>Feature sequence001 618 436 gene locus_tag LOCUS_00010 618 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1210 584 gene locus_tag LOCUS_00020 1210 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1817 1203 gene locus_tag LOCUS_00030 1817 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_00030 3500 2301 gene locus_tag LOCUS_00040 3500 2301 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_00040 4980 3733 gene locus_tag LOCUS_00050 4980 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5150 6019 gene locus_tag LOCUS_00060 5150 6019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_00060 6188 7111 gene locus_tag LOCUS_00070 6188 7111 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_00070 7127 8239 gene locus_tag LOCUS_00080 7127 8239 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_00080 8816 10651 gene locus_tag LOCUS_00090 8816 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10679 11752 gene locus_tag LOCUS_00100 10679 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11676 13589 gene locus_tag LOCUS_00110 11676 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13953 17216 gene locus_tag LOCUS_00120 13953 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17321 17917 gene locus_tag LOCUS_00130 17321 17917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878301.1 protein_id gnl|my_center|LOCUS_00130 18126 19154 gene locus_tag LOCUS_00140 18126 19154 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957813.1 protein_id gnl|my_center|LOCUS_00140 19237 22287 gene locus_tag LOCUS_00150 gene vmeI 19237 22287 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_00150 22376 23683 gene locus_tag LOCUS_00160 22376 23683 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766603.1 protein_id gnl|my_center|LOCUS_00160 23862 24470 gene locus_tag LOCUS_00170 23862 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24688 25455 gene locus_tag LOCUS_00180 24688 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25541 28477 gene locus_tag LOCUS_00190 25541 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28511 28822 gene locus_tag LOCUS_00200 28511 28822 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_00200 28866 29639 gene locus_tag LOCUS_00210 28866 29639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29642 30964 gene locus_tag LOCUS_00220 29642 30964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 32477 31125 gene locus_tag LOCUS_00230 32477 31125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_00230 33828 32467 gene locus_tag LOCUS_00240 33828 32467 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_00240 34022 35272 gene locus_tag LOCUS_00250 34022 35272 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_00250 35282 37603 gene locus_tag LOCUS_00260 35282 37603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_00260 37731 39986 gene locus_tag LOCUS_00270 37731 39986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_00270 40001 42325 gene locus_tag LOCUS_00280 40001 42325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_00280 42342 43019 gene locus_tag LOCUS_00290 42342 43019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_00290 44871 43243 gene locus_tag LOCUS_00300 gene pruA 44871 43243 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_00300 45217 45290 gene locus_tag LOCUS_t00010 45217 45290 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45692 45501 gene locus_tag LOCUS_00310 45692 45501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 47354 45891 gene locus_tag LOCUS_00320 47354 45891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00320 47475 47906 gene locus_tag LOCUS_00330 47475 47906 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369539.1 protein_id gnl|my_center|LOCUS_00330 48101 49330 gene locus_tag LOCUS_00340 48101 49330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 50062 49544 gene locus_tag LOCUS_00350 50062 49544 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_00350 50167 51729 gene locus_tag LOCUS_00360 50167 51729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence002 409 2061 gene locus_tag LOCUS_00370 409 2061 CDS product IS1634-like element ISMac10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_00370 2409 2795 gene locus_tag LOCUS_00380 2409 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2797 3531 gene locus_tag LOCUS_00390 gene recO 2797 3531 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_00390 3745 3545 gene locus_tag LOCUS_00400 3745 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 4287 5024 gene locus_tag LOCUS_00410 4287 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 5500 5964 gene locus_tag LOCUS_00420 5500 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 6001 7749 gene locus_tag LOCUS_00430 6001 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 7871 9658 gene locus_tag LOCUS_00440 gene lepA 7871 9658 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788089.1 protein_id gnl|my_center|LOCUS_00440 10048 12315 gene locus_tag LOCUS_00450 10048 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 12387 12830 gene locus_tag LOCUS_00460 12387 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 12870 13337 gene locus_tag LOCUS_00470 12870 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 14257 13694 gene locus_tag LOCUS_00480 14257 13694 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944038.1 protein_id gnl|my_center|LOCUS_00480 16588 14768 gene locus_tag LOCUS_00490 16588 14768 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_00490 19121 16794 gene locus_tag LOCUS_00500 19121 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 20900 19188 gene locus_tag LOCUS_00510 20900 19188 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_00510 23078 20913 gene locus_tag LOCUS_00520 23078 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 23997 23029 gene locus_tag LOCUS_00530 23997 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00530 25305 24082 gene locus_tag LOCUS_00540 25305 24082 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_00540 27747 26107 gene locus_tag LOCUS_00550 27747 26107 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_00550 27918 30707 gene locus_tag LOCUS_00560 27918 30707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 31820 31098 gene locus_tag LOCUS_00570 31820 31098 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_00570 31943 34141 gene locus_tag LOCUS_00580 31943 34141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 34449 34138 gene locus_tag LOCUS_00590 34449 34138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459969.1 protein_id gnl|my_center|LOCUS_00590 36866 34704 gene locus_tag LOCUS_00600 36866 34704 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_00600 37028 39502 gene locus_tag LOCUS_00610 37028 39502 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_00610 39638 41878 gene locus_tag LOCUS_00620 39638 41878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 42001 42576 gene locus_tag LOCUS_00630 42001 42576 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence003 1015 2 gene locus_tag LOCUS_00640 1015 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 1454 1026 gene locus_tag LOCUS_00650 gene ybeY 1454 1026 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_00650 1854 1456 gene locus_tag LOCUS_00660 1854 1456 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_00660 5183 1881 gene locus_tag LOCUS_00670 5183 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215436752.1 protein_id gnl|my_center|LOCUS_00670 6545 5364 gene locus_tag LOCUS_00680 6545 5364 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_00680 7372 6545 gene locus_tag LOCUS_00690 7372 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 9072 7492 gene locus_tag LOCUS_00700 9072 7492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_00700 9709 9392 gene locus_tag LOCUS_00710 9709 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00710 11279 9780 gene locus_tag LOCUS_00720 11279 9780 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_00720 11718 11272 gene locus_tag LOCUS_00730 11718 11272 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_00730 12236 11730 gene locus_tag LOCUS_00740 12236 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 13415 12357 gene locus_tag LOCUS_00750 13415 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 18332 14163 gene locus_tag LOCUS_00760 18332 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 18645 19028 gene locus_tag LOCUS_00770 18645 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 19446 19006 gene locus_tag LOCUS_00780 19446 19006 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393584.1 protein_id gnl|my_center|LOCUS_00780 20484 19549 gene locus_tag LOCUS_00790 gene nadA 20484 19549 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_00790 20672 21118 gene locus_tag LOCUS_00800 gene rpiB 20672 21118 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_00800 21206 22579 gene locus_tag LOCUS_00810 21206 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 23400 22765 gene locus_tag LOCUS_00820 23400 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 23787 23443 gene locus_tag LOCUS_00830 23787 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00830 24133 23810 gene locus_tag LOCUS_00840 24133 23810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 25163 24123 gene locus_tag LOCUS_00850 25163 24123 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_00850 25323 25156 gene locus_tag LOCUS_00860 25323 25156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 25668 25342 gene locus_tag LOCUS_00870 25668 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 27448 26126 gene locus_tag LOCUS_00880 27448 26126 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_00880 27924 28388 gene locus_tag LOCUS_00890 27924 28388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 28379 28975 gene locus_tag LOCUS_00900 28379 28975 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_00900 31743 28987 gene locus_tag LOCUS_00910 31743 28987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 32168 31749 gene locus_tag LOCUS_00920 32168 31749 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_00920 32599 32180 gene locus_tag LOCUS_00930 32599 32180 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_00930 35906 32874 gene locus_tag LOCUS_00940 35906 32874 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_00940 37776 36199 gene locus_tag LOCUS_00950 gene nadB 37776 36199 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_00950 37905 38189 gene locus_tag LOCUS_00960 37905 38189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence004 1822 734 gene locus_tag LOCUS_00970 1822 734 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_00970 2636 1908 gene locus_tag LOCUS_00980 gene trmB 2636 1908 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_00980 3196 2741 gene locus_tag LOCUS_00990 3196 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 4125 3247 gene locus_tag LOCUS_01000 4125 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 4397 4137 gene locus_tag LOCUS_01010 4397 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 5708 4566 gene locus_tag LOCUS_01020 5708 4566 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_01020 5848 7038 gene locus_tag LOCUS_01030 5848 7038 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_01030 7854 7108 gene locus_tag LOCUS_01040 7854 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 8540 7860 gene locus_tag LOCUS_01050 8540 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 8661 9152 gene locus_tag LOCUS_01060 8661 9152 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_01060 9547 9149 gene locus_tag LOCUS_01070 9547 9149 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_01070 9707 11005 gene locus_tag LOCUS_01080 9707 11005 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_01080 12348 11359 gene locus_tag LOCUS_01090 12348 11359 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_01090 13587 12568 gene locus_tag LOCUS_01100 13587 12568 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_01100 15518 13632 gene locus_tag LOCUS_01110 15518 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16347 15505 gene locus_tag LOCUS_01120 16347 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 16662 17894 gene locus_tag LOCUS_01130 16662 17894 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_01130 18832 18035 gene locus_tag LOCUS_01140 18832 18035 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_01140 19883 18852 gene locus_tag LOCUS_01150 19883 18852 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_01150 20940 19945 gene locus_tag LOCUS_01160 20940 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 21423 20986 gene locus_tag LOCUS_01170 21423 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 21627 22322 gene locus_tag LOCUS_01180 21627 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 22355 23089 gene locus_tag LOCUS_01190 22355 23089 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_01190 23677 23150 gene locus_tag LOCUS_01200 23677 23150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_01200 24425 23739 gene locus_tag LOCUS_01210 24425 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 24995 25067 gene locus_tag LOCUS_t00020 24995 25067 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25193 25429 gene locus_tag LOCUS_01220 25193 25429 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_01220 25525 26778 gene locus_tag LOCUS_01230 gene fabF 25525 26778 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_01230 26880 27500 gene locus_tag LOCUS_01240 26880 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 27546 27950 gene locus_tag LOCUS_01250 27546 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 29303 27939 gene locus_tag LOCUS_01260 29303 27939 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_01260 29570 31744 gene locus_tag LOCUS_01270 29570 31744 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_01270 33008 32301 gene locus_tag LOCUS_01280 33008 32301 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_01280 33933 32998 gene locus_tag LOCUS_01290 33933 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence005 2487 2702 gene locus_tag LOCUS_01300 2487 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2906 6085 gene locus_tag LOCUS_01310 2906 6085 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_01310 6405 9584 gene locus_tag LOCUS_01320 6405 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9612 9974 gene locus_tag LOCUS_01330 9612 9974 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_01330 10003 10635 gene locus_tag LOCUS_01340 10003 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 11595 10648 gene locus_tag LOCUS_01350 11595 10648 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_01350 12861 11752 gene locus_tag LOCUS_01360 gene amrS 12861 11752 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_01360 13140 14261 gene locus_tag LOCUS_01370 13140 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 14889 14332 gene locus_tag LOCUS_01380 14889 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 17145 14980 gene locus_tag LOCUS_01390 17145 14980 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_01390 17221 18831 gene locus_tag LOCUS_01400 17221 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 18896 19828 gene locus_tag LOCUS_01410 18896 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 19920 20711 gene locus_tag LOCUS_01420 19920 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 20751 23162 gene locus_tag LOCUS_01430 20751 23162 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_01430 24559 23159 gene locus_tag LOCUS_01440 24559 23159 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_01440 26411 24825 gene locus_tag LOCUS_01450 26411 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 27397 26423 gene locus_tag LOCUS_01460 27397 26423 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_01460 27870 30488 gene locus_tag LOCUS_01470 gene alaS 27870 30488 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_01470 <31686 30580 gene locus_tag LOCUS_01480 <31686 30580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase/ligase >Feature sequence006 476 66 gene locus_tag LOCUS_01490 476 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 1443 682 gene locus_tag LOCUS_01500 1443 682 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_01500 2542 1448 gene locus_tag LOCUS_01510 2542 1448 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765714.1 protein_id gnl|my_center|LOCUS_01510 2936 2604 gene locus_tag LOCUS_01520 2936 2604 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_01520 4139 3015 gene locus_tag LOCUS_01530 4139 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 5132 4161 gene locus_tag LOCUS_01540 5132 4161 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_01540 5410 5485 gene locus_tag LOCUS_t00030 5410 5485 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6014 8215 gene locus_tag LOCUS_01550 6014 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8226 9329 gene locus_tag LOCUS_01560 8226 9329 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_01560 11566 9425 gene locus_tag LOCUS_01570 11566 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 12874 11717 gene locus_tag LOCUS_01580 12874 11717 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_01580 14866 12971 gene locus_tag LOCUS_01590 14866 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16408 15263 gene locus_tag LOCUS_01600 16408 15263 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_01600 17050 16523 gene locus_tag LOCUS_01610 17050 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 17341 17508 gene locus_tag LOCUS_01620 17341 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19764 17725 gene locus_tag LOCUS_01630 19764 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 20959 19751 gene locus_tag LOCUS_01640 20959 19751 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_01640 21889 20963 gene locus_tag LOCUS_01650 21889 20963 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_01650 22846 21983 gene locus_tag LOCUS_01660 22846 21983 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765895.1 protein_id gnl|my_center|LOCUS_01660 24345 22894 gene locus_tag LOCUS_01670 24345 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 25712 24345 gene locus_tag LOCUS_01680 25712 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 27912 25744 gene locus_tag LOCUS_01690 27912 25744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765878.1 protein_id gnl|my_center|LOCUS_01690 28843 27989 gene locus_tag LOCUS_01700 28843 27989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 30023 28860 gene locus_tag LOCUS_01710 30023 28860 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793362.1 protein_id gnl|my_center|LOCUS_01710 30532 30143 gene locus_tag LOCUS_01720 30532 30143 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_01720 >Feature sequence007 <1 631 gene locus_tag LOCUS_01730 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000185732.1:NAD(P)H-dependent oxidoreductase 656 1996 gene locus_tag LOCUS_01740 656 1996 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_01740 2017 2589 gene locus_tag LOCUS_01750 2017 2589 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_01750 3094 2570 gene locus_tag LOCUS_01760 3094 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 4189 3563 gene locus_tag LOCUS_01770 4189 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4950 6134 gene locus_tag LOCUS_01780 4950 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7298 6327 gene locus_tag LOCUS_01790 7298 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 8376 7666 gene locus_tag LOCUS_01800 8376 7666 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_01800 9622 8363 gene locus_tag LOCUS_01810 9622 8363 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_01810 9704 9629 gene locus_tag LOCUS_t00040 9704 9629 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10303 9728 gene locus_tag LOCUS_01820 10303 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10787 10365 gene locus_tag LOCUS_01830 10787 10365 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_01830 11035 10784 gene locus_tag LOCUS_01840 11035 10784 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_01840 12940 11228 gene locus_tag LOCUS_01850 gene lysS 12940 11228 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_01850 13956 13387 gene locus_tag LOCUS_01860 13956 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 14051 15766 gene locus_tag LOCUS_01870 gene recJ 14051 15766 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_01870 16009 17652 gene locus_tag LOCUS_01880 16009 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 19593 18130 gene locus_tag LOCUS_01890 19593 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 21400 19766 gene locus_tag LOCUS_01900 21400 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 23650 21443 gene locus_tag LOCUS_01910 23650 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 23883 26201 gene locus_tag LOCUS_01920 23883 26201 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_01920 26262 26849 gene locus_tag LOCUS_01930 26262 26849 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_01930 27076 28383 gene locus_tag LOCUS_01940 gene murA 27076 28383 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_01940 28397 28774 gene locus_tag LOCUS_01950 28397 28774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 29811 30197 gene locus_tag LOCUS_01960 29811 30197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence008 1905 802 gene locus_tag LOCUS_01970 1905 802 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_01970 2353 2018 gene locus_tag LOCUS_01980 gene rbfA 2353 2018 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_01980 2515 5064 gene locus_tag LOCUS_01990 2515 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5068 6324 gene locus_tag LOCUS_02000 gene ssnA 5068 6324 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_02000 6835 6380 gene locus_tag LOCUS_02010 6835 6380 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_02010 6966 8015 gene locus_tag LOCUS_02020 6966 8015 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_02020 8254 8538 gene locus_tag LOCUS_02030 8254 8538 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_02030 8627 9673 gene locus_tag LOCUS_02040 8627 9673 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_02040 10535 9732 gene locus_tag LOCUS_02050 10535 9732 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_02050 10664 11050 gene locus_tag LOCUS_02060 10664 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 11068 11250 gene locus_tag LOCUS_02070 11068 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 14099 11418 gene locus_tag LOCUS_02080 14099 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 16788 14389 gene locus_tag LOCUS_02090 16788 14389 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186922643.1 protein_id gnl|my_center|LOCUS_02090 17032 18483 gene locus_tag LOCUS_02100 gene sufB 17032 18483 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_02100 18534 19298 gene locus_tag LOCUS_02110 gene sufC 18534 19298 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_02110 19395 20747 gene locus_tag LOCUS_02120 gene sufD 19395 20747 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_02120 20914 21174 gene locus_tag LOCUS_02130 20914 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 21335 21613 gene locus_tag LOCUS_02140 21335 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 21624 22841 gene locus_tag LOCUS_02150 21624 22841 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_02150 22871 23296 gene locus_tag LOCUS_02160 22871 23296 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_02160 23403 23726 gene locus_tag LOCUS_02170 23403 23726 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_02170 25031 23835 gene locus_tag LOCUS_02180 25031 23835 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_02180 27028 25619 gene locus_tag LOCUS_02190 27028 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 <28932 27177 gene locus_tag LOCUS_02200 <28932 27177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121001.1:ATP-binding protein >Feature sequence009 1427 459 gene locus_tag LOCUS_02210 1427 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2297 3778 gene locus_tag LOCUS_02220 2297 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 3787 6945 gene locus_tag LOCUS_02230 3787 6945 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_02230 7090 8643 gene locus_tag LOCUS_02240 7090 8643 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_02240 8782 9018 gene locus_tag LOCUS_02250 8782 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10275 9118 gene locus_tag LOCUS_02260 10275 9118 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_02260 11217 10507 gene locus_tag LOCUS_02270 11217 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 12351 11287 gene locus_tag LOCUS_02280 gene mnmH 12351 11287 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_02280 14304 12373 gene locus_tag LOCUS_02290 gene dxs 14304 12373 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_02290 14415 15668 gene locus_tag LOCUS_02300 14415 15668 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_02300 17034 15817 gene locus_tag LOCUS_02310 17034 15817 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_02310 18295 17297 gene locus_tag LOCUS_02320 gene gldB 18295 17297 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_02320 20054 18315 gene locus_tag LOCUS_02330 20054 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 21363 20107 gene locus_tag LOCUS_02340 21363 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22755 21592 gene locus_tag LOCUS_02350 22755 21592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 23571 22891 gene locus_tag LOCUS_02360 23571 22891 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_02360 24376 23705 gene locus_tag LOCUS_02370 24376 23705 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_02370 25820 24465 gene locus_tag LOCUS_02380 25820 24465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 26195 25824 gene locus_tag LOCUS_02390 26195 25824 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_02390 26417 26493 gene locus_tag LOCUS_t00050 26417 26493 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27825 26542 gene locus_tag LOCUS_02400 27825 26542 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence010 313 2703 gene locus_tag LOCUS_02410 313 2703 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_02410 2846 3457 gene locus_tag LOCUS_02420 2846 3457 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_02420 3497 3682 gene locus_tag LOCUS_02430 gene rpmF 3497 3682 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_02430 3897 4898 gene locus_tag LOCUS_02440 3897 4898 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_02440 5003 5515 gene locus_tag LOCUS_02450 gene accB 5003 5515 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_02450 5537 6037 gene locus_tag LOCUS_02460 5537 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6144 7472 gene locus_tag LOCUS_02470 gene accC 6144 7472 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_02470 7517 7981 gene locus_tag LOCUS_02480 7517 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 7914 8159 gene locus_tag LOCUS_02490 7914 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8161 8538 gene locus_tag LOCUS_02500 8161 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 8756 9883 gene locus_tag LOCUS_02510 gene atpB 8756 9883 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_02510 9932 10189 gene locus_tag LOCUS_02520 gene atpE 9932 10189 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_02520 10284 10778 gene locus_tag LOCUS_02530 10284 10778 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_02530 10793 11326 gene locus_tag LOCUS_02540 gene atpH 10793 11326 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_02540 11350 12930 gene locus_tag LOCUS_02550 gene atpA 11350 12930 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_02550 12988 13245 gene locus_tag LOCUS_02560 12988 13245 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_02560 13269 14144 gene locus_tag LOCUS_02570 gene atpG 13269 14144 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_02570 14267 16465 gene locus_tag LOCUS_02580 14267 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 17223 16501 gene locus_tag LOCUS_02590 17223 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 17581 17216 gene locus_tag LOCUS_02600 gene folX 17581 17216 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_02600 18337 17624 gene locus_tag LOCUS_02610 18337 17624 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_02610 21358 18755 gene locus_tag LOCUS_02620 21358 18755 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_02620 22147 21365 gene locus_tag LOCUS_02630 22147 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 22674 22348 gene locus_tag LOCUS_02640 22674 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 23144 24511 gene locus_tag LOCUS_02650 gene hydA 23144 24511 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_02650 24524 25834 gene locus_tag LOCUS_02660 24524 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence011 371 820 gene locus_tag LOCUS_02670 371 820 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_02670 968 1783 gene locus_tag LOCUS_02680 gene larE 968 1783 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947958.1 protein_id gnl|my_center|LOCUS_02680 1776 2237 gene locus_tag LOCUS_02690 1776 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3525 2320 gene locus_tag LOCUS_02700 3525 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_02700 4302 3619 gene locus_tag LOCUS_02710 4302 3619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_02710 5558 4329 gene locus_tag LOCUS_02720 5558 4329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_02720 6841 5624 gene locus_tag LOCUS_02730 6841 5624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_02730 7658 6906 gene locus_tag LOCUS_02740 7658 6906 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_02740 8241 7666 gene locus_tag LOCUS_02750 8241 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 8533 9150 gene locus_tag LOCUS_02760 8533 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 9172 9828 gene locus_tag LOCUS_02770 9172 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 10764 9847 gene locus_tag LOCUS_02780 10764 9847 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_02780 12800 11319 gene locus_tag LOCUS_02790 12800 11319 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_02790 14671 12902 gene locus_tag LOCUS_02800 14671 12902 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205437.1 protein_id gnl|my_center|LOCUS_02800 17960 14703 gene locus_tag LOCUS_02810 gene ygfK 17960 14703 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869176.1 protein_id gnl|my_center|LOCUS_02810 18330 19259 gene locus_tag LOCUS_02820 18330 19259 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_02820 20017 19298 gene locus_tag LOCUS_02830 20017 19298 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_02830 20071 21060 gene locus_tag LOCUS_02840 20071 21060 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_02840 21160 21534 gene locus_tag LOCUS_02850 21160 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21954 22643 gene locus_tag LOCUS_02860 21954 22643 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839368.1 protein_id gnl|my_center|LOCUS_02860 22796 23269 gene locus_tag LOCUS_02870 22796 23269 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_02870 23500 23327 gene locus_tag LOCUS_02880 23500 23327 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_02880 24787 23696 gene locus_tag LOCUS_02890 24787 23696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence012 2077 1049 gene locus_tag LOCUS_02900 2077 1049 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_02900 2271 4184 gene locus_tag LOCUS_02910 2271 4184 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_02910 5338 4250 gene locus_tag LOCUS_02920 5338 4250 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405150.1 protein_id gnl|my_center|LOCUS_02920 5338 5826 gene locus_tag LOCUS_02930 5338 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6143 6556 gene locus_tag LOCUS_02940 6143 6556 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_02940 6579 7070 gene locus_tag LOCUS_02950 6579 7070 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706473.1 protein_id gnl|my_center|LOCUS_02950 7652 7167 gene locus_tag LOCUS_02960 7652 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8394 7693 gene locus_tag LOCUS_02970 8394 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 8883 8632 gene locus_tag LOCUS_02980 8883 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 9856 9104 gene locus_tag LOCUS_02990 9856 9104 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_02990 10311 12278 gene locus_tag LOCUS_03000 10311 12278 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_03000 12352 13569 gene locus_tag LOCUS_03010 12352 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 13680 14456 gene locus_tag LOCUS_03020 13680 14456 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_03020 14431 14739 gene locus_tag LOCUS_03030 14431 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 14861 15739 gene locus_tag LOCUS_03040 14861 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 protein_id gnl|my_center|LOCUS_03040 15919 16302 gene locus_tag LOCUS_03050 15919 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 17868 16477 gene locus_tag LOCUS_03060 17868 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 20505 18007 gene locus_tag LOCUS_03070 gene gyrA 20505 18007 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_03070 20976 21638 gene locus_tag LOCUS_03080 gene ung 20976 21638 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence013 2631 1003 gene locus_tag LOCUS_03090 2631 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4912 2903 gene locus_tag LOCUS_03100 4912 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6516 5008 gene locus_tag LOCUS_03110 6516 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 7131 9239 gene locus_tag LOCUS_03120 7131 9239 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_03120 9323 9940 gene locus_tag LOCUS_03130 9323 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 10014 10892 gene locus_tag LOCUS_03140 10014 10892 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_03140 12125 11010 gene locus_tag LOCUS_03150 gene hydE 12125 11010 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_03150 13252 12233 gene locus_tag LOCUS_03160 gene bioF 13252 12233 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870815.1 protein_id gnl|my_center|LOCUS_03160 15147 13240 gene locus_tag LOCUS_03170 15147 13240 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_03170 16167 15214 gene locus_tag LOCUS_03180 16167 15214 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_03180 17206 16520 gene locus_tag LOCUS_03190 17206 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 18031 17225 gene locus_tag LOCUS_03200 18031 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 18793 18092 gene locus_tag LOCUS_03210 18793 18092 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_03210 20067 19066 gene locus_tag LOCUS_03220 gene amrB 20067 19066 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986781.1 protein_id gnl|my_center|LOCUS_03220 20249 21967 gene locus_tag LOCUS_03230 20249 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 22092 22622 gene locus_tag LOCUS_03240 22092 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence014 288 1115 gene locus_tag LOCUS_03250 288 1115 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_03250 1119 1628 gene locus_tag LOCUS_03260 1119 1628 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_03260 1712 2662 gene locus_tag LOCUS_03270 1712 2662 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_03270 2692 3276 gene locus_tag LOCUS_03280 2692 3276 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_03280 3351 5513 gene locus_tag LOCUS_03290 3351 5513 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_03290 5602 6636 gene locus_tag LOCUS_03300 5602 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7394 6684 gene locus_tag LOCUS_03310 7394 6684 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_03310 7817 9250 gene locus_tag LOCUS_03320 7817 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 9269 9655 gene locus_tag LOCUS_03330 9269 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 9851 10000 gene locus_tag LOCUS_03340 9851 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 10012 10422 gene locus_tag LOCUS_03350 10012 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 10773 12197 gene locus_tag LOCUS_03360 10773 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12255 12827 gene locus_tag LOCUS_03370 12255 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 13699 14274 gene locus_tag LOCUS_03380 13699 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 14901 14335 gene locus_tag LOCUS_03390 gene lpxF 14901 14335 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_03390 15966 14977 gene locus_tag LOCUS_03400 gene obgE 15966 14977 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_03400 16581 16000 gene locus_tag LOCUS_03410 16581 16000 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_03410 17137 16598 gene locus_tag LOCUS_03420 gene hpt 17137 16598 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_03420 17400 17912 gene locus_tag LOCUS_03430 gene purE 17400 17912 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_03430 18131 18952 gene locus_tag LOCUS_03440 18131 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 18980 19933 gene locus_tag LOCUS_03450 18980 19933 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_03450 19970 22030 gene locus_tag LOCUS_03460 19970 22030 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_03460 23398 22052 gene locus_tag LOCUS_03470 23398 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence015 35 580 gene locus_tag LOCUS_03480 35 580 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_03480 590 1366 gene locus_tag LOCUS_03490 590 1366 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_03490 1925 1389 gene locus_tag LOCUS_03500 1925 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3408 2392 gene locus_tag LOCUS_03510 3408 2392 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080582.1 protein_id gnl|my_center|LOCUS_03510 4363 3434 gene locus_tag LOCUS_03520 4363 3434 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074294.1 protein_id gnl|my_center|LOCUS_03520 5333 4446 gene locus_tag LOCUS_03530 5333 4446 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_03530 6463 5384 gene locus_tag LOCUS_03540 gene buk 6463 5384 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_03540 7391 6495 gene locus_tag LOCUS_03550 gene ptb 7391 6495 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_03550 8583 7441 gene locus_tag LOCUS_03560 8583 7441 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_03560 9707 8730 gene locus_tag LOCUS_03570 9707 8730 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_03570 10872 9874 gene locus_tag LOCUS_03580 gene pta 10872 9874 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_03580 11534 11157 gene locus_tag LOCUS_03590 11534 11157 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_03590 11825 13273 gene locus_tag LOCUS_03600 11825 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 13951 13277 gene locus_tag LOCUS_03610 13951 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 14355 14134 gene locus_tag LOCUS_03620 14355 14134 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_03620 15572 14805 gene locus_tag LOCUS_03630 15572 14805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 15823 15671 gene locus_tag LOCUS_03640 15823 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 16102 15824 gene locus_tag LOCUS_03650 16102 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 17236 16181 gene locus_tag LOCUS_03660 17236 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 18032 17241 gene locus_tag LOCUS_03670 18032 17241 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_03670 18163 20202 gene locus_tag LOCUS_03680 18163 20202 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459173.1 protein_id gnl|my_center|LOCUS_03680 20199 21488 gene locus_tag LOCUS_03690 20199 21488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 21675 21917 gene locus_tag LOCUS_03700 gene rpmB 21675 21917 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_03700 21937 22122 gene locus_tag LOCUS_03710 gene rpmG 21937 22122 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_03710 22129 22284 gene locus_tag LOCUS_03720 22129 22284 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence016 1459 2532 gene locus_tag LOCUS_03730 1459 2532 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_03730 2880 3878 gene locus_tag LOCUS_03740 gene hutG 2880 3878 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113438.1 protein_id gnl|my_center|LOCUS_03740 3880 5898 gene locus_tag LOCUS_03750 3880 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7360 6074 gene locus_tag LOCUS_03760 7360 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7440 9374 gene locus_tag LOCUS_03770 7440 9374 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_03770 9367 9939 gene locus_tag LOCUS_03780 9367 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 10035 10499 gene locus_tag LOCUS_03790 10035 10499 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_03790 11251 12870 gene locus_tag LOCUS_03800 11251 12870 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_03800 15370 13088 gene locus_tag LOCUS_03810 15370 13088 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_03810 15547 16110 gene locus_tag LOCUS_03820 15547 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 17845 16160 gene locus_tag LOCUS_03830 17845 16160 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_03830 18765 18070 gene locus_tag LOCUS_03840 18765 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 20968 18866 gene locus_tag LOCUS_03850 20968 18866 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_03850 21102 21542 gene locus_tag LOCUS_03860 21102 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 21666 22073 gene locus_tag LOCUS_03870 21666 22073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 22568 22077 gene locus_tag LOCUS_03880 22568 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence017 936 457 gene locus_tag LOCUS_03890 936 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1364 948 gene locus_tag LOCUS_03900 1364 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1735 1367 gene locus_tag LOCUS_03910 1735 1367 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081551.1 protein_id gnl|my_center|LOCUS_03910 2926 1736 gene locus_tag LOCUS_03920 2926 1736 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_03920 4772 2910 gene locus_tag LOCUS_03930 4772 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5021 4776 gene locus_tag LOCUS_03940 5021 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5649 5155 gene locus_tag LOCUS_03950 5649 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6766 6134 gene locus_tag LOCUS_03960 gene nreC 6766 6134 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_03960 7764 6772 gene locus_tag LOCUS_03970 7764 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 22307 7929 gene locus_tag LOCUS_03980 22307 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 22712 22560 gene locus_tag LOCUS_03990 22712 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence018 <1 1755 gene locus_tag LOCUS_04000 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765626.1:DUF3352 domain-containing protein 1963 2835 gene locus_tag LOCUS_04010 1963 2835 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_04010 2842 3735 gene locus_tag LOCUS_04020 2842 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3958 4284 gene locus_tag LOCUS_04030 3958 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7037 4815 gene locus_tag LOCUS_04040 7037 4815 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_04040 8680 7121 gene locus_tag LOCUS_04050 8680 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9553 8846 gene locus_tag LOCUS_04060 9553 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 11184 9709 gene locus_tag LOCUS_04070 gene proS 11184 9709 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_04070 12349 11315 gene locus_tag LOCUS_04080 12349 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 12906 13367 gene locus_tag LOCUS_04090 12906 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 14779 13658 gene locus_tag LOCUS_04100 14779 13658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_04100 15931 14825 gene locus_tag LOCUS_04110 15931 14825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_04110 16925 16143 gene locus_tag LOCUS_04120 16925 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 17850 16951 gene locus_tag LOCUS_04130 17850 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 18840 17962 gene locus_tag LOCUS_04140 18840 17962 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107324.1 protein_id gnl|my_center|LOCUS_04140 20127 18868 gene locus_tag LOCUS_04150 20127 18868 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692557.1 protein_id gnl|my_center|LOCUS_04150 20780 20151 gene locus_tag LOCUS_04160 20780 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 22250 20910 gene locus_tag LOCUS_04170 gene clcA 22250 20910 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence019 272 1099 gene locus_tag LOCUS_04180 272 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1641 1159 gene locus_tag LOCUS_04190 1641 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2583 1714 gene locus_tag LOCUS_04200 2583 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2656 4476 gene locus_tag LOCUS_04210 2656 4476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_04210 5154 4462 gene locus_tag LOCUS_04220 5154 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5543 7375 gene locus_tag LOCUS_04230 gene ilvD 5543 7375 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_04230 7476 9218 gene locus_tag LOCUS_04240 gene ilvB 7476 9218 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_04240 9229 9768 gene locus_tag LOCUS_04250 gene ilvN 9229 9768 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_04250 10006 11052 gene locus_tag LOCUS_04260 gene ilvC 10006 11052 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_04260 11154 12215 gene locus_tag LOCUS_04270 11154 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 12579 12226 gene locus_tag LOCUS_04280 12579 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 14283 12610 gene locus_tag LOCUS_04290 14283 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04290 17804 14712 gene locus_tag LOCUS_04300 17804 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 19026 18256 gene locus_tag LOCUS_04310 19026 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 20456 19197 gene locus_tag LOCUS_04320 20456 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 21152 20535 gene locus_tag LOCUS_04330 21152 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence020 6232 2357 gene locus_tag LOCUS_04340 6232 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6595 6281 gene locus_tag LOCUS_04350 6595 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9744 6880 gene locus_tag LOCUS_04360 9744 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 11057 10134 gene locus_tag LOCUS_04370 11057 10134 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_04370 11127 12185 gene locus_tag LOCUS_04380 11127 12185 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_04380 13510 12389 gene locus_tag LOCUS_04390 13510 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 14120 13683 gene locus_tag LOCUS_04400 14120 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 14625 14188 gene locus_tag LOCUS_04410 14625 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16753 14735 gene locus_tag LOCUS_04420 16753 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 17495 16791 gene locus_tag LOCUS_04430 17495 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 17587 18180 gene locus_tag LOCUS_04440 gene mocA 17587 18180 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 protein_id gnl|my_center|LOCUS_04440 18328 19047 gene locus_tag LOCUS_04450 18328 19047 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_04450 19047 19688 gene locus_tag LOCUS_04460 19047 19688 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_04460 19685 21304 gene locus_tag LOCUS_04470 19685 21304 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943191.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence021 178 1428 gene locus_tag LOCUS_04480 178 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963254.1 protein_id gnl|my_center|LOCUS_04480 1409 2011 gene locus_tag LOCUS_04490 1409 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2209 3903 gene locus_tag LOCUS_04500 2209 3903 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_04500 4953 4057 gene locus_tag LOCUS_04510 4953 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5022 6746 gene locus_tag LOCUS_04520 5022 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7227 8009 gene locus_tag LOCUS_04530 gene surE 7227 8009 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_04530 8022 8318 gene locus_tag LOCUS_04540 8022 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8553 9671 gene locus_tag LOCUS_04550 gene lpxB 8553 9671 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_04550 9675 10814 gene locus_tag LOCUS_04560 9675 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 12151 10886 gene locus_tag LOCUS_04570 gene lepB 12151 10886 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_04570 12509 13702 gene locus_tag LOCUS_04580 12509 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_04580 13803 14393 gene locus_tag LOCUS_04590 13803 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 15194 14436 gene locus_tag LOCUS_04600 gene rlmB 15194 14436 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_04600 16634 15264 gene locus_tag LOCUS_04610 16634 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 16828 17547 gene locus_tag LOCUS_04620 16828 17547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_04620 17540 18772 gene locus_tag LOCUS_04630 17540 18772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_04630 18815 20080 gene locus_tag LOCUS_04640 18815 20080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_04640 20212 21330 gene locus_tag LOCUS_04650 20212 21330 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence022 840 2249 gene locus_tag LOCUS_04660 840 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2771 2256 gene locus_tag LOCUS_04670 2771 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3690 2791 gene locus_tag LOCUS_04680 3690 2791 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_04680 4167 3748 gene locus_tag LOCUS_04690 4167 3748 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_04690 4623 4246 gene locus_tag LOCUS_04700 4623 4246 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_04700 5027 4821 gene locus_tag LOCUS_04710 5027 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5266 6126 gene locus_tag LOCUS_04720 5266 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6331 6936 gene locus_tag LOCUS_04730 6331 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6936 7517 gene locus_tag LOCUS_04740 6936 7517 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_04740 7627 8232 gene locus_tag LOCUS_04750 7627 8232 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_04750 8248 8748 gene locus_tag LOCUS_04760 8248 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8768 9646 gene locus_tag LOCUS_04770 8768 9646 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_04770 9704 11467 gene locus_tag LOCUS_04780 9704 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 11510 13759 gene locus_tag LOCUS_04790 11510 13759 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_04790 14505 13756 gene locus_tag LOCUS_04800 14505 13756 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_04800 14624 15346 gene locus_tag LOCUS_04810 14624 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 15343 16566 gene locus_tag LOCUS_04820 15343 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04820 16660 17484 gene locus_tag LOCUS_04830 16660 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 18092 17391 gene locus_tag LOCUS_04840 18092 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 19197 18166 gene locus_tag LOCUS_04850 19197 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 19939 19283 gene locus_tag LOCUS_04860 gene dccR 19939 19283 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence023 2395 893 gene locus_tag LOCUS_04870 2395 893 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 protein_id gnl|my_center|LOCUS_04870 2757 2389 gene locus_tag LOCUS_04880 2757 2389 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_04880 3482 2763 gene locus_tag LOCUS_04890 3482 2763 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053840.1 protein_id gnl|my_center|LOCUS_04890 3748 3491 gene locus_tag LOCUS_04900 3748 3491 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867827.1 protein_id gnl|my_center|LOCUS_04900 4105 3752 gene locus_tag LOCUS_04910 gene mnhG 4105 3752 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080104.1 protein_id gnl|my_center|LOCUS_04910 4340 4107 gene locus_tag LOCUS_04920 4340 4107 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146638.1 protein_id gnl|my_center|LOCUS_04920 4878 4372 gene locus_tag LOCUS_04930 4878 4372 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_04930 6021 5026 gene locus_tag LOCUS_04940 6021 5026 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_04940 7521 6037 gene locus_tag LOCUS_04950 7521 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04950 8373 7543 gene locus_tag LOCUS_04960 8373 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04960 9862 8618 gene locus_tag LOCUS_04970 9862 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 10441 10085 gene locus_tag LOCUS_04980 10441 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 11470 10625 gene locus_tag LOCUS_04990 11470 10625 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_04990 11808 13454 gene locus_tag LOCUS_05000 11808 13454 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_05000 14093 13497 gene locus_tag LOCUS_05010 14093 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 14239 15747 gene locus_tag LOCUS_05020 14239 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15888 16520 gene locus_tag LOCUS_05030 15888 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 17868 16582 gene locus_tag LOCUS_05040 gene eno 17868 16582 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_05040 18255 17905 gene locus_tag LOCUS_05050 18255 17905 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_05050 18633 18259 gene locus_tag LOCUS_05060 gene crcB 18633 18259 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011704.1 protein_id gnl|my_center|LOCUS_05060 18928 19875 gene locus_tag LOCUS_05070 18928 19875 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence024 1997 1455 gene locus_tag LOCUS_05080 1997 1455 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_05080 2723 2019 gene locus_tag LOCUS_05090 2723 2019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_05090 3582 2791 gene locus_tag LOCUS_05100 3582 2791 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_05100 6089 3609 gene locus_tag LOCUS_05110 6089 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6288 9569 gene locus_tag LOCUS_05120 6288 9569 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_05120 9569 10822 gene locus_tag LOCUS_05130 9569 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12161 10884 gene locus_tag LOCUS_05140 12161 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 12341 13396 gene locus_tag LOCUS_05150 12341 13396 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_05150 13670 14335 gene locus_tag LOCUS_05160 13670 14335 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263394.1 protein_id gnl|my_center|LOCUS_05160 15080 16021 gene locus_tag LOCUS_05170 15080 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16179 17897 gene locus_tag LOCUS_05180 16179 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17978 18703 gene locus_tag LOCUS_05190 17978 18703 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_05190 19033 18662 gene locus_tag LOCUS_05200 19033 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 19203 19021 gene locus_tag LOCUS_05210 19203 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 20291 19338 gene locus_tag LOCUS_05220 20291 19338 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence025 169 477 gene locus_tag LOCUS_05230 169 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 882 1364 gene locus_tag LOCUS_05240 882 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 1528 2433 gene locus_tag LOCUS_05250 1528 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2691 2491 gene locus_tag LOCUS_05260 2691 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 3114 2770 gene locus_tag LOCUS_05270 3114 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3173 3745 gene locus_tag LOCUS_05280 3173 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3760 4530 gene locus_tag LOCUS_05290 3760 4530 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_05290 5592 4570 gene locus_tag LOCUS_05300 gene tdh 5592 4570 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_05300 5803 7329 gene locus_tag LOCUS_05310 gene gltX 5803 7329 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_05310 7728 9014 gene locus_tag LOCUS_05320 gene metK 7728 9014 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_05320 10297 9092 gene locus_tag LOCUS_05330 10297 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10374 10808 gene locus_tag LOCUS_05340 10374 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362012.1 protein_id gnl|my_center|LOCUS_05340 10870 11538 gene locus_tag LOCUS_05350 10870 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 11531 12718 gene locus_tag LOCUS_05360 11531 12718 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_05360 13512 12826 gene locus_tag LOCUS_05370 13512 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 13777 14184 gene locus_tag LOCUS_05380 13777 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 14245 15135 gene locus_tag LOCUS_05390 14245 15135 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_05390 15139 16311 gene locus_tag LOCUS_05400 15139 16311 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_05400 17497 16388 gene locus_tag LOCUS_05410 17497 16388 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_05410 17598 18947 gene locus_tag LOCUS_05420 17598 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 18950 19963 gene locus_tag LOCUS_05430 18950 19963 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence026 <1 1672 gene locus_tag LOCUS_05440 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880310.1:TonB-dependent receptor 4399 1925 gene locus_tag LOCUS_05450 4399 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5148 4846 gene locus_tag LOCUS_05460 5148 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5357 5136 gene locus_tag LOCUS_05470 5357 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6989 5493 gene locus_tag LOCUS_05480 gene amrB 6989 5493 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_05480 8552 7473 gene locus_tag LOCUS_05490 gene meaB 8552 7473 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_05490 9471 8563 gene locus_tag LOCUS_05500 9471 8563 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_05500 10664 9468 gene locus_tag LOCUS_05510 gene coaBC 10664 9468 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_05510 11458 10778 gene locus_tag LOCUS_05520 11458 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 12835 11606 gene locus_tag LOCUS_05530 12835 11606 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_05530 13135 12914 gene locus_tag LOCUS_05540 13135 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 16559 13341 gene locus_tag LOCUS_05550 gene carB 16559 13341 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_05550 18055 16631 gene locus_tag LOCUS_05560 gene argH 18055 16631 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_05560 19208 18162 gene locus_tag LOCUS_05570 19208 18162 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_05570 19809 19231 gene locus_tag LOCUS_05580 19809 19231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05580 20259 19879 gene locus_tag LOCUS_05590 20259 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence027 1427 744 gene locus_tag LOCUS_05600 1427 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2071 3351 gene locus_tag LOCUS_05610 2071 3351 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931827.1 protein_id gnl|my_center|LOCUS_05610 3379 3723 gene locus_tag LOCUS_05620 3379 3723 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931828.1 protein_id gnl|my_center|LOCUS_05620 4362 5036 gene locus_tag LOCUS_05630 4362 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107993.1 protein_id gnl|my_center|LOCUS_05630 5399 7525 gene locus_tag LOCUS_05640 5399 7525 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_05640 8267 9331 gene locus_tag LOCUS_05650 gene serC 8267 9331 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_05650 9413 10336 gene locus_tag LOCUS_05660 9413 10336 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_05660 10442 11689 gene locus_tag LOCUS_05670 10442 11689 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_05670 11817 13145 gene locus_tag LOCUS_05680 11817 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 14694 13720 gene locus_tag LOCUS_05690 14694 13720 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_05690 15605 14718 gene locus_tag LOCUS_05700 15605 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18416 15795 gene locus_tag LOCUS_05710 18416 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19898 18903 gene locus_tag LOCUS_05720 19898 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence028 333 809 gene locus_tag LOCUS_05730 333 809 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_05730 1022 1651 gene locus_tag LOCUS_05740 1022 1651 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_05740 1835 2617 gene locus_tag LOCUS_05750 1835 2617 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_05750 2704 3597 gene locus_tag LOCUS_05760 2704 3597 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_05760 3629 4282 gene locus_tag LOCUS_05770 3629 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4297 5889 gene locus_tag LOCUS_05780 4297 5889 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_05780 5955 7520 gene locus_tag LOCUS_05790 5955 7520 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108446.1 protein_id gnl|my_center|LOCUS_05790 7483 8790 gene locus_tag LOCUS_05800 7483 8790 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_05800 9159 10337 gene locus_tag LOCUS_05810 9159 10337 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_05810 10985 10563 gene locus_tag LOCUS_05820 10985 10563 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_05820 11858 11100 gene locus_tag LOCUS_05830 11858 11100 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_05830 12552 11902 gene locus_tag LOCUS_05840 12552 11902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_05840 13554 12568 gene locus_tag LOCUS_05850 13554 12568 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_05850 13772 13554 gene locus_tag LOCUS_05860 13772 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 16934 13890 gene locus_tag LOCUS_05870 gene secDF 16934 13890 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_05870 18174 17236 gene locus_tag LOCUS_05880 gene mdh 18174 17236 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_05880 <20046 18346 gene locus_tag LOCUS_05890 <20046 18346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926994.1:AMP-dependent synthetase/ligase >Feature sequence029 <1 631 gene locus_tag LOCUS_05900 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962774.1:acetyl-CoA carboxylase carboxyltransferase subunit alpha 764 2284 gene locus_tag LOCUS_05910 gene dnaB 764 2284 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_05910 2373 3626 gene locus_tag LOCUS_05920 2373 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_05920 3623 3835 gene locus_tag LOCUS_05930 3623 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 5175 3844 gene locus_tag LOCUS_05940 5175 3844 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_05940 5905 5234 gene locus_tag LOCUS_05950 gene modB 5905 5234 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_05950 6610 6146 gene locus_tag LOCUS_05960 6610 6146 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_05960 7181 6612 gene locus_tag LOCUS_05970 7181 6612 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_05970 7700 7233 gene locus_tag LOCUS_05980 7700 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8597 7773 gene locus_tag LOCUS_05990 8597 7773 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_05990 8757 8669 gene locus_tag LOCUS_t00060 8757 8669 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10102 9059 gene locus_tag LOCUS_06000 10102 9059 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_06000 10907 10137 gene locus_tag LOCUS_06010 10907 10137 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_06010 11224 12774 gene locus_tag LOCUS_06020 11224 12774 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_06020 12799 13251 gene locus_tag LOCUS_06030 gene tsaE 12799 13251 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_06030 13332 14552 gene locus_tag LOCUS_06040 13332 14552 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_06040 15129 14653 gene locus_tag LOCUS_06050 15129 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 15629 15162 gene locus_tag LOCUS_06060 15629 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 16153 15695 gene locus_tag LOCUS_06070 16153 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 16793 16215 gene locus_tag LOCUS_06080 16793 16215 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_06080 16946 17575 gene locus_tag LOCUS_06090 16946 17575 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_06090 18593 17622 gene locus_tag LOCUS_06100 18593 17622 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_06100 19401 18586 gene locus_tag LOCUS_06110 19401 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence030 1342 371 gene locus_tag LOCUS_06120 1342 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4007 1632 gene locus_tag LOCUS_06130 4007 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4608 4201 gene locus_tag LOCUS_06140 4608 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5420 4650 gene locus_tag LOCUS_06150 gene modA 5420 4650 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_06150 5847 6242 gene locus_tag LOCUS_06160 5847 6242 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_06160 7563 6310 gene locus_tag LOCUS_06170 7563 6310 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_06170 7980 11297 gene locus_tag LOCUS_06180 7980 11297 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202000.1 protein_id gnl|my_center|LOCUS_06180 11302 12978 gene locus_tag LOCUS_06190 11302 12978 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_06190 13193 14023 gene locus_tag LOCUS_06200 13193 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 14182 15000 gene locus_tag LOCUS_06210 14182 15000 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_06210 15136 16176 gene locus_tag LOCUS_06220 15136 16176 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_06220 16148 16711 gene locus_tag LOCUS_06230 16148 16711 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_06230 16971 18518 gene locus_tag LOCUS_06240 16971 18518 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_06240 19577 18546 gene locus_tag LOCUS_06250 19577 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence031 <1 626 gene locus_tag LOCUS_06260 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932463.1:GTP cyclohydrolase I FolE 959 2065 gene locus_tag LOCUS_06270 959 2065 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_06270 2760 2062 gene locus_tag LOCUS_06280 2760 2062 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_06280 2949 4277 gene locus_tag LOCUS_06290 2949 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_06290 4476 7247 gene locus_tag LOCUS_06300 4476 7247 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_06300 7762 8286 gene locus_tag LOCUS_06310 7762 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9739 8357 gene locus_tag LOCUS_06320 gene miaB 9739 8357 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_06320 9940 10695 gene locus_tag LOCUS_06330 9940 10695 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_06330 11759 10770 gene locus_tag LOCUS_06340 11759 10770 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_06340 12202 11756 gene locus_tag LOCUS_06350 12202 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 13107 12199 gene locus_tag LOCUS_06360 gene miaA 13107 12199 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_06360 14184 13141 gene locus_tag LOCUS_06370 14184 13141 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_06370 14320 15324 gene locus_tag LOCUS_06380 gene gap 14320 15324 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118955.1 protein_id gnl|my_center|LOCUS_06380 16359 15607 gene locus_tag LOCUS_06390 16359 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 17220 16471 gene locus_tag LOCUS_06400 17220 16471 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_06400 17360 17545 gene locus_tag LOCUS_06410 17360 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 17597 18364 gene locus_tag LOCUS_06420 17597 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 <19478 18408 gene locus_tag LOCUS_06430 <19478 18408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963016.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence032 <1 3659 gene locus_tag LOCUS_06440 <1 3659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838773.1:lamin tail domain-containing protein 4807 3782 gene locus_tag LOCUS_06450 4807 3782 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_06450 5426 4821 gene locus_tag LOCUS_06460 5426 4821 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_06460 6031 9099 gene locus_tag LOCUS_06470 6031 9099 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476308.1 protein_id gnl|my_center|LOCUS_06470 9479 9153 gene locus_tag LOCUS_06480 9479 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11584 10073 gene locus_tag LOCUS_06490 11584 10073 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_06490 12137 11700 gene locus_tag LOCUS_06500 12137 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12755 12306 gene locus_tag LOCUS_06510 12755 12306 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295281.1 protein_id gnl|my_center|LOCUS_06510 13181 13756 gene locus_tag LOCUS_06520 13181 13756 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_06520 13944 15044 gene locus_tag LOCUS_06530 13944 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 15732 15265 gene locus_tag LOCUS_06540 15732 15265 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_06540 15949 17562 gene locus_tag LOCUS_06550 gene asnB 15949 17562 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_06550 18201 17635 gene locus_tag LOCUS_06560 18201 17635 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_06560 18327 18893 gene locus_tag LOCUS_06570 18327 18893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence033 424 2097 gene locus_tag LOCUS_06580 gene ettA 424 2097 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_06580 2601 2341 gene locus_tag LOCUS_06590 gene yoeB 2601 2341 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_06590 3264 3007 gene locus_tag LOCUS_06600 3264 3007 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_06600 4709 3465 gene locus_tag LOCUS_06610 gene hydF 4709 3465 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964958.1 protein_id gnl|my_center|LOCUS_06610 5128 7473 gene locus_tag LOCUS_06620 5128 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 7476 10037 gene locus_tag LOCUS_06630 7476 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10504 10034 gene locus_tag LOCUS_06640 10504 10034 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206947.1 protein_id gnl|my_center|LOCUS_06640 12051 10513 gene locus_tag LOCUS_06650 12051 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12237 14024 gene locus_tag LOCUS_06660 12237 14024 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_06660 14625 15527 gene locus_tag LOCUS_06670 14625 15527 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_06670 15531 17000 gene locus_tag LOCUS_06680 15531 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17801 17148 gene locus_tag LOCUS_06690 17801 17148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 18001 18678 gene locus_tag LOCUS_06700 gene trmB 18001 18678 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_06700 18678 19307 gene locus_tag LOCUS_06710 18678 19307 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence034 413 1102 gene locus_tag LOCUS_06720 413 1102 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_06720 1265 1444 gene locus_tag LOCUS_06730 1265 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2351 1518 gene locus_tag LOCUS_06740 2351 1518 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_06740 2810 3829 gene locus_tag LOCUS_06750 2810 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4936 4070 gene locus_tag LOCUS_06760 gene rfbD 4936 4070 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_06760 5889 4948 gene locus_tag LOCUS_06770 5889 4948 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_06770 7243 5915 gene locus_tag LOCUS_06780 7243 5915 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_06780 7679 7942 gene locus_tag LOCUS_06790 7679 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 7962 9935 gene locus_tag LOCUS_06800 gene asnB 7962 9935 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_06800 9967 10953 gene locus_tag LOCUS_06810 gene nadE 9967 10953 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533125.1 protein_id gnl|my_center|LOCUS_06810 10956 12419 gene locus_tag LOCUS_06820 10956 12419 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065781.1 protein_id gnl|my_center|LOCUS_06820 12539 14149 gene locus_tag LOCUS_06830 12539 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 15467 14211 gene locus_tag LOCUS_06840 15467 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06840 16226 15609 gene locus_tag LOCUS_06850 16226 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 17586 16552 gene locus_tag LOCUS_06860 17586 16552 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence035 1909 2298 gene locus_tag LOCUS_06870 1909 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2538 4100 gene locus_tag LOCUS_06880 2538 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5252 4131 gene locus_tag LOCUS_06890 5252 4131 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966190.1 protein_id gnl|my_center|LOCUS_06890 5334 6779 gene locus_tag LOCUS_06900 5334 6779 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047910.1 protein_id gnl|my_center|LOCUS_06900 7707 6751 gene locus_tag LOCUS_06910 7707 6751 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_06910 7943 7713 gene locus_tag LOCUS_06920 7943 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 8202 7927 gene locus_tag LOCUS_06930 8202 7927 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_06930 9419 8223 gene locus_tag LOCUS_06940 9419 8223 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_06940 10646 9534 gene locus_tag LOCUS_06950 10646 9534 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476530.1 protein_id gnl|my_center|LOCUS_06950 11358 12464 gene locus_tag LOCUS_06960 11358 12464 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_06960 13517 12519 gene locus_tag LOCUS_06970 13517 12519 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_06970 13830 14216 gene locus_tag LOCUS_06980 13830 14216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 14359 14706 gene locus_tag LOCUS_06990 14359 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06990 14722 16548 gene locus_tag LOCUS_07000 14722 16548 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785391.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07000 16656 18656 gene locus_tag LOCUS_07010 16656 18656 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence036 999 2246 gene locus_tag LOCUS_07020 999 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3289 2243 gene locus_tag LOCUS_07030 3289 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4106 3294 gene locus_tag LOCUS_07040 4106 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4891 4103 gene locus_tag LOCUS_07050 4891 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 5553 4888 gene locus_tag LOCUS_07060 5553 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6556 5564 gene locus_tag LOCUS_07070 6556 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 7599 6553 gene locus_tag LOCUS_07080 7599 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 8399 7596 gene locus_tag LOCUS_07090 8399 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 9684 8404 gene locus_tag LOCUS_07100 9684 8404 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_07100 11003 9870 gene locus_tag LOCUS_07110 11003 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11061 11639 gene locus_tag LOCUS_07120 11061 11639 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_07120 12661 11636 gene locus_tag LOCUS_07130 12661 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 13623 12772 gene locus_tag LOCUS_07140 13623 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 14729 13620 gene locus_tag LOCUS_07150 14729 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 17239 14711 gene locus_tag LOCUS_07160 17239 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 18350 17208 gene locus_tag LOCUS_07170 18350 17208 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence037 166 1752 gene locus_tag LOCUS_07180 166 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1749 2567 gene locus_tag LOCUS_07190 1749 2567 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_07190 3444 2587 gene locus_tag LOCUS_07200 3444 2587 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_07200 3796 4230 gene locus_tag LOCUS_07210 3796 4230 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081498.1 protein_id gnl|my_center|LOCUS_07210 4542 6371 gene locus_tag LOCUS_07220 4542 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6454 7701 gene locus_tag LOCUS_07230 6454 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7859 12514 gene locus_tag LOCUS_07240 7859 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 12974 13375 gene locus_tag LOCUS_07250 12974 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 13419 15395 gene locus_tag LOCUS_07260 13419 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 15528 16070 gene locus_tag LOCUS_07270 15528 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 16181 16492 gene locus_tag LOCUS_07280 16181 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07280 16565 17563 gene locus_tag LOCUS_07290 16565 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07290 >Feature sequence038 <1 1312 gene locus_tag LOCUS_07300 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763196.1:2-isopropylmalate synthase 1450 2853 gene locus_tag LOCUS_07310 gene leuC 1450 2853 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_07310 2897 3487 gene locus_tag LOCUS_07320 gene leuD 2897 3487 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_07320 3588 5156 gene locus_tag LOCUS_07330 3588 5156 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_07330 5169 6236 gene locus_tag LOCUS_07340 gene leuB 5169 6236 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_07340 6442 10953 gene locus_tag LOCUS_07350 gene gltB 6442 10953 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_07350 11127 12554 gene locus_tag LOCUS_07360 11127 12554 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_07360 12660 13448 gene locus_tag LOCUS_07370 gene proC 12660 13448 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_07370 13660 15444 gene locus_tag LOCUS_07380 13660 15444 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_07380 15637 17157 gene locus_tag LOCUS_07390 15637 17157 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence039 12080 7566 gene locus_tag LOCUS_07400 12080 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12388 12927 gene locus_tag LOCUS_07410 12388 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 12984 13736 gene locus_tag LOCUS_07420 12984 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13823 16936 gene locus_tag LOCUS_07430 13823 16936 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_07430 17036 17284 gene locus_tag LOCUS_07440 17036 17284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence040 576 2372 gene locus_tag LOCUS_07450 576 2372 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_07450 4369 2573 gene locus_tag LOCUS_07460 gene ilvB 4369 2573 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_07460 5994 4576 gene locus_tag LOCUS_07470 5994 4576 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_07470 6376 6080 gene locus_tag LOCUS_07480 6376 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8804 6468 gene locus_tag LOCUS_07490 8804 6468 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_07490 9021 10073 gene locus_tag LOCUS_07500 9021 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10327 14010 gene locus_tag LOCUS_07510 10327 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 14101 17586 gene locus_tag LOCUS_07520 14101 17586 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence041 <1 1164 gene locus_tag LOCUS_07530 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403141.1:glycoside hydrolase family 13 protein 2073 1168 gene locus_tag LOCUS_07540 2073 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3377 2088 gene locus_tag LOCUS_07550 3377 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5478 3469 gene locus_tag LOCUS_07560 5478 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6196 5498 gene locus_tag LOCUS_07570 6196 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6711 6193 gene locus_tag LOCUS_07580 6711 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6920 7630 gene locus_tag LOCUS_07590 6920 7630 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_07590 7713 8534 gene locus_tag LOCUS_07600 7713 8534 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_07600 8653 10296 gene locus_tag LOCUS_07610 8653 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 12909 10321 gene locus_tag LOCUS_07620 gene mutS 12909 10321 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_07620 13221 16415 gene locus_tag LOCUS_07630 13221 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence042 3159 1924 gene locus_tag LOCUS_07640 gene nusA 3159 1924 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763665.1 protein_id gnl|my_center|LOCUS_07640 3665 3183 gene locus_tag LOCUS_07650 3665 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3846 5126 gene locus_tag LOCUS_07660 3846 5126 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_07660 5606 6658 gene locus_tag LOCUS_07670 gene lpxD 5606 6658 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_07670 6741 8132 gene locus_tag LOCUS_07680 6741 8132 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_07680 8537 9310 gene locus_tag LOCUS_07690 gene lpxA 8537 9310 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_07690 10534 9419 gene locus_tag LOCUS_07700 gene thiL 10534 9419 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_07700 11201 10557 gene locus_tag LOCUS_07710 11201 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964282.1 protein_id gnl|my_center|LOCUS_07710 11612 12064 gene locus_tag LOCUS_07720 11612 12064 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_07720 12102 14003 gene locus_tag LOCUS_07730 12102 14003 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_07730 15127 14180 gene locus_tag LOCUS_07740 15127 14180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_07740 16030 15182 gene locus_tag LOCUS_07750 16030 15182 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_07750 16368 16832 gene locus_tag LOCUS_07760 gene mraZ 16368 16832 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence043 1143 1228 gene locus_tag LOCUS_t00070 1143 1228 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2546 1317 gene locus_tag LOCUS_07770 2546 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3989 2805 gene locus_tag LOCUS_07780 3989 2805 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_07780 4659 4228 gene locus_tag LOCUS_07790 4659 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4805 5818 gene locus_tag LOCUS_07800 4805 5818 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_07800 6019 7449 gene locus_tag LOCUS_07810 gene hydG 6019 7449 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_07810 7474 8094 gene locus_tag LOCUS_07820 7474 8094 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_07820 8627 8244 gene locus_tag LOCUS_07830 8627 8244 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_07830 9710 8754 gene locus_tag LOCUS_07840 9710 8754 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_07840 10377 9874 gene locus_tag LOCUS_07850 10377 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 10746 10522 gene locus_tag LOCUS_07860 10746 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 10902 11591 gene locus_tag LOCUS_07870 10902 11591 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_07870 13508 11598 gene locus_tag LOCUS_07880 13508 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 16707 14224 gene locus_tag LOCUS_07890 16707 14224 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence044 1331 648 gene locus_tag LOCUS_07900 gene folE 1331 648 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_07900 2594 1464 gene locus_tag LOCUS_07910 2594 1464 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_07910 2578 2970 gene locus_tag LOCUS_07920 2578 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3469 3050 gene locus_tag LOCUS_07930 3469 3050 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_07930 3592 4293 gene locus_tag LOCUS_07940 3592 4293 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_07940 5528 4317 gene locus_tag LOCUS_07950 5528 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6811 5720 gene locus_tag LOCUS_07960 6811 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6954 8651 gene locus_tag LOCUS_07970 6954 8651 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_07970 9661 8699 gene locus_tag LOCUS_07980 gene metF 9661 8699 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_07980 9814 10170 gene locus_tag LOCUS_07990 9814 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 10699 10211 gene locus_tag LOCUS_08000 10699 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 11239 10721 gene locus_tag LOCUS_08010 11239 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 11686 11246 gene locus_tag LOCUS_08020 11686 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 12308 11724 gene locus_tag LOCUS_08030 12308 11724 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_08030 12505 13548 gene locus_tag LOCUS_08040 gene ruvB 12505 13548 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_08040 14909 13695 gene locus_tag LOCUS_08050 14909 13695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_08050 15475 16107 gene locus_tag LOCUS_08060 15475 16107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_08060 16104 16637 gene locus_tag LOCUS_08070 16104 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence045 562 230 gene locus_tag LOCUS_08080 562 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 981 562 gene locus_tag LOCUS_08090 981 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2703 994 gene locus_tag LOCUS_08100 2703 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4940 2754 gene locus_tag LOCUS_08110 gene recQ 4940 2754 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_08110 5209 6030 gene locus_tag LOCUS_08120 gene tatC 5209 6030 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_08120 6060 6794 gene locus_tag LOCUS_08130 gene lptB 6060 6794 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_08130 7750 6791 gene locus_tag LOCUS_08140 7750 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 <16504 8013 gene locus_tag LOCUS_08150 <16504 8013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence046 505 179 gene locus_tag LOCUS_08160 505 179 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_08160 1779 517 gene locus_tag LOCUS_08170 1779 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6286 2003 gene locus_tag LOCUS_08180 6286 2003 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_08180 7065 6685 gene locus_tag LOCUS_08190 7065 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 9288 7144 gene locus_tag LOCUS_08200 9288 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10599 9424 gene locus_tag LOCUS_08210 10599 9424 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_08210 11152 11835 gene locus_tag LOCUS_08220 11152 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 14295 11884 gene locus_tag LOCUS_08230 14295 11884 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08230 14531 15589 gene locus_tag LOCUS_08240 gene rlmN 14531 15589 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence047 786 208 gene locus_tag LOCUS_08250 786 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2085 868 gene locus_tag LOCUS_08260 2085 868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_08260 2628 3443 gene locus_tag LOCUS_08270 2628 3443 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_08270 3784 5892 gene locus_tag LOCUS_08280 gene recG 3784 5892 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_08280 6001 8652 gene locus_tag LOCUS_08290 6001 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9067 11040 gene locus_tag LOCUS_08300 9067 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11215 11733 gene locus_tag LOCUS_08310 11215 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11785 12225 gene locus_tag LOCUS_08320 11785 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12256 13176 gene locus_tag LOCUS_08330 12256 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 13228 13752 gene locus_tag LOCUS_08340 13228 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13974 14348 gene locus_tag LOCUS_08350 13974 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence048 438 367 gene locus_tag LOCUS_t00080 438 367 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 782 606 gene locus_tag LOCUS_08360 782 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1126 1926 gene locus_tag LOCUS_08370 1126 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946551.1 protein_id gnl|my_center|LOCUS_08370 2010 2372 gene locus_tag LOCUS_08380 2010 2372 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 protein_id gnl|my_center|LOCUS_08380 2701 6078 gene locus_tag LOCUS_08390 2701 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_08390 7303 6179 gene locus_tag LOCUS_08400 7303 6179 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_08400 9723 7513 gene locus_tag LOCUS_08410 9723 7513 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_08410 10375 9875 gene locus_tag LOCUS_08420 10375 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10869 13436 gene locus_tag LOCUS_08430 10869 13436 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_08430 14267 13506 gene locus_tag LOCUS_08440 14267 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_08440 14715 15632 gene locus_tag LOCUS_08450 14715 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence049 548 234 gene locus_tag LOCUS_08460 548 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1475 903 gene locus_tag LOCUS_08470 1475 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1782 1477 gene locus_tag LOCUS_08480 1782 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2492 2061 gene locus_tag LOCUS_08490 2492 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 4380 3010 gene locus_tag LOCUS_08500 4380 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6085 4415 gene locus_tag LOCUS_08510 6085 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 9315 6409 gene locus_tag LOCUS_08520 9315 6409 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_08520 10480 9581 gene locus_tag LOCUS_08530 10480 9581 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_08530 11562 10483 gene locus_tag LOCUS_08540 11562 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546662.1 protein_id gnl|my_center|LOCUS_08540 12422 11568 gene locus_tag LOCUS_08550 12422 11568 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545553.1 protein_id gnl|my_center|LOCUS_08550 13697 12495 gene locus_tag LOCUS_08560 13697 12495 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_08560 14563 13976 gene locus_tag LOCUS_08570 14563 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 14729 15280 gene locus_tag LOCUS_08580 14729 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 15264 15548 gene locus_tag LOCUS_08590 15264 15548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence050 98 928 gene locus_tag LOCUS_08600 98 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 918 1733 gene locus_tag LOCUS_08610 918 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2657 1758 gene locus_tag LOCUS_08620 2657 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3023 4075 gene locus_tag LOCUS_08630 3023 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4186 5028 gene locus_tag LOCUS_08640 4186 5028 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_08640 5040 5870 gene locus_tag LOCUS_08650 5040 5870 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_08650 5894 6205 gene locus_tag LOCUS_08660 5894 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6299 6454 gene locus_tag LOCUS_08670 6299 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6507 7316 gene locus_tag LOCUS_08680 6507 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7935 7300 gene locus_tag LOCUS_08690 7935 7300 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_08690 8131 8577 gene locus_tag LOCUS_08700 8131 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 8656 9777 gene locus_tag LOCUS_08710 8656 9777 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_08710 10447 9791 gene locus_tag LOCUS_08720 10447 9791 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_08720 12284 10533 gene locus_tag LOCUS_08730 12284 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 13108 12521 gene locus_tag LOCUS_08740 13108 12521 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_08740 13380 13694 gene locus_tag LOCUS_08750 gene rplU 13380 13694 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_08750 13734 14000 gene locus_tag LOCUS_08760 gene rpmA 13734 14000 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_08760 14103 15374 gene locus_tag LOCUS_08770 gene serS 14103 15374 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence051 809 111 gene locus_tag LOCUS_08780 809 111 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_08780 1074 3041 gene locus_tag LOCUS_08790 gene gyrB 1074 3041 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_08790 3129 3626 gene locus_tag LOCUS_08800 3129 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4773 3637 gene locus_tag LOCUS_08810 4773 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 5265 4825 gene locus_tag LOCUS_08820 5265 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08820 5634 7982 gene locus_tag LOCUS_08830 5634 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 7994 9181 gene locus_tag LOCUS_08840 7994 9181 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203727.1 protein_id gnl|my_center|LOCUS_08840 9204 12332 gene locus_tag LOCUS_08850 9204 12332 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263237.1 protein_id gnl|my_center|LOCUS_08850 13805 12672 gene locus_tag LOCUS_08860 13805 12672 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_08860 14868 13816 gene locus_tag LOCUS_08870 14868 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence052 <1 530 gene locus_tag LOCUS_08880 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein 731 1822 gene locus_tag LOCUS_08890 gene gcvT 731 1822 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_08890 1910 2662 gene locus_tag LOCUS_08900 1910 2662 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_08900 2769 2695 gene locus_tag LOCUS_t00090 2769 2695 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3480 2983 gene locus_tag LOCUS_08910 3480 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5338 3563 gene locus_tag LOCUS_08920 5338 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5838 5365 gene locus_tag LOCUS_08930 5838 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7839 6019 gene locus_tag LOCUS_08940 7839 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 9044 8253 gene locus_tag LOCUS_08950 9044 8253 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_08950 9635 9159 gene locus_tag LOCUS_08960 9635 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 10764 9649 gene locus_tag LOCUS_08970 10764 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 11593 11102 gene locus_tag LOCUS_08980 11593 11102 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145486.1 protein_id gnl|my_center|LOCUS_08980 11926 13374 gene locus_tag LOCUS_08990 11926 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 13414 14865 gene locus_tag LOCUS_09000 13414 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence053 3645 13 gene locus_tag LOCUS_09010 3645 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4477 4773 gene locus_tag LOCUS_09020 4477 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4927 6216 gene locus_tag LOCUS_09030 4927 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 6529 8061 gene locus_tag LOCUS_09040 6529 8061 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_09040 8634 8110 gene locus_tag LOCUS_09050 8634 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8744 10144 gene locus_tag LOCUS_09060 8744 10144 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_09060 11578 10802 gene locus_tag LOCUS_09070 11578 10802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_09070 11814 12503 gene locus_tag LOCUS_09080 11814 12503 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_09080 12533 14476 gene locus_tag LOCUS_09090 12533 14476 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_09090 14484 15242 gene locus_tag LOCUS_09100 14484 15242 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence054 329 700 gene locus_tag LOCUS_09110 329 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 851 1657 gene locus_tag LOCUS_09120 851 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2345 1680 gene locus_tag LOCUS_09130 2345 1680 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_09130 4152 2347 gene locus_tag LOCUS_09140 4152 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4761 5726 gene locus_tag LOCUS_09150 4761 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5742 6731 gene locus_tag LOCUS_09160 5742 6731 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_09160 9358 6737 gene locus_tag LOCUS_09170 9358 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_09170 9521 10015 gene locus_tag LOCUS_09180 9521 10015 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202236.1 protein_id gnl|my_center|LOCUS_09180 10536 10018 gene locus_tag LOCUS_09190 10536 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12415 10556 gene locus_tag LOCUS_09200 12415 10556 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_09200 12575 14101 gene locus_tag LOCUS_09210 gene gpmI 12575 14101 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108817.1 protein_id gnl|my_center|LOCUS_09210 14091 14684 gene locus_tag LOCUS_09220 14091 14684 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_09220 14760 15170 gene locus_tag LOCUS_09230 14760 15170 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869146.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence055 730 155 gene locus_tag LOCUS_09240 730 155 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_09240 884 2764 gene locus_tag LOCUS_09250 884 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2794 3708 gene locus_tag LOCUS_09260 2794 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3780 4172 gene locus_tag LOCUS_09270 3780 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4247 4909 gene locus_tag LOCUS_09280 gene cas6 4247 4909 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_09280 4917 5507 gene locus_tag LOCUS_09290 4917 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_09290 5509 7680 gene locus_tag LOCUS_09300 5509 7680 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_09300 7690 8286 gene locus_tag LOCUS_09310 7690 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09310 8389 9087 gene locus_tag LOCUS_09320 8389 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09320 9108 10178 gene locus_tag LOCUS_09330 9108 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_09330 10483 10809 gene locus_tag LOCUS_09340 10483 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 10831 11844 gene locus_tag LOCUS_09350 10831 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 11956 12384 gene locus_tag LOCUS_09360 gene cas4 11956 12384 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_09360 12439 12846 gene locus_tag LOCUS_09370 12439 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 12839 13846 gene locus_tag LOCUS_09380 gene cas1b 12839 13846 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_09380 13874 14137 gene locus_tag LOCUS_09390 gene cas2 13874 14137 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_09390 14359 15377 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaatcgtaccattttggaattgaaa >Feature sequence056 <1 622 gene locus_tag LOCUS_09400 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein 711 2243 gene locus_tag LOCUS_09410 711 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2424 4427 gene locus_tag LOCUS_09420 2424 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 5154 4411 gene locus_tag LOCUS_09430 gene cobB 5154 4411 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_09430 5611 5201 gene locus_tag LOCUS_09440 5611 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8164 5615 gene locus_tag LOCUS_09450 8164 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8413 9309 gene locus_tag LOCUS_09460 8413 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11579 9483 gene locus_tag LOCUS_09470 11579 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 14362 12098 gene locus_tag LOCUS_09480 14362 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 15107 14370 gene locus_tag LOCUS_09490 15107 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence057 <1 722 gene locus_tag LOCUS_09500 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014548276.1:ROK family protein 782 1657 gene locus_tag LOCUS_09510 782 1657 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548276.1 protein_id gnl|my_center|LOCUS_09510 1758 3689 gene locus_tag LOCUS_09520 1758 3689 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_09520 3823 5997 gene locus_tag LOCUS_09530 3823 5997 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_09530 6146 8083 gene locus_tag LOCUS_09540 6146 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 9027 8416 gene locus_tag LOCUS_09550 9027 8416 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_09550 9915 9031 gene locus_tag LOCUS_09560 9915 9031 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_09560 11481 9994 gene locus_tag LOCUS_09570 11481 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12952 11828 gene locus_tag LOCUS_09580 gene dnaN 12952 11828 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_09580 14276 13308 gene locus_tag LOCUS_09590 14276 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence058 54 1157 gene locus_tag LOCUS_09600 54 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1224 3584 gene locus_tag LOCUS_09610 1224 3584 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_09610 3597 4490 gene locus_tag LOCUS_09620 3597 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4565 4903 gene locus_tag LOCUS_09630 4565 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6081 5191 gene locus_tag LOCUS_09640 6081 5191 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_09640 6797 6147 gene locus_tag LOCUS_09650 gene elbB 6797 6147 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_09650 8700 6916 gene locus_tag LOCUS_09660 8700 6916 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_09660 9092 9919 gene locus_tag LOCUS_09670 9092 9919 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_09670 10311 10123 gene locus_tag LOCUS_09680 10311 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 10639 11229 gene locus_tag LOCUS_09690 10639 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11357 12520 gene locus_tag LOCUS_09700 11357 12520 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_09700 13008 12547 gene locus_tag LOCUS_09710 gene rnhA 13008 12547 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_09710 13621 13019 gene locus_tag LOCUS_09720 13621 13019 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_09720 14921 13650 gene locus_tag LOCUS_09730 14921 13650 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence059 <1 5725 gene locus_tag LOCUS_09740 <1 5725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150939794.1:T9SS type A sorting domain-containing protein 5991 6572 gene locus_tag LOCUS_09750 gene ruvA 5991 6572 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_09750 6665 14137 gene locus_tag LOCUS_09760 gene sprA 6665 14137 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_09760 14393 14542 gene locus_tag LOCUS_09770 14393 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence060 1 189 gene locus_tag LOCUS_09780 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1407 349 gene locus_tag LOCUS_09790 gene aroA 1407 349 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_09790 2661 1537 gene locus_tag LOCUS_09800 2661 1537 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_09800 3807 2923 gene locus_tag LOCUS_09810 3807 2923 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_09810 5035 3860 gene locus_tag LOCUS_09820 5035 3860 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_09820 5945 5046 gene locus_tag LOCUS_09830 5945 5046 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_09830 6489 7631 gene locus_tag LOCUS_09840 6489 7631 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_09840 8567 7878 gene locus_tag LOCUS_09850 8567 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13813 8654 gene locus_tag LOCUS_09860 13813 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence061 690 412 gene locus_tag LOCUS_09870 690 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2066 615 gene locus_tag LOCUS_09880 2066 615 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_09880 3790 2135 gene locus_tag LOCUS_09890 3790 2135 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_09890 4024 4518 gene locus_tag LOCUS_09900 4024 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4612 6738 gene locus_tag LOCUS_09910 4612 6738 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_09910 6533 6621 gene locus_tag LOCUS_t00100 6533 6621 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6892 6966 gene locus_tag LOCUS_t00110 6892 6966 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8118 7150 gene locus_tag LOCUS_09920 gene xylF 8118 7150 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 protein_id gnl|my_center|LOCUS_09920 10336 8123 gene locus_tag LOCUS_09930 10336 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 11093 10428 gene locus_tag LOCUS_09940 11093 10428 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_09940 11958 11104 gene locus_tag LOCUS_09950 11958 11104 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119440.1 protein_id gnl|my_center|LOCUS_09950 12766 11945 gene locus_tag LOCUS_09960 12766 11945 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119440.1 protein_id gnl|my_center|LOCUS_09960 <14316 12794 gene locus_tag LOCUS_09970 <14316 12794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119440.1:polysaccharide lyase family 7 protein >Feature sequence062 1306 140 gene locus_tag LOCUS_09980 1306 140 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_09980 2205 1387 gene locus_tag LOCUS_09990 2205 1387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677519.1 protein_id gnl|my_center|LOCUS_09990 3133 2210 gene locus_tag LOCUS_10000 3133 2210 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_10000 3466 3263 gene locus_tag LOCUS_10010 3466 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 4078 3518 gene locus_tag LOCUS_10020 4078 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10020 4295 4723 gene locus_tag LOCUS_10030 4295 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5075 5410 gene locus_tag LOCUS_10040 5075 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6314 5412 gene locus_tag LOCUS_10050 6314 5412 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_10050 7239 6619 gene locus_tag LOCUS_10060 7239 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9210 7264 gene locus_tag LOCUS_10070 9210 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 9392 12613 gene locus_tag LOCUS_10080 9392 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 13682 12624 gene locus_tag LOCUS_10090 13682 12624 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence063 561 1745 gene locus_tag LOCUS_10100 561 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1786 2964 gene locus_tag LOCUS_10110 1786 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3659 2967 gene locus_tag LOCUS_10120 3659 2967 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_10120 3955 4320 gene locus_tag LOCUS_10130 3955 4320 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_10130 4629 5795 gene locus_tag LOCUS_10140 4629 5795 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_10140 6144 7148 gene locus_tag LOCUS_10150 6144 7148 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_10150 7445 7206 gene locus_tag LOCUS_10160 7445 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7787 7512 gene locus_tag LOCUS_10170 7787 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7936 8754 gene locus_tag LOCUS_10180 7936 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8781 9497 gene locus_tag LOCUS_10190 8781 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9612 10346 gene locus_tag LOCUS_10200 9612 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_10200 11426 10386 gene locus_tag LOCUS_10210 11426 10386 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_10210 11999 13084 gene locus_tag LOCUS_10220 11999 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 13126 13299 gene locus_tag LOCUS_10230 13126 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 13332 13847 gene locus_tag LOCUS_10240 13332 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence064 944 219 gene locus_tag LOCUS_10250 944 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2361 1174 gene locus_tag LOCUS_10260 gene ygeW 2361 1174 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366901.1 protein_id gnl|my_center|LOCUS_10260 3578 2388 gene locus_tag LOCUS_10270 3578 2388 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047945.1 protein_id gnl|my_center|LOCUS_10270 3786 5219 gene locus_tag LOCUS_10280 3786 5219 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_10280 6674 5265 gene locus_tag LOCUS_10290 6674 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 9578 7086 gene locus_tag LOCUS_10300 9578 7086 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_10300 10769 9780 gene locus_tag LOCUS_10310 gene trpS 10769 9780 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_10310 10874 11356 gene locus_tag LOCUS_10320 10874 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11361 12461 gene locus_tag LOCUS_10330 11361 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 <14004 12840 gene locus_tag LOCUS_10340 <14004 12840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890758.1:peptidase domain-containing ABC transporter >Feature sequence065 830 2431 gene locus_tag LOCUS_10350 830 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3881 2487 gene locus_tag LOCUS_10360 3881 2487 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_10360 6350 4023 gene locus_tag LOCUS_10370 6350 4023 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_10370 7126 6470 gene locus_tag LOCUS_10380 gene pgmB 7126 6470 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_10380 8864 7170 gene locus_tag LOCUS_10390 8864 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 10359 9337 gene locus_tag LOCUS_10400 10359 9337 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_10400 10777 13779 gene locus_tag LOCUS_10410 10777 13779 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence066 2413 992 gene locus_tag LOCUS_10420 2413 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4254 2512 gene locus_tag LOCUS_10430 4254 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4636 4962 gene locus_tag LOCUS_10440 4636 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5769 5068 gene locus_tag LOCUS_10450 5769 5068 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_10450 5827 6318 gene locus_tag LOCUS_10460 5827 6318 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_10460 8061 6322 gene locus_tag LOCUS_10470 8061 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 12020 8088 gene locus_tag LOCUS_10480 12020 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 13226 12288 gene locus_tag LOCUS_10490 13226 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13157 13324 gene locus_tag LOCUS_10500 13157 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence067 1042 2295 gene locus_tag LOCUS_10510 gene hutI 1042 2295 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_10510 2765 4450 gene locus_tag LOCUS_10520 2765 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4672 7923 gene locus_tag LOCUS_10530 4672 7923 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_10530 7935 9380 gene locus_tag LOCUS_10540 7935 9380 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_10540 9611 12835 gene locus_tag LOCUS_10550 9611 12835 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence068 993 3116 gene locus_tag LOCUS_10560 993 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3797 3171 gene locus_tag LOCUS_10570 3797 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4907 3810 gene locus_tag LOCUS_10580 gene ychF 4907 3810 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_10580 5394 5074 gene locus_tag LOCUS_10590 5394 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 6829 5399 gene locus_tag LOCUS_10600 6829 5399 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_10600 8346 6853 gene locus_tag LOCUS_10610 8346 6853 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_10610 9296 8364 gene locus_tag LOCUS_10620 9296 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10620 10285 9320 gene locus_tag LOCUS_10630 10285 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 10609 10292 gene locus_tag LOCUS_10640 gene nuoK 10609 10292 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_10640 11111 10623 gene locus_tag LOCUS_10650 11111 10623 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_10650 11638 11150 gene locus_tag LOCUS_10660 11638 11150 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_10660 12703 11651 gene locus_tag LOCUS_10670 gene nuoH 12703 11651 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence069 2462 3634 gene locus_tag LOCUS_10680 2462 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4023 5390 gene locus_tag LOCUS_10690 4023 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 5395 6432 gene locus_tag LOCUS_10700 5395 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6514 7224 gene locus_tag LOCUS_10710 6514 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8524 7550 gene locus_tag LOCUS_10720 8524 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 9559 8534 gene locus_tag LOCUS_10730 9559 8534 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_10730 12095 9537 gene locus_tag LOCUS_10740 12095 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12931 12158 gene locus_tag LOCUS_10750 gene mazG 12931 12158 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence070 1841 1506 gene locus_tag LOCUS_10760 1841 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3046 1946 gene locus_tag LOCUS_10770 3046 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3898 3218 gene locus_tag LOCUS_10780 3898 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4926 3937 gene locus_tag LOCUS_10790 4926 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6302 5196 gene locus_tag LOCUS_10800 6302 5196 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_10800 7088 6333 gene locus_tag LOCUS_10810 7088 6333 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_10810 10303 7142 gene locus_tag LOCUS_10820 10303 7142 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_10820 12824 10575 gene locus_tag LOCUS_10830 12824 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence071 2994 1813 gene locus_tag LOCUS_10840 2994 1813 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_10840 3462 3124 gene locus_tag LOCUS_10850 3462 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4049 3531 gene locus_tag LOCUS_10860 4049 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4166 4408 gene locus_tag LOCUS_10870 4166 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5108 4497 gene locus_tag LOCUS_10880 5108 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5706 5383 gene locus_tag LOCUS_10890 5706 5383 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_10890 6842 5709 gene locus_tag LOCUS_10900 6842 5709 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_10900 8562 6916 gene locus_tag LOCUS_10910 8562 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8737 9834 gene locus_tag LOCUS_10920 8737 9834 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_10920 10184 11251 gene locus_tag LOCUS_10930 10184 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 <13130 11255 gene locus_tag LOCUS_10940 <13130 11255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107841.1:DUF5686 and carboxypeptidase-like regulatory domain-containing protein >Feature sequence072 7155 6031 gene locus_tag LOCUS_10950 gene mqnE 7155 6031 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_10950 7416 8114 gene locus_tag LOCUS_10960 7416 8114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_10960 8832 8206 gene locus_tag LOCUS_10970 8832 8206 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_10970 8962 9036 gene locus_tag LOCUS_t00120 8962 9036 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9180 9749 gene locus_tag LOCUS_10980 9180 9749 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_10980 9879 10619 gene locus_tag LOCUS_10990 9879 10619 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102484484.1 protein_id gnl|my_center|LOCUS_10990 10630 12336 gene locus_tag LOCUS_11000 10630 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 13069 12392 gene locus_tag LOCUS_11010 13069 12392 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence073 <1 665 gene locus_tag LOCUS_11020 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962507.1:electron transfer flavoprotein subunit beta/FixA family protein 700 1674 gene locus_tag LOCUS_11030 700 1674 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_11030 2298 1741 gene locus_tag LOCUS_11040 2298 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4924 2423 gene locus_tag LOCUS_11050 4924 2423 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_11050 5007 5378 gene locus_tag LOCUS_11060 5007 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5383 6504 gene locus_tag LOCUS_11070 5383 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8996 6558 gene locus_tag LOCUS_11080 8996 6558 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_11080 9275 9505 gene locus_tag LOCUS_11090 9275 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 10731 9586 gene locus_tag LOCUS_11100 10731 9586 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_11100 <13124 11330 gene locus_tag LOCUS_11110 <13124 11330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000764979.1:YfhO family protein >Feature sequence074 918 1466 gene locus_tag LOCUS_11120 918 1466 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538562.1 protein_id gnl|my_center|LOCUS_11120 1478 1657 gene locus_tag LOCUS_11130 1478 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1916 2824 gene locus_tag LOCUS_11140 1916 2824 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_11140 2829 3119 gene locus_tag LOCUS_11150 2829 3119 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_11150 4860 3403 gene locus_tag LOCUS_11160 4860 3403 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_11160 5689 5243 gene locus_tag LOCUS_11170 5689 5243 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893498.1 protein_id gnl|my_center|LOCUS_11170 5893 6789 gene locus_tag LOCUS_11180 5893 6789 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_11180 8767 6809 gene locus_tag LOCUS_11190 8767 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9961 9467 gene locus_tag LOCUS_11200 9961 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 10410 9973 gene locus_tag LOCUS_11210 10410 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957009.1 protein_id gnl|my_center|LOCUS_11210 10955 10440 gene locus_tag LOCUS_11220 10955 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 11694 12980 gene locus_tag LOCUS_11230 11694 12980 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence075 1730 387 gene locus_tag LOCUS_11240 gene purB 1730 387 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_11240 2086 1799 gene locus_tag LOCUS_11250 2086 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2368 2174 gene locus_tag LOCUS_11260 2368 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2775 2452 gene locus_tag LOCUS_11270 2775 2452 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015938.1 protein_id gnl|my_center|LOCUS_11270 3662 2925 gene locus_tag LOCUS_11280 3662 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 7825 3695 gene locus_tag LOCUS_11290 7825 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8062 8364 gene locus_tag LOCUS_11300 8062 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 10011 8659 gene locus_tag LOCUS_11310 10011 8659 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_11310 10154 12577 gene locus_tag LOCUS_11320 10154 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 12808 12590 gene locus_tag LOCUS_11330 12808 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence076 560 4381 gene locus_tag LOCUS_11340 560 4381 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_11340 4433 5650 gene locus_tag LOCUS_11350 4433 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5687 7501 gene locus_tag LOCUS_11360 5687 7501 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_11360 7701 8279 gene locus_tag LOCUS_11370 7701 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8328 8660 gene locus_tag LOCUS_11380 8328 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8739 9131 gene locus_tag LOCUS_11390 8739 9131 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_11390 9140 9508 gene locus_tag LOCUS_11400 9140 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 9710 10153 gene locus_tag LOCUS_11410 9710 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 10311 11372 gene locus_tag LOCUS_11420 10311 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 11383 11844 gene locus_tag LOCUS_11430 11383 11844 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_11430 11921 12430 gene locus_tag LOCUS_11440 11921 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence077 449 1570 gene locus_tag LOCUS_11450 gene murG 449 1570 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_11450 1673 2560 gene locus_tag LOCUS_11460 1673 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2683 4023 gene locus_tag LOCUS_11470 gene murC 2683 4023 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_11470 4158 4853 gene locus_tag LOCUS_11480 4158 4853 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_11480 4877 6241 gene locus_tag LOCUS_11490 gene ftsA 4877 6241 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_11490 6280 7848 gene locus_tag LOCUS_11500 6280 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7868 8314 gene locus_tag LOCUS_11510 7868 8314 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_11510 8524 8330 gene locus_tag LOCUS_11520 8524 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 8913 8521 gene locus_tag LOCUS_11530 8913 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 9042 9776 gene locus_tag LOCUS_11540 9042 9776 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_11540 9808 11031 gene locus_tag LOCUS_11550 9808 11031 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_11550 11160 12743 gene locus_tag LOCUS_11560 11160 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence078 174 512 gene locus_tag LOCUS_11570 174 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 516 1256 gene locus_tag LOCUS_11580 516 1256 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_11580 1253 1798 gene locus_tag LOCUS_11590 1253 1798 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_11590 1829 2227 gene locus_tag LOCUS_11600 1829 2227 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_11600 2230 4023 gene locus_tag LOCUS_11610 gene nuoF 2230 4023 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_11610 4032 5834 gene locus_tag LOCUS_11620 4032 5834 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_11620 5863 6351 gene locus_tag LOCUS_11630 gene nuoE 5863 6351 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_11630 6487 8442 gene locus_tag LOCUS_11640 6487 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8454 9575 gene locus_tag LOCUS_11650 8454 9575 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_11650 11471 9636 gene locus_tag LOCUS_11660 gene glmS 11471 9636 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence079 213 40 gene locus_tag LOCUS_11670 gene ccoS 213 40 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533251.1 protein_id gnl|my_center|LOCUS_11670 1073 327 gene locus_tag LOCUS_11680 1073 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2092 1073 gene locus_tag LOCUS_11690 2092 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2695 4038 gene locus_tag LOCUS_11700 gene rimO 2695 4038 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_11700 4252 4947 gene locus_tag LOCUS_11710 4252 4947 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_11710 7131 4963 gene locus_tag LOCUS_11720 7131 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 8107 7310 gene locus_tag LOCUS_11730 8107 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 8443 8159 gene locus_tag LOCUS_11740 8443 8159 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_11740 9022 8447 gene locus_tag LOCUS_11750 9022 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence080 1193 801 gene locus_tag LOCUS_11760 1193 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1411 1193 gene locus_tag LOCUS_11770 1411 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1648 1439 gene locus_tag LOCUS_11780 1648 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3388 2399 gene locus_tag LOCUS_11790 3388 2399 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_11790 3833 3570 gene locus_tag LOCUS_11800 3833 3570 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933446.1 protein_id gnl|my_center|LOCUS_11800 5038 3908 gene locus_tag LOCUS_11810 5038 3908 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_11810 5312 5989 gene locus_tag LOCUS_11820 gene pgeF 5312 5989 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_11820 6080 6388 gene locus_tag LOCUS_11830 6080 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6744 6400 gene locus_tag LOCUS_11840 6744 6400 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_11840 9085 6809 gene locus_tag LOCUS_11850 9085 6809 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_11850 10671 9148 gene locus_tag LOCUS_11860 10671 9148 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_11860 10992 11585 gene locus_tag LOCUS_11870 10992 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11585 12241 gene locus_tag LOCUS_11880 11585 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12290 12532 gene locus_tag LOCUS_11890 12290 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence081 688 1962 gene locus_tag LOCUS_11900 688 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2289 4811 gene locus_tag LOCUS_11910 2289 4811 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_11910 6511 5261 gene locus_tag LOCUS_11920 6511 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7469 6534 gene locus_tag LOCUS_11930 7469 6534 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_11930 8904 7462 gene locus_tag LOCUS_11940 8904 7462 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_11940 9138 9422 gene locus_tag LOCUS_11950 9138 9422 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378666.1 protein_id gnl|my_center|LOCUS_11950 10425 9478 gene locus_tag LOCUS_11960 gene rsgA 10425 9478 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_11960 11732 10563 gene locus_tag LOCUS_11970 11732 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 12338 12006 gene locus_tag LOCUS_11980 12338 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence082 1036 353 gene locus_tag LOCUS_11990 1036 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1472 1167 gene locus_tag LOCUS_12000 1472 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2808 1708 gene locus_tag LOCUS_12010 2808 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3369 2893 gene locus_tag LOCUS_12020 3369 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4280 3942 gene locus_tag LOCUS_12030 4280 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4629 6008 gene locus_tag LOCUS_12040 gene murC 4629 6008 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_12040 6157 6459 gene locus_tag LOCUS_12050 6157 6459 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_12050 7812 7183 gene locus_tag LOCUS_12060 gene rsmG 7812 7183 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_12060 8474 7878 gene locus_tag LOCUS_12070 gene sigW 8474 7878 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_12070 9600 8458 gene locus_tag LOCUS_12080 9600 8458 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_12080 9741 10871 gene locus_tag LOCUS_12090 gene tgt 9741 10871 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_12090 10882 11976 gene locus_tag LOCUS_12100 10882 11976 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_12100 12331 12528 gene locus_tag LOCUS_12110 12331 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence083 55 3138 gene locus_tag LOCUS_12120 gene ccsA 55 3138 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_12120 3373 4836 gene locus_tag LOCUS_12130 gene rpoN 3373 4836 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108333.1 protein_id gnl|my_center|LOCUS_12130 4861 5829 gene locus_tag LOCUS_12140 4861 5829 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_12140 8197 5834 gene locus_tag LOCUS_12150 8197 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 9069 8704 gene locus_tag LOCUS_12160 9069 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 9458 9081 gene locus_tag LOCUS_12170 9458 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11301 9469 gene locus_tag LOCUS_12180 11301 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 12600 11539 gene locus_tag LOCUS_12190 12600 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence084 2233 1856 gene locus_tag LOCUS_12200 gene rplL 2233 1856 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_12200 2786 2262 gene locus_tag LOCUS_12210 gene rplJ 2786 2262 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_12210 3498 2803 gene locus_tag LOCUS_12220 gene rplA 3498 2803 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_12220 3961 3515 gene locus_tag LOCUS_12230 gene rplK 3961 3515 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_12230 4613 4062 gene locus_tag LOCUS_12240 gene nusG 4613 4062 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_12240 4916 4843 gene locus_tag LOCUS_t00130 4916 4843 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6179 4992 gene locus_tag LOCUS_12250 gene tuf 6179 4992 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_12250 6311 6239 gene locus_tag LOCUS_t00140 6311 6239 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6398 6325 gene locus_tag LOCUS_t00150 6398 6325 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6498 6416 gene locus_tag LOCUS_t00160 6498 6416 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6601 6527 gene locus_tag LOCUS_t00170 6601 6527 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6994 6698 gene locus_tag LOCUS_12260 6994 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7894 7010 gene locus_tag LOCUS_12270 gene xerC 7894 7010 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_12270 8233 8036 gene locus_tag LOCUS_12280 gene rpsU 8233 8036 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_12280 9545 8397 gene locus_tag LOCUS_12290 9545 8397 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_12290 10834 9698 gene locus_tag LOCUS_12300 10834 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 <12287 10837 gene locus_tag LOCUS_12310 <12287 10837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189099273.1:alanine/glycine:cation symporter family protein >Feature sequence085 2 1432 gene locus_tag LOCUS_12320 2 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1762 2289 gene locus_tag LOCUS_12330 1762 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2419 4116 gene locus_tag LOCUS_12340 2419 4116 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_12340 4442 4873 gene locus_tag LOCUS_12350 4442 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5726 5148 gene locus_tag LOCUS_12360 5726 5148 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_12360 6066 7259 gene locus_tag LOCUS_12370 6066 7259 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_12370 7698 9038 gene locus_tag LOCUS_12380 7698 9038 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_12380 9162 10328 gene locus_tag LOCUS_12390 9162 10328 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_12390 10826 10563 gene locus_tag LOCUS_12400 10826 10563 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_12400 11250 12125 gene locus_tag LOCUS_12410 11250 12125 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence086 974 132 gene locus_tag LOCUS_12420 gene murQ 974 132 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_12420 1824 988 gene locus_tag LOCUS_12430 1824 988 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_12430 3443 1839 gene locus_tag LOCUS_12440 3443 1839 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_12440 4704 3673 gene locus_tag LOCUS_12450 4704 3673 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_12450 5814 4783 gene locus_tag LOCUS_12460 5814 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6284 5892 gene locus_tag LOCUS_12470 6284 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6463 8130 gene locus_tag LOCUS_12480 6463 8130 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_12480 8357 9550 gene locus_tag LOCUS_12490 8357 9550 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_12490 11274 9595 gene locus_tag LOCUS_12500 11274 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <12264 11337 gene locus_tag LOCUS_12510 <12264 11337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083846.1:thioredoxin family protein >Feature sequence087 826 2022 gene locus_tag LOCUS_12520 826 2022 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_12520 2174 3253 gene locus_tag LOCUS_12530 2174 3253 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_12530 3360 4196 gene locus_tag LOCUS_12540 gene kdsA 3360 4196 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_12540 4294 5298 gene locus_tag LOCUS_12550 4294 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5440 6000 gene locus_tag LOCUS_12560 5440 6000 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_12560 6010 7944 gene locus_tag LOCUS_12570 6010 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8142 9479 gene locus_tag LOCUS_12580 gene tilS 8142 9479 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_12580 9524 11536 gene locus_tag LOCUS_12590 9524 11536 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021374131.1 protein_id gnl|my_center|LOCUS_12590 <12146 11597 gene locus_tag LOCUS_12600 <12146 11597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963737.1:anthranilate synthase component I family protein >Feature sequence088 5447 645 gene locus_tag LOCUS_12610 5447 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6424 5648 gene locus_tag LOCUS_12620 gene trpA 6424 5648 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_12620 7064 6570 gene locus_tag LOCUS_12630 7064 6570 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_12630 8239 7061 gene locus_tag LOCUS_12640 gene trpB 8239 7061 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_12640 9093 8452 gene locus_tag LOCUS_12650 9093 8452 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_12650 9897 9106 gene locus_tag LOCUS_12660 gene trpC 9897 9106 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_12660 10911 9925 gene locus_tag LOCUS_12670 gene trpD 10911 9925 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_12670 11532 10963 gene locus_tag LOCUS_12680 11532 10963 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence089 1030 326 gene locus_tag LOCUS_12690 1030 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1186 2295 gene locus_tag LOCUS_12700 gene dprA 1186 2295 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_12700 3362 2343 gene locus_tag LOCUS_12710 3362 2343 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_12710 5206 3365 gene locus_tag LOCUS_12720 5206 3365 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_12720 5564 5770 gene locus_tag LOCUS_12730 5564 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 5875 6186 gene locus_tag LOCUS_12740 5875 6186 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_12740 7082 6192 gene locus_tag LOCUS_12750 7082 6192 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207886.1 protein_id gnl|my_center|LOCUS_12750 7986 7087 gene locus_tag LOCUS_12760 7986 7087 CDS product S-adenosylmethionine uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596540.1 protein_id gnl|my_center|LOCUS_12760 8145 8930 gene locus_tag LOCUS_12770 8145 8930 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576912.1 protein_id gnl|my_center|LOCUS_12770 9854 8997 gene locus_tag LOCUS_12780 9854 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 9949 10611 gene locus_tag LOCUS_12790 9949 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 10640 11371 gene locus_tag LOCUS_12800 10640 11371 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence090 224 1060 gene locus_tag LOCUS_12810 224 1060 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_12810 2751 1222 gene locus_tag LOCUS_12820 2751 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3632 2793 gene locus_tag LOCUS_12830 3632 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4235 3645 gene locus_tag LOCUS_12840 4235 3645 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_12840 5720 4491 gene locus_tag LOCUS_12850 5720 4491 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_12850 5922 6980 gene locus_tag LOCUS_12860 5922 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 6991 7797 gene locus_tag LOCUS_12870 6991 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10210 7790 gene locus_tag LOCUS_12880 10210 7790 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_12880 10984 10214 gene locus_tag LOCUS_12890 10984 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 11203 11790 gene locus_tag LOCUS_12900 11203 11790 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763511.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence091 1406 9 gene locus_tag LOCUS_12910 1406 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3998 1479 gene locus_tag LOCUS_12920 3998 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4991 4401 gene locus_tag LOCUS_12930 4991 4401 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_12930 6588 5182 gene locus_tag LOCUS_12940 6588 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7869 7456 gene locus_tag LOCUS_12950 7869 7456 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_12950 8096 8677 gene locus_tag LOCUS_12960 8096 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 8682 10490 gene locus_tag LOCUS_12970 8682 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 10509 10967 gene locus_tag LOCUS_12980 10509 10967 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence092 809 231 gene locus_tag LOCUS_12990 809 231 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881435.1 protein_id gnl|my_center|LOCUS_12990 1609 1094 gene locus_tag LOCUS_13000 1609 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2728 1622 gene locus_tag LOCUS_13010 2728 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4604 2853 gene locus_tag LOCUS_13020 4604 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6194 4713 gene locus_tag LOCUS_13030 6194 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6526 6314 gene locus_tag LOCUS_13040 6526 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7706 6711 gene locus_tag LOCUS_13050 7706 6711 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_13050 8145 7714 gene locus_tag LOCUS_13060 8145 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9392 8271 gene locus_tag LOCUS_13070 9392 8271 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_13070 <11963 9448 gene locus_tag LOCUS_13080 <11963 9448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963036.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence093 2057 147 gene locus_tag LOCUS_13090 2057 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3708 2329 gene locus_tag LOCUS_13100 3708 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4214 6661 gene locus_tag LOCUS_13110 gene thrA 4214 6661 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_13110 6716 7639 gene locus_tag LOCUS_13120 6716 7639 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_13120 7703 9034 gene locus_tag LOCUS_13130 gene thrC 7703 9034 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_13130 9072 9656 gene locus_tag LOCUS_13140 9072 9656 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_13140 9653 10480 gene locus_tag LOCUS_13150 9653 10480 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_13150 10531 11727 gene locus_tag LOCUS_13160 gene hflX 10531 11727 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence094 1788 418 gene locus_tag LOCUS_13170 1788 418 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_13170 2446 1748 gene locus_tag LOCUS_13180 2446 1748 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107609.1 protein_id gnl|my_center|LOCUS_13180 3058 2480 gene locus_tag LOCUS_13190 3058 2480 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107608.1 protein_id gnl|my_center|LOCUS_13190 3918 3196 gene locus_tag LOCUS_13200 gene dapB 3918 3196 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_13200 4559 3963 gene locus_tag LOCUS_13210 4559 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5112 4768 gene locus_tag LOCUS_13220 gene rplT 5112 4768 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_13220 5420 5223 gene locus_tag LOCUS_13230 gene rpmI 5420 5223 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_13230 5760 5470 gene locus_tag LOCUS_13240 5760 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8003 6063 gene locus_tag LOCUS_13250 gene thrS 8003 6063 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_13250 10079 8283 gene locus_tag LOCUS_13260 10079 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 10318 10497 gene locus_tag LOCUS_13270 10318 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 10583 11665 gene locus_tag LOCUS_13280 10583 11665 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence095 196 975 gene locus_tag LOCUS_13290 196 975 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668952.1 protein_id gnl|my_center|LOCUS_13290 1452 1009 gene locus_tag LOCUS_13300 1452 1009 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880607.1 protein_id gnl|my_center|LOCUS_13300 2864 1446 gene locus_tag LOCUS_13310 2864 1446 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_13310 3838 3044 gene locus_tag LOCUS_13320 3838 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 7078 4013 gene locus_tag LOCUS_13330 7078 4013 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_13330 11811 7210 gene locus_tag LOCUS_13340 11811 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence096 180 1364 gene locus_tag LOCUS_13350 180 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1507 2994 gene locus_tag LOCUS_13360 1507 2994 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_13360 3009 3365 gene locus_tag LOCUS_13370 gene folB 3009 3365 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_13370 3974 3408 gene locus_tag LOCUS_13380 3974 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6246 4360 gene locus_tag LOCUS_13390 6246 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7804 6404 gene locus_tag LOCUS_13400 7804 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8677 8000 gene locus_tag LOCUS_13410 8677 8000 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_13410 9064 8690 gene locus_tag LOCUS_13420 9064 8690 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_13420 9373 9092 gene locus_tag LOCUS_13430 9373 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13430 9729 9487 gene locus_tag LOCUS_13440 9729 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <11763 9777 gene locus_tag LOCUS_13450 <11763 9777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202809.1:isoleucine--tRNA ligase >Feature sequence097 480 869 gene locus_tag LOCUS_13460 480 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1131 2390 gene locus_tag LOCUS_13470 1131 2390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_13470 2571 4004 gene locus_tag LOCUS_13480 2571 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4070 5128 gene locus_tag LOCUS_13490 gene pdxA 4070 5128 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_13490 5370 8735 gene locus_tag LOCUS_13500 gene ileS 5370 8735 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_13500 8751 9143 gene locus_tag LOCUS_13510 8751 9143 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_13510 9158 9763 gene locus_tag LOCUS_13520 9158 9763 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_13520 9907 11571 gene locus_tag LOCUS_13530 9907 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence098 736 260 gene locus_tag LOCUS_13540 736 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 991 809 gene locus_tag LOCUS_13550 991 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2296 992 gene locus_tag LOCUS_13560 gene rfbH 2296 992 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_13560 2899 2315 gene locus_tag LOCUS_13570 gene rfbC 2899 2315 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_13570 3921 2890 gene locus_tag LOCUS_13580 3921 2890 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_13580 4746 3967 gene locus_tag LOCUS_13590 gene rfbF 4746 3967 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_13590 6450 4990 gene locus_tag LOCUS_13600 6450 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7662 6604 gene locus_tag LOCUS_13610 7662 6604 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_13610 8119 8610 gene locus_tag LOCUS_13620 8119 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 8600 10807 gene locus_tag LOCUS_13630 8600 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence099 35 1303 gene locus_tag LOCUS_13640 35 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2297 1263 gene locus_tag LOCUS_13650 gene metX 2297 1263 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_13650 2965 2504 gene locus_tag LOCUS_13660 2965 2504 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_13660 4277 2979 gene locus_tag LOCUS_13670 4277 2979 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_13670 5884 4475 gene locus_tag LOCUS_13680 5884 4475 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_13680 7682 6432 gene locus_tag LOCUS_13690 7682 6432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_13690 7820 10363 gene locus_tag LOCUS_13700 gene acnB 7820 10363 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942304.1 protein_id gnl|my_center|LOCUS_13700 10589 11413 gene locus_tag LOCUS_13710 10589 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence100 555 911 gene locus_tag LOCUS_13720 555 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 904 1620 gene locus_tag LOCUS_13730 904 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1824 2252 gene locus_tag LOCUS_13740 1824 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2394 2798 gene locus_tag LOCUS_13750 2394 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3269 2946 gene locus_tag LOCUS_13760 3269 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 3520 3332 gene locus_tag LOCUS_13770 3520 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4052 3513 gene locus_tag LOCUS_13780 4052 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4629 6986 gene locus_tag LOCUS_13790 4629 6986 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_13790 8268 7063 gene locus_tag LOCUS_13800 8268 7063 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_13800 9733 8315 gene locus_tag LOCUS_13810 9733 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10512 9883 gene locus_tag LOCUS_13820 10512 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence101 398 1165 gene locus_tag LOCUS_13830 398 1165 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_13830 1152 2162 gene locus_tag LOCUS_13840 1152 2162 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495222.1 protein_id gnl|my_center|LOCUS_13840 2780 2169 gene locus_tag LOCUS_13850 2780 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3062 5962 gene locus_tag LOCUS_13860 gene gcvP 3062 5962 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_13860 6731 6030 gene locus_tag LOCUS_13870 6731 6030 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_13870 6873 7358 gene locus_tag LOCUS_13880 6873 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 8371 7838 gene locus_tag LOCUS_13890 8371 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 9371 8343 gene locus_tag LOCUS_13900 9371 8343 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_13900 10695 9409 gene locus_tag LOCUS_13910 10695 9409 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_13910 10804 11463 gene locus_tag LOCUS_13920 10804 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence102 <1 1493 gene locus_tag LOCUS_13930 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 1746 2327 gene locus_tag LOCUS_13940 1746 2327 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_13940 2343 2726 gene locus_tag LOCUS_13950 gene siaC 2343 2726 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_13950 2790 5897 gene locus_tag LOCUS_13960 2790 5897 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_13960 6002 6919 gene locus_tag LOCUS_13970 6002 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6921 7394 gene locus_tag LOCUS_13980 6921 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 8313 7486 gene locus_tag LOCUS_13990 gene pyrF 8313 7486 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_13990 9416 8322 gene locus_tag LOCUS_14000 gene prfA 9416 8322 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_14000 10721 9555 gene locus_tag LOCUS_14010 10721 9555 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence103 662 1747 gene locus_tag LOCUS_14020 662 1747 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_14020 2823 1813 gene locus_tag LOCUS_14030 2823 1813 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807291.1 protein_id gnl|my_center|LOCUS_14030 3025 4329 gene locus_tag LOCUS_14040 3025 4329 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_14040 5154 4381 gene locus_tag LOCUS_14050 5154 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 5322 5840 gene locus_tag LOCUS_14060 5322 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5906 7237 gene locus_tag LOCUS_14070 5906 7237 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_14070 7247 8605 gene locus_tag LOCUS_14080 7247 8605 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence104 489 2903 gene locus_tag LOCUS_14090 489 2903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_14090 3300 3923 gene locus_tag LOCUS_14100 gene recR 3300 3923 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_14100 3979 5157 gene locus_tag LOCUS_14110 3979 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5221 6168 gene locus_tag LOCUS_14120 5221 6168 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_14120 6344 6517 gene locus_tag LOCUS_14130 6344 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 9502 6722 gene locus_tag LOCUS_14140 9502 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 9714 11054 gene locus_tag LOCUS_14150 9714 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence105 2515 800 gene locus_tag LOCUS_14160 2515 800 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_14160 3435 2788 gene locus_tag LOCUS_14170 3435 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4211 3546 gene locus_tag LOCUS_14180 4211 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5541 4432 gene locus_tag LOCUS_14190 5541 4432 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382304.1 protein_id gnl|my_center|LOCUS_14190 6964 5564 gene locus_tag LOCUS_14200 6964 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_14200 7718 6996 gene locus_tag LOCUS_14210 7718 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107993.1 protein_id gnl|my_center|LOCUS_14210 8576 7746 gene locus_tag LOCUS_14220 8576 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 10882 8642 gene locus_tag LOCUS_14230 10882 8642 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence106 1434 478 gene locus_tag LOCUS_14240 1434 478 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_14240 2061 1858 gene locus_tag LOCUS_14250 2061 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3485 2163 gene locus_tag LOCUS_14260 gene rseP 3485 2163 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_14260 4707 3511 gene locus_tag LOCUS_14270 4707 3511 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_14270 5560 4697 gene locus_tag LOCUS_14280 5560 4697 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_14280 6109 5699 gene locus_tag LOCUS_14290 6109 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 6558 6106 gene locus_tag LOCUS_14300 6558 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 7397 6555 gene locus_tag LOCUS_14310 gene prmA 7397 6555 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_14310 7623 8159 gene locus_tag LOCUS_14320 7623 8159 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence107 1 360 gene locus_tag LOCUS_14330 1 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 470 1402 gene locus_tag LOCUS_14340 470 1402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_14340 2108 1395 gene locus_tag LOCUS_14350 2108 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3700 2429 gene locus_tag LOCUS_14360 gene purD 3700 2429 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_14360 4160 6307 gene locus_tag LOCUS_14370 4160 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6311 8941 gene locus_tag LOCUS_14380 6311 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 10376 8895 gene locus_tag LOCUS_14390 gene lpdA 10376 8895 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_14390 10588 10827 gene locus_tag LOCUS_14400 10588 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence108 1190 744 gene locus_tag LOCUS_14410 gene rplO 1190 744 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_14410 1391 1212 gene locus_tag LOCUS_14420 gene rpmD 1391 1212 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108454.1 protein_id gnl|my_center|LOCUS_14420 1918 1403 gene locus_tag LOCUS_14430 gene rpsE 1918 1403 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_14430 2283 1924 gene locus_tag LOCUS_14440 gene rplR 2283 1924 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_14440 2859 2305 gene locus_tag LOCUS_14450 gene rplF 2859 2305 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_14450 3266 2871 gene locus_tag LOCUS_14460 gene rpsH 3266 2871 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_14460 3554 3285 gene locus_tag LOCUS_14470 gene rpsN 3554 3285 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_14470 4114 3557 gene locus_tag LOCUS_14480 gene rplE 4114 3557 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_14480 4437 4114 gene locus_tag LOCUS_14490 gene rplX 4437 4114 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_14490 4821 4456 gene locus_tag LOCUS_14500 gene rplN 4821 4456 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_14500 5081 4824 gene locus_tag LOCUS_14510 gene rpsQ 5081 4824 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_14510 5294 5091 gene locus_tag LOCUS_14520 5294 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5680 5294 gene locus_tag LOCUS_14530 gene rplP 5680 5294 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_14530 6444 5749 gene locus_tag LOCUS_14540 gene rpsC 6444 5749 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_14540 6849 6448 gene locus_tag LOCUS_14550 gene rplV 6849 6448 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_14550 7143 6874 gene locus_tag LOCUS_14560 gene rpsS 7143 6874 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_14560 7989 7165 gene locus_tag LOCUS_14570 gene rplB 7989 7165 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_14570 8285 7995 gene locus_tag LOCUS_14580 gene rplW 8285 7995 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_14580 8911 8288 gene locus_tag LOCUS_14590 gene rplD 8911 8288 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_14590 9528 8911 gene locus_tag LOCUS_14600 gene rplC 9528 8911 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_14600 9850 9545 gene locus_tag LOCUS_14610 gene rpsJ 9850 9545 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_14610 <11082 9862 gene locus_tag LOCUS_14620 <11082 9862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762033.1:elongation factor G >Feature sequence109 781 35 gene locus_tag LOCUS_14630 gene fabG 781 35 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_14630 1047 1520 gene locus_tag LOCUS_14640 1047 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1540 2142 gene locus_tag LOCUS_14650 1540 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2506 3840 gene locus_tag LOCUS_14660 gene ffh 2506 3840 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_14660 3865 4746 gene locus_tag LOCUS_14670 gene folD 3865 4746 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_14670 5514 4909 gene locus_tag LOCUS_14680 5514 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 7065 5521 gene locus_tag LOCUS_14690 7065 5521 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_14690 8242 7346 gene locus_tag LOCUS_14700 8242 7346 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_14700 8339 9325 gene locus_tag LOCUS_14710 8339 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9465 10562 gene locus_tag LOCUS_14720 9465 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence110 <1 1470 gene locus_tag LOCUS_14730 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase family glycosyl hydrolase 2976 1543 gene locus_tag LOCUS_14740 2976 1543 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_14740 3290 2979 gene locus_tag LOCUS_14750 3290 2979 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_14750 4430 3303 gene locus_tag LOCUS_14760 4430 3303 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_14760 7564 5435 gene locus_tag LOCUS_14770 7564 5435 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_14770 8342 7626 gene locus_tag LOCUS_14780 8342 7626 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_14780 9030 8335 gene locus_tag LOCUS_14790 9030 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9619 9984 gene locus_tag LOCUS_14800 9619 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence111 2032 1328 gene locus_tag LOCUS_14810 2032 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2922 2047 gene locus_tag LOCUS_14820 2922 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3068 3592 gene locus_tag LOCUS_14830 3068 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3713 5047 gene locus_tag LOCUS_14840 3713 5047 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_14840 5105 5686 gene locus_tag LOCUS_14850 gene gldD 5105 5686 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_14850 5688 6332 gene locus_tag LOCUS_14860 5688 6332 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_14860 6329 7063 gene locus_tag LOCUS_14870 6329 7063 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_14870 8243 7041 gene locus_tag LOCUS_14880 8243 7041 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104516.1 protein_id gnl|my_center|LOCUS_14880 8787 8260 gene locus_tag LOCUS_14890 8787 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_14890 8991 10883 gene locus_tag LOCUS_14900 8991 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence112 916 155 gene locus_tag LOCUS_14910 916 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1283 1357 gene locus_tag LOCUS_t00180 1283 1357 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1847 2614 gene locus_tag LOCUS_14920 1847 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3458 3141 gene locus_tag LOCUS_14930 3458 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3829 3461 gene locus_tag LOCUS_14940 3829 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4049 3864 gene locus_tag LOCUS_14950 4049 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4290 4030 gene locus_tag LOCUS_14960 4290 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4592 4341 gene locus_tag LOCUS_14970 4592 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4783 4595 gene locus_tag LOCUS_14980 4783 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5125 4952 gene locus_tag LOCUS_14990 5125 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5968 5669 gene locus_tag LOCUS_15000 5968 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6259 5993 gene locus_tag LOCUS_15010 6259 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6402 6737 gene locus_tag LOCUS_15020 6402 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6749 7078 gene locus_tag LOCUS_15030 6749 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7075 7500 gene locus_tag LOCUS_15040 7075 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7887 7612 gene locus_tag LOCUS_15050 7887 7612 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_15050 8342 7890 gene locus_tag LOCUS_15060 8342 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 9698 8649 gene locus_tag LOCUS_15070 9698 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 10040 9843 gene locus_tag LOCUS_15080 10040 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 10392 10102 gene locus_tag LOCUS_15090 10392 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence113 683 1333 gene locus_tag LOCUS_15100 683 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2378 1365 gene locus_tag LOCUS_15110 gene murB 2378 1365 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_15110 2454 3620 gene locus_tag LOCUS_15120 2454 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5260 3914 gene locus_tag LOCUS_15130 5260 3914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_15130 6126 5278 gene locus_tag LOCUS_15140 6126 5278 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760774.1 protein_id gnl|my_center|LOCUS_15140 8103 6151 gene locus_tag LOCUS_15150 8103 6151 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_15150 9706 8237 gene locus_tag LOCUS_15160 gene guaB 9706 8237 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_15160 10600 9884 gene locus_tag LOCUS_15170 10600 9884 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence114 2586 457 gene locus_tag LOCUS_15180 gene pbpC 2586 457 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495148.1 protein_id gnl|my_center|LOCUS_15180 3318 2860 gene locus_tag LOCUS_15190 3318 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3580 3657 gene locus_tag LOCUS_t00190 3580 3657 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4538 3753 gene locus_tag LOCUS_15200 4538 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6784 4622 gene locus_tag LOCUS_15210 6784 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8027 6810 gene locus_tag LOCUS_15220 8027 6810 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_15220 10107 8113 gene locus_tag LOCUS_15230 10107 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 10302 10108 gene locus_tag LOCUS_15240 10302 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence115 861 253 gene locus_tag LOCUS_15250 gene cysC 861 253 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202511.1 protein_id gnl|my_center|LOCUS_15250 1043 3166 gene locus_tag LOCUS_15260 1043 3166 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_15260 3349 4170 gene locus_tag LOCUS_15270 3349 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4741 6210 gene locus_tag LOCUS_15280 gene cysS 4741 6210 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_15280 6266 7411 gene locus_tag LOCUS_15290 6266 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7672 7899 gene locus_tag LOCUS_15300 7672 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7933 9174 gene locus_tag LOCUS_15310 7933 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9149 10510 gene locus_tag LOCUS_15320 9149 10510 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence116 78 638 gene locus_tag LOCUS_15330 78 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 651 2615 gene locus_tag LOCUS_15340 651 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2624 4813 gene locus_tag LOCUS_15350 2624 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4974 6278 gene locus_tag LOCUS_15360 4974 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6283 8169 gene locus_tag LOCUS_15370 6283 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 8201 10564 gene locus_tag LOCUS_15380 8201 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence117 221 460 gene locus_tag LOCUS_15390 221 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2672 519 gene locus_tag LOCUS_15400 2672 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3318 3944 gene locus_tag LOCUS_15410 3318 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3976 5583 gene locus_tag LOCUS_15420 3976 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5588 6745 gene locus_tag LOCUS_15430 5588 6745 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_15430 8838 6784 gene locus_tag LOCUS_15440 8838 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 9956 8898 gene locus_tag LOCUS_15450 9956 8898 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_15450 <10742 10056 gene locus_tag LOCUS_15460 <10742 10056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545413.1:TrkH family potassium uptake protein >Feature sequence118 <1 1254 gene locus_tag LOCUS_15470 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545463.1:type III-A CRISPR-associated protein Cas10/Csm1 1308 1775 gene locus_tag LOCUS_15480 gene csm2 1308 1775 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296332.1 protein_id gnl|my_center|LOCUS_15480 1789 2193 gene locus_tag LOCUS_15490 1789 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2201 3916 gene locus_tag LOCUS_15500 2201 3916 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_15500 5162 4020 gene locus_tag LOCUS_15510 5162 4020 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_15510 6940 5678 gene locus_tag LOCUS_15520 6940 5678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_15520 8296 7100 gene locus_tag LOCUS_15530 8296 7100 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_15530 8715 8329 gene locus_tag LOCUS_15540 8715 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8855 9613 gene locus_tag LOCUS_15550 8855 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 9778 10209 gene locus_tag LOCUS_15560 9778 10209 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_15560 10310 10648 gene locus_tag LOCUS_15570 10310 10648 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937339.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence119 845 597 gene locus_tag LOCUS_15580 845 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1960 965 gene locus_tag LOCUS_15590 1960 965 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_15590 2931 2188 gene locus_tag LOCUS_15600 2931 2188 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_15600 3208 5601 gene locus_tag LOCUS_15610 3208 5601 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065451001.1 protein_id gnl|my_center|LOCUS_15610 5733 6962 gene locus_tag LOCUS_15620 5733 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963254.1 protein_id gnl|my_center|LOCUS_15620 7123 8538 gene locus_tag LOCUS_15630 7123 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8677 9624 gene locus_tag LOCUS_15640 8677 9624 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_15640 9638 10411 gene locus_tag LOCUS_15650 9638 10411 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence120 <1 1377 gene locus_tag LOCUS_15660 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243849.1:assimilatory sulfite reductase (NADPH) hemoprotein subunit 1374 2327 gene locus_tag LOCUS_15670 gene cysD 1374 2327 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 protein_id gnl|my_center|LOCUS_15670 2362 3324 gene locus_tag LOCUS_15680 2362 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3328 3984 gene locus_tag LOCUS_15690 gene rpe 3328 3984 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_15690 5647 4289 gene locus_tag LOCUS_15700 gene mgtE 5647 4289 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_15700 6226 5687 gene locus_tag LOCUS_15710 6226 5687 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_15710 6990 6415 gene locus_tag LOCUS_15720 6990 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 7988 6984 gene locus_tag LOCUS_15730 7988 6984 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_15730 8137 9468 gene locus_tag LOCUS_15740 8137 9468 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_15740 9519 10133 gene locus_tag LOCUS_15750 9519 10133 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence121 1000 1437 gene locus_tag LOCUS_15760 1000 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3156 1504 gene locus_tag LOCUS_15770 3156 1504 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_15770 3545 3339 gene locus_tag LOCUS_15780 3545 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15780 4138 3605 gene locus_tag LOCUS_15790 4138 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5056 4685 gene locus_tag LOCUS_15800 5056 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 5771 7060 gene locus_tag LOCUS_15810 5771 7060 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118828814.1 protein_id gnl|my_center|LOCUS_15810 7076 7648 gene locus_tag LOCUS_15820 7076 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7681 7962 gene locus_tag LOCUS_15830 7681 7962 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_15830 7971 8972 gene locus_tag LOCUS_15840 gene egtD 7971 8972 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_15840 <10583 9243 gene locus_tag LOCUS_15850 <10583 9243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048692340.1:ATP-binding protein >Feature sequence122 1217 324 gene locus_tag LOCUS_15860 1217 324 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584059.1 protein_id gnl|my_center|LOCUS_15860 2296 1304 gene locus_tag LOCUS_15870 gene mltG 2296 1304 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_15870 2530 3327 gene locus_tag LOCUS_15880 2530 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3663 4223 gene locus_tag LOCUS_15890 3663 4223 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_15890 4294 5415 gene locus_tag LOCUS_15900 4294 5415 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_15900 5563 8883 gene locus_tag LOCUS_15910 5563 8883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 protein_id gnl|my_center|LOCUS_15910 8907 10286 gene locus_tag LOCUS_15920 8907 10286 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence123 2880 1261 gene locus_tag LOCUS_15930 2880 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3190 3864 gene locus_tag LOCUS_15940 3190 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_15940 3982 4737 gene locus_tag LOCUS_15950 3982 4737 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_15950 5093 7090 gene locus_tag LOCUS_15960 5093 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 7149 8858 gene locus_tag LOCUS_15970 7149 8858 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_15970 10057 9164 gene locus_tag LOCUS_15980 10057 9164 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence124 2429 1842 gene locus_tag LOCUS_15990 2429 1842 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_15990 4082 2469 gene locus_tag LOCUS_16000 4082 2469 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_16000 5376 4495 gene locus_tag LOCUS_16010 5376 4495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188441.1 protein_id gnl|my_center|LOCUS_16010 7165 5462 gene locus_tag LOCUS_16020 7165 5462 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_16020 7286 7639 gene locus_tag LOCUS_16030 7286 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_16030 7654 7965 gene locus_tag LOCUS_16040 7654 7965 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790425.1 protein_id gnl|my_center|LOCUS_16040 8211 9773 gene locus_tag LOCUS_16050 gene rny 8211 9773 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_16050 10267 10100 gene locus_tag LOCUS_16060 10267 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence125 3054 877 gene locus_tag LOCUS_16070 3054 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16070 5741 3681 gene locus_tag LOCUS_16080 5741 3681 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_16080 6084 6671 gene locus_tag LOCUS_16090 6084 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6864 7613 gene locus_tag LOCUS_16100 6864 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence126 3674 1929 gene locus_tag LOCUS_16110 3674 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5564 3687 gene locus_tag LOCUS_16120 5564 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5857 6741 gene locus_tag LOCUS_16130 gene dapA 5857 6741 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_16130 8542 6782 gene locus_tag LOCUS_16140 8542 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 9966 8599 gene locus_tag LOCUS_16150 9966 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence127 796 269 gene locus_tag LOCUS_16160 gene yjjX 796 269 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_16160 1050 1727 gene locus_tag LOCUS_16170 1050 1727 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_16170 1821 2798 gene locus_tag LOCUS_16180 1821 2798 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_16180 3519 4241 gene locus_tag LOCUS_16190 3519 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4304 4669 gene locus_tag LOCUS_16200 4304 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5000 5635 gene locus_tag LOCUS_16210 5000 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 5655 6197 gene locus_tag LOCUS_16220 5655 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6496 6864 gene locus_tag LOCUS_16230 6496 6864 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_16230 6923 8626 gene locus_tag LOCUS_16240 6923 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 8659 9273 gene locus_tag LOCUS_16250 8659 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence128 734 1930 gene locus_tag LOCUS_16260 734 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2064 1822 gene locus_tag LOCUS_16270 2064 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4028 2151 gene locus_tag LOCUS_16280 4028 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5045 4179 gene locus_tag LOCUS_16290 5045 4179 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_16290 5182 5751 gene locus_tag LOCUS_16300 gene gmk 5182 5751 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_16300 5883 6458 gene locus_tag LOCUS_16310 gene nadD 5883 6458 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_16310 6455 7177 gene locus_tag LOCUS_16320 6455 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16320 7343 7552 gene locus_tag LOCUS_16330 7343 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9002 7638 gene locus_tag LOCUS_16340 9002 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 9361 9777 gene locus_tag LOCUS_16350 9361 9777 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_16350 9842 10270 gene locus_tag LOCUS_16360 9842 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence129 187 1533 gene locus_tag LOCUS_16370 187 1533 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021323.1 protein_id gnl|my_center|LOCUS_16370 1571 2527 gene locus_tag LOCUS_16380 1571 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2897 4561 gene locus_tag LOCUS_16390 2897 4561 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_16390 5975 5592 gene locus_tag LOCUS_16400 gene rnpA 5975 5592 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_16400 6837 6088 gene locus_tag LOCUS_16410 6837 6088 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_16410 7874 6885 gene locus_tag LOCUS_16420 7874 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence130 263 1141 gene locus_tag LOCUS_16430 gene deoC 263 1141 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_16430 2070 1243 gene locus_tag LOCUS_16440 2070 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3741 2263 gene locus_tag LOCUS_16450 3741 2263 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_16450 4380 3793 gene locus_tag LOCUS_16460 4380 3793 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_16460 4512 5450 gene locus_tag LOCUS_16470 4512 5450 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_16470 6902 5514 gene locus_tag LOCUS_16480 6902 5514 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_16480 7104 8723 gene locus_tag LOCUS_16490 7104 8723 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730832.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence131 1327 74 gene locus_tag LOCUS_16500 1327 74 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_16500 4151 1479 gene locus_tag LOCUS_16510 4151 1479 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_16510 4388 7381 gene locus_tag LOCUS_16520 4388 7381 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_16520 7408 8844 gene locus_tag LOCUS_16530 7408 8844 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_16530 8918 9730 gene locus_tag LOCUS_16540 8918 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9844 10098 gene locus_tag LOCUS_16550 9844 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence132 838 2100 gene locus_tag LOCUS_16560 838 2100 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_16560 2264 3760 gene locus_tag LOCUS_16570 2264 3760 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_16570 4292 3831 gene locus_tag LOCUS_16580 4292 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142078.1 protein_id gnl|my_center|LOCUS_16580 4512 5150 gene locus_tag LOCUS_16590 4512 5150 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_16590 5761 5147 gene locus_tag LOCUS_16600 5761 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5789 6418 gene locus_tag LOCUS_16610 gene pyrE 5789 6418 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_16610 6421 7737 gene locus_tag LOCUS_16620 6421 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 8998 7769 gene locus_tag LOCUS_16630 8998 7769 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_16630 9988 9311 gene locus_tag LOCUS_16640 9988 9311 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence133 1888 1175 gene locus_tag LOCUS_16650 1888 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2028 5126 gene locus_tag LOCUS_16660 2028 5126 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_16660 5665 5297 gene locus_tag LOCUS_16670 5665 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6013 7974 gene locus_tag LOCUS_16680 6013 7974 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_16680 9755 8088 gene locus_tag LOCUS_16690 9755 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence134 1595 462 gene locus_tag LOCUS_16700 1595 462 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_16700 2985 1642 gene locus_tag LOCUS_16710 2985 1642 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_16710 3630 3019 gene locus_tag LOCUS_16720 3630 3019 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_16720 3797 4393 gene locus_tag LOCUS_16730 3797 4393 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_16730 4422 4808 gene locus_tag LOCUS_16740 4422 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16740 4887 5267 gene locus_tag LOCUS_16750 4887 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16750 5378 6613 gene locus_tag LOCUS_16760 5378 6613 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_16760 6718 9465 gene locus_tag LOCUS_16770 6718 9465 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_16770 9550 9999 gene locus_tag LOCUS_16780 9550 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence135 118 1095 gene locus_tag LOCUS_16790 118 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1758 2393 gene locus_tag LOCUS_16800 1758 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2411 2980 gene locus_tag LOCUS_16810 2411 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3231 4004 gene locus_tag LOCUS_16820 3231 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4030 6501 gene locus_tag LOCUS_16830 4030 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 7249 6785 gene locus_tag LOCUS_16840 7249 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 7418 7344 gene locus_tag LOCUS_t00200 7418 7344 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7560 9893 gene locus_tag LOCUS_16850 7560 9893 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence136 328 2391 gene locus_tag LOCUS_16860 328 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2788 2441 gene locus_tag LOCUS_16870 gene rplS 2788 2441 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_16870 3595 2933 gene locus_tag LOCUS_16880 3595 2933 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_16880 6164 3651 gene locus_tag LOCUS_16890 6164 3651 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_16890 6193 6402 gene locus_tag LOCUS_16900 6193 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 6389 7534 gene locus_tag LOCUS_16910 6389 7534 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_16910 7590 8624 gene locus_tag LOCUS_16920 7590 8624 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_16920 8626 9108 gene locus_tag LOCUS_16930 8626 9108 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence137 2405 525 gene locus_tag LOCUS_16940 2405 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3003 2473 gene locus_tag LOCUS_16950 3003 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5400 3100 gene locus_tag LOCUS_16960 5400 3100 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_16960 5637 6170 gene locus_tag LOCUS_16970 5637 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6283 8664 gene locus_tag LOCUS_16980 6283 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence138 51 1403 gene locus_tag LOCUS_16990 51 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1433 2347 gene locus_tag LOCUS_17000 1433 2347 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080087.1 protein_id gnl|my_center|LOCUS_17000 2372 2923 gene locus_tag LOCUS_17010 2372 2923 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 protein_id gnl|my_center|LOCUS_17010 2934 3518 gene locus_tag LOCUS_17020 2934 3518 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080084.1 protein_id gnl|my_center|LOCUS_17020 3515 4621 gene locus_tag LOCUS_17030 3515 4621 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146623.1 protein_id gnl|my_center|LOCUS_17030 4671 6452 gene locus_tag LOCUS_17040 4671 6452 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080080.1 protein_id gnl|my_center|LOCUS_17040 6792 7289 gene locus_tag LOCUS_17050 6792 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 8367 7321 gene locus_tag LOCUS_17060 8367 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 8983 8465 gene locus_tag LOCUS_17070 8983 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 9546 8986 gene locus_tag LOCUS_17080 9546 8986 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850560.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence139 1966 50 gene locus_tag LOCUS_17090 1966 50 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_17090 2527 2051 gene locus_tag LOCUS_17100 2527 2051 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555221.1 protein_id gnl|my_center|LOCUS_17100 3596 2646 gene locus_tag LOCUS_17110 3596 2646 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_17110 3847 3662 gene locus_tag LOCUS_17120 3847 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4693 3869 gene locus_tag LOCUS_17130 4693 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4827 5507 gene locus_tag LOCUS_17140 gene msrA 4827 5507 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962794.1 protein_id gnl|my_center|LOCUS_17140 5887 5639 gene locus_tag LOCUS_17150 5887 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6150 6803 gene locus_tag LOCUS_17160 6150 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6871 7248 gene locus_tag LOCUS_17170 6871 7248 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_17170 7366 7893 gene locus_tag LOCUS_17180 7366 7893 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_17180 9005 8067 gene locus_tag LOCUS_17190 9005 8067 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_17190 9168 9830 gene locus_tag LOCUS_17200 9168 9830 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence140 833 168 gene locus_tag LOCUS_17210 gene lipB 833 168 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_17210 1236 850 gene locus_tag LOCUS_17220 1236 850 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_17220 1442 1215 gene locus_tag LOCUS_17230 1442 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2362 1511 gene locus_tag LOCUS_17240 gene lipA 2362 1511 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679245.1 protein_id gnl|my_center|LOCUS_17240 2614 3897 gene locus_tag LOCUS_17250 2614 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4325 3909 gene locus_tag LOCUS_17260 gene aroQ 4325 3909 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_17260 4540 5490 gene locus_tag LOCUS_17270 gene xerD 4540 5490 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_17270 5580 7187 gene locus_tag LOCUS_17280 gene pckA 5580 7187 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964464.1 protein_id gnl|my_center|LOCUS_17280 7252 8211 gene locus_tag LOCUS_17290 7252 8211 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_17290 9852 8218 gene locus_tag LOCUS_17300 9852 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence141 643 1986 gene locus_tag LOCUS_17310 643 1986 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_17310 2213 2767 gene locus_tag LOCUS_17320 2213 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2963 3901 gene locus_tag LOCUS_17330 2963 3901 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_17330 5378 4092 gene locus_tag LOCUS_17340 5378 4092 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_17340 5572 6600 gene locus_tag LOCUS_17350 gene fbp 5572 6600 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence142 <1 504 gene locus_tag LOCUS_17360 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079937.1:ATP-binding protein 666 1004 gene locus_tag LOCUS_17370 666 1004 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_17370 1005 1298 gene locus_tag LOCUS_17380 1005 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1491 2309 gene locus_tag LOCUS_17390 1491 2309 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_17390 2306 2719 gene locus_tag LOCUS_17400 2306 2719 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_17400 2716 3165 gene locus_tag LOCUS_17410 2716 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3192 4133 gene locus_tag LOCUS_17420 3192 4133 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903868.1 protein_id gnl|my_center|LOCUS_17420 4201 4629 gene locus_tag LOCUS_17430 4201 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4626 5084 gene locus_tag LOCUS_17440 gene tsaA 4626 5084 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839871.1 protein_id gnl|my_center|LOCUS_17440 5450 7693 gene locus_tag LOCUS_17450 5450 7693 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_17450 7729 8262 gene locus_tag LOCUS_17460 7729 8262 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_17460 8286 9293 gene locus_tag LOCUS_17470 gene nrfD 8286 9293 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_17470 9314 9853 gene locus_tag LOCUS_17480 9314 9853 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence143 3991 1358 gene locus_tag LOCUS_17490 3991 1358 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_17490 4815 3988 gene locus_tag LOCUS_17500 4815 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5156 4956 gene locus_tag LOCUS_17510 5156 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5722 5366 gene locus_tag LOCUS_17520 5722 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5967 7928 gene locus_tag LOCUS_17530 gene tet 5967 7928 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_17530 <9939 7980 gene locus_tag LOCUS_17540 <9939 7980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766212.1:S46 family peptidase >Feature sequence144 448 4119 gene locus_tag LOCUS_17550 gene purL 448 4119 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_17550 5717 4206 gene locus_tag LOCUS_17560 gene nrfA 5717 4206 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_17560 6305 5724 gene locus_tag LOCUS_17570 gene nrfH 6305 5724 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201985.1 protein_id gnl|my_center|LOCUS_17570 7694 6387 gene locus_tag LOCUS_17580 7694 6387 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_17580 8009 9814 gene locus_tag LOCUS_17590 gene aor 8009 9814 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence145 1836 955 gene locus_tag LOCUS_17600 1836 955 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_17600 3058 2090 gene locus_tag LOCUS_17610 3058 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3267 3058 gene locus_tag LOCUS_17620 3267 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3891 3502 gene locus_tag LOCUS_17630 3891 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5228 3897 gene locus_tag LOCUS_17640 5228 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6802 5405 gene locus_tag LOCUS_17650 gene fumC 6802 5405 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_17650 7013 7378 gene locus_tag LOCUS_17660 7013 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 8329 7382 gene locus_tag LOCUS_17670 8329 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 9397 8384 gene locus_tag LOCUS_17680 gene xylF 9397 8384 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_17680 9738 9550 gene locus_tag LOCUS_17690 9738 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence146 2752 362 gene locus_tag LOCUS_17700 2752 362 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_17700 3349 2876 gene locus_tag LOCUS_17710 3349 2876 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_17710 3855 3397 gene locus_tag LOCUS_17720 3855 3397 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_17720 4778 3975 gene locus_tag LOCUS_17730 4778 3975 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_17730 5388 7295 gene locus_tag LOCUS_17740 5388 7295 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_17740 7308 8381 gene locus_tag LOCUS_17750 7308 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9232 8450 gene locus_tag LOCUS_17760 9232 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence147 1794 1576 gene locus_tag LOCUS_17770 1794 1576 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_17770 2419 1805 gene locus_tag LOCUS_17780 2419 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 3197 2505 gene locus_tag LOCUS_17790 3197 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3402 4640 gene locus_tag LOCUS_17800 3402 4640 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_17800 4663 5334 gene locus_tag LOCUS_17810 4663 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 5369 5683 gene locus_tag LOCUS_17820 5369 5683 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_17820 5759 6259 gene locus_tag LOCUS_17830 5759 6259 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_17830 6647 6360 gene locus_tag LOCUS_17840 6647 6360 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582457.1 protein_id gnl|my_center|LOCUS_17840 7283 6684 gene locus_tag LOCUS_17850 7283 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 8105 7455 gene locus_tag LOCUS_17860 8105 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 9025 8123 gene locus_tag LOCUS_17870 9025 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 9264 9755 gene locus_tag LOCUS_17880 9264 9755 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941381.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence148 1018 245 gene locus_tag LOCUS_17890 1018 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1625 1011 gene locus_tag LOCUS_17900 1625 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2976 1702 gene locus_tag LOCUS_17910 2976 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3847 2969 gene locus_tag LOCUS_17920 3847 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4636 3872 gene locus_tag LOCUS_17930 4636 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5738 4641 gene locus_tag LOCUS_17940 5738 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 7143 5935 gene locus_tag LOCUS_17950 7143 5935 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_17950 8051 7134 gene locus_tag LOCUS_17960 8051 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 9802 8432 gene locus_tag LOCUS_17970 9802 8432 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146491.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence149 500 787 gene locus_tag LOCUS_17980 500 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1951 824 gene locus_tag LOCUS_17990 gene nhaD 1951 824 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_17990 3732 2149 gene locus_tag LOCUS_18000 3732 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18000 6666 3754 gene locus_tag LOCUS_18010 6666 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 6785 7804 gene locus_tag LOCUS_18020 gene tsaD 6785 7804 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_18020 7840 8463 gene locus_tag LOCUS_18030 7840 8463 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_18030 <9741 8537 gene locus_tag LOCUS_18040 <9741 8537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964462.1:saccharopine dehydrogenase C-terminal domain-containing protein >Feature sequence150 <1 567 gene locus_tag LOCUS_18050 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969632.1:GTP-binding protein 641 916 gene locus_tag LOCUS_18060 gene yidD 641 916 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_18060 928 1950 gene locus_tag LOCUS_18070 928 1950 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029627571.1 protein_id gnl|my_center|LOCUS_18070 2046 3407 gene locus_tag LOCUS_18080 gene hisS 2046 3407 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_18080 5549 3402 gene locus_tag LOCUS_18090 5549 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 5903 6373 gene locus_tag LOCUS_18100 gene nuoE 5903 6373 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_18100 6393 7556 gene locus_tag LOCUS_18110 6393 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7597 9381 gene locus_tag LOCUS_18120 7597 9381 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence151 9 1379 gene locus_tag LOCUS_18130 9 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2435 1437 gene locus_tag LOCUS_18140 gene porQ 2435 1437 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_18140 3422 2484 gene locus_tag LOCUS_18150 3422 2484 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 protein_id gnl|my_center|LOCUS_18150 4584 3463 gene locus_tag LOCUS_18160 4584 3463 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_18160 6071 4629 gene locus_tag LOCUS_18170 6071 4629 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_18170 7244 6078 gene locus_tag LOCUS_18180 7244 6078 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_18180 8255 7797 gene locus_tag LOCUS_18190 8255 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 8316 9542 gene locus_tag LOCUS_18200 8316 9542 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence152 183 4127 gene locus_tag LOCUS_18210 183 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4249 5064 gene locus_tag LOCUS_18220 4249 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5125 6231 gene locus_tag LOCUS_18230 5125 6231 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_18230 6481 7635 gene locus_tag LOCUS_18240 6481 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 7728 8492 gene locus_tag LOCUS_18250 gene truA 7728 8492 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_18250 <9612 8939 gene locus_tag LOCUS_18260 <9612 8939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249945.1:ArsA family ATPase >Feature sequence153 2034 1237 gene locus_tag LOCUS_18270 2034 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2566 2177 gene locus_tag LOCUS_18280 2566 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5226 2836 gene locus_tag LOCUS_18290 gene nosZ 5226 2836 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_18290 7507 5276 gene locus_tag LOCUS_18300 gene nosZ 7507 5276 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_18300 7900 8283 gene locus_tag LOCUS_18310 7900 8283 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_18310 9566 8319 gene locus_tag LOCUS_18320 9566 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence154 <1 546 gene locus_tag LOCUS_18330 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761349.1:TolC family protein 671 3748 gene locus_tag LOCUS_18340 671 3748 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_18340 7188 4063 gene locus_tag LOCUS_18350 7188 4063 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_18350 8382 7531 gene locus_tag LOCUS_18360 8382 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence155 <1 2224 gene locus_tag LOCUS_18370 <1 2224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162445741.1:sensor histidine kinase 2282 2668 gene locus_tag LOCUS_18380 2282 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2749 4443 gene locus_tag LOCUS_18390 2749 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 6191 4440 gene locus_tag LOCUS_18400 6191 4440 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_18400 7155 6463 gene locus_tag LOCUS_18410 7155 6463 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_18410 <9339 7264 gene locus_tag LOCUS_18420 <9339 7264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765612.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence156 328 537 gene locus_tag LOCUS_18430 328 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 747 2873 gene locus_tag LOCUS_18440 747 2873 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_18440 3266 2955 gene locus_tag LOCUS_18450 3266 2955 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963031.1 protein_id gnl|my_center|LOCUS_18450 4142 3285 gene locus_tag LOCUS_18460 4142 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 4863 4165 gene locus_tag LOCUS_18470 4863 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6846 4951 gene locus_tag LOCUS_18480 6846 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6968 8800 gene locus_tag LOCUS_18490 6968 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence157 621 1304 gene locus_tag LOCUS_18500 621 1304 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_18500 4794 1504 gene locus_tag LOCUS_18510 gene secA 4794 1504 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_18510 5105 5983 gene locus_tag LOCUS_18520 5105 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6904 6758 gene locus_tag LOCUS_18530 6904 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence158 3500 1014 gene locus_tag LOCUS_18540 3500 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 7248 4222 gene locus_tag LOCUS_18550 7248 4222 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_18550 7687 7190 gene locus_tag LOCUS_18560 7687 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8454 7921 gene locus_tag LOCUS_18570 8454 7921 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_18570 8806 8492 gene locus_tag LOCUS_18580 8806 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence159 1280 405 gene locus_tag LOCUS_18590 1280 405 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_18590 2175 1345 gene locus_tag LOCUS_18600 2175 1345 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_18600 3213 2176 gene locus_tag LOCUS_18610 3213 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 3998 3231 gene locus_tag LOCUS_18620 3998 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4869 6074 gene locus_tag LOCUS_18630 4869 6074 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_18630 6561 7541 gene locus_tag LOCUS_18640 gene pfkA 6561 7541 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence160 1813 434 gene locus_tag LOCUS_18650 1813 434 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_18650 2334 4376 gene locus_tag LOCUS_18660 gene btuB 2334 4376 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099293.1 protein_id gnl|my_center|LOCUS_18660 4534 4782 gene locus_tag LOCUS_18670 4534 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4786 5094 gene locus_tag LOCUS_18680 4786 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5279 7366 gene locus_tag LOCUS_18690 5279 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence161 2858 408 gene locus_tag LOCUS_18700 gene leuS 2858 408 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_18700 3558 3085 gene locus_tag LOCUS_18710 3558 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3613 4854 gene locus_tag LOCUS_18720 3613 4854 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_18720 4967 7549 gene locus_tag LOCUS_18730 4967 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7682 7754 gene locus_tag LOCUS_t00210 7682 7754 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7800 8051 gene locus_tag LOCUS_18740 gene rpsT 7800 8051 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_18740 <9181 8146 gene locus_tag LOCUS_18750 <9181 8146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963059.1:ADP-forming succinate--CoA ligase subunit beta >Feature sequence162 148 414 gene locus_tag LOCUS_18760 148 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 618 1505 gene locus_tag LOCUS_18770 618 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2002 1520 gene locus_tag LOCUS_18780 2002 1520 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_18780 3895 2114 gene locus_tag LOCUS_18790 3895 2114 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_18790 5144 3972 gene locus_tag LOCUS_18800 5144 3972 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_18800 7603 5201 gene locus_tag LOCUS_18810 7603 5201 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_18810 8154 7687 gene locus_tag LOCUS_18820 8154 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8320 8748 gene locus_tag LOCUS_18830 8320 8748 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence163 557 907 gene locus_tag LOCUS_18840 557 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2834 1242 gene locus_tag LOCUS_18850 2834 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4899 2899 gene locus_tag LOCUS_18860 4899 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6960 5773 gene locus_tag LOCUS_18870 gene mnmA 6960 5773 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_18870 7483 6962 gene locus_tag LOCUS_18880 7483 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 7543 8415 gene locus_tag LOCUS_18890 7543 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence164 3479 1281 gene locus_tag LOCUS_18900 3479 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3627 5267 gene locus_tag LOCUS_18910 3627 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5331 5750 gene locus_tag LOCUS_18920 5331 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5752 6354 gene locus_tag LOCUS_18930 5752 6354 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_18930 6373 7299 gene locus_tag LOCUS_18940 6373 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7374 8282 gene locus_tag LOCUS_18950 gene pyrB 7374 8282 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_18950 8317 8781 gene locus_tag LOCUS_18960 gene pyrI 8317 8781 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence165 1645 140 gene locus_tag LOCUS_18970 1645 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 3765 2038 gene locus_tag LOCUS_18980 3765 2038 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_18980 4981 3767 gene locus_tag LOCUS_18990 4981 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 5449 5069 gene locus_tag LOCUS_19000 5449 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5858 5478 gene locus_tag LOCUS_19010 5858 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 7946 5979 gene locus_tag LOCUS_19020 7946 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 8045 8830 gene locus_tag LOCUS_19030 8045 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 8884 9042 gene locus_tag LOCUS_19040 8884 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence166 1747 1166 gene locus_tag LOCUS_19050 1747 1166 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_19050 2308 1790 gene locus_tag LOCUS_19060 2308 1790 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_19060 3691 2312 gene locus_tag LOCUS_19070 gene nrfD 3691 2312 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_19070 6718 3761 gene locus_tag LOCUS_19080 6718 3761 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_19080 7926 6781 gene locus_tag LOCUS_19090 7926 6781 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence167 742 2874 gene locus_tag LOCUS_19100 742 2874 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_19100 2974 3273 gene locus_tag LOCUS_19110 2974 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3255 3638 gene locus_tag LOCUS_19120 3255 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3664 4335 gene locus_tag LOCUS_19130 3664 4335 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_19130 4831 4349 gene locus_tag LOCUS_19140 gene cdd 4831 4349 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_19140 6003 5011 gene locus_tag LOCUS_19150 gene fmt 6003 5011 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109030.1 protein_id gnl|my_center|LOCUS_19150 6186 7259 gene locus_tag LOCUS_19160 6186 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 7886 7458 gene locus_tag LOCUS_19170 7886 7458 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence168 156 743 gene locus_tag LOCUS_19180 156 743 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_19180 1233 721 gene locus_tag LOCUS_19190 1233 721 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_19190 2265 1363 gene locus_tag LOCUS_19200 2265 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3447 2377 gene locus_tag LOCUS_19210 3447 2377 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19210 3708 3505 gene locus_tag LOCUS_19220 3708 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19220 4692 4036 gene locus_tag LOCUS_19230 gene fsa 4692 4036 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_19230 4948 5475 gene locus_tag LOCUS_19240 4948 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5869 6807 gene locus_tag LOCUS_19250 5869 6807 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_19250 <8890 6812 gene locus_tag LOCUS_19260 <8890 6812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072985.1:fatty acid oxidation complex subunit alpha FadJ >Feature sequence169 320 1147 gene locus_tag LOCUS_19270 320 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2414 1308 gene locus_tag LOCUS_19280 2414 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3062 2442 gene locus_tag LOCUS_19290 3062 2442 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_19290 5152 3095 gene locus_tag LOCUS_19300 5152 3095 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_19300 5884 5318 gene locus_tag LOCUS_19310 5884 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 6948 6169 gene locus_tag LOCUS_19320 6948 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8222 7176 gene locus_tag LOCUS_19330 gene selD 8222 7176 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011344950.1 protein_id gnl|my_center|LOCUS_19330 <8880 8235 gene locus_tag LOCUS_19340 <8880 8235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583089.1:cysteine desulfurase NifS >Feature sequence170 1340 627 gene locus_tag LOCUS_19350 1340 627 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_19350 1402 2067 gene locus_tag LOCUS_19360 1402 2067 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_19360 2115 3545 gene locus_tag LOCUS_19370 2115 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3567 4451 gene locus_tag LOCUS_19380 3567 4451 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_19380 4696 5601 gene locus_tag LOCUS_19390 4696 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5628 6335 gene locus_tag LOCUS_19400 5628 6335 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_19400 6352 7101 gene locus_tag LOCUS_19410 6352 7101 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence171 3881 582 gene locus_tag LOCUS_19420 3881 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4798 3881 gene locus_tag LOCUS_19430 4798 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 6097 5393 gene locus_tag LOCUS_19440 6097 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392177.1 protein_id gnl|my_center|LOCUS_19440 7539 6094 gene locus_tag LOCUS_19450 7539 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 8560 7541 gene locus_tag LOCUS_19460 8560 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8745 8560 gene locus_tag LOCUS_19470 8745 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence172 611 931 gene locus_tag LOCUS_19480 611 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 961 1326 gene locus_tag LOCUS_19490 961 1326 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938884.1 protein_id gnl|my_center|LOCUS_19490 1405 3438 gene locus_tag LOCUS_19500 1405 3438 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_19500 3447 3929 gene locus_tag LOCUS_19510 3447 3929 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_19510 4008 4436 gene locus_tag LOCUS_19520 4008 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4672 6747 gene locus_tag LOCUS_19530 4672 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 6753 8807 gene locus_tag LOCUS_19540 6753 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence173 1566 595 gene locus_tag LOCUS_19550 1566 595 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_19550 1728 5516 gene locus_tag LOCUS_19560 gene porU 1728 5516 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_19560 5700 6899 gene locus_tag LOCUS_19570 gene porV 5700 6899 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_19570 6900 7382 gene locus_tag LOCUS_19580 gene ispF 6900 7382 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_19580 7435 7797 gene locus_tag LOCUS_19590 7435 7797 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_19590 8348 7917 gene locus_tag LOCUS_19600 8348 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence174 2898 2185 gene locus_tag LOCUS_19610 2898 2185 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_19610 4095 2956 gene locus_tag LOCUS_19620 gene dnaJ 4095 2956 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_19620 4716 4294 gene locus_tag LOCUS_19630 4716 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19630 5011 4799 gene locus_tag LOCUS_19640 5011 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4908 6077 gene locus_tag LOCUS_19650 4908 6077 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839787.1 protein_id gnl|my_center|LOCUS_19650 7618 6293 gene locus_tag LOCUS_19660 7618 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence175 <1 1189 gene locus_tag LOCUS_19670 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206198.1:OmpA family protein 1269 2378 gene locus_tag LOCUS_19680 1269 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2380 3180 gene locus_tag LOCUS_19690 2380 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3353 4360 gene locus_tag LOCUS_19700 3353 4360 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_19700 5678 4614 gene locus_tag LOCUS_19710 5678 4614 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence176 607 533 gene locus_tag LOCUS_t00220 607 533 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 745 671 gene locus_tag LOCUS_t00230 745 671 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1363 827 gene locus_tag LOCUS_19720 1363 827 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_19720 2202 1360 gene locus_tag LOCUS_19730 2202 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3092 2463 gene locus_tag LOCUS_19740 3092 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_19740 3253 4680 gene locus_tag LOCUS_19750 3253 4680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_19750 4962 4675 gene locus_tag LOCUS_19760 4962 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 5641 5165 gene locus_tag LOCUS_19770 5641 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 6200 5652 gene locus_tag LOCUS_19780 6200 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 7722 6382 gene locus_tag LOCUS_19790 7722 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 8266 7706 gene locus_tag LOCUS_19800 8266 7706 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence177 2001 706 gene locus_tag LOCUS_19810 2001 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2605 2039 gene locus_tag LOCUS_19820 2605 2039 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19820 3506 2685 gene locus_tag LOCUS_19830 3506 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4131 3544 gene locus_tag LOCUS_19840 4131 3544 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_19840 4263 6803 gene locus_tag LOCUS_19850 4263 6803 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_19850 7250 7029 gene locus_tag LOCUS_19860 7250 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8542 7892 gene locus_tag LOCUS_19870 8542 7892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence178 <1 1509 gene locus_tag LOCUS_19880 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933164.1:apolipoprotein N-acyltransferase 2182 1523 gene locus_tag LOCUS_19890 2182 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2358 2786 gene locus_tag LOCUS_19900 2358 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2811 3062 gene locus_tag LOCUS_19910 2811 3062 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_19910 3064 3471 gene locus_tag LOCUS_19920 3064 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3475 4794 gene locus_tag LOCUS_19930 3475 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4865 5611 gene locus_tag LOCUS_19940 4865 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19940 5933 6796 gene locus_tag LOCUS_19950 5933 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6818 7102 gene locus_tag LOCUS_19960 6818 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7095 8144 gene locus_tag LOCUS_19970 7095 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence179 <1 2247 gene locus_tag LOCUS_19980 <1 2247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031134.1:oxidoreductase 3013 2543 gene locus_tag LOCUS_19990 3013 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3475 3047 gene locus_tag LOCUS_20000 3475 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3892 3479 gene locus_tag LOCUS_20010 3892 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 4738 3923 gene locus_tag LOCUS_20020 4738 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 5690 4845 gene locus_tag LOCUS_20030 5690 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 6901 5876 gene locus_tag LOCUS_20040 6901 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 8104 7184 gene locus_tag LOCUS_20050 8104 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence180 5544 4750 gene locus_tag LOCUS_20060 5544 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5676 6758 gene locus_tag LOCUS_20070 5676 6758 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_20070 7333 8004 gene locus_tag LOCUS_20080 7333 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence181 487 302 gene locus_tag LOCUS_20090 487 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1595 636 gene locus_tag LOCUS_20100 1595 636 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_20100 1764 2591 gene locus_tag LOCUS_20110 1764 2591 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_20110 2566 2835 gene locus_tag LOCUS_20120 2566 2835 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_20120 3955 2825 gene locus_tag LOCUS_20130 3955 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 8189 4737 gene locus_tag LOCUS_20140 8189 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence182 478 1311 gene locus_tag LOCUS_20150 478 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1441 2055 gene locus_tag LOCUS_20160 1441 2055 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_20160 2283 3311 gene locus_tag LOCUS_20170 gene galE 2283 3311 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_20170 3323 4741 gene locus_tag LOCUS_20180 3323 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5327 6454 gene locus_tag LOCUS_20190 5327 6454 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_20190 6742 7638 gene locus_tag LOCUS_20200 6742 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence183 1145 600 gene locus_tag LOCUS_20210 1145 600 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221956.1 protein_id gnl|my_center|LOCUS_20210 2020 1313 gene locus_tag LOCUS_20220 gene cybH 2020 1313 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 protein_id gnl|my_center|LOCUS_20220 3780 2038 gene locus_tag LOCUS_20230 3780 2038 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_20230 4918 3785 gene locus_tag LOCUS_20240 4918 3785 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880392.1 protein_id gnl|my_center|LOCUS_20240 5232 5573 gene locus_tag LOCUS_20250 5232 5573 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675609.1 protein_id gnl|my_center|LOCUS_20250 5608 6426 gene locus_tag LOCUS_20260 gene hypB 5608 6426 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence184 2164 635 gene locus_tag LOCUS_20270 gene guaA 2164 635 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_20270 3433 2501 gene locus_tag LOCUS_20280 3433 2501 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_20280 3830 3459 gene locus_tag LOCUS_20290 3830 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 5812 3896 gene locus_tag LOCUS_20300 gene rpsA 5812 3896 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_20300 6458 7477 gene locus_tag LOCUS_20310 6458 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence185 3678 616 gene locus_tag LOCUS_20320 3678 616 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_20320 4779 3697 gene locus_tag LOCUS_20330 4779 3697 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107390.1 protein_id gnl|my_center|LOCUS_20330 5107 5763 gene locus_tag LOCUS_20340 5107 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence186 2 325 gene locus_tag LOCUS_20350 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 339 1061 gene locus_tag LOCUS_20360 339 1061 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_20360 1069 1689 gene locus_tag LOCUS_20370 1069 1689 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_20370 1701 2321 gene locus_tag LOCUS_20380 gene nqrE 1701 2321 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_20380 2340 3596 gene locus_tag LOCUS_20390 gene nqrF 2340 3596 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_20390 3690 4691 gene locus_tag LOCUS_20400 3690 4691 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence187 951 91 gene locus_tag LOCUS_20410 951 91 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_20410 1558 2406 gene locus_tag LOCUS_20420 1558 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2543 3739 gene locus_tag LOCUS_20430 2543 3739 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_20430 3732 4685 gene locus_tag LOCUS_20440 3732 4685 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_20440 6365 4890 gene locus_tag LOCUS_20450 6365 4890 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269092.1 protein_id gnl|my_center|LOCUS_20450 7683 6583 gene locus_tag LOCUS_20460 7683 6583 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence188 1902 1480 gene locus_tag LOCUS_20470 1902 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2794 1940 gene locus_tag LOCUS_20480 2794 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3232 3819 gene locus_tag LOCUS_20490 3232 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3806 4450 gene locus_tag LOCUS_20500 3806 4450 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_20500 6806 4491 gene locus_tag LOCUS_20510 6806 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 7645 7118 gene locus_tag LOCUS_20520 7645 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence189 2653 332 gene locus_tag LOCUS_20530 2653 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4985 2925 gene locus_tag LOCUS_20540 4985 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6032 5157 gene locus_tag LOCUS_20550 6032 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 6830 6420 gene locus_tag LOCUS_20560 6830 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7664 6906 gene locus_tag LOCUS_20570 7664 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence190 2668 257 gene locus_tag LOCUS_20580 2668 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2957 3607 gene locus_tag LOCUS_20590 2957 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3612 4793 gene locus_tag LOCUS_20600 3612 4793 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 protein_id gnl|my_center|LOCUS_20600 4799 5272 gene locus_tag LOCUS_20610 4799 5272 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_20610 5293 6468 gene locus_tag LOCUS_20620 5293 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence191 231 1094 gene locus_tag LOCUS_20630 231 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1109 1528 gene locus_tag LOCUS_20640 1109 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1698 3815 gene locus_tag LOCUS_20650 1698 3815 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_20650 4124 5839 gene locus_tag LOCUS_20660 4124 5839 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_20660 7416 5920 gene locus_tag LOCUS_20670 7416 5920 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_20670 <8112 7510 gene locus_tag LOCUS_20680 <8112 7510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795828.1:PepSY-associated TM helix domain-containing protein >Feature sequence192 <1 790 gene locus_tag LOCUS_20690 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009938929.1:glycosyltransferase family 4 protein 787 1995 gene locus_tag LOCUS_20700 787 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2151 2564 gene locus_tag LOCUS_20710 2151 2564 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_20710 2840 4084 gene locus_tag LOCUS_20720 2840 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4086 5135 gene locus_tag LOCUS_20730 4086 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5233 6366 gene locus_tag LOCUS_20740 5233 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6363 6758 gene locus_tag LOCUS_20750 6363 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 6958 7203 gene locus_tag LOCUS_20760 6958 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 <8112 7348 gene locus_tag LOCUS_20770 <8112 7348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038509176.1:ATP-binding protein >Feature sequence193 1139 15 gene locus_tag LOCUS_20780 1139 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4192 1244 gene locus_tag LOCUS_20790 4192 1244 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_20790 5050 4283 gene locus_tag LOCUS_20800 gene yaaA 5050 4283 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_20800 5299 5078 gene locus_tag LOCUS_20810 5299 5078 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915104.1 protein_id gnl|my_center|LOCUS_20810 6331 5522 gene locus_tag LOCUS_20820 6331 5522 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence194 353 1525 gene locus_tag LOCUS_20830 353 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1925 3115 gene locus_tag LOCUS_20840 gene kbl 1925 3115 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_20840 4040 3165 gene locus_tag LOCUS_20850 4040 3165 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_20850 4779 5390 gene locus_tag LOCUS_20860 4779 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 5421 5765 gene locus_tag LOCUS_20870 gene arsC 5421 5765 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194454.1 protein_id gnl|my_center|LOCUS_20870 7395 5839 gene locus_tag LOCUS_20880 7395 5839 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_20880 7595 7999 gene locus_tag LOCUS_20890 7595 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence195 2567 558 gene locus_tag LOCUS_20900 2567 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 6800 2958 gene locus_tag LOCUS_20910 6800 2958 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence196 <1 970 gene locus_tag LOCUS_20920 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048692340.1:ATP-binding protein note possible pseudo, frameshifted 1158 2585 gene locus_tag LOCUS_20930 1158 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2813 3892 gene locus_tag LOCUS_20940 2813 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4853 3942 gene locus_tag LOCUS_20950 4853 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 6624 5011 gene locus_tag LOCUS_20960 6624 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 7894 6731 gene locus_tag LOCUS_20970 7894 6731 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764542.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence197 <1 752 gene locus_tag LOCUS_20980 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788185.1:peptide MFS transporter 949 3207 gene locus_tag LOCUS_20990 949 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3884 3294 gene locus_tag LOCUS_21000 3884 3294 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_21000 5182 4253 gene locus_tag LOCUS_21010 5182 4253 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_21010 6457 5462 gene locus_tag LOCUS_21020 6457 5462 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_21020 7475 6447 gene locus_tag LOCUS_21030 7475 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence198 <1 872 gene locus_tag LOCUS_21040 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964430.1:hydroxymethylglutaryl-CoA reductase, degradative 926 1834 gene locus_tag LOCUS_21050 926 1834 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143470457.1 protein_id gnl|my_center|LOCUS_21050 1844 2911 gene locus_tag LOCUS_21060 gene mvaD 1844 2911 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_21060 3051 3983 gene locus_tag LOCUS_21070 3051 3983 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_21070 4189 5346 gene locus_tag LOCUS_21080 4189 5346 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_21080 7019 5445 gene locus_tag LOCUS_21090 7019 5445 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_21090 7736 7095 gene locus_tag LOCUS_21100 7736 7095 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230605.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence199 1320 469 gene locus_tag LOCUS_21110 1320 469 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_21110 1671 2066 gene locus_tag LOCUS_21120 1671 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2050 3555 gene locus_tag LOCUS_21130 2050 3555 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_21130 3818 5098 gene locus_tag LOCUS_21140 3818 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 5621 5127 gene locus_tag LOCUS_21150 5621 5127 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_21150 6528 5668 gene locus_tag LOCUS_21160 6528 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 7415 6600 gene locus_tag LOCUS_21170 gene panB 7415 6600 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence200 550 26 gene locus_tag LOCUS_21180 550 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 665 522 gene locus_tag LOCUS_21190 665 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 800 1438 gene locus_tag LOCUS_21200 800 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1444 2508 gene locus_tag LOCUS_21210 1444 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2584 3210 gene locus_tag LOCUS_21220 gene yihA 2584 3210 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_21220 3263 4195 gene locus_tag LOCUS_21230 3263 4195 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_21230 4306 4914 gene locus_tag LOCUS_21240 4306 4914 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_21240 4946 5587 gene locus_tag LOCUS_21250 gene pth 4946 5587 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_21250 5739 6116 gene locus_tag LOCUS_21260 5739 6116 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_21260 6209 6757 gene locus_tag LOCUS_21270 6209 6757 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_21270 7766 6762 gene locus_tag LOCUS_21280 7766 6762 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence201 863 2113 gene locus_tag LOCUS_21290 863 2113 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 protein_id gnl|my_center|LOCUS_21290 2274 2534 gene locus_tag LOCUS_21300 2274 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2531 2974 gene locus_tag LOCUS_21310 2531 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2975 3736 gene locus_tag LOCUS_21320 2975 3736 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_21320 4885 3779 gene locus_tag LOCUS_21330 4885 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5321 6568 gene locus_tag LOCUS_21340 5321 6568 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_21340 6568 7146 gene locus_tag LOCUS_21350 6568 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence202 1721 2608 gene locus_tag LOCUS_21360 1721 2608 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_21360 2595 3101 gene locus_tag LOCUS_21370 2595 3101 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_21370 3094 3687 gene locus_tag LOCUS_21380 3094 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3928 4575 gene locus_tag LOCUS_21390 3928 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6602 4908 gene locus_tag LOCUS_21400 6602 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 protein_id gnl|my_center|LOCUS_21400 6759 7184 gene locus_tag LOCUS_21410 6759 7184 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence203 267 1079 gene locus_tag LOCUS_21420 gene napH 267 1079 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_21420 1096 1692 gene locus_tag LOCUS_21430 1096 1692 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_21430 1897 2811 gene locus_tag LOCUS_21440 1897 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2818 3171 gene locus_tag LOCUS_21450 2818 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3267 3746 gene locus_tag LOCUS_21460 3267 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 4279 4887 gene locus_tag LOCUS_21470 4279 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4894 5940 gene locus_tag LOCUS_21480 4894 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 6592 6104 gene locus_tag LOCUS_21490 gene ribH 6592 6104 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_21490 7421 6696 gene locus_tag LOCUS_21500 7421 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence204 <1 2800 gene locus_tag LOCUS_21510 <1 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143960588.1:methylmalonyl-CoA mutase family protein 3130 2840 gene locus_tag LOCUS_21520 3130 2840 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082906.1 protein_id gnl|my_center|LOCUS_21520 3925 3179 gene locus_tag LOCUS_21530 3925 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4609 3956 gene locus_tag LOCUS_21540 4609 3956 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_21540 4868 4944 gene locus_tag LOCUS_t00240 4868 4944 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5685 5089 gene locus_tag LOCUS_21550 5685 5089 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765529.1 protein_id gnl|my_center|LOCUS_21550 5878 7533 gene locus_tag LOCUS_21560 gene recN 5878 7533 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence205 1077 253 gene locus_tag LOCUS_21570 1077 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1798 1373 gene locus_tag LOCUS_21580 1798 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2367 1957 gene locus_tag LOCUS_21590 2367 1957 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_21590 5045 2421 gene locus_tag LOCUS_21600 5045 2421 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_21600 6983 5142 gene locus_tag LOCUS_21610 6983 5142 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence206 136 1098 gene locus_tag LOCUS_21620 136 1098 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21620 1434 2312 gene locus_tag LOCUS_21630 1434 2312 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_21630 2954 5998 gene locus_tag LOCUS_21640 2954 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 6003 6329 gene locus_tag LOCUS_21650 6003 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence207 2034 1501 gene locus_tag LOCUS_21660 2034 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2666 2307 gene locus_tag LOCUS_21670 2666 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 3381 2698 gene locus_tag LOCUS_21680 3381 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3853 3386 gene locus_tag LOCUS_21690 3853 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4483 3917 gene locus_tag LOCUS_21700 4483 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 5004 4516 gene locus_tag LOCUS_21710 5004 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 5569 6708 gene locus_tag LOCUS_21720 5569 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 6712 7095 gene locus_tag LOCUS_21730 6712 7095 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence208 1594 677 gene locus_tag LOCUS_21740 1594 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2315 1704 gene locus_tag LOCUS_21750 2315 1704 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_21750 2486 3760 gene locus_tag LOCUS_21760 2486 3760 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582859.1 protein_id gnl|my_center|LOCUS_21760 3770 4444 gene locus_tag LOCUS_21770 gene rsmI 3770 4444 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_21770 4520 5395 gene locus_tag LOCUS_21780 4520 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence209 1625 1221 gene locus_tag LOCUS_21790 1625 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2954 1644 gene locus_tag LOCUS_21800 2954 1644 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943954.1 protein_id gnl|my_center|LOCUS_21800 5110 3029 gene locus_tag LOCUS_21810 5110 3029 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943953.1 protein_id gnl|my_center|LOCUS_21810 5847 5185 gene locus_tag LOCUS_21820 5847 5185 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_21820 5942 6919 gene locus_tag LOCUS_21830 5942 6919 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence210 1617 532 gene locus_tag LOCUS_21840 1617 532 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_21840 1692 2726 gene locus_tag LOCUS_21850 1692 2726 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_21850 2738 3742 gene locus_tag LOCUS_21860 2738 3742 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_21860 3778 4533 gene locus_tag LOCUS_21870 3778 4533 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_21870 6086 4530 gene locus_tag LOCUS_21880 6086 4530 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_21880 6833 6123 gene locus_tag LOCUS_21890 6833 6123 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence211 <1 1270 gene locus_tag LOCUS_21900 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272539.1:cell wall-binding repeat-containing protein 1637 1302 gene locus_tag LOCUS_21910 1637 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3462 1651 gene locus_tag LOCUS_21920 3462 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 4076 3597 gene locus_tag LOCUS_21930 4076 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 4607 4083 gene locus_tag LOCUS_21940 4607 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4905 5951 gene locus_tag LOCUS_21950 4905 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6010 6405 gene locus_tag LOCUS_21960 6010 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence212 1425 1177 gene locus_tag LOCUS_21970 1425 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1703 1500 gene locus_tag LOCUS_21980 1703 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3135 1714 gene locus_tag LOCUS_21990 3135 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3799 3125 gene locus_tag LOCUS_22000 3799 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3957 5543 gene locus_tag LOCUS_22010 3957 5543 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_22010 5826 6677 gene locus_tag LOCUS_22020 5826 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 7009 6680 gene locus_tag LOCUS_22030 7009 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence213 745 2406 gene locus_tag LOCUS_22040 745 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22040 2416 4239 gene locus_tag LOCUS_22050 2416 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22050 4886 4281 gene locus_tag LOCUS_22060 4886 4281 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_22060 5140 6519 gene locus_tag LOCUS_22070 5140 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6509 7126 gene locus_tag LOCUS_22080 6509 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence214 1813 5121 gene locus_tag LOCUS_22090 1813 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_22090 6791 5355 gene locus_tag LOCUS_22100 6791 5355 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_22100 7057 6788 gene locus_tag LOCUS_22110 7057 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence215 460 1464 gene locus_tag LOCUS_22120 460 1464 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_22120 1864 3549 gene locus_tag LOCUS_22130 1864 3549 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_22130 3583 5055 gene locus_tag LOCUS_22140 3583 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 5138 6511 gene locus_tag LOCUS_22150 5138 6511 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence216 1121 690 gene locus_tag LOCUS_22160 1121 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22160 1370 1215 gene locus_tag LOCUS_22170 1370 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2916 1522 gene locus_tag LOCUS_22180 2916 1522 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_22180 3822 2968 gene locus_tag LOCUS_22190 3822 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 5011 3884 gene locus_tag LOCUS_22200 5011 3884 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926821.1 protein_id gnl|my_center|LOCUS_22200 5209 5868 gene locus_tag LOCUS_22210 5209 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 6338 5997 gene locus_tag LOCUS_22220 6338 5997 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_22220 <7291 6496 gene locus_tag LOCUS_22230 <7291 6496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962696.1:ABC transporter ATP-binding protein >Feature sequence217 <1 977 gene locus_tag LOCUS_22240 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799138.1:S8 family serine peptidase 996 2168 gene locus_tag LOCUS_22250 gene xseA 996 2168 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_22250 2211 2369 gene locus_tag LOCUS_22260 2211 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2543 2905 gene locus_tag LOCUS_22270 2543 2905 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_22270 4423 2912 gene locus_tag LOCUS_22280 4423 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4868 4590 gene locus_tag LOCUS_22290 4868 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249944.1 protein_id gnl|my_center|LOCUS_22290 5244 4879 gene locus_tag LOCUS_22300 5244 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 5682 5248 gene locus_tag LOCUS_22310 5682 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6137 5685 gene locus_tag LOCUS_22320 6137 5685 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_22320 6614 6219 gene locus_tag LOCUS_22330 6614 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence218 1906 644 gene locus_tag LOCUS_22340 1906 644 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_22340 4412 1860 gene locus_tag LOCUS_22350 4412 1860 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_22350 4812 4420 gene locus_tag LOCUS_22360 4812 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5288 4812 gene locus_tag LOCUS_22370 5288 4812 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_22370 6652 5297 gene locus_tag LOCUS_22380 6652 5297 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_22380 <7241 6681 gene locus_tag LOCUS_22390 <7241 6681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762243.1:CDP-alcohol phosphatidyltransferase family protein >Feature sequence219 837 289 gene locus_tag LOCUS_22400 837 289 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_22400 938 1774 gene locus_tag LOCUS_22410 938 1774 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_22410 2093 1917 gene locus_tag LOCUS_22420 2093 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2245 2709 gene locus_tag LOCUS_22430 2245 2709 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_22430 2982 4970 gene locus_tag LOCUS_22440 2982 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5010 5591 gene locus_tag LOCUS_22450 5010 5591 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_22450 6217 5594 gene locus_tag LOCUS_22460 6217 5594 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence220 <1 661 gene locus_tag LOCUS_22470 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766373.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB 3104 711 gene locus_tag LOCUS_22480 3104 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3716 3207 gene locus_tag LOCUS_22490 3716 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4466 3765 gene locus_tag LOCUS_22500 4466 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4816 5232 gene locus_tag LOCUS_22510 4816 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5411 6205 gene locus_tag LOCUS_22520 5411 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 6202 6513 gene locus_tag LOCUS_22530 6202 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence221 1923 238 gene locus_tag LOCUS_22540 1923 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2023 3318 gene locus_tag LOCUS_22550 2023 3318 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_22550 3486 5084 gene locus_tag LOCUS_22560 3486 5084 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence222 1609 737 gene locus_tag LOCUS_22570 1609 737 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_22570 2703 1765 gene locus_tag LOCUS_22580 2703 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3393 2764 gene locus_tag LOCUS_22590 3393 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5632 3569 gene locus_tag LOCUS_22600 gene ftsH 5632 3569 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_22600 6161 5787 gene locus_tag LOCUS_22610 gene rsfS 6161 5787 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_22610 6350 7078 gene locus_tag LOCUS_22620 6350 7078 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence223 3905 3087 gene locus_tag LOCUS_22630 3905 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6740 4065 gene locus_tag LOCUS_22640 6740 4065 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence224 4819 2498 gene locus_tag LOCUS_22650 4819 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 6534 4984 gene locus_tag LOCUS_22660 6534 4984 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681001.1 protein_id gnl|my_center|LOCUS_22660 <7189 6660 gene locus_tag LOCUS_22670 <7189 6660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681003.1:FAD-binding oxidoreductase >Feature sequence225 1363 194 gene locus_tag LOCUS_22680 1363 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1611 2627 gene locus_tag LOCUS_22690 1611 2627 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_22690 2631 5774 gene locus_tag LOCUS_22700 2631 5774 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence226 1578 466 gene locus_tag LOCUS_22710 1578 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2318 1581 gene locus_tag LOCUS_22720 2318 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2320 2547 gene locus_tag LOCUS_22730 2320 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3805 2567 gene locus_tag LOCUS_22740 gene wlbE 3805 2567 CDS product O-antigen biosynthesis protein WlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925721.1 protein_id gnl|my_center|LOCUS_22740 5095 3806 gene locus_tag LOCUS_22750 5095 3806 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768493.1 protein_id gnl|my_center|LOCUS_22750 5997 5116 gene locus_tag LOCUS_22760 5997 5116 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015764.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence227 168 95 gene locus_tag LOCUS_t00250 168 95 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3170 255 gene locus_tag LOCUS_22770 3170 255 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_22770 3305 3829 gene locus_tag LOCUS_22780 3305 3829 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790192.1 protein_id gnl|my_center|LOCUS_22780 3832 4497 gene locus_tag LOCUS_22790 3832 4497 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901989.1 protein_id gnl|my_center|LOCUS_22790 5536 4502 gene locus_tag LOCUS_22800 gene holA 5536 4502 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_22800 5645 6385 gene locus_tag LOCUS_22810 5645 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6363 6692 gene locus_tag LOCUS_22820 6363 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 6757 6969 gene locus_tag LOCUS_22830 6757 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence228 656 1222 gene locus_tag LOCUS_22840 656 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1252 2220 gene locus_tag LOCUS_22850 1252 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2238 4055 gene locus_tag LOCUS_22860 2238 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4066 5247 gene locus_tag LOCUS_22870 4066 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5295 6059 gene locus_tag LOCUS_22880 5295 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021095.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence229 667 125 gene locus_tag LOCUS_22890 667 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 848 1606 gene locus_tag LOCUS_22900 848 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1741 1668 gene locus_tag LOCUS_t00260 1741 1668 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2751 1873 gene locus_tag LOCUS_22910 gene gldN 2751 1873 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_22910 4382 2832 gene locus_tag LOCUS_22920 gene gldM 4382 2832 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_22920 5317 4424 gene locus_tag LOCUS_22930 5317 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6843 5404 gene locus_tag LOCUS_22940 gene gldK 6843 5404 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence230 1687 359 gene locus_tag LOCUS_22950 1687 359 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555764.1 protein_id gnl|my_center|LOCUS_22950 2997 1735 gene locus_tag LOCUS_22960 2997 1735 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250773.1 protein_id gnl|my_center|LOCUS_22960 3741 3553 gene locus_tag LOCUS_22970 3741 3553 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314720.1 protein_id gnl|my_center|LOCUS_22970 4212 5006 gene locus_tag LOCUS_22980 4212 5006 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203682.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence231 1164 1382 gene locus_tag LOCUS_22990 1164 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1435 1593 gene locus_tag LOCUS_23000 1435 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1623 1784 gene locus_tag LOCUS_23010 1623 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1787 1936 gene locus_tag LOCUS_23020 1787 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2079 2297 gene locus_tag LOCUS_23030 2079 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2367 2552 gene locus_tag LOCUS_23040 2367 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3730 2711 gene locus_tag LOCUS_23050 3730 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 4065 3751 gene locus_tag LOCUS_23060 4065 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23060 4900 6330 gene locus_tag LOCUS_23070 gene rlmD 4900 6330 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_23070 <7112 6534 gene locus_tag LOCUS_23080 <7112 6534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108532.1:acetate--CoA ligase >Feature sequence232 2955 1558 gene locus_tag LOCUS_23090 gene xdhA 2955 1558 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 protein_id gnl|my_center|LOCUS_23090 3273 4028 gene locus_tag LOCUS_23100 3273 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4030 4569 gene locus_tag LOCUS_23110 4030 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4800 6716 gene locus_tag LOCUS_23120 4800 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence233 1169 981 gene locus_tag LOCUS_23130 1169 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1422 1072 gene locus_tag LOCUS_23140 gene rplS 1422 1072 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_23140 2539 1820 gene locus_tag LOCUS_23150 gene trmD 2539 1820 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_23150 4044 2593 gene locus_tag LOCUS_23160 4044 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4798 4109 gene locus_tag LOCUS_23170 gene radC 4798 4109 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_23170 <7061 5071 gene locus_tag LOCUS_23180 <7061 5071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963539.1:cytochrome c biogenesis protein CcsA >Feature sequence234 <1 1704 gene locus_tag LOCUS_23190 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor 1846 2805 gene locus_tag LOCUS_23200 1846 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2812 3414 gene locus_tag LOCUS_23210 2812 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 3424 4002 gene locus_tag LOCUS_23220 3424 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 6311 4014 gene locus_tag LOCUS_23230 6311 4014 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943956.1 protein_id gnl|my_center|LOCUS_23230 <7058 6518 gene locus_tag LOCUS_23240 <7058 6518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943955.1:SpoVR family protein >Feature sequence235 791 93 gene locus_tag LOCUS_23250 791 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1543 1112 gene locus_tag LOCUS_23260 1543 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2414 1560 gene locus_tag LOCUS_23270 2414 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3666 2482 gene locus_tag LOCUS_23280 3666 2482 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_23280 4388 3681 gene locus_tag LOCUS_23290 4388 3681 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_23290 4847 4575 gene locus_tag LOCUS_23300 4847 4575 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_23300 6965 5301 gene locus_tag LOCUS_23310 6965 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence236 <1 1149 gene locus_tag LOCUS_23320 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531371.1:OmpA family protein 1386 2123 gene locus_tag LOCUS_23330 1386 2123 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_23330 2142 3389 gene locus_tag LOCUS_23340 2142 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3402 3620 gene locus_tag LOCUS_23350 3402 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4480 3698 gene locus_tag LOCUS_23360 4480 3698 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_23360 4803 5849 gene locus_tag LOCUS_23370 4803 5849 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_23370 5855 6373 gene locus_tag LOCUS_23380 5855 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23380 6404 6919 gene locus_tag LOCUS_23390 6404 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23390 >Feature sequence237 1449 271 gene locus_tag LOCUS_23400 1449 271 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_23400 2812 1811 gene locus_tag LOCUS_23410 2812 1811 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 protein_id gnl|my_center|LOCUS_23410 4029 3073 gene locus_tag LOCUS_23420 gene arcC 4029 3073 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_23420 5766 4300 gene locus_tag LOCUS_23430 5766 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6311 5763 gene locus_tag LOCUS_23440 6311 5763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_23440 6551 6975 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcaattccaaaatggtacgattaaaag >Feature sequence238 1397 981 gene locus_tag LOCUS_23450 1397 981 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_23450 1738 1400 gene locus_tag LOCUS_23460 1738 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3299 1740 gene locus_tag LOCUS_23470 3299 1740 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_23470 3742 3341 gene locus_tag LOCUS_23480 gene mce 3742 3341 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_23480 3907 4833 gene locus_tag LOCUS_23490 3907 4833 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_23490 4912 5580 gene locus_tag LOCUS_23500 4912 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence239 <1 1911 gene locus_tag LOCUS_23510 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173072481.1:ATP-binding cassette domain-containing protein 2299 1913 gene locus_tag LOCUS_23520 2299 1913 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_23520 2872 2318 gene locus_tag LOCUS_23530 2872 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4242 3055 gene locus_tag LOCUS_23540 4242 3055 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_23540 5041 4514 gene locus_tag LOCUS_23550 5041 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5630 5034 gene locus_tag LOCUS_23560 gene pnuC 5630 5034 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_23560 <6962 5644 gene locus_tag LOCUS_23570 <6962 5644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797168.1:S41 family peptidase >Feature sequence240 1 540 gene locus_tag LOCUS_23580 1 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 787 987 gene locus_tag LOCUS_23590 787 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1425 2060 gene locus_tag LOCUS_23600 1425 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4867 2063 gene locus_tag LOCUS_23610 4867 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 5082 5585 gene locus_tag LOCUS_23620 5082 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 6172 5756 gene locus_tag LOCUS_23630 6172 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence241 464 24 gene locus_tag LOCUS_23640 464 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1811 468 gene locus_tag LOCUS_23650 1811 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2775 1783 gene locus_tag LOCUS_23660 gene lpxK 2775 1783 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_23660 4632 2848 gene locus_tag LOCUS_23670 gene sppA 4632 2848 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_23670 5683 4739 gene locus_tag LOCUS_23680 5683 4739 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence242 2245 248 gene locus_tag LOCUS_23690 2245 248 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_23690 3940 2450 gene locus_tag LOCUS_23700 gene hutH 3940 2450 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838340.1 protein_id gnl|my_center|LOCUS_23700 4074 4952 gene locus_tag LOCUS_23710 4074 4952 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_23710 5288 6349 gene locus_tag LOCUS_23720 5288 6349 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence243 <1 1760 gene locus_tag LOCUS_23730 <1 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760913.1:RelA/SpoT family protein 1964 3031 gene locus_tag LOCUS_23740 1964 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4362 3118 gene locus_tag LOCUS_23750 4362 3118 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_23750 4776 4417 gene locus_tag LOCUS_23760 4776 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 6017 4770 gene locus_tag LOCUS_23770 6017 4770 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence244 491 685 gene locus_tag LOCUS_23780 491 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 720 2873 gene locus_tag LOCUS_23790 gene ccoN 720 2873 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_23790 3095 3751 gene locus_tag LOCUS_23800 3095 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3821 4405 gene locus_tag LOCUS_23810 3821 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5787 4420 gene locus_tag LOCUS_23820 5787 4420 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_23820 <6903 5905 gene locus_tag LOCUS_23830 <6903 5905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795080.1:putative porin >Feature sequence245 1554 367 gene locus_tag LOCUS_23840 1554 367 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_23840 2261 1554 gene locus_tag LOCUS_23850 2261 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3264 2416 gene locus_tag LOCUS_23860 3264 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4282 3302 gene locus_tag LOCUS_23870 4282 3302 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_23870 4409 5593 gene locus_tag LOCUS_23880 4409 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 5624 6394 gene locus_tag LOCUS_23890 5624 6394 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence246 <1 1812 gene locus_tag LOCUS_23900 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 2280 1870 gene locus_tag LOCUS_23910 2280 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3428 2295 gene locus_tag LOCUS_23920 3428 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3777 4448 gene locus_tag LOCUS_23930 gene fldA 3777 4448 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_23930 4620 5441 gene locus_tag LOCUS_23940 gene zupT 4620 5441 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176713.1 protein_id gnl|my_center|LOCUS_23940 5518 6144 gene locus_tag LOCUS_23950 5518 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence247 1136 252 gene locus_tag LOCUS_23960 1136 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1689 1174 gene locus_tag LOCUS_23970 1689 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1931 1719 gene locus_tag LOCUS_23980 1931 1719 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_23980 2212 2688 gene locus_tag LOCUS_23990 2212 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 5838 2767 gene locus_tag LOCUS_24000 5838 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 <6886 6036 gene locus_tag LOCUS_24010 <6886 6036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942953.1:mechanosensitive ion channel >Feature sequence248 4376 153 gene locus_tag LOCUS_24020 4376 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4563 4982 gene locus_tag LOCUS_24030 4563 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 6381 5002 gene locus_tag LOCUS_24040 6381 5002 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence249 189 467 gene locus_tag LOCUS_24050 189 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 614 781 gene locus_tag LOCUS_24060 614 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1323 982 gene locus_tag LOCUS_24070 1323 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2141 1320 gene locus_tag LOCUS_24080 2141 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4228 3221 gene locus_tag LOCUS_24090 gene rfbB 4228 3221 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_24090 4648 4457 gene locus_tag LOCUS_24100 4648 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 5994 4630 gene locus_tag LOCUS_24110 5994 4630 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_24110 6322 6071 gene locus_tag LOCUS_24120 6322 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 <6855 6222 gene locus_tag LOCUS_24130 <6855 6222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038019.1:GH92 family glycosyl hydrolase >Feature sequence250 <1 601 gene locus_tag LOCUS_24140 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583708.1:DegT/DnrJ/EryC1/StrS family aminotransferase 1257 823 gene locus_tag LOCUS_24150 1257 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2544 1336 gene locus_tag LOCUS_24160 2544 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 5342 2736 gene locus_tag LOCUS_24170 5342 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 5901 5368 gene locus_tag LOCUS_24180 5901 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6129 6719 gene locus_tag LOCUS_24190 6129 6719 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence251 1864 1586 gene locus_tag LOCUS_24200 1864 1586 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_24200 2518 2186 gene locus_tag LOCUS_24210 gene secG 2518 2186 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_24210 4571 2535 gene locus_tag LOCUS_24220 4571 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5100 4582 gene locus_tag LOCUS_24230 5100 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 6380 5160 gene locus_tag LOCUS_24240 6380 5160 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence252 138 638 gene locus_tag LOCUS_24250 138 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 795 577 gene locus_tag LOCUS_24260 795 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1229 2290 gene locus_tag LOCUS_24270 1229 2290 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_24270 2436 2843 gene locus_tag LOCUS_24280 2436 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24280 2904 4976 gene locus_tag LOCUS_24290 gene xdh 2904 4976 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869184.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24290 6112 5063 gene locus_tag LOCUS_24300 gene queA 6112 5063 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762821.1 protein_id gnl|my_center|LOCUS_24300 <6741 6227 gene locus_tag LOCUS_24310 <6741 6227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783635.1:tRNA pseudouridine(55) synthase TruB >Feature sequence253 71 2185 gene locus_tag LOCUS_24320 gene ppdK 71 2185 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_24320 2705 2929 gene locus_tag LOCUS_24330 2705 2929 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915104.1 protein_id gnl|my_center|LOCUS_24330 2941 3141 gene locus_tag LOCUS_24340 2941 3141 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 protein_id gnl|my_center|LOCUS_24340 3190 3999 gene locus_tag LOCUS_24350 3190 3999 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_24350 4425 3988 gene locus_tag LOCUS_24360 4425 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4885 4520 gene locus_tag LOCUS_24370 4885 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 5313 5089 gene locus_tag LOCUS_24380 5313 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 6097 5420 gene locus_tag LOCUS_24390 6097 5420 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_24390 6737 6549 gene locus_tag LOCUS_24400 6737 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence254 2027 1038 gene locus_tag LOCUS_24410 gene dusB 2027 1038 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_24410 2601 2359 gene locus_tag LOCUS_24420 2601 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4137 2626 gene locus_tag LOCUS_24430 gene atpD 4137 2626 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_24430 4359 5867 gene locus_tag LOCUS_24440 4359 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 6004 6390 gene locus_tag LOCUS_24450 6004 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence255 547 1956 gene locus_tag LOCUS_24460 547 1956 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence256 1275 361 gene locus_tag LOCUS_24470 gene gldA 1275 361 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_24470 1345 3264 gene locus_tag LOCUS_24480 1345 3264 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_24480 3605 4396 gene locus_tag LOCUS_24490 3605 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5036 4401 gene locus_tag LOCUS_24500 5036 4401 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_24500 6232 5048 gene locus_tag LOCUS_24510 gene mqnC 6232 5048 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence257 412 744 gene locus_tag LOCUS_24520 412 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1793 696 gene locus_tag LOCUS_24530 1793 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3277 1796 gene locus_tag LOCUS_24540 3277 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 3844 3380 gene locus_tag LOCUS_24550 gene coaD 3844 3380 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_24550 5365 4025 gene locus_tag LOCUS_24560 gene gdhA 5365 4025 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_24560 <6610 5616 gene locus_tag LOCUS_24570 <6610 5616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962445.1:NADP-specific glutamate dehydrogenase >Feature sequence258 1087 176 gene locus_tag LOCUS_24580 1087 176 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_24580 2544 1240 gene locus_tag LOCUS_24590 gene tyrS 2544 1240 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_24590 3791 2676 gene locus_tag LOCUS_24600 3791 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4736 4098 gene locus_tag LOCUS_24610 4736 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 6328 4994 gene locus_tag LOCUS_24620 gene nhaA 6328 4994 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence259 1994 1089 gene locus_tag LOCUS_24630 gene cysD 1994 1089 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_24630 2748 2014 gene locus_tag LOCUS_24640 2748 2014 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_24640 3852 2764 gene locus_tag LOCUS_24650 3852 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 4129 4656 gene locus_tag LOCUS_24660 4129 4656 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_24660 5683 4805 gene locus_tag LOCUS_24670 5683 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 <6554 5753 gene locus_tag LOCUS_24680 <6554 5753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765463.1:DUF4974 domain-containing protein >Feature sequence260 639 316 gene locus_tag LOCUS_24690 639 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 741 5156 gene locus_tag LOCUS_24700 741 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5249 6334 gene locus_tag LOCUS_24710 5249 6334 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence261 1263 229 gene locus_tag LOCUS_24720 1263 229 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_24720 2100 1348 gene locus_tag LOCUS_24730 2100 1348 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_24730 3398 2124 gene locus_tag LOCUS_24740 3398 2124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_24740 3781 3404 gene locus_tag LOCUS_24750 3781 3404 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_24750 6000 3796 gene locus_tag LOCUS_24760 6000 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence262 <1 554 gene locus_tag LOCUS_24770 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202272.1:AbgT family transporter 1502 825 gene locus_tag LOCUS_24780 1502 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4015 1565 gene locus_tag LOCUS_24790 4015 1565 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_24790 5352 4639 gene locus_tag LOCUS_24800 5352 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 6207 5440 gene locus_tag LOCUS_24810 6207 5440 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_24810 6312 6396 gene locus_tag LOCUS_t00270 6312 6396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence263 572 805 gene locus_tag LOCUS_24820 572 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 816 1103 gene locus_tag LOCUS_24830 816 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_24830 1239 3218 gene locus_tag LOCUS_24840 1239 3218 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_24840 4626 3229 gene locus_tag LOCUS_24850 4626 3229 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_24850 4697 4936 gene locus_tag LOCUS_24860 4697 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5521 5258 gene locus_tag LOCUS_24870 5521 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5599 5874 gene locus_tag LOCUS_24880 5599 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence264 2696 1278 gene locus_tag LOCUS_24890 2696 1278 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_24890 4725 2776 gene locus_tag LOCUS_24900 4725 2776 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_24900 5338 4931 gene locus_tag LOCUS_24910 5338 4931 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_24910 5382 6416 gene locus_tag LOCUS_24920 5382 6416 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence265 1354 1067 gene locus_tag LOCUS_24930 1354 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2638 1358 gene locus_tag LOCUS_24940 2638 1358 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_24940 2766 3128 gene locus_tag LOCUS_24950 2766 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3224 3430 gene locus_tag LOCUS_24960 3224 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3858 4835 gene locus_tag LOCUS_24970 3858 4835 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_24970 4916 6100 gene locus_tag LOCUS_24980 4916 6100 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence266 2560 275 gene locus_tag LOCUS_24990 2560 275 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_24990 3228 2725 gene locus_tag LOCUS_25000 3228 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4014 3280 gene locus_tag LOCUS_25010 4014 3280 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_25010 4465 4025 gene locus_tag LOCUS_25020 4465 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 5910 4507 gene locus_tag LOCUS_25030 gene ccoG 5910 4507 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence267 497 237 gene locus_tag LOCUS_25040 497 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 910 590 gene locus_tag LOCUS_25050 910 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25050 2173 914 gene locus_tag LOCUS_25060 2173 914 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048213.1 protein_id gnl|my_center|LOCUS_25060 2504 2160 gene locus_tag LOCUS_25070 2504 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 4265 3222 gene locus_tag LOCUS_25080 4265 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 5529 4348 gene locus_tag LOCUS_25090 5529 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 <6323 5782 gene locus_tag LOCUS_25100 <6323 5782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695098.1:TonB-dependent receptor >Feature sequence268 215 586 gene locus_tag LOCUS_25110 215 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 944 1747 gene locus_tag LOCUS_25120 944 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1947 3086 gene locus_tag LOCUS_25130 1947 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4623 3193 gene locus_tag LOCUS_25140 gene dnaA 4623 3193 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_25140 5950 5153 gene locus_tag LOCUS_25150 5950 5153 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence269 2620 2126 gene locus_tag LOCUS_25160 2620 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2736 3152 gene locus_tag LOCUS_25170 2736 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3719 3174 gene locus_tag LOCUS_25180 3719 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3821 5065 gene locus_tag LOCUS_25190 3821 5065 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_25190 5181 5330 gene locus_tag LOCUS_25200 5181 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 <6283 5333 gene locus_tag LOCUS_25210 <6283 5333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461701.1:low specificity L-threonine aldolase >Feature sequence270 3554 1224 gene locus_tag LOCUS_25220 3554 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4049 3645 gene locus_tag LOCUS_25230 4049 3645 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_25230 4313 4086 gene locus_tag LOCUS_25240 4313 4086 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_25240 4802 4320 gene locus_tag LOCUS_25250 4802 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 5615 4815 gene locus_tag LOCUS_25260 gene moeB 5615 4815 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_25260 <6263 5618 gene locus_tag LOCUS_25270 <6263 5618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202226.1:PLP-dependent transferase >Feature sequence271 1501 182 gene locus_tag LOCUS_25280 1501 182 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_25280 1910 2125 gene locus_tag LOCUS_25290 1910 2125 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_25290 2151 3707 gene locus_tag LOCUS_25300 2151 3707 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786918.1 protein_id gnl|my_center|LOCUS_25300 3723 4904 gene locus_tag LOCUS_25310 3723 4904 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_25310 5913 5209 gene locus_tag LOCUS_25320 5913 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence272 1534 626 gene locus_tag LOCUS_25330 1534 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2392 1562 gene locus_tag LOCUS_25340 2392 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2978 2460 gene locus_tag LOCUS_25350 2978 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3851 2982 gene locus_tag LOCUS_25360 3851 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 4786 3899 gene locus_tag LOCUS_25370 4786 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 5659 4844 gene locus_tag LOCUS_25380 gene napG 5659 4844 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091295.1 protein_id gnl|my_center|LOCUS_25380 6090 5755 gene locus_tag LOCUS_25390 6090 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence273 219 147 gene locus_tag LOCUS_t00280 219 147 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1767 337 gene locus_tag LOCUS_25400 1767 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2985 1822 gene locus_tag LOCUS_25410 2985 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3273 5612 gene locus_tag LOCUS_25420 3273 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence274 2208 988 gene locus_tag LOCUS_25430 2208 988 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_25430 3341 2205 gene locus_tag LOCUS_25440 gene wecB 3341 2205 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 protein_id gnl|my_center|LOCUS_25440 4472 3354 gene locus_tag LOCUS_25450 4472 3354 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_25450 5502 4489 gene locus_tag LOCUS_25460 5502 4489 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817159.1 protein_id gnl|my_center|LOCUS_25460 <6166 5504 gene locus_tag LOCUS_25470 <6166 5504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331373.1:glycosyltransferase >Feature sequence275 871 80 gene locus_tag LOCUS_25480 871 80 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_25480 1190 942 gene locus_tag LOCUS_25490 1190 942 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_25490 2117 1224 gene locus_tag LOCUS_25500 2117 1224 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_25500 3034 2177 gene locus_tag LOCUS_25510 3034 2177 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_25510 3981 3289 gene locus_tag LOCUS_25520 3981 3289 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_25520 4390 3989 gene locus_tag LOCUS_25530 4390 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 5790 4579 gene locus_tag LOCUS_25540 5790 4579 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence276 25 492 gene locus_tag LOCUS_25550 25 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 702 1787 gene locus_tag LOCUS_25560 702 1787 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_25560 1803 2462 gene locus_tag LOCUS_25570 1803 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25570 2459 3127 gene locus_tag LOCUS_25580 2459 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3387 3764 gene locus_tag LOCUS_25590 3387 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence277 <1 1937 gene locus_tag LOCUS_25600 <1 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765723.1:NAD-dependent DNA ligase LigA 2085 3542 gene locus_tag LOCUS_25610 2085 3542 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250519.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence278 1247 681 gene locus_tag LOCUS_25620 1247 681 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687254.1 protein_id gnl|my_center|LOCUS_25620 1395 4661 gene locus_tag LOCUS_25630 1395 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_25630 5023 4730 gene locus_tag LOCUS_25640 5023 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence279 1144 203 gene locus_tag LOCUS_25650 1144 203 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_25650 1283 3676 gene locus_tag LOCUS_25660 1283 3676 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_25660 4486 4653 gene locus_tag LOCUS_25670 4486 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 5017 4862 gene locus_tag LOCUS_25680 5017 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence280 718 2094 gene locus_tag LOCUS_25690 718 2094 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_25690 2804 3385 gene locus_tag LOCUS_25700 2804 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 3667 4887 gene locus_tag LOCUS_25710 3667 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence281 1377 331 gene locus_tag LOCUS_25720 1377 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2895 1510 gene locus_tag LOCUS_25730 2895 1510 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_25730 4615 2975 gene locus_tag LOCUS_25740 4615 2975 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_25740 4894 4637 gene locus_tag LOCUS_25750 4894 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 5222 5085 gene locus_tag LOCUS_25760 5222 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5906 5346 gene locus_tag LOCUS_25770 5906 5346 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence282 2852 2652 gene locus_tag LOCUS_25780 2852 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3069 2800 gene locus_tag LOCUS_25790 3069 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3408 3193 gene locus_tag LOCUS_25800 3408 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3454 4071 gene locus_tag LOCUS_25810 3454 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4766 5125 gene locus_tag LOCUS_25820 4766 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence283 1506 646 gene locus_tag LOCUS_25830 1506 646 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_25830 3100 1670 gene locus_tag LOCUS_25840 3100 1670 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_25840 3209 3769 gene locus_tag LOCUS_25850 3209 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25850 3851 3991 gene locus_tag LOCUS_25860 3851 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 <6015 4126 gene locus_tag LOCUS_25870 <6015 4126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962399.1:patatin-like phospholipase family protein >Feature sequence284 1996 836 gene locus_tag LOCUS_25880 1996 836 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_25880 4684 2171 gene locus_tag LOCUS_25890 gene topA 4684 2171 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence285 <1 1365 gene locus_tag LOCUS_25900 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864601.1:FtsW/RodA/SpoVE family cell cycle protein 3338 1749 gene locus_tag LOCUS_25910 3338 1749 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_25910 3552 5528 gene locus_tag LOCUS_25920 3552 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 5557 5949 gene locus_tag LOCUS_25930 5557 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence286 1523 312 gene locus_tag LOCUS_25940 1523 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2598 1528 gene locus_tag LOCUS_25950 2598 1528 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_25950 2945 3733 gene locus_tag LOCUS_25960 gene pssA 2945 3733 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_25960 4726 3797 gene locus_tag LOCUS_25970 4726 3797 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763494.1 protein_id gnl|my_center|LOCUS_25970 4893 5783 gene locus_tag LOCUS_25980 4893 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25980 >Feature sequence287 936 3215 gene locus_tag LOCUS_25990 gene extM 936 3215 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_25990 3344 3925 gene locus_tag LOCUS_26000 3344 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4203 5879 gene locus_tag LOCUS_26010 4203 5879 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence288 2581 542 gene locus_tag LOCUS_26020 2581 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 4377 2770 gene locus_tag LOCUS_26030 4377 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 4802 4494 gene locus_tag LOCUS_26040 4802 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26040 <5939 4830 gene locus_tag LOCUS_26050 <5939 4830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767524.1:RagB/SusD family nutrient uptake outer membrane protein note possible pseudo, internal stop codon >Feature sequence289 <1 500 gene locus_tag LOCUS_26060 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761244.1:RnfABCDGE type electron transport complex subunit D 493 1068 gene locus_tag LOCUS_26070 493 1068 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_26070 1092 1676 gene locus_tag LOCUS_26080 1092 1676 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_26080 1687 2259 gene locus_tag LOCUS_26090 gene rsxA 1687 2259 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_26090 3060 2470 gene locus_tag LOCUS_26100 3060 2470 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_26100 5202 3232 gene locus_tag LOCUS_26110 5202 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence290 2046 697 gene locus_tag LOCUS_26120 2046 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3771 2461 gene locus_tag LOCUS_26130 gene dacB 3771 2461 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_26130 4807 3842 gene locus_tag LOCUS_26140 4807 3842 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence291 892 101 gene locus_tag LOCUS_26150 892 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3244 992 gene locus_tag LOCUS_26160 3244 992 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_26160 3375 3908 gene locus_tag LOCUS_26170 3375 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 <5854 3987 gene locus_tag LOCUS_26180 <5854 3987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279149.1:M13 family metallopeptidase >Feature sequence292 1571 2392 gene locus_tag LOCUS_26190 1571 2392 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_26190 2414 3304 gene locus_tag LOCUS_26200 2414 3304 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_26200 3381 4022 gene locus_tag LOCUS_26210 3381 4022 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_26210 5174 3999 gene locus_tag LOCUS_26220 5174 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 5796 5176 gene locus_tag LOCUS_26230 5796 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence293 <1 1760 gene locus_tag LOCUS_26240 <1 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071149.1:PAS domain S-box protein 1975 3093 gene locus_tag LOCUS_26250 1975 3093 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_26250 4051 3356 gene locus_tag LOCUS_26260 4051 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 4915 4133 gene locus_tag LOCUS_26270 4915 4133 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451066.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence294 3477 715 gene locus_tag LOCUS_26280 3477 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4573 3812 gene locus_tag LOCUS_26290 4573 3812 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_26290 <5802 4605 gene locus_tag LOCUS_26300 <5802 4605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025814212.1:BatD family protein >Feature sequence295 <1 868 gene locus_tag LOCUS_26310 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783735.1:TIGR00341 family protein 3029 1221 gene locus_tag LOCUS_26320 gene uvrC 3029 1221 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_26320 4808 3177 gene locus_tag LOCUS_26330 gene ade 4808 3177 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022289.1 protein_id gnl|my_center|LOCUS_26330 <5799 4955 gene locus_tag LOCUS_26340 <5799 4955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783704.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence296 1093 338 gene locus_tag LOCUS_26350 1093 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1227 2141 gene locus_tag LOCUS_26360 1227 2141 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_26360 3363 2131 gene locus_tag LOCUS_26370 3363 2131 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence297 1886 225 gene locus_tag LOCUS_26380 1886 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3207 2161 gene locus_tag LOCUS_26390 3207 2161 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_26390 4640 3486 gene locus_tag LOCUS_26400 4640 3486 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence298 81 8 gene locus_tag LOCUS_t00290 81 8 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1780 239 gene locus_tag LOCUS_26410 1780 239 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000248.1 protein_id gnl|my_center|LOCUS_26410 3353 2007 gene locus_tag LOCUS_26420 3353 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 5443 3365 gene locus_tag LOCUS_26430 5443 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence299 623 72 gene locus_tag LOCUS_26440 623 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26440 2442 949 gene locus_tag LOCUS_26450 2442 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3376 2432 gene locus_tag LOCUS_26460 gene phnD 3376 2432 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_26460 3557 5314 gene locus_tag LOCUS_26470 gene aspS 3557 5314 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_26470 5314 5655 gene locus_tag LOCUS_26480 5314 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence300 7 432 gene locus_tag LOCUS_26490 7 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 451 3153 gene locus_tag LOCUS_26500 451 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3535 3158 gene locus_tag LOCUS_26510 3535 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26510 5104 3584 gene locus_tag LOCUS_26520 5104 3584 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26520 >Feature sequence301 1532 162 gene locus_tag LOCUS_26530 gene mnmE 1532 162 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_26530 1985 2857 gene locus_tag LOCUS_26540 gene sucD 1985 2857 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_26540 3315 3010 gene locus_tag LOCUS_26550 3315 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 4679 3438 gene locus_tag LOCUS_26560 4679 3438 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_26560 <5680 4639 gene locus_tag LOCUS_26570 <5680 4639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289301.1:glycosyltransferase family 2 protein >Feature sequence302 272 847 gene locus_tag LOCUS_26580 272 847 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 protein_id gnl|my_center|LOCUS_26580 1016 1591 gene locus_tag LOCUS_26590 1016 1591 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_26590 1643 3946 gene locus_tag LOCUS_26600 1643 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 4178 4528 gene locus_tag LOCUS_26610 4178 4528 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_26610 4665 5441 gene locus_tag LOCUS_26620 4665 5441 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence303 588 310 gene locus_tag LOCUS_26630 588 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1699 740 gene locus_tag LOCUS_26640 1699 740 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_26640 2662 1721 gene locus_tag LOCUS_26650 2662 1721 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_26650 2841 3608 gene locus_tag LOCUS_26660 gene rsmA 2841 3608 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_26660 4183 3786 gene locus_tag LOCUS_tm00010 4183 3786 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence304 1415 567 gene locus_tag LOCUS_26670 1415 567 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_26670 1953 1474 gene locus_tag LOCUS_26680 gene tsaA 1953 1474 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_26680 3875 2022 gene locus_tag LOCUS_26690 3875 2022 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_26690 4418 4026 gene locus_tag LOCUS_26700 4418 4026 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_26700 <5613 4462 gene locus_tag LOCUS_26710 <5613 4462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250265.1:ATP-binding protein >Feature sequence305 1627 566 gene locus_tag LOCUS_26720 1627 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2075 1863 gene locus_tag LOCUS_26730 2075 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2238 3698 gene locus_tag LOCUS_26740 2238 3698 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_26740 <5589 3775 gene locus_tag LOCUS_26750 <5589 3775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002079042.1:response regulator >Feature sequence306 879 1460 gene locus_tag LOCUS_26760 879 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2101 3033 gene locus_tag LOCUS_26770 2101 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4406 3039 gene locus_tag LOCUS_26780 4406 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 5110 4403 gene locus_tag LOCUS_26790 5110 4403 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence307 3107 1908 gene locus_tag LOCUS_26800 3107 1908 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_26800 3378 4346 gene locus_tag LOCUS_26810 gene aroB 3378 4346 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_26810 4441 5430 gene locus_tag LOCUS_26820 gene rfaD 4441 5430 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence308 173 2068 gene locus_tag LOCUS_26830 173 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3406 2771 gene locus_tag LOCUS_26840 3406 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4736 3705 gene locus_tag LOCUS_26850 4736 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence309 860 186 gene locus_tag LOCUS_26860 860 186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_26860 2228 924 gene locus_tag LOCUS_26870 gene mtaB 2228 924 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_26870 3208 2309 gene locus_tag LOCUS_26880 3208 2309 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_26880 4846 3518 gene locus_tag LOCUS_26890 4846 3518 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_26890 4942 5412 gene locus_tag LOCUS_26900 4942 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence310 1716 97 gene locus_tag LOCUS_26910 1716 97 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 protein_id gnl|my_center|LOCUS_26910 2025 5213 gene locus_tag LOCUS_26920 2025 5213 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107757.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence311 <1 2759 gene locus_tag LOCUS_26930 <1 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203753.1:leucine--tRNA ligase 2963 5362 gene locus_tag LOCUS_26940 2963 5362 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence312 175 1257 gene locus_tag LOCUS_26950 175 1257 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_26950 1529 3259 gene locus_tag LOCUS_26960 1529 3259 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786603.1 protein_id gnl|my_center|LOCUS_26960 4613 3321 gene locus_tag LOCUS_26970 4613 3321 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_26970 5243 4698 gene locus_tag LOCUS_26980 5243 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence313 62 1060 gene locus_tag LOCUS_26990 62 1060 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_26990 2606 1212 gene locus_tag LOCUS_27000 2606 1212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_27000 2905 3900 gene locus_tag LOCUS_27010 2905 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3893 4504 gene locus_tag LOCUS_27020 gene coaE 3893 4504 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_27020 4528 5232 gene locus_tag LOCUS_27030 4528 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence314 398 234 gene locus_tag LOCUS_27040 398 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 871 2190 gene locus_tag LOCUS_27050 871 2190 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_27050 2372 3238 gene locus_tag LOCUS_27060 2372 3238 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074724765.1 protein_id gnl|my_center|LOCUS_27060 3497 3985 gene locus_tag LOCUS_27070 3497 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence315 1158 94 gene locus_tag LOCUS_27080 1158 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1716 1162 gene locus_tag LOCUS_27090 gene speG 1716 1162 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723772.1 protein_id gnl|my_center|LOCUS_27090 2875 1727 gene locus_tag LOCUS_27100 2875 1727 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_27100 3846 2872 gene locus_tag LOCUS_27110 3846 2872 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_27110 4894 3899 gene locus_tag LOCUS_27120 gene legB 4894 3899 CDS product 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786732.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence316 1623 1883 gene locus_tag LOCUS_27130 1623 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1909 2055 gene locus_tag LOCUS_27140 1909 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2102 2482 gene locus_tag LOCUS_27150 2102 2482 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_27150 2779 3975 gene locus_tag LOCUS_27160 2779 3975 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence317 <1 927 gene locus_tag LOCUS_27170 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225090007.1:fused MFS/spermidine synthase 1510 1034 gene locus_tag LOCUS_27180 gene ssb 1510 1034 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_27180 1961 1539 gene locus_tag LOCUS_27190 1961 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_27190 3436 2120 gene locus_tag LOCUS_27200 gene thrC 3436 2120 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_27200 4295 3453 gene locus_tag LOCUS_27210 gene cysQ 4295 3453 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813481.1 protein_id gnl|my_center|LOCUS_27210 4985 4311 gene locus_tag LOCUS_27220 4985 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence318 235 1026 gene locus_tag LOCUS_27230 235 1026 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_27230 1157 1651 gene locus_tag LOCUS_27240 gene dfrA 1157 1651 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_27240 1818 2642 gene locus_tag LOCUS_27250 1818 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3204 2677 gene locus_tag LOCUS_27260 3204 2677 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_27260 3824 3204 gene locus_tag LOCUS_27270 3824 3204 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_27270 <5339 3900 gene locus_tag LOCUS_27280 <5339 3900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403246.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence319 <5337 2940 gene locus_tag LOCUS_27290 <5337 2940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence320 255 464 gene locus_tag LOCUS_27300 255 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 743 2689 gene locus_tag LOCUS_27310 743 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27310 2686 2940 gene locus_tag LOCUS_27320 2686 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2882 3073 gene locus_tag LOCUS_27330 2882 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3401 3096 gene locus_tag LOCUS_27340 3401 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4875 3526 gene locus_tag LOCUS_27350 4875 3526 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361992.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence321 351 1013 gene locus_tag LOCUS_27360 351 1013 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_27360 1343 1071 gene locus_tag LOCUS_27370 1343 1071 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_27370 3273 1471 gene locus_tag LOCUS_27380 gene typA 3273 1471 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_27380 3755 4297 gene locus_tag LOCUS_27390 3755 4297 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_27390 4303 4695 gene locus_tag LOCUS_27400 4303 4695 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_27400 4702 5247 gene locus_tag LOCUS_27410 4702 5247 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence322 528 1982 gene locus_tag LOCUS_27420 528 1982 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 protein_id gnl|my_center|LOCUS_27420 1975 2736 gene locus_tag LOCUS_27430 1975 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2742 3086 gene locus_tag LOCUS_27440 2742 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3079 3807 gene locus_tag LOCUS_27450 3079 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3939 4448 gene locus_tag LOCUS_27460 3939 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4452 4907 gene locus_tag LOCUS_27470 4452 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence323 <1 2014 gene locus_tag LOCUS_27480 <1 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094146567.1:histidine kinase 2536 4152 gene locus_tag LOCUS_27490 2536 4152 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556306.1 protein_id gnl|my_center|LOCUS_27490 4167 4337 gene locus_tag LOCUS_27500 4167 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 4337 4561 gene locus_tag LOCUS_27510 4337 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 4605 4955 gene locus_tag LOCUS_27520 4605 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence324 2293 968 gene locus_tag LOCUS_27530 2293 968 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_27530 2712 2365 gene locus_tag LOCUS_27540 2712 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2887 3891 gene locus_tag LOCUS_27550 gene cobT 2887 3891 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067582.1 protein_id gnl|my_center|LOCUS_27550 3894 4649 gene locus_tag LOCUS_27560 3894 4649 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence325 1216 248 gene locus_tag LOCUS_27570 1216 248 CDS product DUF4340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404000.1 protein_id gnl|my_center|LOCUS_27570 2708 1209 gene locus_tag LOCUS_27580 2708 1209 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_27580 3557 2832 gene locus_tag LOCUS_27590 3557 2832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_27590 4545 3619 gene locus_tag LOCUS_27600 4545 3619 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence326 386 1246 gene locus_tag LOCUS_27610 gene prfB 386 1246 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27610 1452 3206 gene locus_tag LOCUS_27620 1452 3206 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_27620 3595 3260 gene locus_tag LOCUS_27630 3595 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 <5141 3766 gene locus_tag LOCUS_27640 <5141 3766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783920.1:translation initiation factor IF-2 >Feature sequence327 52 837 gene locus_tag LOCUS_27650 52 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 917 1618 gene locus_tag LOCUS_27660 917 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2046 2504 gene locus_tag LOCUS_27670 2046 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2521 3447 gene locus_tag LOCUS_27680 2521 3447 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_27680 3489 4820 gene locus_tag LOCUS_27690 gene rsxC 3489 4820 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence328 222 950 gene locus_tag LOCUS_27700 222 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2316 997 gene locus_tag LOCUS_27710 2316 997 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_27710 3804 2389 gene locus_tag LOCUS_27720 3804 2389 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_27720 <5128 3830 gene locus_tag LOCUS_27730 <5128 3830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463655.1:esterase-like activity of phytase family protein >Feature sequence329 1331 378 gene locus_tag LOCUS_27740 1331 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2340 1414 gene locus_tag LOCUS_27750 2340 1414 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_27750 2549 3538 gene locus_tag LOCUS_27760 gene fni 2549 3538 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_27760 3563 4009 gene locus_tag LOCUS_27770 3563 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27770 4013 4891 gene locus_tag LOCUS_27780 4013 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27780 >Feature sequence330 1942 167 gene locus_tag LOCUS_27790 1942 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2855 1935 gene locus_tag LOCUS_27800 2855 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3170 2874 gene locus_tag LOCUS_27810 3170 2874 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939100.1 protein_id gnl|my_center|LOCUS_27810 3793 3176 gene locus_tag LOCUS_27820 3793 3176 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_27820 <5085 3836 gene locus_tag LOCUS_27830 <5085 3836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939102.1:cytochrome c oxidase subunit I >Feature sequence331 764 9 gene locus_tag LOCUS_27840 764 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1655 1215 gene locus_tag LOCUS_27850 1655 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3974 1740 gene locus_tag LOCUS_27860 3974 1740 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_27860 4316 4026 gene locus_tag LOCUS_27870 4316 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27870 >Feature sequence332 2558 2632 gene locus_tag LOCUS_t00300 2558 2632 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3968 3090 gene locus_tag LOCUS_27880 3968 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 4391 4038 gene locus_tag LOCUS_27890 4391 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence333 1423 164 gene locus_tag LOCUS_27900 1423 164 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_27900 2701 1595 gene locus_tag LOCUS_27910 2701 1595 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_27910 3389 2817 gene locus_tag LOCUS_27920 3389 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 4438 3581 gene locus_tag LOCUS_27930 4438 3581 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_27930 <5047 4451 gene locus_tag LOCUS_27940 <5047 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769932.1:(d)CMP kinase >Feature sequence334 1523 435 gene locus_tag LOCUS_27950 gene megL 1523 435 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_27950 2080 1598 gene locus_tag LOCUS_27960 2080 1598 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_27960 2315 3130 gene locus_tag LOCUS_27970 2315 3130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_27970 3205 3408 gene locus_tag LOCUS_27980 3205 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 3794 4678 gene locus_tag LOCUS_27990 3794 4678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence335 348 4 gene locus_tag LOCUS_28000 348 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1752 355 gene locus_tag LOCUS_28010 1752 355 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_28010 2004 3797 gene locus_tag LOCUS_28020 2004 3797 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence336 286 1164 gene locus_tag LOCUS_28030 286 1164 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_28030 2242 1175 gene locus_tag LOCUS_28040 gene hemH 2242 1175 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444837.1 protein_id gnl|my_center|LOCUS_28040 2828 2388 gene locus_tag LOCUS_28050 2828 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4333 2975 gene locus_tag LOCUS_28060 gene hemG 4333 2975 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202640.1 protein_id gnl|my_center|LOCUS_28060 <5022 4461 gene locus_tag LOCUS_28070 <5022 4461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202641.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence337 636 316 gene locus_tag LOCUS_28080 gene yajC 636 316 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_28080 1098 679 gene locus_tag LOCUS_28090 1098 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2076 1138 gene locus_tag LOCUS_28100 gene nusB 2076 1138 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_28100 4021 2462 gene locus_tag LOCUS_28110 4021 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 4280 4855 gene locus_tag LOCUS_28120 4280 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence338 1135 137 gene locus_tag LOCUS_28130 1135 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2210 1173 gene locus_tag LOCUS_28140 gene arsB 2210 1173 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498585.1 protein_id gnl|my_center|LOCUS_28140 3128 2217 gene locus_tag LOCUS_28150 3128 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 3851 3249 gene locus_tag LOCUS_28160 3851 3249 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927076.1 protein_id gnl|my_center|LOCUS_28160 4870 3869 gene locus_tag LOCUS_28170 4870 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence339 911 6 gene locus_tag LOCUS_28180 911 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1058 1684 gene locus_tag LOCUS_28190 1058 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1857 2309 gene locus_tag LOCUS_28200 1857 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2964 3263 gene locus_tag LOCUS_28210 2964 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3250 3459 gene locus_tag LOCUS_28220 3250 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3687 4451 gene locus_tag LOCUS_28230 3687 4451 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_28230 4448 4675 gene locus_tag LOCUS_28240 4448 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence340 2409 1543 gene locus_tag LOCUS_28250 2409 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2493 2987 gene locus_tag LOCUS_28260 gene folK 2493 2987 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_28260 3077 4495 gene locus_tag LOCUS_28270 gene ahcY 3077 4495 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_28270 4669 4594 gene locus_tag LOCUS_t00310 4669 4594 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence341 604 807 gene locus_tag LOCUS_28280 604 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 875 1204 gene locus_tag LOCUS_28290 875 1204 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582838.1 protein_id gnl|my_center|LOCUS_28290 2849 1389 gene locus_tag LOCUS_28300 2849 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3899 2862 gene locus_tag LOCUS_28310 3899 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence342 890 111 gene locus_tag LOCUS_28320 890 111 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_28320 1055 2326 gene locus_tag LOCUS_28330 1055 2326 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_28330 2384 3514 gene locus_tag LOCUS_28340 2384 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 4791 3517 gene locus_tag LOCUS_28350 4791 3517 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence343 606 3506 gene locus_tag LOCUS_28360 606 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence344 2287 62 gene locus_tag LOCUS_28370 2287 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3786 2443 gene locus_tag LOCUS_28380 3786 2443 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_28380 4599 3787 gene locus_tag LOCUS_28390 4599 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence345 349 1104 gene locus_tag LOCUS_28400 349 1104 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_28400 1336 1680 gene locus_tag LOCUS_28410 1336 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1928 3049 gene locus_tag LOCUS_28420 1928 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_28420 3688 3122 gene locus_tag LOCUS_28430 3688 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3823 4764 gene locus_tag LOCUS_28440 3823 4764 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence346 <1 2123 gene locus_tag LOCUS_28450 <1 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039300.1:tetratricopeptide repeat protein 2252 2599 gene locus_tag LOCUS_28460 gene rpsF 2252 2599 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_28460 2601 2870 gene locus_tag LOCUS_28470 gene rpsR 2601 2870 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_28470 2920 3363 gene locus_tag LOCUS_28480 gene rplI 2920 3363 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_28480 4540 3647 gene locus_tag LOCUS_28490 4540 3647 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence347 <1 1331 gene locus_tag LOCUS_28500 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:insulinase family protein 2498 1509 gene locus_tag LOCUS_28510 2498 1509 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083050.1 protein_id gnl|my_center|LOCUS_28510 2860 2525 gene locus_tag LOCUS_28520 2860 2525 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_28520 4044 2980 gene locus_tag LOCUS_28530 4044 2980 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_28530 4516 4064 gene locus_tag LOCUS_28540 gene dtd 4516 4064 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence348 1133 300 gene locus_tag LOCUS_28550 1133 300 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_28550 2008 1556 gene locus_tag LOCUS_28560 2008 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2185 2997 gene locus_tag LOCUS_28570 2185 2997 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_28570 3722 2994 gene locus_tag LOCUS_28580 3722 2994 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_28580 4367 3723 gene locus_tag LOCUS_28590 gene udk 4367 3723 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence349 142 2268 gene locus_tag LOCUS_28600 142 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3014 2358 gene locus_tag LOCUS_28610 3014 2358 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_28610 4577 3345 gene locus_tag LOCUS_28620 gene clpX 4577 3345 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_28620 4779 4639 gene locus_tag LOCUS_28630 4779 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence350 <1 1491 gene locus_tag LOCUS_28640 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001044441.1:M23 family metallopeptidase 1502 2809 gene locus_tag LOCUS_28650 1502 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2797 3423 gene locus_tag LOCUS_28660 2797 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3688 4752 gene locus_tag LOCUS_28670 3688 4752 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence351 1126 656 gene locus_tag LOCUS_28680 1126 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1130 1939 gene locus_tag LOCUS_28690 1130 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 4767 2209 gene locus_tag LOCUS_28700 4767 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence352 1238 369 gene locus_tag LOCUS_28710 1238 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28710 2266 1562 gene locus_tag LOCUS_28720 2266 1562 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054418.1 protein_id gnl|my_center|LOCUS_28720 2719 3444 gene locus_tag LOCUS_28730 2719 3444 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_28730 3441 4415 gene locus_tag LOCUS_28740 3441 4415 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence353 615 25 gene locus_tag LOCUS_28750 615 25 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_28750 1166 663 gene locus_tag LOCUS_28760 1166 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2823 1609 gene locus_tag LOCUS_28770 gene rocD 2823 1609 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_28770 3066 3470 gene locus_tag LOCUS_28780 3066 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3514 4443 gene locus_tag LOCUS_28790 3514 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence354 720 1391 gene locus_tag LOCUS_28800 720 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1420 2202 gene locus_tag LOCUS_28810 gene proB 1420 2202 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_28810 2214 3461 gene locus_tag LOCUS_28820 2214 3461 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence355 2346 2176 gene locus_tag LOCUS_28830 2346 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28830 2722 2531 gene locus_tag LOCUS_28840 2722 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 2865 2671 gene locus_tag LOCUS_28850 2865 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2988 3836 gene locus_tag LOCUS_28860 2988 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 3933 4286 gene locus_tag LOCUS_28870 3933 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence356 1546 530 gene locus_tag LOCUS_28880 gene recA 1546 530 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_28880 2023 1565 gene locus_tag LOCUS_28890 gene bcp 2023 1565 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence357 3075 727 gene locus_tag LOCUS_28900 3075 727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_28900 4128 3208 gene locus_tag LOCUS_28910 4128 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence358 <1 1093 gene locus_tag LOCUS_28920 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942111.1:NADP-dependent isocitrate dehydrogenase 1169 1687 gene locus_tag LOCUS_28930 gene ftnA 1169 1687 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070543.1 protein_id gnl|my_center|LOCUS_28930 2084 3208 gene locus_tag LOCUS_28940 2084 3208 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_28940 3262 3834 gene locus_tag LOCUS_28950 3262 3834 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence359 1590 664 gene locus_tag LOCUS_28960 1590 664 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_28960 2380 1583 gene locus_tag LOCUS_28970 2380 1583 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_28970 3652 2459 gene locus_tag LOCUS_28980 3652 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 4431 3769 gene locus_tag LOCUS_28990 4431 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence360 <1 510 gene locus_tag LOCUS_29000 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205009343.1:restriction endonuclease subunit S <4606 627 gene locus_tag LOCUS_29010 <4606 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:MG2 domain-containing protein >Feature sequence361 436 131 gene locus_tag LOCUS_29020 436 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 946 437 gene locus_tag LOCUS_29030 gene cobU 946 437 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_29030 2268 958 gene locus_tag LOCUS_29040 2268 958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_29040 3223 2300 gene locus_tag LOCUS_29050 3223 2300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_29050 4059 3526 gene locus_tag LOCUS_29060 4059 3526 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545311.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence362 35 4309 gene locus_tag LOCUS_29070 gene rpoC 35 4309 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_29070 >Feature sequence363 2095 785 gene locus_tag LOCUS_29080 2095 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 4423 2624 gene locus_tag LOCUS_29090 4423 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence364 2077 1793 gene locus_tag LOCUS_29100 2077 1793 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_29100 2370 3452 gene locus_tag LOCUS_29110 gene mutY 2370 3452 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_29110 <4579 3425 gene locus_tag LOCUS_29120 <4579 3425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062542257.1:HAMP domain-containing sensor histidine kinase >Feature sequence365 1593 1102 gene locus_tag LOCUS_29130 1593 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2074 1721 gene locus_tag LOCUS_29140 2074 1721 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_29140 3118 2267 gene locus_tag LOCUS_29150 gene panC 3118 2267 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_29150 3288 4094 gene locus_tag LOCUS_29160 3288 4094 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence366 1028 561 gene locus_tag LOCUS_29170 1028 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2280 1156 gene locus_tag LOCUS_29180 2280 1156 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262578.1 protein_id gnl|my_center|LOCUS_29180 2534 2839 gene locus_tag LOCUS_29190 2534 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence367 2897 1587 gene locus_tag LOCUS_29200 2897 1587 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_29200 4470 3001 gene locus_tag LOCUS_29210 4470 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence368 <1 2311 gene locus_tag LOCUS_29220 <1 2311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:carboxypeptidase-like regulatory domain-containing protein 3339 2566 gene locus_tag LOCUS_29230 3339 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence369 147 575 gene locus_tag LOCUS_29240 147 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 <4445 956 gene locus_tag LOCUS_29250 <4445 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262678.1:long-chain fatty acid--CoA ligase >Feature sequence370 <1 909 gene locus_tag LOCUS_29260 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028721.1:phosphomannomutase/phosphoglucomutase 911 2260 gene locus_tag LOCUS_29270 gene trkA 911 2260 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_29270 2280 3728 gene locus_tag LOCUS_29280 2280 3728 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_29280 4367 3783 gene locus_tag LOCUS_29290 4367 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence371 166 1383 gene locus_tag LOCUS_29300 gene serB 166 1383 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010528670.1 protein_id gnl|my_center|LOCUS_29300 3667 1484 gene locus_tag LOCUS_29310 3667 1484 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_29310 3765 4250 gene locus_tag LOCUS_29320 3765 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence372 1859 585 gene locus_tag LOCUS_29330 1859 585 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456088.1 protein_id gnl|my_center|LOCUS_29330 2508 1921 gene locus_tag LOCUS_29340 2508 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965296.1 protein_id gnl|my_center|LOCUS_29340 3564 2509 gene locus_tag LOCUS_29350 3564 2509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_29350 <4381 3615 gene locus_tag LOCUS_29360 <4381 3615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877607.1:tungstate ABC transporter permease WtpB >Feature sequence373 <1 730 gene locus_tag LOCUS_29370 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922781.1:menaquinone biosynthesis protein 1823 720 gene locus_tag LOCUS_29380 1823 720 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_29380 2561 1824 gene locus_tag LOCUS_29390 2561 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2688 3902 gene locus_tag LOCUS_29400 2688 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence374 689 102 gene locus_tag LOCUS_29410 689 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1976 963 gene locus_tag LOCUS_29420 1976 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2504 2358 gene locus_tag LOCUS_29430 2504 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 <4303 2703 gene locus_tag LOCUS_29440 <4303 2703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048172.1:glycyl radical protein >Feature sequence375 918 181 gene locus_tag LOCUS_29450 918 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1825 1151 gene locus_tag LOCUS_29460 1825 1151 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 protein_id gnl|my_center|LOCUS_29460 2949 1864 gene locus_tag LOCUS_29470 2949 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4267 2942 gene locus_tag LOCUS_29480 gene glmM 4267 2942 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence376 896 2032 gene locus_tag LOCUS_29490 896 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2035 2847 gene locus_tag LOCUS_29500 2035 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2998 3630 gene locus_tag LOCUS_29510 2998 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 <4289 3645 gene locus_tag LOCUS_29520 <4289 3645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263383.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence377 252 1517 gene locus_tag LOCUS_29530 252 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3515 1590 gene locus_tag LOCUS_29540 gene yidC 3515 1590 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_29540 <4286 3536 gene locus_tag LOCUS_29550 <4286 3536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947977.1:CTP synthase >Feature sequence378 8 292 gene locus_tag LOCUS_29560 8 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 324 770 gene locus_tag LOCUS_29570 324 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 760 1116 gene locus_tag LOCUS_29580 760 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1179 1940 gene locus_tag LOCUS_29590 1179 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 2984 2505 gene locus_tag LOCUS_29600 2984 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3454 2981 gene locus_tag LOCUS_29610 3454 2981 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_29610 <4280 3576 gene locus_tag LOCUS_29620 <4280 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640504.1:amidase >Feature sequence379 1092 631 gene locus_tag LOCUS_29630 1092 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2239 1097 gene locus_tag LOCUS_29640 2239 1097 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_29640 4024 2369 gene locus_tag LOCUS_29650 4024 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence380 139 414 gene locus_tag LOCUS_29660 139 414 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_29660 496 963 gene locus_tag LOCUS_29670 496 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 968 1951 gene locus_tag LOCUS_29680 gene floA 968 1951 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence381 3030 2557 gene locus_tag LOCUS_29690 gene rlmH 3030 2557 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_29690 3243 3608 gene locus_tag LOCUS_29700 3243 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence382 1810 275 gene locus_tag LOCUS_29710 1810 275 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_29710 2146 2913 gene locus_tag LOCUS_29720 2146 2913 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence383 3472 1832 gene locus_tag LOCUS_29730 3472 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 4229 3453 gene locus_tag LOCUS_29740 4229 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence384 1887 385 gene locus_tag LOCUS_29750 1887 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence385 289 1815 gene locus_tag LOCUS_29760 gene purH 289 1815 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_29760 1837 2859 gene locus_tag LOCUS_29770 1837 2859 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_29770 2873 3703 gene locus_tag LOCUS_29780 gene mreC 2873 3703 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence386 1977 604 gene locus_tag LOCUS_29790 gene tig 1977 604 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_29790 2143 2061 gene locus_tag LOCUS_t00320 2143 2061 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence387 155 538 gene locus_tag LOCUS_29800 155 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 1398 733 gene locus_tag LOCUS_29810 gene mnmD 1398 733 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_29810 2055 1402 gene locus_tag LOCUS_29820 2055 1402 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_29820 3327 2059 gene locus_tag LOCUS_29830 3327 2059 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_29830 4018 3464 gene locus_tag LOCUS_29840 4018 3464 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence388 2430 517 gene locus_tag LOCUS_29850 2430 517 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_29850 3875 2667 gene locus_tag LOCUS_29860 3875 2667 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence389 941 324 gene locus_tag LOCUS_29870 941 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2262 1300 gene locus_tag LOCUS_29880 2262 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3927 2269 gene locus_tag LOCUS_29890 3927 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence390 490 2931 gene locus_tag LOCUS_29900 490 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence391 306 1532 gene locus_tag LOCUS_29910 306 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1549 1920 gene locus_tag LOCUS_29920 1549 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 2042 2548 gene locus_tag LOCUS_29930 2042 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2529 3554 gene locus_tag LOCUS_29940 2529 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3566 3937 gene locus_tag LOCUS_29950 3566 3937 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence392 362 793 gene locus_tag LOCUS_29960 362 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1088 3193 gene locus_tag LOCUS_29970 1088 3193 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence393 1605 340 gene locus_tag LOCUS_29980 1605 340 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_29980 1922 3271 gene locus_tag LOCUS_29990 1922 3271 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_29990 3304 3858 gene locus_tag LOCUS_30000 3304 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30000 >Feature sequence394 1993 2310 gene locus_tag LOCUS_30010 gene trxA 1993 2310 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_30010 2361 2648 gene locus_tag LOCUS_30020 2361 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 2645 3568 gene locus_tag LOCUS_30030 2645 3568 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence395 1546 485 gene locus_tag LOCUS_30040 gene mnmA 1546 485 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_30040 2106 1567 gene locus_tag LOCUS_30050 2106 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 2456 2986 gene locus_tag LOCUS_30060 2456 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3515 3087 gene locus_tag LOCUS_30070 3515 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30070 >Feature sequence396 10 501 gene locus_tag LOCUS_30080 gene msrB 10 501 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_30080 962 654 gene locus_tag LOCUS_30090 962 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1805 963 gene locus_tag LOCUS_30100 1805 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30100 2509 1883 gene locus_tag LOCUS_30110 2509 1883 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_30110 2744 3865 gene locus_tag LOCUS_30120 gene recF 2744 3865 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence397 <1 1846 gene locus_tag LOCUS_30130 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:MMPL family transporter 1860 2915 gene locus_tag LOCUS_30140 1860 2915 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence398 <1 622 gene locus_tag LOCUS_30150 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202860.1:ATP-dependent Clp protease ATP-binding subunit 1303 1112 gene locus_tag LOCUS_30160 1303 1112 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_30160 2136 1522 gene locus_tag LOCUS_30170 2136 1522 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_30170 2651 2133 gene locus_tag LOCUS_30180 2651 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence399 406 1053 gene locus_tag LOCUS_30190 406 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1677 1015 gene locus_tag LOCUS_30200 1677 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 1830 2099 gene locus_tag LOCUS_30210 gene rpsO 1830 2099 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence400 603 160 gene locus_tag LOCUS_30220 603 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 2179 809 gene locus_tag LOCUS_30230 gene fslC 2179 809 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_30230 3285 2194 gene locus_tag LOCUS_30240 3285 2194 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_30240 3508 3251 gene locus_tag LOCUS_30250 3508 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence401 2 1483 gene locus_tag LOCUS_30260 2 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2750 2388 gene locus_tag LOCUS_30270 2750 2388 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_30270 2918 3463 gene locus_tag LOCUS_30280 2918 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence402 569 1531 gene locus_tag LOCUS_30290 569 1531 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_30290 2735 1563 gene locus_tag LOCUS_30300 2735 1563 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 protein_id gnl|my_center|LOCUS_30300 3189 2737 gene locus_tag LOCUS_30310 3189 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence403 94 987 gene locus_tag LOCUS_30320 94 987 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_30320 966 1496 gene locus_tag LOCUS_30330 966 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1545 2141 gene locus_tag LOCUS_30340 1545 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30340 2200 2502 gene locus_tag LOCUS_30350 2200 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2444 2962 gene locus_tag LOCUS_30360 2444 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 2968 3333 gene locus_tag LOCUS_30370 2968 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3362 3703 gene locus_tag LOCUS_30380 3362 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence404 768 235 gene locus_tag LOCUS_30390 768 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30390 1121 891 gene locus_tag LOCUS_30400 1121 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 2494 1199 gene locus_tag LOCUS_30410 2494 1199 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_30410 2726 3523 gene locus_tag LOCUS_30420 2726 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence405 730 3678 gene locus_tag LOCUS_30430 730 3678 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence406 1249 539 gene locus_tag LOCUS_30440 1249 539 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_30440 2589 1228 gene locus_tag LOCUS_30450 2589 1228 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_30450 <3814 2579 gene locus_tag LOCUS_30460 <3814 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202702.1:sigma-54 dependent transcriptional regulator >Feature sequence407 866 357 gene locus_tag LOCUS_30470 866 357 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_30470 1830 1267 gene locus_tag LOCUS_30480 1830 1267 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_30480 2169 2810 gene locus_tag LOCUS_30490 2169 2810 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_30490 2879 3607 gene locus_tag LOCUS_30500 2879 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence408 <3729 1023 gene locus_tag LOCUS_30510 <3729 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:efflux RND transporter permease subunit >Feature sequence409 <1 834 gene locus_tag LOCUS_30520 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539284.1:pyridoxal-dependent decarboxylase 2458 1202 gene locus_tag LOCUS_30530 2458 1202 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_30530 2839 3414 gene locus_tag LOCUS_30540 2839 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence410 <1 1292 gene locus_tag LOCUS_30550 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173387048.1:asparagine--tRNA ligase 2495 1845 gene locus_tag LOCUS_30560 gene upp 2495 1845 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_30560 3406 2492 gene locus_tag LOCUS_30570 3406 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence411 1227 2009 gene locus_tag LOCUS_30580 1227 2009 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_30580 2071 2850 gene locus_tag LOCUS_30590 2071 2850 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_30590 <3657 2858 gene locus_tag LOCUS_30600 <3657 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203607.1:primosomal protein N' >Feature sequence412 1118 102 gene locus_tag LOCUS_30610 gene amrS 1118 102 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_30610 1666 1136 gene locus_tag LOCUS_30620 gene amrA 1666 1136 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081947.1 protein_id gnl|my_center|LOCUS_30620 2594 1671 gene locus_tag LOCUS_30630 2594 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence413 1028 639 gene locus_tag LOCUS_30640 1028 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1072 2118 gene locus_tag LOCUS_30650 gene ribD 1072 2118 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_30650 2121 2783 gene locus_tag LOCUS_30660 2121 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence414 66 1283 gene locus_tag LOCUS_30670 66 1283 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_30670 2235 1357 gene locus_tag LOCUS_30680 gene fabD 2235 1357 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_30680 2336 2995 gene locus_tag LOCUS_30690 2336 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 <3607 3062 gene locus_tag LOCUS_30700 <3607 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943268.1:metallophosphoesterase family protein >Feature sequence415 1174 95 gene locus_tag LOCUS_30710 gene dinB 1174 95 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_30710 2366 1266 gene locus_tag LOCUS_30720 2366 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_30720 <3572 2534 gene locus_tag LOCUS_30730 <3572 2534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337358.1:SPFH domain-containing protein >Feature sequence416 1 453 gene locus_tag LOCUS_30740 1 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1829 450 gene locus_tag LOCUS_30750 1829 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 >Feature sequence417 345 1649 gene locus_tag LOCUS_30760 345 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 1807 2544 gene locus_tag LOCUS_30770 1807 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 <3546 2893 gene locus_tag LOCUS_30780 <3546 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258670.1:ATP-binding protein >Feature sequence418 85 654 gene locus_tag LOCUS_30790 gene lpcA 85 654 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 protein_id gnl|my_center|LOCUS_30790 674 2212 gene locus_tag LOCUS_30800 674 2212 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_30800 2317 3297 gene locus_tag LOCUS_30810 2317 3297 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence419 1008 2291 gene locus_tag LOCUS_30820 1008 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3161 2799 gene locus_tag LOCUS_30830 3161 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence420 <1 674 gene locus_tag LOCUS_30840 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463527.1:OmpA family protein 806 1264 gene locus_tag LOCUS_30850 806 1264 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_30850 2592 1267 gene locus_tag LOCUS_30860 2592 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence421 44 448 gene locus_tag LOCUS_30870 44 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 638 471 gene locus_tag LOCUS_30880 638 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1180 761 gene locus_tag LOCUS_30890 1180 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2029 1187 gene locus_tag LOCUS_30900 2029 1187 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_30900 2956 2114 gene locus_tag LOCUS_30910 2956 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 <3517 2960 gene locus_tag LOCUS_30920 <3517 2960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor >Feature sequence422 1130 2113 gene locus_tag LOCUS_30930 1130 2113 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence423 1518 409 gene locus_tag LOCUS_30940 1518 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2206 1559 gene locus_tag LOCUS_30950 2206 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2878 2228 gene locus_tag LOCUS_30960 2878 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 <3498 2894 gene locus_tag LOCUS_30970 <3498 2894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942948.1:YeeE/YedE thiosulfate transporter family protein >Feature sequence424 1099 419 gene locus_tag LOCUS_30980 1099 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 <3468 1642 gene locus_tag LOCUS_30990 <3468 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785809.1:molecular chaperone DnaK >Feature sequence425 649 2097 gene locus_tag LOCUS_31000 649 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence426 549 1541 gene locus_tag LOCUS_31010 549 1541 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_31010 1688 2755 gene locus_tag LOCUS_31020 1688 2755 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence427 <1 1025 gene locus_tag LOCUS_31030 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766212.1:S46 family peptidase 1524 2198 gene locus_tag LOCUS_31040 1524 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence428 562 14 gene locus_tag LOCUS_31050 562 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 875 1246 gene locus_tag LOCUS_31060 875 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1323 1748 gene locus_tag LOCUS_31070 gene trxA 1323 1748 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_31070 2002 2265 gene locus_tag LOCUS_31080 2002 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2228 3196 gene locus_tag LOCUS_31090 2228 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence429 2946 1663 gene locus_tag LOCUS_31100 gene hisD 2946 1663 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence430 218 1036 gene locus_tag LOCUS_31110 218 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1296 2549 gene locus_tag LOCUS_31120 1296 2549 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_31120 2739 3380 gene locus_tag LOCUS_31130 2739 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence431 2094 1525 gene locus_tag LOCUS_31140 2094 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31140 3274 2120 gene locus_tag LOCUS_31150 3274 2120 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702141.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence432 141 3332 gene locus_tag LOCUS_31160 141 3332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence433 2377 1409 gene locus_tag LOCUS_31170 2377 1409 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_31170 3025 2510 gene locus_tag LOCUS_31180 3025 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence434 <1 504 gene locus_tag LOCUS_31190 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203449.1:methylmalonyl-CoA mutase small subunit 516 2651 gene locus_tag LOCUS_31200 gene scpA 516 2651 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence435 412 14 gene locus_tag LOCUS_31210 412 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 451 1032 gene locus_tag LOCUS_31220 gene hisH 451 1032 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_31220 1116 1826 gene locus_tag LOCUS_31230 gene hisA 1116 1826 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_31230 1842 2633 gene locus_tag LOCUS_31240 gene hisF 1842 2633 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_31240 2655 3323 gene locus_tag LOCUS_31250 gene hisIE 2655 3323 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence436 359 1393 gene locus_tag LOCUS_31260 359 1393 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_31260 <3341 1755 gene locus_tag LOCUS_31270 <3341 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964422.1:carboxy terminal-processing peptidase >Feature sequence437 1507 1881 gene locus_tag LOCUS_31280 gene rpsL 1507 1881 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_31280 1905 2381 gene locus_tag LOCUS_31290 gene rpsG 1905 2381 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence438 590 222 gene locus_tag LOCUS_31300 590 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 1567 914 gene locus_tag LOCUS_31310 1567 914 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_31310 3243 1834 gene locus_tag LOCUS_31320 3243 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence439 678 1877 gene locus_tag LOCUS_31330 678 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence440 <1 1349 gene locus_tag LOCUS_31340 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_098075356.1:RagB/SusD family nutrient uptake outer membrane protein 1393 1950 gene locus_tag LOCUS_31350 1393 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence441 1602 2609 gene locus_tag LOCUS_31360 gene xylF 1602 2609 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693436.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence442 763 122 gene locus_tag LOCUS_31370 gene nth 763 122 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_31370 2846 876 gene locus_tag LOCUS_31380 2846 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence443 1369 569 gene locus_tag LOCUS_31390 1369 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1533 1862 gene locus_tag LOCUS_31400 1533 1862 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921943.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence444 489 1217 gene locus_tag LOCUS_31410 489 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 2836 1295 gene locus_tag LOCUS_31420 2836 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence445 459 989 gene locus_tag LOCUS_31430 459 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1026 1502 gene locus_tag LOCUS_31440 gene smpB 1026 1502 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_31440 1474 1965 gene locus_tag LOCUS_31450 1474 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2247 1978 gene locus_tag LOCUS_31460 2247 1978 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_31460 3020 2253 gene locus_tag LOCUS_31470 3020 2253 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879799.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence446 2785 2 gene locus_tag LOCUS_31480 2785 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence447 <1 521 gene locus_tag LOCUS_31490 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403880.1:ADP-forming succinate--CoA ligase subunit beta 697 1536 gene locus_tag LOCUS_31500 697 1536 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_31500 1539 2801 gene locus_tag LOCUS_31510 1539 2801 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence448 <1 1098 gene locus_tag LOCUS_31520 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905558.1:cystathionine gamma-synthase 2366 1095 gene locus_tag LOCUS_31530 2366 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence449 1652 753 gene locus_tag LOCUS_31540 1652 753 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_31540 2353 1685 gene locus_tag LOCUS_31550 2353 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2835 2356 gene locus_tag LOCUS_31560 2835 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence450 623 1057 gene locus_tag LOCUS_31570 623 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1240 1722 gene locus_tag LOCUS_31580 gene greA 1240 1722 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_31580 <3159 1780 gene locus_tag LOCUS_31590 <3159 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase >Feature sequence451 1423 2352 gene locus_tag LOCUS_31600 1423 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2689 2510 gene locus_tag LOCUS_31610 2689 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence452 1315 137 gene locus_tag LOCUS_31620 1315 137 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_31620 2659 1925 gene locus_tag LOCUS_31630 2659 1925 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence453 1614 280 gene locus_tag LOCUS_31640 1614 280 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_31640 2340 1645 gene locus_tag LOCUS_31650 2340 1645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_31650 2620 2345 gene locus_tag LOCUS_31660 2620 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence454 1233 469 gene locus_tag LOCUS_31670 gene hemD 1233 469 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992353.1 protein_id gnl|my_center|LOCUS_31670 2211 1282 gene locus_tag LOCUS_31680 gene hemC 2211 1282 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_31680 <3079 2343 gene locus_tag LOCUS_31690 <3079 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546522.1:glutamyl-tRNA reductase >Feature sequence455 <1 1834 gene locus_tag LOCUS_31700 <1 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000767848.1:TonB-dependent receptor 2062 1883 gene locus_tag LOCUS_31710 2062 1883 CDS product FaeA/PapI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813931.1 protein_id gnl|my_center|LOCUS_31710 2382 2726 gene locus_tag LOCUS_31720 2382 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31720 2742 3038 gene locus_tag LOCUS_31730 2742 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31730 >Feature sequence456 <1 1282 gene locus_tag LOCUS_31740 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107425.1:transglycosylase domain-containing protein 1384 2076 gene locus_tag LOCUS_31750 1384 2076 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_31750 2156 2812 gene locus_tag LOCUS_31760 2156 2812 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence457 20 93 gene locus_tag LOCUS_t00330 20 93 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1550 162 gene locus_tag LOCUS_31770 1550 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1713 2798 gene locus_tag LOCUS_31780 1713 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence458 1160 597 gene locus_tag LOCUS_31790 1160 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 2127 1336 gene locus_tag LOCUS_31800 2127 1336 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31800 2931 2131 gene locus_tag LOCUS_31810 2931 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence459 220 1170 gene locus_tag LOCUS_31820 220 1170 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence460 226 468 gene locus_tag LOCUS_31830 226 468 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_31830 692 1381 gene locus_tag LOCUS_31840 gene fadR 692 1381 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 protein_id gnl|my_center|LOCUS_31840 1396 3036 gene locus_tag LOCUS_31850 1396 3036 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence461 1085 663 gene locus_tag LOCUS_31860 1085 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_31860 1523 1164 gene locus_tag LOCUS_31870 1523 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2918 1650 gene locus_tag LOCUS_31880 2918 1650 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence462 3 995 gene locus_tag LOCUS_31890 3 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 1065 1796 gene locus_tag LOCUS_31900 1065 1796 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_31900 <3009 1827 gene locus_tag LOCUS_31910 <3009 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942560.1:methyl-accepting chemotaxis protein >Feature sequence463 1035 622 gene locus_tag LOCUS_31920 1035 622 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 protein_id gnl|my_center|LOCUS_31920 <3004 1448 gene locus_tag LOCUS_31930 <3004 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764749.1:ATP-dependent chaperone ClpB >Feature sequence464 2368 386 gene locus_tag LOCUS_31940 2368 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence465 2588 2001 gene locus_tag LOCUS_31950 2588 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence466 <1 2417 gene locus_tag LOCUS_31960 <1 2417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I >Feature sequence467 1669 407 gene locus_tag LOCUS_31970 1669 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1912 2748 gene locus_tag LOCUS_31980 gene yidA 1912 2748 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence468 899 2143 gene locus_tag LOCUS_31990 899 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_31990 2263 2691 gene locus_tag LOCUS_32000 2263 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence469 <1 1324 gene locus_tag LOCUS_32010 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861455.1:MATE family efflux transporter 1343 2470 gene locus_tag LOCUS_32020 1343 2470 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence470 648 79 gene locus_tag LOCUS_32030 648 79 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_32030 1732 656 gene locus_tag LOCUS_32040 gene carA 1732 656 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_32040 2257 1781 gene locus_tag LOCUS_32050 gene argR 2257 1781 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence471 2611 1676 gene locus_tag LOCUS_32060 2611 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence472 1505 561 gene locus_tag LOCUS_32070 1505 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1551 2669 gene locus_tag LOCUS_32080 gene gmd 1551 2669 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence473 2591 699 gene locus_tag LOCUS_32090 2591 699 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence474 <2810 526 gene locus_tag LOCUS_32100 <2810 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000454344.1:penicillin acylase family protein >Feature sequence475 88 2733 gene locus_tag LOCUS_32110 88 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence476 <1 774 gene locus_tag LOCUS_32120 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392758.1:glutamate-1-semialdehyde 2,1-aminomutase 878 1891 gene locus_tag LOCUS_32130 gene hemE 878 1891 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence477 151 2106 gene locus_tag LOCUS_32140 151 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 2396 2124 gene locus_tag LOCUS_32150 2396 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence478 <1 819 gene locus_tag LOCUS_32160 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784370.1:POTRA domain-containing protein 999 1505 gene locus_tag LOCUS_32170 999 1505 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_32170 1710 2240 gene locus_tag LOCUS_32180 1710 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence479 985 1434 gene locus_tag LOCUS_32190 985 1434 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_32190 1588 1884 gene locus_tag LOCUS_32200 1588 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence480 <1 1452 gene locus_tag LOCUS_32210 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012896469.1:glycerol kinase GlpK 2501 1731 gene locus_tag LOCUS_32220 2501 1731 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963370.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence481 1016 537 gene locus_tag LOCUS_32230 1016 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2174 1023 gene locus_tag LOCUS_32240 2174 1023 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence482 1271 936 gene locus_tag LOCUS_32250 1271 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 2151 1261 gene locus_tag LOCUS_32260 gene era 2151 1261 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence483 2329 725 gene locus_tag LOCUS_32270 2329 725 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_32270 2524 2405 gene locus_tag LOCUS_32280 2524 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence484 256 1998 gene locus_tag LOCUS_32290 256 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence485 3 566 gene locus_tag LOCUS_32300 3 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 541 1206 gene locus_tag LOCUS_32310 541 1206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_32310 1311 2339 gene locus_tag LOCUS_32320 1311 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence486 3 395 gene locus_tag LOCUS_32330 3 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 419 970 gene locus_tag LOCUS_32340 419 970 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_32340 2023 1016 gene locus_tag LOCUS_32350 2023 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence487 335 535 gene locus_tag LOCUS_32360 335 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 607 1641 gene locus_tag LOCUS_32370 607 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1643 2176 gene locus_tag LOCUS_32380 1643 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence488 1307 48 gene locus_tag LOCUS_32390 1307 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2515 1304 gene locus_tag LOCUS_32400 2515 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence489 154 588 gene locus_tag LOCUS_32410 154 588 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_32410 591 956 gene locus_tag LOCUS_32420 591 956 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_32420 1436 1035 gene locus_tag LOCUS_32430 1436 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 2107 1517 gene locus_tag LOCUS_32440 2107 1517 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence490 988 665 gene locus_tag LOCUS_32450 988 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1820 1278 gene locus_tag LOCUS_32460 1820 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2140 1991 gene locus_tag LOCUS_32470 2140 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32470 >Feature sequence491 1997 87 gene locus_tag LOCUS_32480 1997 87 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence492 >Feature sequence493 1686 355 gene locus_tag LOCUS_32490 1686 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 >Feature sequence494 1583 1218 gene locus_tag LOCUS_32500 1583 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 <2489 1580 gene locus_tag LOCUS_32510 <2489 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763720.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence495 54 1250 gene locus_tag LOCUS_32520 54 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 1301 1921 gene locus_tag LOCUS_32530 1301 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence496 1484 633 gene locus_tag LOCUS_32540 1484 633 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_32540 1674 1495 gene locus_tag LOCUS_32550 1674 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32550 2306 1704 gene locus_tag LOCUS_32560 2306 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32560 >Feature sequence497 559 269 gene locus_tag LOCUS_32570 559 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence498 537 160 gene locus_tag LOCUS_32580 537 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 763 1536 gene locus_tag LOCUS_32590 763 1536 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933431.1 protein_id gnl|my_center|LOCUS_32590 1556 2032 gene locus_tag LOCUS_32600 1556 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 >Feature sequence499 2025 691 gene locus_tag LOCUS_32610 gene murD 2025 691 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence500 1195 416 gene locus_tag LOCUS_32620 1195 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32620 1534 1292 gene locus_tag LOCUS_32630 1534 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 <2318 1709 gene locus_tag LOCUS_32640 <2318 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259387.1:glycosyltransferase >Feature sequence501 1975 1577 gene locus_tag LOCUS_32650 1975 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence502 1537 371 gene locus_tag LOCUS_32660 gene pncB 1537 371 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence503 1078 842 gene locus_tag LOCUS_32670 1078 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence504 <1 1250 gene locus_tag LOCUS_32680 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026955981.1:long-chain fatty acid--CoA ligase 1657 1259 gene locus_tag LOCUS_32690 1657 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence505 349 999 gene locus_tag LOCUS_32700 349 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 1828 1247 gene locus_tag LOCUS_32710 gene purN 1828 1247 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence506 1623 817 gene locus_tag LOCUS_32720 1623 817 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_32720 >Feature sequence507 <1 1053 gene locus_tag LOCUS_32730 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791925.1:methionine--tRNA ligase >Feature sequence508 <1 1803 gene locus_tag LOCUS_32740 <1 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thioredoxin family protein >Feature sequence509 577 1467 gene locus_tag LOCUS_32750 577 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_32750 2137 1523 gene locus_tag LOCUS_32760 2137 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence510 763 125 gene locus_tag LOCUS_32770 763 125 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763832.1 protein_id gnl|my_center|LOCUS_32770 1616 828 gene locus_tag LOCUS_32780 1616 828 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_32780 <2146 1642 gene locus_tag LOCUS_32790 <2146 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793740.1:formylglycine-generating enzyme family protein >Feature sequence511 518 318 gene locus_tag LOCUS_32800 518 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 418 1809 gene locus_tag LOCUS_32810 418 1809 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence512 <1 1412 gene locus_tag LOCUS_32820 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113937.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence513 1762 569 gene locus_tag LOCUS_32830 1762 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence514 >Feature sequence515 847 299 gene locus_tag LOCUS_32840 847 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 1431 1051 gene locus_tag LOCUS_32850 1431 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 2013 1447 gene locus_tag LOCUS_32860 2013 1447 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_32860