537 gene locus_tag LOCUS_10430 230604 229537 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159135634.1 protein_id gnl|my_center|LOCUS_10430 231461 230619 gene locus_tag LOCUS_10440 231461 230619 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964110.1 protein_id gnl|my_center|LOCUS_10440 233594 231771 gene locus_tag LOCUS_10450 233594 231771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 235283 233673 gene locus_tag LOCUS_10460 235283 233673 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_10460 235621 235463 gene locus_tag LOCUS_10470 235621 235463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 240165 235651 gene locus_tag LOCUS_10480 240165 235651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 240864 240187 gene locus_tag LOCUS_10490 240864 240187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 243876 240892 gene locus_tag LOCUS_10500 243876 240892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 244351 245157 gene locus_tag LOCUS_10510 244351 245157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 246710 245268 gene locus_tag LOCUS_10520 gene xylB 246710 245268 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_10520 248034 246721 gene locus_tag LOCUS_10530 gene xylA 248034 246721 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898127.1 protein_id gnl|my_center|LOCUS_10530 250137 248071 gene locus_tag LOCUS_10540 250137 248071 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584070.1 protein_id gnl|my_center|LOCUS_10540 253321 250757 gene locus_tag LOCUS_10550 253321 250757 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_10550 254714 253311 gene locus_tag LOCUS_10560 gene melB 254714 253311 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032709637.1 protein_id gnl|my_center|LOCUS_10560 256525 255320 gene locus_tag LOCUS_10570 256525 255320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 256716 257375 gene locus_tag LOCUS_10580 256716 257375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 257413 259131 gene locus_tag LOCUS_10590 257413 259131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_10590 259128 261470 gene locus_tag LOCUS_10600 259128 261470 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157437265.1 protein_id gnl|my_center|LOCUS_10600 261475 263184 gene locus_tag LOCUS_10610 261475 263184 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_10610 263194 265743 gene locus_tag LOCUS_10620 263194 265743 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_10620 265827 266270 gene locus_tag LOCUS_10630 265827 266270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 266267 267589 gene locus_tag LOCUS_10640 266267 267589 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_10640 267586 269037 gene locus_tag LOCUS_10650 267586 269037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 269039 271537 gene locus_tag LOCUS_10660 269039 271537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 271534 272025 gene locus_tag LOCUS_10670 271534 272025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 272047 272319 gene locus_tag LOCUS_10680 272047 272319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 272371 272757 gene locus_tag LOCUS_10690 272371 272757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 273270 272905 gene locus_tag LOCUS_10700 273270 272905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 273999 273319 gene locus_tag LOCUS_10710 273999 273319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 274709 274395 gene locus_tag LOCUS_10720 274709 274395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 274861 275019 gene locus_tag LOCUS_10730 274861 275019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence04 1449 967 gene locus_tag LOCUS_10740 1449 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598973.1 protein_id gnl|my_center|LOCUS_10740 1708 1493 gene locus_tag LOCUS_10750 1708 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1896 1711 gene locus_tag LOCUS_10760 1896 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3502 2093 gene locus_tag LOCUS_10770 3502 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4918 3623 gene locus_tag LOCUS_10780 4918 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5099 6043 gene locus_tag LOCUS_10790 5099 6043 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_10790 7532 6156 gene locus_tag LOCUS_10800 7532 6156 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_10800 7694 7608 gene locus_tag LOCUS_t00160 7694 7608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7876 7793 gene locus_tag LOCUS_t00170 7876 7793 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9601 8000 gene locus_tag LOCUS_10810 9601 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10919 9684 gene locus_tag LOCUS_10820 10919 9684 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_10820 12368 10977 gene locus_tag LOCUS_10830 12368 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12965 12381 gene locus_tag LOCUS_10840 12965 12381 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230122.1 protein_id gnl|my_center|LOCUS_10840 13498 12956 gene locus_tag LOCUS_10850 13498 12956 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_10850 14392 13514 gene locus_tag LOCUS_10860 14392 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 15300 14389 gene locus_tag LOCUS_10870 15300 14389 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_10870 16125 15538 gene locus_tag LOCUS_10880 16125 15538 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_10880 16991 16125 gene locus_tag LOCUS_10890 gene dpsA 16991 16125 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_10890 17204 18583 gene locus_tag LOCUS_10900 gene murC 17204 18583 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_10900 18585 19097 gene locus_tag LOCUS_10910 18585 19097 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_10910 19145 20074 gene locus_tag LOCUS_10920 19145 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 20765 20190 gene locus_tag LOCUS_10930 20765 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 22086 21043 gene locus_tag LOCUS_10940 22086 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 23526 22291 gene locus_tag LOCUS_10950 23526 22291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_10950 25041 23542 gene locus_tag LOCUS_10960 25041 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25301 25864 gene locus_tag LOCUS_10970 25301 25864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 26896 25874 gene locus_tag LOCUS_10980 26896 25874 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757575.1 protein_id gnl|my_center|LOCUS_10980 27258 27004 gene locus_tag LOCUS_10990 gene spoIIID 27258 27004 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_10990 27750 27337 gene locus_tag LOCUS_11000 27750 27337 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_11000 28968 27835 gene locus_tag LOCUS_11010 gene tgt 28968 27835 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_11010 30013 28991 gene locus_tag LOCUS_11020 gene queA 30013 28991 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_11020 30198 31280 gene locus_tag LOCUS_11030 gene asd 30198 31280 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_11030 31341 32228 gene locus_tag LOCUS_11040 gene dapA 31341 32228 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391089.1 protein_id gnl|my_center|LOCUS_11040 32265 33032 gene locus_tag LOCUS_11050 gene dapB 32265 33032 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_11050 33029 33490 gene locus_tag LOCUS_11060 33029 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 34984 33557 gene locus_tag LOCUS_11070 34984 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 36254 35139 gene locus_tag LOCUS_11080 36254 35139 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_11080 37731 36259 gene locus_tag LOCUS_11090 37731 36259 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_11090 41626 37880 gene locus_tag LOCUS_11100 41626 37880 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_11100 42693 41638 gene locus_tag LOCUS_11110 gene ispG 42693 41638 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_11110 43789 42698 gene locus_tag LOCUS_11120 gene rseP 43789 42698 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_11120 44964 43819 gene locus_tag LOCUS_11130 44964 43819 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_11130 45826 44969 gene locus_tag LOCUS_11140 45826 44969 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 protein_id gnl|my_center|LOCUS_11140 46584 45856 gene locus_tag LOCUS_11150 46584 45856 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_11150 47223 46669 gene locus_tag LOCUS_11160 gene frr 47223 46669 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_11160 47981 47277 gene locus_tag LOCUS_11170 gene pyrH 47981 47277 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_11170 50338 48137 gene locus_tag LOCUS_11180 50338 48137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_11180 50883 50377 gene locus_tag LOCUS_11190 50883 50377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 53204 50895 gene locus_tag LOCUS_11200 53204 50895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_11200 54590 53289 gene locus_tag LOCUS_11210 54590 53289 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_11210 55694 54603 gene locus_tag LOCUS_11220 55694 54603 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_11220 56116 55691 gene locus_tag LOCUS_11230 56116 55691 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_11230 57291 56113 gene locus_tag LOCUS_11240 57291 56113 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_11240 58010 57306 gene locus_tag LOCUS_11250 gene deoD 58010 57306 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_11250 58689 58024 gene locus_tag LOCUS_11260 gene deoC 58689 58024 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_11260 58818 59024 gene locus_tag LOCUS_11270 58818 59024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 59021 59272 gene locus_tag LOCUS_11280 59021 59272 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_11280 59260 59871 gene locus_tag LOCUS_11290 59260 59871 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_11290 61095 59929 gene locus_tag LOCUS_11300 61095 59929 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_11300 61338 62552 gene locus_tag LOCUS_11310 61338 62552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 62554 62865 gene locus_tag LOCUS_11320 62554 62865 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_11320 63914 62934 gene locus_tag LOCUS_11330 63914 62934 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722331.1 protein_id gnl|my_center|LOCUS_11330 64087 65328 gene locus_tag LOCUS_11340 gene rhaA 64087 65328 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_11340 65325 66140 gene locus_tag LOCUS_11350 gene rhaD 65325 66140 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_11350 66193 66714 gene locus_tag LOCUS_11360 66193 66714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 67171 66764 gene locus_tag LOCUS_11370 gene iscR 67171 66764 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417910.1 protein_id gnl|my_center|LOCUS_11370 67616 67176 gene locus_tag LOCUS_11380 gene nifU 67616 67176 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_11380 68821 67631 gene locus_tag LOCUS_11390 gene nifS 68821 67631 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_11390 69946 68993 gene locus_tag LOCUS_11400 69946 68993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_11400 70258 71073 gene locus_tag LOCUS_11410 70258 71073 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_11410 71142 72023 gene locus_tag LOCUS_11420 gene pstC 71142 72023 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_11420 72026 72886 gene locus_tag LOCUS_11430 gene pstA 72026 72886 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_11430 72901 73662 gene locus_tag LOCUS_11440 gene pstB 72901 73662 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_11440 73662 74306 gene locus_tag LOCUS_11450 gene phoU 73662 74306 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_11450 74309 74986 gene locus_tag LOCUS_11460 74309 74986 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_11460 74983 76641 gene locus_tag LOCUS_11470 74983 76641 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_11470 77944 76694 gene locus_tag LOCUS_11480 77944 76694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 78082 78633 gene locus_tag LOCUS_11490 78082 78633 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868802.1 protein_id gnl|my_center|LOCUS_11490 80269 78893 gene locus_tag LOCUS_11500 80269 78893 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679363.1 protein_id gnl|my_center|LOCUS_11500 82049 80256 gene locus_tag LOCUS_11510 82049 80256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 82182 82886 gene locus_tag LOCUS_11520 82182 82886 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100889.1 protein_id gnl|my_center|LOCUS_11520 82883 83353 gene locus_tag LOCUS_11530 82883 83353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 84085 83603 gene locus_tag LOCUS_11540 84085 83603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 85792 84317 gene locus_tag LOCUS_11550 85792 84317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 85794 86069 gene locus_tag LOCUS_11560 85794 86069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 86066 87334 gene locus_tag LOCUS_11570 86066 87334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 87448 87981 gene locus_tag LOCUS_11580 87448 87981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 88481 88275 gene locus_tag LOCUS_11590 88481 88275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 89254 88478 gene locus_tag LOCUS_11600 89254 88478 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493645.1 protein_id gnl|my_center|LOCUS_11600 89750 90328 gene locus_tag LOCUS_11610 89750 90328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603095.1 protein_id gnl|my_center|LOCUS_11610 90441 91058 gene locus_tag LOCUS_11620 90441 91058 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_11620 91060 91668 gene locus_tag LOCUS_11630 91060 91668 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_11630 91713 92414 gene locus_tag LOCUS_11640 91713 92414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 92442 93218 gene locus_tag LOCUS_11650 92442 93218 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11650 93246 93488 gene locus_tag LOCUS_11660 93246 93488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 93488 93664 gene locus_tag LOCUS_11670 93488 93664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 94709 93714 gene locus_tag LOCUS_11680 94709 93714 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_11680 95109 94735 gene locus_tag LOCUS_11690 95109 94735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 96233 95142 gene locus_tag LOCUS_11700 gene mglC 96233 95142 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275106.1 protein_id gnl|my_center|LOCUS_11700 97775 96246 gene locus_tag LOCUS_11710 gene mglA 97775 96246 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_11710 98930 97848 gene locus_tag LOCUS_11720 gene mglB 98930 97848 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_11720 100104 99121 gene locus_tag LOCUS_11730 100104 99121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_11730 101830 100094 gene locus_tag LOCUS_11740 101830 100094 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_11740 103397 101814 gene locus_tag LOCUS_11750 103397 101814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 103660 104790 gene locus_tag LOCUS_11760 103660 104790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 105168 106253 gene locus_tag LOCUS_11770 gene pheS 105168 106253 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_11770 106258 108621 gene locus_tag LOCUS_11780 gene pheT 106258 108621 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_11780 108691 108942 gene locus_tag LOCUS_11790 108691 108942 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_11790 108975 109268 gene locus_tag LOCUS_11800 108975 109268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 110153 109455 gene locus_tag LOCUS_11810 110153 109455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 111629 110340 gene locus_tag LOCUS_11820 111629 110340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 112507 111626 gene locus_tag LOCUS_11830 gene cdaA 112507 111626 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_11830 113034 112561 gene locus_tag LOCUS_11840 gene ispF 113034 112561 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_11840 113636 113031 gene locus_tag LOCUS_11850 gene rnmV 113636 113031 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832196.1 protein_id gnl|my_center|LOCUS_11850 114707 113661 gene locus_tag LOCUS_11860 114707 113661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 116915 114708 gene locus_tag LOCUS_11870 116915 114708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 117471 116932 gene locus_tag LOCUS_11880 117471 116932 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_11880 117849 117508 gene locus_tag LOCUS_11890 117849 117508 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_11890 120554 117915 gene locus_tag LOCUS_11900 gene alaS 120554 117915 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_11900 122152 121073 gene locus_tag LOCUS_11910 122152 121073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 122291 122608 gene locus_tag LOCUS_11920 122291 122608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 124188 122734 gene locus_tag LOCUS_11930 124188 122734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 125120 124362 gene locus_tag LOCUS_11940 125120 124362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 125824 125297 gene locus_tag LOCUS_11950 125824 125297 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495432.1 protein_id gnl|my_center|LOCUS_11950 126068 125838 gene locus_tag LOCUS_11960 126068 125838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11960 126591 128348 gene locus_tag LOCUS_11970 126591 128348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_11970 129562 128369 gene locus_tag LOCUS_11980 gene rlmD 129562 128369 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_11980 130110 129607 gene locus_tag LOCUS_11990 130110 129607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 131805 130132 gene locus_tag LOCUS_12000 gene recN 131805 130132 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_12000 132268 131816 gene locus_tag LOCUS_12010 132268 131816 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_12010 133146 132265 gene locus_tag LOCUS_12020 133146 132265 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_12020 133964 133149 gene locus_tag LOCUS_12030 133964 133149 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_12030 135829 133967 gene locus_tag LOCUS_12040 gene dxs 135829 133967 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_12040 136752 135865 gene locus_tag LOCUS_12050 136752 135865 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_12050 136951 136745 gene locus_tag LOCUS_12060 136951 136745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 138170 136944 gene locus_tag LOCUS_12070 gene xseA 138170 136944 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_12070 139101 138163 gene locus_tag LOCUS_12080 139101 138163 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_12080 139542 139105 gene locus_tag LOCUS_12090 gene nusB 139542 139105 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_12090 140013 139645 gene locus_tag LOCUS_12100 140013 139645 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564719.1 protein_id gnl|my_center|LOCUS_12100 140628 140062 gene locus_tag LOCUS_12110 140628 140062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 141231 140671 gene locus_tag LOCUS_12120 141231 140671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 141712 141209 gene locus_tag LOCUS_12130 141712 141209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 142847 141714 gene locus_tag LOCUS_12140 142847 141714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 143249 142857 gene locus_tag LOCUS_12150 143249 142857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 143445 143251 gene locus_tag LOCUS_12160 gene spoIIIAC 143445 143251 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_12160 143997 143491 gene locus_tag LOCUS_12170 143997 143491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 144937 143903 gene locus_tag LOCUS_12180 gene spoIIIAA 144937 143903 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_12180 146733 145051 gene locus_tag LOCUS_12190 146733 145051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 147043 146915 gene locus_tag LOCUS_12200 147043 146915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 149057 147390 gene locus_tag LOCUS_12210 149057 147390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 149789 149253 gene locus_tag LOCUS_12220 149789 149253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 150028 151725 gene locus_tag LOCUS_12230 150028 151725 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966681.1 protein_id gnl|my_center|LOCUS_12230 152481 152026 gene locus_tag LOCUS_12240 gene nrdR 152481 152026 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_12240 153310 152531 gene locus_tag LOCUS_12250 153310 152531 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965930.1 protein_id gnl|my_center|LOCUS_12250 153400 153663 gene locus_tag LOCUS_12260 153400 153663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 153816 154826 gene locus_tag LOCUS_12270 153816 154826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 155661 154867 gene locus_tag LOCUS_12280 155661 154867 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_12280 156962 155640 gene locus_tag LOCUS_12290 156962 155640 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_12290 158538 157060 gene locus_tag LOCUS_12300 gene spoIVA 158538 157060 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_12300 160068 158551 gene locus_tag LOCUS_12310 160068 158551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 160381 160815 gene locus_tag LOCUS_12320 160381 160815 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_12320 162355 160883 gene locus_tag LOCUS_12330 162355 160883 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_12330 165378 162376 gene locus_tag LOCUS_12340 gene lacZ 165378 162376 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_12340 165517 166869 gene locus_tag LOCUS_12350 gene lpdA 165517 166869 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_12350 166862 168013 gene locus_tag LOCUS_12360 166862 168013 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203177.1 protein_id gnl|my_center|LOCUS_12360 168015 168311 gene locus_tag LOCUS_12370 168015 168311 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192097.1 protein_id gnl|my_center|LOCUS_12370 168513 168965 gene locus_tag LOCUS_12380 168513 168965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 168980 169381 gene locus_tag LOCUS_12390 168980 169381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 169579 169424 gene locus_tag LOCUS_12400 169579 169424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 171585 169576 gene locus_tag LOCUS_12410 gene feoB 171585 169576 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_12410 171818 171582 gene locus_tag LOCUS_12420 171818 171582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 172412 172005 gene locus_tag LOCUS_12430 172412 172005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 172997 172428 gene locus_tag LOCUS_12440 172997 172428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 174033 173020 gene locus_tag LOCUS_12450 174033 173020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 174908 174084 gene locus_tag LOCUS_12460 174908 174084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 176016 174922 gene locus_tag LOCUS_12470 176016 174922 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_12470 177391 176504 gene locus_tag LOCUS_12480 177391 176504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 177587 177462 gene locus_tag LOCUS_12490 177587 177462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 177769 177554 gene locus_tag LOCUS_12500 177769 177554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 179205 177778 gene locus_tag LOCUS_12510 179205 177778 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_12510 179834 179274 gene locus_tag LOCUS_12520 179834 179274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 180256 179849 gene locus_tag LOCUS_12530 180256 179849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 180626 180315 gene locus_tag LOCUS_12540 180626 180315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 182232 180757 gene locus_tag LOCUS_12550 182232 180757 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_12550 182924 182307 gene locus_tag LOCUS_12560 182924 182307 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_12560 184321 182921 gene locus_tag LOCUS_12570 184321 182921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 186777 184354 gene locus_tag LOCUS_12580 186777 184354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 187004 187090 gene locus_tag LOCUS_t00180 187004 187090 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 187747 188289 gene locus_tag LOCUS_12590 187747 188289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 188347 189144 gene locus_tag LOCUS_12600 188347 189144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 189157 189669 gene locus_tag LOCUS_12610 189157 189669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 190024 192231 gene locus_tag LOCUS_12620 190024 192231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 192245 192922 gene locus_tag LOCUS_12630 192245 192922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 193100 193837 gene locus_tag LOCUS_12640 193100 193837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 193974 195545 gene locus_tag LOCUS_12650 193974 195545 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_12650 196087 195662 gene locus_tag LOCUS_12660 196087 195662 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_12660 197411 196224 gene locus_tag LOCUS_12670 197411 196224 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_12670 197550 198752 gene locus_tag LOCUS_12680 gene ackA 197550 198752 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_12680 198754 199374 gene locus_tag LOCUS_12690 198754 199374 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_12690 199380 200504 gene locus_tag LOCUS_12700 199380 200504 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_12700 200533 200868 gene locus_tag LOCUS_12710 200533 200868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 201430 200858 gene locus_tag LOCUS_12720 201430 200858 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_12720 201566 203686 gene locus_tag LOCUS_12730 201566 203686 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_12730 203683 203853 gene locus_tag LOCUS_12740 203683 203853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 205440 203899 gene locus_tag LOCUS_12750 205440 203899 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_12750 206771 205467 gene locus_tag LOCUS_12760 206771 205467 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_12760 207984 206785 gene locus_tag LOCUS_12770 207984 206785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 208629 208156 gene locus_tag LOCUS_12780 gene ybaK 208629 208156 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_12780 209569 208634 gene locus_tag LOCUS_12790 209569 208634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 210389 209556 gene locus_tag LOCUS_12800 210389 209556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 211096 210410 gene locus_tag LOCUS_12810 211096 210410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 212361 211096 gene locus_tag LOCUS_12820 212361 211096 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_12820 213127 212363 gene locus_tag LOCUS_12830 213127 212363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 214139 213120 gene locus_tag LOCUS_12840 214139 213120 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_12840 215167 214139 gene locus_tag LOCUS_12850 215167 214139 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_12850 215262 216341 gene locus_tag LOCUS_12860 215262 216341 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_12860 217638 216361 gene locus_tag LOCUS_12870 gene galK 217638 216361 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_12870 218312 217662 gene locus_tag LOCUS_12880 218312 217662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 218586 219953 gene locus_tag LOCUS_12890 218586 219953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 219934 220893 gene locus_tag LOCUS_12900 219934 220893 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_12900 221213 221932 gene locus_tag LOCUS_12910 221213 221932 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_12910 221929 223146 gene locus_tag LOCUS_12920 221929 223146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 223545 225374 gene locus_tag LOCUS_12930 gene ftsH 223545 225374 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_12930 225371 225919 gene locus_tag LOCUS_12940 225371 225919 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_12940 227283 226108 gene locus_tag LOCUS_12950 gene pepT 227283 226108 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_12950 230577 227491 gene locus_tag LOCUS_12960 gene lacZ 230577 227491 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_12960 232185 230701 gene locus_tag LOCUS_12970 232185 230701 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989833.1 protein_id gnl|my_center|LOCUS_12970 232544 232212 gene locus_tag LOCUS_12980 232544 232212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 233852 232611 gene locus_tag LOCUS_12990 233852 232611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 235599 233857 gene locus_tag LOCUS_13000 235599 233857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 235812 236909 gene locus_tag LOCUS_13010 235812 236909 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052806.1 protein_id gnl|my_center|LOCUS_13010 236934 237218 gene locus_tag LOCUS_13020 236934 237218 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_13020 237690 237388 gene locus_tag LOCUS_13030 237690 237388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence05 560 1237 gene locus_tag LOCUS_13040 560 1237 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_13040 1282 2799 gene locus_tag LOCUS_13050 1282 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4236 2866 gene locus_tag LOCUS_13060 4236 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5756 4233 gene locus_tag LOCUS_13070 5756 4233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_13070 5967 7034 gene locus_tag LOCUS_13080 5967 7034 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_13080 7087 7500 gene locus_tag LOCUS_13090 7087 7500 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_13090 7605 8798 gene locus_tag LOCUS_13100 7605 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 8876 11791 gene locus_tag LOCUS_13110 8876 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 12184 11783 gene locus_tag LOCUS_13120 12184 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 12268 13863 gene locus_tag LOCUS_13130 12268 13863 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_13130 13883 14578 gene locus_tag LOCUS_13140 13883 14578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_13140 15478 14627 gene locus_tag LOCUS_13150 15478 14627 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_13150 15590 16030 gene locus_tag LOCUS_13160 gene aroQ 15590 16030 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903558.1 protein_id gnl|my_center|LOCUS_13160 16119 17033 gene locus_tag LOCUS_13170 16119 17033 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963968.1 protein_id gnl|my_center|LOCUS_13170 16984 17571 gene locus_tag LOCUS_13180 16984 17571 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_13180 17562 18131 gene locus_tag LOCUS_13190 17562 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963966.1 protein_id gnl|my_center|LOCUS_13190 19540 18257 gene locus_tag LOCUS_13200 gene mtaB 19540 18257 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_13200 19699 20853 gene locus_tag LOCUS_13210 19699 20853 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_13210 21005 21766 gene locus_tag LOCUS_13220 21005 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 21820 22578 gene locus_tag LOCUS_13230 gene rlmA 21820 22578 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705931.1 protein_id gnl|my_center|LOCUS_13230 22766 23863 gene locus_tag LOCUS_13240 22766 23863 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_13240 23880 24527 gene locus_tag LOCUS_13250 23880 24527 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966256.1 protein_id gnl|my_center|LOCUS_13250 24561 25832 gene locus_tag LOCUS_13260 gene obgE 24561 25832 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_13260 25847 26269 gene locus_tag LOCUS_13270 25847 26269 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_13270 26266 27222 gene locus_tag LOCUS_13280 26266 27222 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_13280 27356 27895 gene locus_tag LOCUS_13290 gene sigV 27356 27895 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_13290 27882 28637 gene locus_tag LOCUS_13300 27882 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 28658 30004 gene locus_tag LOCUS_13310 28658 30004 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_13310 30017 31285 gene locus_tag LOCUS_13320 30017 31285 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_13320 32811 31375 gene locus_tag LOCUS_13330 32811 31375 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_13330 34551 32836 gene locus_tag LOCUS_13340 34551 32836 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_13340 35217 34576 gene locus_tag LOCUS_13350 gene gmhA 35217 34576 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_13350 36209 35214 gene locus_tag LOCUS_13360 36209 35214 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_13360 36330 37007 gene locus_tag LOCUS_13370 36330 37007 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_13370 37004 37387 gene locus_tag LOCUS_13380 37004 37387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 37457 37909 gene locus_tag LOCUS_13390 37457 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 38200 39750 gene locus_tag LOCUS_13400 38200 39750 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_13400 39764 41152 gene locus_tag LOCUS_13410 39764 41152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 41168 41386 gene locus_tag LOCUS_13420 41168 41386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 43506 41452 gene locus_tag LOCUS_13430 43506 41452 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_13430 44679 43732 gene locus_tag LOCUS_13440 44679 43732 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_13440 45128 44691 gene locus_tag LOCUS_13450 45128 44691 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_13450 46667 45234 gene locus_tag LOCUS_13460 46667 45234 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_13460 48096 46741 gene locus_tag LOCUS_13470 48096 46741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 48908 48108 gene locus_tag LOCUS_13480 48908 48108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 49558 50598 gene locus_tag LOCUS_13490 49558 50598 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_13490 50664 51602 gene locus_tag LOCUS_13500 50664 51602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_13500 51595 52380 gene locus_tag LOCUS_13510 51595 52380 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_13510 53801 52617 gene locus_tag LOCUS_13520 53801 52617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 54352 53798 gene locus_tag LOCUS_13530 54352 53798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 54564 55703 gene locus_tag LOCUS_13540 54564 55703 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180269231.1 protein_id gnl|my_center|LOCUS_13540 55974 55901 gene locus_tag LOCUS_t00190 55974 55901 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56187 56260 gene locus_tag LOCUS_t00200 56187 56260 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 56311 56961 gene locus_tag LOCUS_13550 56311 56961 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_13550 58646 57363 gene locus_tag LOCUS_13560 gene estB 58646 57363 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986581.1 protein_id gnl|my_center|LOCUS_13560 58591 58866 gene locus_tag LOCUS_13570 58591 58866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 58911 59132 gene locus_tag LOCUS_13580 58911 59132 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_13580 59288 61048 gene locus_tag LOCUS_13590 gene dnaG 59288 61048 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_13590 61120 62220 gene locus_tag LOCUS_13600 gene rpoD 61120 62220 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_13600 63069 62275 gene locus_tag LOCUS_13610 63069 62275 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_13610 63660 63097 gene locus_tag LOCUS_13620 63660 63097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 65969 63672 gene locus_tag LOCUS_13630 65969 63672 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_13630 66155 67009 gene locus_tag LOCUS_13640 66155 67009 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_13640 67031 68266 gene locus_tag LOCUS_13650 67031 68266 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_13650 68290 68955 gene locus_tag LOCUS_13660 gene cmk 68290 68955 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_13660 68955 69623 gene locus_tag LOCUS_13670 68955 69623 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_13670 69598 71700 gene locus_tag LOCUS_13680 69598 71700 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392842.1 protein_id gnl|my_center|LOCUS_13680 72012 72668 gene locus_tag LOCUS_13690 72012 72668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_13690 72746 72952 gene locus_tag LOCUS_13700 72746 72952 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_13700 72990 74036 gene locus_tag LOCUS_13710 72990 74036 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_13710 74036 74791 gene locus_tag LOCUS_13720 74036 74791 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_13720 74788 75327 gene locus_tag LOCUS_13730 74788 75327 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_13730 76615 75467 gene locus_tag LOCUS_13740 gene fucO 76615 75467 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_13740 76984 76763 gene locus_tag LOCUS_13750 76984 76763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 77114 77569 gene locus_tag LOCUS_13760 77114 77569 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816073.1 protein_id gnl|my_center|LOCUS_13760 77676 78572 gene locus_tag LOCUS_13770 77676 78572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 78653 78729 gene locus_tag LOCUS_t00210 78653 78729 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78762 78837 gene locus_tag LOCUS_t00220 78762 78837 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 79355 79789 gene locus_tag LOCUS_13780 79355 79789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 80000 80488 gene locus_tag LOCUS_13790 80000 80488 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 protein_id gnl|my_center|LOCUS_13790 81566 80643 gene locus_tag LOCUS_13800 81566 80643 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654136.1 protein_id gnl|my_center|LOCUS_13800 82358 82008 gene locus_tag LOCUS_13810 82358 82008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 82696 83148 gene locus_tag LOCUS_13820 82696 83148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 83160 83342 gene locus_tag LOCUS_13830 83160 83342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 84476 83490 gene locus_tag LOCUS_13840 84476 83490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 86076 84652 gene locus_tag LOCUS_13850 86076 84652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 86248 86934 gene locus_tag LOCUS_13860 86248 86934 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_13860 86959 89451 gene locus_tag LOCUS_13870 86959 89451 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_13870 89610 90257 gene locus_tag LOCUS_13880 89610 90257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 90396 92066 gene locus_tag LOCUS_13890 90396 92066 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_13890 92446 94272 gene locus_tag LOCUS_13900 gene glmS 92446 94272 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_13900 94392 95813 gene locus_tag LOCUS_13910 94392 95813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 97389 95872 gene locus_tag LOCUS_13920 97389 95872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 97923 97420 gene locus_tag LOCUS_13930 97923 97420 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_13930 98702 97956 gene locus_tag LOCUS_13940 98702 97956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 98940 99611 gene locus_tag LOCUS_13950 98940 99611 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_13950 99668 101119 gene locus_tag LOCUS_13960 99668 101119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 101209 103479 gene locus_tag LOCUS_13970 101209 103479 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_13970 103502 103846 gene locus_tag LOCUS_13980 103502 103846 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 protein_id gnl|my_center|LOCUS_13980 104074 105999 gene locus_tag LOCUS_13990 104074 105999 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_13990 106216 106836 gene locus_tag LOCUS_14000 106216 106836 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013589.1 protein_id gnl|my_center|LOCUS_14000 106829 107653 gene locus_tag LOCUS_14010 106829 107653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 107673 108809 gene locus_tag LOCUS_14020 107673 108809 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_14020 108826 109908 gene locus_tag LOCUS_14030 108826 109908 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_14030 109915 110667 gene locus_tag LOCUS_14040 109915 110667 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_14040 110660 111790 gene locus_tag LOCUS_14050 110660 111790 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_14050 111809 112999 gene locus_tag LOCUS_14060 111809 112999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 113013 113909 gene locus_tag LOCUS_14070 113013 113909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 113914 114939 gene locus_tag LOCUS_14080 113914 114939 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243644.1 protein_id gnl|my_center|LOCUS_14080 114936 115910 gene locus_tag LOCUS_14090 114936 115910 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_14090 115923 116900 gene locus_tag LOCUS_14100 115923 116900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 117258 118346 gene locus_tag LOCUS_14110 117258 118346 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_14110 118343 119893 gene locus_tag LOCUS_14120 118343 119893 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_14120 120037 121794 gene locus_tag LOCUS_14130 120037 121794 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_14130 121800 122642 gene locus_tag LOCUS_14140 121800 122642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838868.1 protein_id gnl|my_center|LOCUS_14140 122703 124253 gene locus_tag LOCUS_14150 122703 124253 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_14150 124303 125166 gene locus_tag LOCUS_14160 124303 125166 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_14160 125182 126324 gene locus_tag LOCUS_14170 125182 126324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 126410 127156 gene locus_tag LOCUS_14180 126410 127156 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894051.1 protein_id gnl|my_center|LOCUS_14180 127153 127962 gene locus_tag LOCUS_14190 127153 127962 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_14190 129757 128066 gene locus_tag LOCUS_14200 129757 128066 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_14200 130335 129787 gene locus_tag LOCUS_14210 130335 129787 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_14210 130536 131687 gene locus_tag LOCUS_14220 130536 131687 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_14220 132654 131737 gene locus_tag LOCUS_14230 132654 131737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 133613 132657 gene locus_tag LOCUS_14240 133613 132657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 134659 133712 gene locus_tag LOCUS_14250 134659 133712 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702248.1 protein_id gnl|my_center|LOCUS_14250 136509 134695 gene locus_tag LOCUS_14260 gene recQ 136509 134695 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948677.1 protein_id gnl|my_center|LOCUS_14260 136842 137735 gene locus_tag LOCUS_14270 gene chbG 136842 137735 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593496.1 protein_id gnl|my_center|LOCUS_14270 137762 139051 gene locus_tag LOCUS_14280 137762 139051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 139671 139237 gene locus_tag LOCUS_14290 139671 139237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 139969 139781 gene locus_tag LOCUS_14300 139969 139781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 142755 140374 gene locus_tag LOCUS_14310 142755 140374 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_14310 143860 142781 gene locus_tag LOCUS_14320 143860 142781 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966091.1 protein_id gnl|my_center|LOCUS_14320 144073 145059 gene locus_tag LOCUS_14330 144073 145059 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_14330 145341 146024 gene locus_tag LOCUS_14340 145341 146024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 146457 147935 gene locus_tag LOCUS_14350 146457 147935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 148149 149210 gene locus_tag LOCUS_14360 148149 149210 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_14360 149322 149819 gene locus_tag LOCUS_14370 149322 149819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 151641 150187 gene locus_tag LOCUS_14380 151641 150187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_14380 152240 151923 gene locus_tag LOCUS_14390 152240 151923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 152843 152424 gene locus_tag LOCUS_14400 152843 152424 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546500.1 protein_id gnl|my_center|LOCUS_14400 153832 152858 gene locus_tag LOCUS_14410 153832 152858 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703563.1 protein_id gnl|my_center|LOCUS_14410 154411 153848 gene locus_tag LOCUS_14420 154411 153848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 156601 154415 gene locus_tag LOCUS_14430 156601 154415 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_14430 158516 156603 gene locus_tag LOCUS_14440 158516 156603 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_14440 159472 158525 gene locus_tag LOCUS_14450 gene manA 159472 158525 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_14450 159601 159876 gene locus_tag LOCUS_14460 159601 159876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 159887 160153 gene locus_tag LOCUS_14470 159887 160153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 160296 160371 gene locus_tag LOCUS_t00230 160296 160371 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 160518 162050 gene locus_tag LOCUS_14480 160518 162050 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_14480 162062 163360 gene locus_tag LOCUS_14490 162062 163360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 163503 163850 gene locus_tag LOCUS_14500 163503 163850 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_14500 163863 165377 gene locus_tag LOCUS_14510 163863 165377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 165984 165511 gene locus_tag LOCUS_14520 165984 165511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 166685 166182 gene locus_tag LOCUS_14530 166685 166182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 167681 166824 gene locus_tag LOCUS_14540 167681 166824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 167955 167704 gene locus_tag LOCUS_14550 167955 167704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 168145 167942 gene locus_tag LOCUS_14560 168145 167942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 168970 168197 gene locus_tag LOCUS_14570 168970 168197 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_14570 169292 170374 gene locus_tag LOCUS_14580 169292 170374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 170440 171405 gene locus_tag LOCUS_14590 170440 171405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 171395 172318 gene locus_tag LOCUS_14600 gene ftsX 171395 172318 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_14600 172308 173612 gene locus_tag LOCUS_14610 172308 173612 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_14610 173641 174855 gene locus_tag LOCUS_14620 173641 174855 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_14620 175134 176207 gene locus_tag LOCUS_14630 gene gap 175134 176207 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_14630 177758 176409 gene locus_tag LOCUS_14640 gene mgtE 177758 176409 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898141.1 protein_id gnl|my_center|LOCUS_14640 178241 178738 gene locus_tag LOCUS_14650 178241 178738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 178725 179993 gene locus_tag LOCUS_14660 178725 179993 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_14660 180078 181181 gene locus_tag LOCUS_14670 180078 181181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 181178 182128 gene locus_tag LOCUS_14680 181178 182128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 182141 182485 gene locus_tag LOCUS_14690 182141 182485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 182504 183508 gene locus_tag LOCUS_14700 182504 183508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 183525 183893 gene locus_tag LOCUS_14710 183525 183893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 183890 184225 gene locus_tag LOCUS_14720 183890 184225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 184277 185116 gene locus_tag LOCUS_14730 184277 185116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 185295 185927 gene locus_tag LOCUS_14740 185295 185927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 185924 186160 gene locus_tag LOCUS_14750 185924 186160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 186157 186972 gene locus_tag LOCUS_14760 186157 186972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 186969 187583 gene locus_tag LOCUS_14770 186969 187583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 187588 187887 gene locus_tag LOCUS_14780 187588 187887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 187874 188041 gene locus_tag LOCUS_14790 187874 188041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 188056 189030 gene locus_tag LOCUS_14800 188056 189030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 189032 189250 gene locus_tag LOCUS_14810 189032 189250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 189262 189552 gene locus_tag LOCUS_14820 189262 189552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 189793 192903 gene locus_tag LOCUS_14830 189793 192903 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_14830 192916 193662 gene locus_tag LOCUS_14840 192916 193662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994265.1 protein_id gnl|my_center|LOCUS_14840 194337 193747 gene locus_tag LOCUS_14850 194337 193747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 194496 195290 gene locus_tag LOCUS_14860 194496 195290 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_14860 195435 195510 gene locus_tag LOCUS_t00240 195435 195510 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 195513 195589 gene locus_tag LOCUS_t00250 195513 195589 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 195630 195705 gene locus_tag LOCUS_t00260 195630 195705 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 195711 195786 gene locus_tag LOCUS_t00270 195711 195786 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 195851 195925 gene locus_tag LOCUS_t00280 195851 195925 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 3100 431 gene locus_tag LOCUS_14870 3100 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5119 3311 gene locus_tag LOCUS_14880 gene fucI 5119 3311 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_14880 6603 5137 gene locus_tag LOCUS_14890 6603 5137 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_14890 7044 6622 gene locus_tag LOCUS_14900 7044 6622 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_14900 8829 7069 gene locus_tag LOCUS_14910 8829 7069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_14910 9007 9723 gene locus_tag LOCUS_14920 9007 9723 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_14920 9720 11051 gene locus_tag LOCUS_14930 9720 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 11211 11378 gene locus_tag LOCUS_14940 11211 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 11470 11679 gene locus_tag LOCUS_14950 11470 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12372 11689 gene locus_tag LOCUS_14960 12372 11689 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924376.1 protein_id gnl|my_center|LOCUS_14960 13162 12623 gene locus_tag LOCUS_14970 gene spoVT 13162 12623 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_14970 13456 14250 gene locus_tag LOCUS_14980 13456 14250 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_14980 14268 14981 gene locus_tag LOCUS_14990 14268 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_14990 16136 16492 gene locus_tag LOCUS_15000 16136 16492 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_15000 16485 16910 gene locus_tag LOCUS_15010 16485 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 16964 18274 gene locus_tag LOCUS_15020 16964 18274 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_15020 18271 18603 gene locus_tag LOCUS_15030 18271 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 18653 18823 gene locus_tag LOCUS_15040 18653 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 19191 22313 gene locus_tag LOCUS_15050 gene ileS 19191 22313 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_15050 22531 23241 gene locus_tag LOCUS_15060 22531 23241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 23452 23976 gene locus_tag LOCUS_15070 gene infC 23452 23976 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_15070 24025 24222 gene locus_tag LOCUS_15080 gene rpmI 24025 24222 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_15080 24265 24621 gene locus_tag LOCUS_15090 gene rplT 24265 24621 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_15090 24707 25495 gene locus_tag LOCUS_15100 24707 25495 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327792.1 protein_id gnl|my_center|LOCUS_15100 25511 26746 gene locus_tag LOCUS_15110 gene dprA 25511 26746 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813280.1 protein_id gnl|my_center|LOCUS_15110 26764 28878 gene locus_tag LOCUS_15120 gene topA 26764 28878 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_15120 28871 30187 gene locus_tag LOCUS_15130 gene trmFO 28871 30187 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813284.1 protein_id gnl|my_center|LOCUS_15130 30184 31188 gene locus_tag LOCUS_15140 gene plsX 30184 31188 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_15140 31193 31873 gene locus_tag LOCUS_15150 gene rnc 31193 31873 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_15150 31870 32877 gene locus_tag LOCUS_15160 31870 32877 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_15160 32892 36467 gene locus_tag LOCUS_15170 gene smc 32892 36467 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_15170 39372 36757 gene locus_tag LOCUS_15180 39372 36757 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_15180 39519 41276 gene locus_tag LOCUS_15190 39519 41276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_15190 41273 43126 gene locus_tag LOCUS_15200 41273 43126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_15200 43589 43398 gene locus_tag LOCUS_15210 43589 43398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 46137 43624 gene locus_tag LOCUS_15220 46137 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 46401 46180 gene locus_tag LOCUS_15230 46401 46180 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_15230 46698 46486 gene locus_tag LOCUS_15240 46698 46486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 46987 47361 gene locus_tag LOCUS_15250 46987 47361 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_15250 47400 47618 gene locus_tag LOCUS_15260 47400 47618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 48356 47745 gene locus_tag LOCUS_15270 48356 47745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 50058 48385 gene locus_tag LOCUS_15280 50058 48385 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_15280 51732 50059 gene locus_tag LOCUS_15290 51732 50059 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_15290 52010 52930 gene locus_tag LOCUS_15300 52010 52930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 53018 53593 gene locus_tag LOCUS_15310 gene eutD 53018 53593 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_15310 53846 54730 gene locus_tag LOCUS_15320 53846 54730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 54926 55846 gene locus_tag LOCUS_15330 54926 55846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 57993 55942 gene locus_tag LOCUS_15340 gene fusA 57993 55942 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_15340 61071 58333 gene locus_tag LOCUS_15350 61071 58333 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_15350 64054 61352 gene locus_tag LOCUS_15360 64054 61352 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_15360 64505 64714 gene locus_tag LOCUS_15370 64505 64714 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463371.1 protein_id gnl|my_center|LOCUS_15370 65915 64830 gene locus_tag LOCUS_15380 65915 64830 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_15380 66427 66526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66814 66889 gene locus_tag LOCUS_t00290 66814 66889 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 67063 67905 gene locus_tag LOCUS_15390 67063 67905 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900020.1 protein_id gnl|my_center|LOCUS_15390 67969 70272 gene locus_tag LOCUS_15400 67969 70272 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_15400 70287 70862 gene locus_tag LOCUS_15410 70287 70862 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_15410 71516 70923 gene locus_tag LOCUS_15420 71516 70923 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_15420 72159 71581 gene locus_tag LOCUS_15430 72159 71581 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_15430 72569 74041 gene locus_tag LOCUS_15440 72569 74041 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_15440 74043 74843 gene locus_tag LOCUS_15450 74043 74843 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_15450 74848 77448 gene locus_tag LOCUS_15460 74848 77448 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_15460 77461 78348 gene locus_tag LOCUS_15470 77461 78348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 78858 78783 gene locus_tag LOCUS_t00300 78858 78783 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 79421 78951 gene locus_tag LOCUS_15480 79421 78951 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_15480 80496 79489 gene locus_tag LOCUS_15490 80496 79489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 80704 81333 gene locus_tag LOCUS_15500 80704 81333 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_15500 83131 81389 gene locus_tag LOCUS_15510 83131 81389 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_15510 84963 83152 gene locus_tag LOCUS_15520 gene nuoF 84963 83152 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_15520 85350 84979 gene locus_tag LOCUS_15530 85350 84979 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_15530 85927 85379 gene locus_tag LOCUS_15540 85927 85379 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_15540 86432 85932 gene locus_tag LOCUS_15550 gene nuoE 86432 85932 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_15550 87310 86576 gene locus_tag LOCUS_15560 87310 86576 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_15560 88737 87487 gene locus_tag LOCUS_15570 88737 87487 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_15570 88934 90847 gene locus_tag LOCUS_15580 88934 90847 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_15580 90865 91860 gene locus_tag LOCUS_15590 90865 91860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 91853 92407 gene locus_tag LOCUS_15600 91853 92407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 93970 92498 gene locus_tag LOCUS_15610 93970 92498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 94486 94067 gene locus_tag LOCUS_15620 94486 94067 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555719.1 protein_id gnl|my_center|LOCUS_15620 94651 95274 gene locus_tag LOCUS_15630 94651 95274 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_15630 95292 96500 gene locus_tag LOCUS_15640 95292 96500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 96521 97240 gene locus_tag LOCUS_15650 96521 97240 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_15650 97570 98328 gene locus_tag LOCUS_15660 97570 98328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 98344 99606 gene locus_tag LOCUS_15670 98344 99606 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_15670 99865 100737 gene locus_tag LOCUS_15680 99865 100737 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_15680 100740 101750 gene locus_tag LOCUS_15690 100740 101750 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_15690 101790 102596 gene locus_tag LOCUS_15700 101790 102596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 102868 104148 gene locus_tag LOCUS_15710 102868 104148 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_15710 104186 105361 gene locus_tag LOCUS_15720 104186 105361 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861089.1 protein_id gnl|my_center|LOCUS_15720 105528 106034 gene locus_tag LOCUS_15730 105528 106034 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986646.1 protein_id gnl|my_center|LOCUS_15730 106047 106265 gene locus_tag LOCUS_15740 106047 106265 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_15740 106262 106750 gene locus_tag LOCUS_15750 106262 106750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 106856 107569 gene locus_tag LOCUS_15760 106856 107569 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 protein_id gnl|my_center|LOCUS_15760 108187 107642 gene locus_tag LOCUS_15770 108187 107642 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_15770 109390 108434 gene locus_tag LOCUS_15780 109390 108434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 109575 110426 gene locus_tag LOCUS_15790 109575 110426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 110749 111681 gene locus_tag LOCUS_15800 gene cysK 110749 111681 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_15800 111802 112191 gene locus_tag LOCUS_15810 111802 112191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 112213 112614 gene locus_tag LOCUS_15820 112213 112614 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_15820 113646 112726 gene locus_tag LOCUS_15830 113646 112726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 113875 116034 gene locus_tag LOCUS_15840 113875 116034 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_15840 116188 116264 gene locus_tag LOCUS_t00310 116188 116264 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 116270 116344 gene locus_tag LOCUS_t00320 116270 116344 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 116418 116494 gene locus_tag LOCUS_t00330 116418 116494 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 116896 117096 gene locus_tag LOCUS_15850 116896 117096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 117872 117132 gene locus_tag LOCUS_15860 117872 117132 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_15860 119323 117869 gene locus_tag LOCUS_15870 119323 117869 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_15870 119523 120425 gene locus_tag LOCUS_15880 119523 120425 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_15880 121592 120495 gene locus_tag LOCUS_15890 121592 120495 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_15890 121791 122870 gene locus_tag LOCUS_15900 gene serC 121791 122870 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_15900 122883 124010 gene locus_tag LOCUS_15910 122883 124010 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_15910 124337 124107 gene locus_tag LOCUS_15920 124337 124107 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249503.1 protein_id gnl|my_center|LOCUS_15920 124544 124993 gene locus_tag LOCUS_15930 124544 124993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 125014 126234 gene locus_tag LOCUS_15940 125014 126234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 127117 126302 gene locus_tag LOCUS_15950 127117 126302 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_15950 128071 127301 gene locus_tag LOCUS_15960 128071 127301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 128234 129664 gene locus_tag LOCUS_15970 gene purB 128234 129664 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_15970 129668 130183 gene locus_tag LOCUS_15980 129668 130183 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_15980 130321 130396 gene locus_tag LOCUS_t00340 130321 130396 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 130653 131147 gene locus_tag LOCUS_15990 130653 131147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 131342 131761 gene locus_tag LOCUS_16000 131342 131761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 131873 132406 gene locus_tag LOCUS_16010 131873 132406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 133774 132611 gene locus_tag LOCUS_16020 133774 132611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_16020 134495 135055 gene locus_tag LOCUS_16030 134495 135055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 135052 135879 gene locus_tag LOCUS_16040 135052 135879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 136444 137676 gene locus_tag LOCUS_16050 136444 137676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 137757 138314 gene locus_tag LOCUS_16060 gene efp 137757 138314 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_16060 138364 138786 gene locus_tag LOCUS_16070 138364 138786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_16070 139066 139983 gene locus_tag LOCUS_16080 139066 139983 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_16080 140804 140031 gene locus_tag LOCUS_16090 gene spo0A 140804 140031 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_16090 142107 140914 gene locus_tag LOCUS_16100 gene spoIVB 142107 140914 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_16100 142310 143359 gene locus_tag LOCUS_16110 142310 143359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 144569 143463 gene locus_tag LOCUS_16120 144569 143463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 146015 144603 gene locus_tag LOCUS_16130 146015 144603 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_16130 146161 146853 gene locus_tag LOCUS_16140 146161 146853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 147362 148615 gene locus_tag LOCUS_16150 147362 148615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 148676 148861 gene locus_tag LOCUS_16160 148676 148861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 149045 149365 gene locus_tag LOCUS_16170 149045 149365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 150827 149412 gene locus_tag LOCUS_16180 gene gatB 150827 149412 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_16180 152239 150824 gene locus_tag LOCUS_16190 gene gatA 152239 150824 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966260.1 protein_id gnl|my_center|LOCUS_16190 152535 152248 gene locus_tag LOCUS_16200 gene gatC 152535 152248 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_16200 152692 152817 gene locus_tag LOCUS_16210 152692 152817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 152962 153903 gene locus_tag LOCUS_16220 152962 153903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 154112 155599 gene locus_tag LOCUS_16230 154112 155599 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_16230 158403 155998 gene locus_tag LOCUS_16240 158403 155998 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_16240 158974 158816 gene locus_tag LOCUS_16250 158974 158816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 159119 159934 gene locus_tag LOCUS_16260 159119 159934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 160045 163524 gene locus_tag LOCUS_16270 gene mfd 160045 163524 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_16270 164659 163553 gene locus_tag LOCUS_16280 gene wecB 164659 163553 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence07 156 80 gene locus_tag LOCUS_t00350 156 80 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 411 2012 gene locus_tag LOCUS_16290 gene xylB 411 2012 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_16290 2146 2814 gene locus_tag LOCUS_16300 2146 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2857 3849 gene locus_tag LOCUS_16310 2857 3849 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_16310 4058 4909 gene locus_tag LOCUS_16320 4058 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4935 5459 gene locus_tag LOCUS_16330 4935 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5478 7541 gene locus_tag LOCUS_16340 5478 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7546 8268 gene locus_tag LOCUS_16350 gene minD 7546 8268 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_16350 8932 9618 gene locus_tag LOCUS_16360 8932 9618 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_16360 9640 10230 gene locus_tag LOCUS_16370 gene nadD 9640 10230 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226048.1 protein_id gnl|my_center|LOCUS_16370 10227 10814 gene locus_tag LOCUS_16380 gene yqeK 10227 10814 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_16380 10811 11164 gene locus_tag LOCUS_16390 gene rsfS 10811 11164 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003001.1 protein_id gnl|my_center|LOCUS_16390 11196 13607 gene locus_tag LOCUS_16400 gene leuS 11196 13607 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_16400 13726 13902 gene locus_tag LOCUS_16410 13726 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 13990 15060 gene locus_tag LOCUS_16420 13990 15060 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391500.1 protein_id gnl|my_center|LOCUS_16420 15188 16696 gene locus_tag LOCUS_16430 15188 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 18359 17796 gene locus_tag LOCUS_16440 18359 17796 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068193.1 protein_id gnl|my_center|LOCUS_16440 18530 19195 gene locus_tag LOCUS_16450 gene rpe 18530 19195 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_16450 19750 19196 gene locus_tag LOCUS_16460 19750 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 19869 20876 gene locus_tag LOCUS_16470 19869 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 20873 21889 gene locus_tag LOCUS_16480 20873 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21886 22485 gene locus_tag LOCUS_16490 21886 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 22546 23658 gene locus_tag LOCUS_16500 22546 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 23675 25531 gene locus_tag LOCUS_16510 23675 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 25553 26440 gene locus_tag LOCUS_16520 25553 26440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 26474 27601 gene locus_tag LOCUS_16530 26474 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 27615 28172 gene locus_tag LOCUS_16540 gene folE 27615 28172 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_16540 28182 29018 gene locus_tag LOCUS_16550 gene folP 28182 29018 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438639.1 protein_id gnl|my_center|LOCUS_16550 29011 29373 gene locus_tag LOCUS_16560 gene folB 29011 29373 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809748.1 protein_id gnl|my_center|LOCUS_16560 29423 29929 gene locus_tag LOCUS_16570 gene folK 29423 29929 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733323.1 protein_id gnl|my_center|LOCUS_16570 29946 31349 gene locus_tag LOCUS_16580 29946 31349 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_16580 33318 31603 gene locus_tag LOCUS_16590 33318 31603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 34723 33311 gene locus_tag LOCUS_16600 34723 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 35216 34842 gene locus_tag LOCUS_16610 35216 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 35521 35336 gene locus_tag LOCUS_16620 35521 35336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 37169 35568 gene locus_tag LOCUS_16630 37169 35568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 38937 37189 gene locus_tag LOCUS_16640 38937 37189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 39428 38955 gene locus_tag LOCUS_16650 39428 38955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 41590 39428 gene locus_tag LOCUS_16660 41590 39428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 44339 41625 gene locus_tag LOCUS_16670 44339 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 46354 44360 gene locus_tag LOCUS_16680 46354 44360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 47075 46374 gene locus_tag LOCUS_16690 47075 46374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 48328 47090 gene locus_tag LOCUS_16700 48328 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 51997 49199 gene locus_tag LOCUS_16710 51997 49199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 52488 52231 gene locus_tag LOCUS_16720 52488 52231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 53782 52772 gene locus_tag LOCUS_16730 53782 52772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 54261 54752 gene locus_tag LOCUS_16740 54261 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 55198 55659 gene locus_tag LOCUS_16750 55198 55659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 55825 56286 gene locus_tag LOCUS_16760 55825 56286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 56507 57478 gene locus_tag LOCUS_16770 56507 57478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 57475 57870 gene locus_tag LOCUS_16780 57475 57870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 60169 58073 gene locus_tag LOCUS_16790 60169 58073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 61659 61249 gene locus_tag LOCUS_16800 61659 61249 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329067.1 protein_id gnl|my_center|LOCUS_16800 62098 61742 gene locus_tag LOCUS_16810 62098 61742 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_16810 62441 62357 gene locus_tag LOCUS_t00360 62441 62357 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 62546 62471 gene locus_tag LOCUS_t00370 62546 62471 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 63315 62623 gene locus_tag LOCUS_16820 63315 62623 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360701.1 protein_id gnl|my_center|LOCUS_16820 63783 63328 gene locus_tag LOCUS_16830 63783 63328 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_16830 64144 64974 gene locus_tag LOCUS_16840 64144 64974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 64997 66277 gene locus_tag LOCUS_16850 64997 66277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 68102 67161 gene locus_tag LOCUS_16860 68102 67161 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_16860 69041 68172 gene locus_tag LOCUS_16870 69041 68172 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_16870 69837 69061 gene locus_tag LOCUS_16880 69837 69061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462327.1 protein_id gnl|my_center|LOCUS_16880 70858 70049 gene locus_tag LOCUS_16890 gene noc 70858 70049 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_16890 71694 70984 gene locus_tag LOCUS_16900 gene rsmG 71694 70984 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437291.1 protein_id gnl|my_center|LOCUS_16900 73564 71684 gene locus_tag LOCUS_16910 gene mnmG 73564 71684 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_16910 75656 74286 gene locus_tag LOCUS_16920 gene mnmE 75656 74286 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_16920 77209 76400 gene locus_tag LOCUS_16930 77209 76400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_16930 77900 77190 gene locus_tag LOCUS_16940 77900 77190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_16940 78874 78035 gene locus_tag LOCUS_16950 78874 78035 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_16950 79589 78867 gene locus_tag LOCUS_16960 79589 78867 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 protein_id gnl|my_center|LOCUS_16960 80554 79586 gene locus_tag LOCUS_16970 80554 79586 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_16970 80960 80544 gene locus_tag LOCUS_16980 80960 80544 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_16980 82176 81655 gene locus_tag LOCUS_16990 82176 81655 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_16990 82568 82350 gene locus_tag LOCUS_17000 82568 82350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 84315 82591 gene locus_tag LOCUS_17010 84315 82591 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_17010 84547 85269 gene locus_tag LOCUS_17020 84547 85269 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167477.1 protein_id gnl|my_center|LOCUS_17020 85262 85585 gene locus_tag LOCUS_17030 85262 85585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 85596 86120 gene locus_tag LOCUS_17040 85596 86120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 87259 86165 gene locus_tag LOCUS_17050 87259 86165 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 protein_id gnl|my_center|LOCUS_17050 87545 87273 gene locus_tag LOCUS_17060 87545 87273 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_17060 88687 87557 gene locus_tag LOCUS_17070 gene recF 88687 87557 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_17070 88904 88659 gene locus_tag LOCUS_17080 gene yaaA 88904 88659 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_17080 90022 88916 gene locus_tag LOCUS_17090 gene dnaN 90022 88916 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_17090 90861 90259 gene locus_tag LOCUS_17100 gene recR 90861 90259 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_17100 91201 90863 gene locus_tag LOCUS_17110 91201 90863 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_17110 92872 91217 gene locus_tag LOCUS_17120 92872 91217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 93302 93808 gene locus_tag LOCUS_17130 93302 93808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 93817 94185 gene locus_tag LOCUS_17140 93817 94185 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_17140 94189 94824 gene locus_tag LOCUS_17150 94189 94824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 95073 94810 gene locus_tag LOCUS_17160 95073 94810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 95373 96227 gene locus_tag LOCUS_17170 95373 96227 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_17170 96217 97029 gene locus_tag LOCUS_17180 96217 97029 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_17180 97047 97754 gene locus_tag LOCUS_17190 97047 97754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 97751 98437 gene locus_tag LOCUS_17200 97751 98437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 98472 99182 gene locus_tag LOCUS_17210 98472 99182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 100463 99576 gene locus_tag LOCUS_17220 100463 99576 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_17220 102303 100483 gene locus_tag LOCUS_17230 gene typA 102303 100483 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_17230 103569 102547 gene locus_tag LOCUS_17240 103569 102547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144142.1 protein_id gnl|my_center|LOCUS_17240 107995 104294 gene locus_tag LOCUS_17250 107995 104294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 109375 108044 gene locus_tag LOCUS_17260 gene rmuC 109375 108044 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_17260 109655 111286 gene locus_tag LOCUS_17270 109655 111286 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728620.1 protein_id gnl|my_center|LOCUS_17270 111294 111791 gene locus_tag LOCUS_17280 111294 111791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 111877 112614 gene locus_tag LOCUS_17290 gene rlmB 111877 112614 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_17290 112651 115728 gene locus_tag LOCUS_17300 112651 115728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 115783 116868 gene locus_tag LOCUS_17310 115783 116868 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_17310 119064 116971 gene locus_tag LOCUS_17320 119064 116971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 120163 119207 gene locus_tag LOCUS_17330 120163 119207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 121158 120211 gene locus_tag LOCUS_17340 121158 120211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 121426 122190 gene locus_tag LOCUS_17350 121426 122190 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_17350 122721 122227 gene locus_tag LOCUS_17360 122721 122227 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_17360 122826 125582 gene locus_tag LOCUS_17370 gene secA 122826 125582 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_17370 126410 125958 gene locus_tag LOCUS_17380 126410 125958 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_17380 127603 126416 gene locus_tag LOCUS_17390 127603 126416 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_17390 129966 128221 gene locus_tag LOCUS_17400 gene argS 129966 128221 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_17400 130440 130021 gene locus_tag LOCUS_17410 130440 130021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 130666 131541 gene locus_tag LOCUS_17420 130666 131541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 131579 133603 gene locus_tag LOCUS_17430 gene gyrB 131579 133603 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_17430 133623 136136 gene locus_tag LOCUS_17440 gene gyrA 133623 136136 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_17440 136257 136658 gene locus_tag LOCUS_17450 gene mgsA 136257 136658 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_17450 136765 138123 gene locus_tag LOCUS_17460 gene hisS 136765 138123 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_17460 138123 139457 gene locus_tag LOCUS_17470 gene aspS 138123 139457 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_17470 139594 140145 gene locus_tag LOCUS_17480 139594 140145 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_17480 140135 140950 gene locus_tag LOCUS_17490 140135 140950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 142920 141013 gene locus_tag LOCUS_17500 142920 141013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 143115 143516 gene locus_tag LOCUS_17510 143115 143516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 143698 144885 gene locus_tag LOCUS_17520 143698 144885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 145021 146034 gene locus_tag LOCUS_17530 145021 146034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 146068 147090 gene locus_tag LOCUS_17540 146068 147090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 147233 148318 gene locus_tag LOCUS_17550 147233 148318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 148467 149438 gene locus_tag LOCUS_17560 148467 149438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 150309 149566 gene locus_tag LOCUS_17570 150309 149566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 150839 150306 gene locus_tag LOCUS_17580 150839 150306 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229943.1 protein_id gnl|my_center|LOCUS_17580 152194 150995 gene locus_tag LOCUS_17590 152194 150995 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682124.1 protein_id gnl|my_center|LOCUS_17590 153553 152291 gene locus_tag LOCUS_17600 gene ytvI 153553 152291 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902953.1 protein_id gnl|my_center|LOCUS_17600 153763 155004 gene locus_tag LOCUS_17610 153763 155004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 155663 155986 gene locus_tag LOCUS_17620 155663 155986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence08 1402 206 gene locus_tag LOCUS_17630 1402 206 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_17630 2445 1525 gene locus_tag LOCUS_17640 2445 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2802 2464 gene locus_tag LOCUS_17650 2802 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3336 3076 gene locus_tag LOCUS_17660 3336 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4410 3394 gene locus_tag LOCUS_17670 4410 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4769 4536 gene locus_tag LOCUS_17680 4769 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5115 4888 gene locus_tag LOCUS_17690 5115 4888 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272156.1 protein_id gnl|my_center|LOCUS_17690 6380 7168 gene locus_tag LOCUS_17700 6380 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 8210 7512 gene locus_tag LOCUS_17710 8210 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 8762 8211 gene locus_tag LOCUS_17720 8762 8211 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983963.1 protein_id gnl|my_center|LOCUS_17720 8986 8995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10448 9063 gene locus_tag LOCUS_17730 10448 9063 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256617.1 protein_id gnl|my_center|LOCUS_17730 12438 10450 gene locus_tag LOCUS_17740 12438 10450 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256616.1 protein_id gnl|my_center|LOCUS_17740 13312 12440 gene locus_tag LOCUS_17750 13312 12440 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_17750 14237 13332 gene locus_tag LOCUS_17760 14237 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 14561 14262 gene locus_tag LOCUS_17770 14561 14262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 17059 14921 gene locus_tag LOCUS_17780 17059 14921 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_17780 17287 17093 gene locus_tag LOCUS_17790 17287 17093 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_17790 17876 17502 gene locus_tag LOCUS_17800 17876 17502 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_17800 18470 18072 gene locus_tag LOCUS_17810 18470 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 19119 19823 gene locus_tag LOCUS_17820 19119 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 19918 20445 gene locus_tag LOCUS_17830 19918 20445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092069.1 protein_id gnl|my_center|LOCUS_17830 20773 20997 gene locus_tag LOCUS_17840 20773 20997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 21094 23826 gene locus_tag LOCUS_17850 21094 23826 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_17850 25647 24073 gene locus_tag LOCUS_17860 25647 24073 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893877.1 protein_id gnl|my_center|LOCUS_17860 28088 26169 gene locus_tag LOCUS_17870 28088 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 28433 29212 gene locus_tag LOCUS_17880 28433 29212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 29214 29870 gene locus_tag LOCUS_17890 29214 29870 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_17890 30020 30223 gene locus_tag LOCUS_17900 30020 30223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 30277 30597 gene locus_tag LOCUS_17910 gene trxA 30277 30597 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311093.1 protein_id gnl|my_center|LOCUS_17910 30840 32225 gene locus_tag LOCUS_17920 gene melB 30840 32225 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 protein_id gnl|my_center|LOCUS_17920 32294 33061 gene locus_tag LOCUS_17930 32294 33061 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_17930 33214 33432 gene locus_tag LOCUS_17940 33214 33432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 33535 34299 gene locus_tag LOCUS_17950 33535 34299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 34627 35388 gene locus_tag LOCUS_17960 34627 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 35489 36190 gene locus_tag LOCUS_17970 35489 36190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_17970 36187 37374 gene locus_tag LOCUS_17980 36187 37374 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437034.1 protein_id gnl|my_center|LOCUS_17980 38184 37597 gene locus_tag LOCUS_17990 38184 37597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 38582 38217 gene locus_tag LOCUS_18000 38582 38217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 39748 38627 gene locus_tag LOCUS_18010 39748 38627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 41450 40020 gene locus_tag LOCUS_18020 41450 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 41783 43397 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagacccctatggaattacactgctctcaaac 44147 43479 gene locus_tag LOCUS_18030 gene csn2 44147 43479 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_18030 44449 44144 gene locus_tag LOCUS_18040 gene cas2 44449 44144 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_18040 45363 44464 gene locus_tag LOCUS_18050 gene cas1 45363 44464 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_18050 49427 45360 gene locus_tag LOCUS_18060 gene cas9 49427 45360 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_18060 50422 49775 gene locus_tag LOCUS_18070 50422 49775 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_18070 51104 50415 gene locus_tag LOCUS_18080 51104 50415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 51979 51146 gene locus_tag LOCUS_18090 51979 51146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 52743 51976 gene locus_tag LOCUS_18100 52743 51976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 53407 52757 gene locus_tag LOCUS_18110 53407 52757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 54482 53427 gene locus_tag LOCUS_18120 54482 53427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 54859 54728 gene locus_tag LOCUS_18130 54859 54728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence09 2227 158 gene locus_tag LOCUS_18140 2227 158 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_18140 2798 2580 gene locus_tag LOCUS_18150 2798 2580 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_18150 3122 5998 gene locus_tag LOCUS_18160 3122 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 6185 6952 gene locus_tag LOCUS_18170 6185 6952 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_18170 6989 8536 gene locus_tag LOCUS_18180 6989 8536 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_18180 8550 9734 gene locus_tag LOCUS_18190 8550 9734 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_18190 9761 11002 gene locus_tag LOCUS_18200 9761 11002 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_18200 11014 11535 gene locus_tag LOCUS_18210 11014 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 13629 11584 gene locus_tag LOCUS_18220 13629 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 14274 13933 gene locus_tag LOCUS_18230 14274 13933 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_18230 14359 15702 gene locus_tag LOCUS_18240 14359 15702 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_18240 17674 15983 gene locus_tag LOCUS_18250 17674 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 17959 17753 gene locus_tag LOCUS_18260 17959 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 17934 19007 gene locus_tag LOCUS_18270 17934 19007 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_18270 19007 19594 gene locus_tag LOCUS_18280 19007 19594 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 protein_id gnl|my_center|LOCUS_18280 19781 20695 gene locus_tag LOCUS_18290 19781 20695 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_18290 20826 21701 gene locus_tag LOCUS_18300 20826 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 21806 22528 gene locus_tag LOCUS_18310 21806 22528 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_18310 22512 23303 gene locus_tag LOCUS_18320 22512 23303 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_18320 25251 23371 gene locus_tag LOCUS_18330 25251 23371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 26765 25383 gene locus_tag LOCUS_18340 26765 25383 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_18340 26764 26982 gene locus_tag LOCUS_18350 26764 26982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 28135 27029 gene locus_tag LOCUS_18360 gene hemW 28135 27029 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_18360 28330 29901 gene locus_tag LOCUS_18370 28330 29901 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039147.1 protein_id gnl|my_center|LOCUS_18370 29928 30194 gene locus_tag LOCUS_18380 29928 30194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 30582 32156 gene locus_tag LOCUS_18390 gene uidB 30582 32156 CDS product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075849.1 protein_id gnl|my_center|LOCUS_18390 32279 33544 gene locus_tag LOCUS_18400 32279 33544 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_18400 33587 34375 gene locus_tag LOCUS_18410 gene proB 33587 34375 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_18410 34393 35643 gene locus_tag LOCUS_18420 34393 35643 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_18420 35660 36460 gene locus_tag LOCUS_18430 35660 36460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 36469 37227 gene locus_tag LOCUS_18440 36469 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 37714 39099 gene locus_tag LOCUS_18450 37714 39099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_18450 39110 40435 gene locus_tag LOCUS_18460 39110 40435 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_18460 41416 40910 gene locus_tag LOCUS_18470 gene trmL 41416 40910 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_18470 41542 41754 gene locus_tag LOCUS_18480 41542 41754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 42398 41784 gene locus_tag LOCUS_18490 gene pth 42398 41784 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_18490 43056 42463 gene locus_tag LOCUS_18500 43056 42463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 44477 43080 gene locus_tag LOCUS_18510 gene glmU 44477 43080 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_18510 44830 47463 gene locus_tag LOCUS_18520 gene ppdK 44830 47463 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_18520 48993 47653 gene locus_tag LOCUS_18530 48993 47653 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_18530 49693 48995 gene locus_tag LOCUS_18540 49693 48995 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_18540 50243 50710 gene locus_tag LOCUS_18550 50243 50710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 51363 50860 gene locus_tag LOCUS_18560 51363 50860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence10 1329 1006 gene locus_tag LOCUS_18570 1329 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2599 1445 gene locus_tag LOCUS_18580 2599 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2927 2607 gene locus_tag LOCUS_18590 2927 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4007 2931 gene locus_tag LOCUS_18600 4007 2931 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_18600 4208 4020 gene locus_tag LOCUS_18610 4208 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_18610 4373 4930 gene locus_tag LOCUS_18620 4373 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6082 5102 gene locus_tag LOCUS_18630 6082 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 7653 6103 gene locus_tag LOCUS_18640 gene guaA 7653 6103 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_18640 8941 7667 gene locus_tag LOCUS_18650 8941 7667 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_18650 9193 10227 gene locus_tag LOCUS_18660 9193 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 11685 10300 gene locus_tag LOCUS_18670 11685 10300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_18670 12944 11853 gene locus_tag LOCUS_18680 12944 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 13501 12941 gene locus_tag LOCUS_18690 13501 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 14949 13699 gene locus_tag LOCUS_18700 14949 13699 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_18700 15148 16932 gene locus_tag LOCUS_18710 15148 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_18710 17243 16998 gene locus_tag LOCUS_18720 17243 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 18049 17621 gene locus_tag LOCUS_18730 18049 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 18788 18360 gene locus_tag LOCUS_18740 18788 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 20364 19105 gene locus_tag LOCUS_18750 20364 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 21370 20624 gene locus_tag LOCUS_18760 21370 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 21899 22981 gene locus_tag LOCUS_18770 21899 22981 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_18770 23188 23913 gene locus_tag LOCUS_18780 23188 23913 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_18780 23935 24900 gene locus_tag LOCUS_18790 23935 24900 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_18790 24946 26013 gene locus_tag LOCUS_18800 24946 26013 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_18800 26308 26928 gene locus_tag LOCUS_18810 26308 26928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_18810 26918 29032 gene locus_tag LOCUS_18820 26918 29032 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_18820 29051 30688 gene locus_tag LOCUS_18830 29051 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 30963 31181 gene locus_tag LOCUS_18840 30963 31181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 31540 31277 gene locus_tag LOCUS_18850 31540 31277 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_18850 31886 31614 gene locus_tag LOCUS_18860 31886 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 32206 31889 gene locus_tag LOCUS_18870 32206 31889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 32455 32210 gene locus_tag LOCUS_18880 32455 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 32567 33028 gene locus_tag LOCUS_18890 32567 33028 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_18890 33037 34368 gene locus_tag LOCUS_18900 33037 34368 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_18900 34432 34755 gene locus_tag LOCUS_18910 34432 34755 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_18910 34769 35632 gene locus_tag LOCUS_18920 34769 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 35646 36512 gene locus_tag LOCUS_18930 35646 36512 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_18930 36629 36796 gene locus_tag LOCUS_18940 36629 36796 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_18940 37483 36920 gene locus_tag LOCUS_18950 37483 36920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 39860 37539 gene locus_tag LOCUS_18960 39860 37539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 41159 40026 gene locus_tag LOCUS_18970 gene plcA 41159 40026 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733144.1 protein_id gnl|my_center|LOCUS_18970 43347 41161 gene locus_tag LOCUS_18980 43347 41161 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_18980 44712 43405 gene locus_tag LOCUS_18990 44712 43405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 45134 45388 gene locus_tag LOCUS_19000 45134 45388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 45449 45537 gene locus_tag LOCUS_t00380 45449 45537 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45574 45664 gene locus_tag LOCUS_t00390 45574 45664 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45930 46937 gene locus_tag LOCUS_19010 gene asnA 45930 46937 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_19010 48253 47825 gene locus_tag LOCUS_19020 48253 47825 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_19020 48346 49014 gene locus_tag LOCUS_19030 48346 49014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 49326 49087 gene locus_tag LOCUS_19040 49326 49087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 49703 51169 gene locus_tag LOCUS_19050 49703 51169 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence11 1703 549 gene locus_tag LOCUS_19060 gene estA 1703 549 CDS product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948553.1 protein_id gnl|my_center|LOCUS_19060 2542 1856 gene locus_tag LOCUS_19070 2542 1856 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_19070 3465 2542 gene locus_tag LOCUS_19080 3465 2542 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_19080 4191 3529 gene locus_tag LOCUS_19090 gene sigF 4191 3529 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_19090 4630 4178 gene locus_tag LOCUS_19100 gene spoIIAB 4630 4178 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_19100 4958 4623 gene locus_tag LOCUS_19110 4958 4623 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_19110 6436 5165 gene locus_tag LOCUS_19120 6436 5165 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_19120 9608 6981 gene locus_tag LOCUS_19130 9608 6981 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_19130 9838 11421 gene locus_tag LOCUS_19140 9838 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 11775 11353 gene locus_tag LOCUS_19150 11775 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 11692 12018 gene locus_tag LOCUS_19160 11692 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 13476 12097 gene locus_tag LOCUS_19170 13476 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 13882 13661 gene locus_tag LOCUS_19180 13882 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 14872 13898 gene locus_tag LOCUS_19190 14872 13898 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965910.1 protein_id gnl|my_center|LOCUS_19190 17533 14885 gene locus_tag LOCUS_19200 17533 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 18432 17563 gene locus_tag LOCUS_19210 gene uppP 18432 17563 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_19210 18653 18441 gene locus_tag LOCUS_19220 18653 18441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 19426 18653 gene locus_tag LOCUS_19230 gene tepA 19426 18653 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_19230 19674 21608 gene locus_tag LOCUS_19240 19674 21608 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_19240 21624 22793 gene locus_tag LOCUS_19250 21624 22793 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_19250 23743 23120 gene locus_tag LOCUS_19260 gene tmk 23743 23120 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_19260 24852 23740 gene locus_tag LOCUS_19270 24852 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 26062 24863 gene locus_tag LOCUS_19280 26062 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 27828 26077 gene locus_tag LOCUS_19290 27828 26077 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_19290 29309 27912 gene locus_tag LOCUS_19300 gene cysS 29309 27912 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_19300 29970 29323 gene locus_tag LOCUS_19310 gene cysE 29970 29323 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_19310 30998 30417 gene locus_tag LOCUS_19320 gene pgsA 30998 30417 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_19320 32350 31022 gene locus_tag LOCUS_19330 gene rimO 32350 31022 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_19330 33046 32414 gene locus_tag LOCUS_19340 33046 32414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 34176 33046 gene locus_tag LOCUS_19350 gene recA 34176 33046 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_19350 35900 34275 gene locus_tag LOCUS_19360 35900 34275 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_19360 37262 36078 gene locus_tag LOCUS_19370 37262 36078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 38464 37259 gene locus_tag LOCUS_19380 38464 37259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 42133 38771 gene locus_tag LOCUS_19390 42133 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 42585 42803 gene locus_tag LOCUS_19400 42585 42803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 42975 42900 gene locus_tag LOCUS_t00400 42975 42900 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43055 42979 gene locus_tag LOCUS_t00410 43055 42979 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 44468 43203 gene locus_tag LOCUS_19410 44468 43203 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013649894.1 protein_id gnl|my_center|LOCUS_19410 44617 45852 gene locus_tag LOCUS_19420 44617 45852 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_19420 45849 46442 gene locus_tag LOCUS_19430 45849 46442 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641564.1 protein_id gnl|my_center|LOCUS_19430 46538 46846 gene locus_tag LOCUS_19440 46538 46846 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_19440 46848 47597 gene locus_tag LOCUS_19450 46848 47597 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_19450 47612 48502 gene locus_tag LOCUS_19460 gene hslO 47612 48502 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_19460 48930 48547 gene locus_tag LOCUS_19470 48930 48547 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_19470 49295 48948 gene locus_tag LOCUS_19480 49295 48948 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence12 <1 589 gene locus_tag LOCUS_19490 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021592.1:tetratricopeptide repeat protein 658 3747 gene locus_tag LOCUS_19500 658 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3782 4363 gene locus_tag LOCUS_19510 3782 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4402 7068 gene locus_tag LOCUS_19520 4402 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 7932 7228 gene locus_tag LOCUS_19530 7932 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 9249 7972 gene locus_tag LOCUS_19540 9249 7972 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_19540 9439 9912 gene locus_tag LOCUS_19550 9439 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 11158 9977 gene locus_tag LOCUS_19560 11158 9977 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_19560 11584 11171 gene locus_tag LOCUS_19570 11584 11171 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_19570 12001 11621 gene locus_tag LOCUS_19580 12001 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 13409 12030 gene locus_tag LOCUS_19590 13409 12030 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_19590 14833 13451 gene locus_tag LOCUS_19600 14833 13451 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_19600 15198 16733 gene locus_tag LOCUS_19610 15198 16733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_19610 16757 18568 gene locus_tag LOCUS_19620 gene lepA 16757 18568 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_19620 19236 18652 gene locus_tag LOCUS_19630 19236 18652 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643718.1 protein_id gnl|my_center|LOCUS_19630 19316 19513 gene locus_tag LOCUS_19640 19316 19513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 21079 19727 gene locus_tag LOCUS_19650 21079 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 21750 21103 gene locus_tag LOCUS_19660 21750 21103 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_19660 21946 22971 gene locus_tag LOCUS_19670 gene hrcA 21946 22971 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_19670 22991 23575 gene locus_tag LOCUS_19680 gene grpE 22991 23575 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048003.1 protein_id gnl|my_center|LOCUS_19680 23636 25474 gene locus_tag LOCUS_19690 gene dnaK 23636 25474 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_19690 25548 25647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26261 26629 gene locus_tag LOCUS_19700 26261 26629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 26644 27804 gene locus_tag LOCUS_19710 gene dnaJ 26644 27804 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_19710 28012 30459 gene locus_tag LOCUS_19720 gene lon 28012 30459 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_19720 30467 31048 gene locus_tag LOCUS_19730 gene yihA 30467 31048 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_19730 31267 32364 gene locus_tag LOCUS_19740 31267 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 32388 33242 gene locus_tag LOCUS_19750 gene folD 32388 33242 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_19750 33293 33526 gene locus_tag LOCUS_19760 33293 33526 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_19760 33737 34048 gene locus_tag LOCUS_19770 gene rplU 33737 34048 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_19770 34052 34357 gene locus_tag LOCUS_19780 34052 34357 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564644.1 protein_id gnl|my_center|LOCUS_19780 34362 34646 gene locus_tag LOCUS_19790 gene rpmA 34362 34646 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_19790 35327 36595 gene locus_tag LOCUS_19800 35327 36595 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814996.1 protein_id gnl|my_center|LOCUS_19800 38389 37697 gene locus_tag LOCUS_19810 38389 37697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963642.1 protein_id gnl|my_center|LOCUS_19810 38524 38973 gene locus_tag LOCUS_19820 gene spoVAC 38524 38973 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_19820 38978 39985 gene locus_tag LOCUS_19830 gene spoVAD 38978 39985 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_19830 39998 40162 gene locus_tag LOCUS_19840 39998 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence13 622 1995 gene locus_tag LOCUS_19850 gene rlmD 622 1995 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_19850 2019 2267 gene locus_tag LOCUS_19860 2019 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 2342 3109 gene locus_tag LOCUS_19870 2342 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3211 3648 gene locus_tag LOCUS_19880 3211 3648 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922703.1 protein_id gnl|my_center|LOCUS_19880 3679 4233 gene locus_tag LOCUS_19890 3679 4233 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_19890 5190 4507 gene locus_tag LOCUS_19900 5190 4507 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_19900 6504 5206 gene locus_tag LOCUS_19910 6504 5206 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_19910 7690 6773 gene locus_tag LOCUS_19920 7690 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 7916 8347 gene locus_tag LOCUS_19930 7916 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 9102 8434 gene locus_tag LOCUS_19940 gene thiT 9102 8434 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_19940 10709 9282 gene locus_tag LOCUS_19950 10709 9282 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_19950 10929 11615 gene locus_tag LOCUS_19960 10929 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12041 11601 gene locus_tag LOCUS_19970 gene dut 12041 11601 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_19970 14106 12055 gene locus_tag LOCUS_19980 14106 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 14455 14099 gene locus_tag LOCUS_19990 14455 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 16133 14601 gene locus_tag LOCUS_20000 16133 14601 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_20000 17194 16262 gene locus_tag LOCUS_20010 17194 16262 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_20010 17927 17196 gene locus_tag LOCUS_20020 17927 17196 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_20020 18150 19577 gene locus_tag LOCUS_20030 18150 19577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 19574 20122 gene locus_tag LOCUS_20040 19574 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 20192 21199 gene locus_tag LOCUS_20050 20192 21199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 21192 23822 gene locus_tag LOCUS_20060 gene ggaB 21192 23822 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_20060 23840 24814 gene locus_tag LOCUS_20070 23840 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 25113 24886 gene locus_tag LOCUS_20080 25113 24886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 25179 25364 gene locus_tag LOCUS_20090 25179 25364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 25372 25869 gene locus_tag LOCUS_20100 25372 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 26292 26720 gene locus_tag LOCUS_20110 26292 26720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 26747 27583 gene locus_tag LOCUS_20120 26747 27583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053699.1 protein_id gnl|my_center|LOCUS_20120 28816 28280 gene locus_tag LOCUS_20130 28816 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456288.1 protein_id gnl|my_center|LOCUS_20130 29584 28838 gene locus_tag LOCUS_20140 29584 28838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 30462 29584 gene locus_tag LOCUS_20150 30462 29584 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_20150 31002 30466 gene locus_tag LOCUS_20160 31002 30466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 31204 31025 gene locus_tag LOCUS_20170 31204 31025 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113082.1 protein_id gnl|my_center|LOCUS_20170 <31981 31217 gene locus_tag LOCUS_20180 <31981 31217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870102.1:DNA adenine methylase >Feature sequence14 502 1092 gene locus_tag LOCUS_20190 502 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1523 1921 gene locus_tag LOCUS_20200 1523 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2010 2486 gene locus_tag LOCUS_20210 2010 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2592 2867 gene locus_tag LOCUS_20220 2592 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3164 3547 gene locus_tag LOCUS_20230 3164 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3685 4341 gene locus_tag LOCUS_20240 3685 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4435 5082 gene locus_tag LOCUS_20250 4435 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5179 5370 gene locus_tag LOCUS_20260 5179 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6400 6945 gene locus_tag LOCUS_20270 6400 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7412 9187 gene locus_tag LOCUS_20280 7412 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 9202 9630 gene locus_tag LOCUS_20290 9202 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 9846 10604 gene locus_tag LOCUS_20300 9846 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 10564 11046 gene locus_tag LOCUS_20310 10564 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 11248 11409 gene locus_tag LOCUS_20320 11248 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 11424 11912 gene locus_tag LOCUS_20330 11424 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 12121 12315 gene locus_tag LOCUS_20340 12121 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 12546 13004 gene locus_tag LOCUS_20350 12546 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 13200 13661 gene locus_tag LOCUS_20360 13200 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 13731 14006 gene locus_tag LOCUS_20370 13731 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 14372 16387 gene locus_tag LOCUS_20380 gene yihQ 14372 16387 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380854.1 protein_id gnl|my_center|LOCUS_20380 16390 17787 gene locus_tag LOCUS_20390 16390 17787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_20390 17803 18489 gene locus_tag LOCUS_20400 gene fsa 17803 18489 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582868.1 protein_id gnl|my_center|LOCUS_20400 18500 19357 gene locus_tag LOCUS_20410 gene mmsB 18500 19357 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919231.1 protein_id gnl|my_center|LOCUS_20410 19350 20027 gene locus_tag LOCUS_20420 19350 20027 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_20420 20041 21381 gene locus_tag LOCUS_20430 20041 21381 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_20430 21383 22117 gene locus_tag LOCUS_20440 21383 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 22170 23366 gene locus_tag LOCUS_20450 22170 23366 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_20450 24234 25073 gene locus_tag LOCUS_20460 24234 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 25066 25611 gene locus_tag LOCUS_20470 25066 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 25655 26371 gene locus_tag LOCUS_20480 25655 26371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 26448 27665 gene locus_tag LOCUS_20490 26448 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 27860 29419 gene locus_tag LOCUS_20500 27860 29419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 29596 30642 gene locus_tag LOCUS_20510 29596 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence15 1111 191 gene locus_tag LOCUS_20520 1111 191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102569.1 protein_id gnl|my_center|LOCUS_20520 3005 1155 gene locus_tag LOCUS_20530 3005 1155 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992484.1 protein_id gnl|my_center|LOCUS_20530 3197 6199 gene locus_tag LOCUS_20540 3197 6199 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_20540 7473 6847 gene locus_tag LOCUS_20550 7473 6847 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_20550 17825 7641 gene locus_tag LOCUS_20560 17825 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence16 2 208 gene locus_tag LOCUS_20570 2 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 205 435 gene locus_tag LOCUS_20580 205 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 432 1073 gene locus_tag LOCUS_20590 432 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1089 1724 gene locus_tag LOCUS_20600 1089 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1788 2081 gene locus_tag LOCUS_20610 1788 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2078 2584 gene locus_tag LOCUS_20620 2078 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2571 2810 gene locus_tag LOCUS_20630 2571 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2807 3151 gene locus_tag LOCUS_20640 2807 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3141 3374 gene locus_tag LOCUS_20650 3141 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3591 4355 gene locus_tag LOCUS_20660 3591 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4352 4735 gene locus_tag LOCUS_20670 4352 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4765 5208 gene locus_tag LOCUS_20680 4765 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5375 5689 gene locus_tag LOCUS_20690 5375 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5789 6178 gene locus_tag LOCUS_20700 5789 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6178 7833 gene locus_tag LOCUS_20710 6178 7833 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426974.1 protein_id gnl|my_center|LOCUS_20710 7838 9103 gene locus_tag LOCUS_20720 7838 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 9108 9695 gene locus_tag LOCUS_20730 9108 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 9734 10918 gene locus_tag LOCUS_20740 9734 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 10934 11236 gene locus_tag LOCUS_20750 10934 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 11240 11548 gene locus_tag LOCUS_20760 11240 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 11545 11877 gene locus_tag LOCUS_20770 11545 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 11870 12298 gene locus_tag LOCUS_20780 11870 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 12310 12882 gene locus_tag LOCUS_20790 12310 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 12951 13340 gene locus_tag LOCUS_20800 12951 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 13483 16272 gene locus_tag LOCUS_20810 13483 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 16269 16808 gene locus_tag LOCUS_20820 16269 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 16828 17208 gene locus_tag LOCUS_20830 16828 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 17224 17745 gene locus_tag LOCUS_20840 17224 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence17 400 660 gene locus_tag LOCUS_20850 400 660 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905237.1 protein_id gnl|my_center|LOCUS_20850 1117 1377 gene locus_tag LOCUS_20860 1117 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 1485 2705 gene locus_tag LOCUS_20870 1485 2705 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_20870 2759 3853 gene locus_tag LOCUS_20880 gene ychF 2759 3853 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_20880 3865 4251 gene locus_tag LOCUS_20890 3865 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 5480 4293 gene locus_tag LOCUS_20900 5480 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 6414 5593 gene locus_tag LOCUS_20910 6414 5593 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 protein_id gnl|my_center|LOCUS_20910 6540 6965 gene locus_tag LOCUS_20920 6540 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 6967 7554 gene locus_tag LOCUS_20930 6967 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 8894 7629 gene locus_tag LOCUS_20940 8894 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence18 286 669 gene locus_tag LOCUS_20950 286 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 673 942 gene locus_tag LOCUS_20960 673 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1760 999 gene locus_tag LOCUS_20970 1760 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20970 1976 1764 gene locus_tag LOCUS_20980 1976 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2319 1990 gene locus_tag LOCUS_20990 2319 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2621 2319 gene locus_tag LOCUS_21000 2621 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2849 2634 gene locus_tag LOCUS_21010 2849 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3259 2846 gene locus_tag LOCUS_21020 3259 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3573 3256 gene locus_tag LOCUS_21030 3573 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3951 3577 gene locus_tag LOCUS_21040 3951 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 5073 3955 gene locus_tag LOCUS_21050 5073 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5886 5464 gene locus_tag LOCUS_21060 5886 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence19 235 357 gene locus_tag LOCUS_21070 235 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 513 704 gene locus_tag LOCUS_21080 513 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 758 1807 gene locus_tag LOCUS_21090 758 1807 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_21090